diff options
Diffstat (limited to 'dependencies/pkg/mod/golang.org/x/exp@v0.0.0-20220613132600-b0d781184e0d/shootout/fasta.go')
-rw-r--r-- | dependencies/pkg/mod/golang.org/x/exp@v0.0.0-20220613132600-b0d781184e0d/shootout/fasta.go | 208 |
1 files changed, 208 insertions, 0 deletions
diff --git a/dependencies/pkg/mod/golang.org/x/exp@v0.0.0-20220613132600-b0d781184e0d/shootout/fasta.go b/dependencies/pkg/mod/golang.org/x/exp@v0.0.0-20220613132600-b0d781184e0d/shootout/fasta.go new file mode 100644 index 0000000..3890113 --- /dev/null +++ b/dependencies/pkg/mod/golang.org/x/exp@v0.0.0-20220613132600-b0d781184e0d/shootout/fasta.go @@ -0,0 +1,208 @@ +//go:build ignore +// +build ignore + +/* +Redistribution and use in source and binary forms, with or without +modification, are permitted provided that the following conditions are met: + + * Redistributions of source code must retain the above copyright + notice, this list of conditions and the following disclaimer. + + * Redistributions in binary form must reproduce the above copyright + notice, this list of conditions and the following disclaimer in the + documentation and/or other materials provided with the distribution. + + * Neither the name of "The Computer Language Benchmarks Game" nor the + name of "The Computer Language Shootout Benchmarks" nor the names of + its contributors may be used to endorse or promote products derived + from this software without specific prior written permission. + +THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS "AS IS" +AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE +IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE +ARE DISCLAIMED. IN NO EVENT SHALL THE COPYRIGHT OWNER OR CONTRIBUTORS BE +LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR +CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF +SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS +INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN +CONTRACT, STRICT LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) +ARISING IN ANY WAY OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE +POSSIBILITY OF SUCH DAMAGE. +*/ + +/* The Computer Language Benchmarks Game + * http://shootout.alioth.debian.org/ + * + * contributed by The Go Authors. + * Based on C program by by Petr Prokhorenkov. + */ + +package main + +import ( + "flag" + "os" +) + +var out = make(buffer, 0, 32768) + +var n = flag.Int("n", 1000, "length of result") + +const Line = 60 + +func Repeat(alu []byte, n int) { + buf := append(alu, alu...) + off := 0 + for n > 0 { + m := n + if m > Line { + m = Line + } + buf1 := out.NextWrite(m + 1) + copy(buf1, buf[off:]) + buf1[m] = '\n' + if off += m; off >= len(alu) { + off -= len(alu) + } + n -= m + } +} + +const ( + IM = 139968 + IA = 3877 + IC = 29573 + + LookupSize = 4096 + LookupScale float64 = LookupSize - 1 +) + +var rand uint32 = 42 + +type Acid struct { + sym byte + prob float64 + cprob float64 + next *Acid +} + +func computeLookup(acid []Acid) *[LookupSize]*Acid { + var lookup [LookupSize]*Acid + var p float64 + for i := range acid { + p += acid[i].prob + acid[i].cprob = p * LookupScale + if i > 0 { + acid[i-1].next = &acid[i] + } + } + acid[len(acid)-1].cprob = 1.0 * LookupScale + + j := 0 + for i := range lookup { + for acid[j].cprob < float64(i) { + j++ + } + lookup[i] = &acid[j] + } + + return &lookup +} + +func Random(acid []Acid, n int) { + lookup := computeLookup(acid) + for n > 0 { + m := n + if m > Line { + m = Line + } + buf := out.NextWrite(m + 1) + f := LookupScale / IM + myrand := rand + for i := 0; i < m; i++ { + myrand = (myrand*IA + IC) % IM + r := float64(int(myrand)) * f + a := lookup[int(r)] + for a.cprob < r { + a = a.next + } + buf[i] = a.sym + } + rand = myrand + buf[m] = '\n' + n -= m + } +} + +func main() { + defer out.Flush() + + flag.Parse() + + iub := []Acid{ + {prob: 0.27, sym: 'a'}, + {prob: 0.12, sym: 'c'}, + {prob: 0.12, sym: 'g'}, + {prob: 0.27, sym: 't'}, + {prob: 0.02, sym: 'B'}, + {prob: 0.02, sym: 'D'}, + {prob: 0.02, sym: 'H'}, + {prob: 0.02, sym: 'K'}, + {prob: 0.02, sym: 'M'}, + {prob: 0.02, sym: 'N'}, + {prob: 0.02, sym: 'R'}, + {prob: 0.02, sym: 'S'}, + {prob: 0.02, sym: 'V'}, + {prob: 0.02, sym: 'W'}, + {prob: 0.02, sym: 'Y'}, + } + + homosapiens := []Acid{ + {prob: 0.3029549426680, sym: 'a'}, + {prob: 0.1979883004921, sym: 'c'}, + {prob: 0.1975473066391, sym: 'g'}, + {prob: 0.3015094502008, sym: 't'}, + } + + alu := []byte( + "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG" + + "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA" + + "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT" + + "ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA" + + "GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG" + + "AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC" + + "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA") + + out.WriteString(">ONE Homo sapiens alu\n") + Repeat(alu, 2**n) + out.WriteString(">TWO IUB ambiguity codes\n") + Random(iub, 3**n) + out.WriteString(">THREE Homo sapiens frequency\n") + Random(homosapiens, 5**n) +} + +type buffer []byte + +func (b *buffer) Flush() { + p := *b + if len(p) > 0 { + os.Stdout.Write(p) + } + *b = p[0:0] +} + +func (b *buffer) WriteString(s string) { + p := b.NextWrite(len(s)) + copy(p, s) +} + +func (b *buffer) NextWrite(n int) []byte { + p := *b + if len(p)+n > cap(p) { + b.Flush() + p = *b + } + out := p[len(p) : len(p)+n] + *b = p[:len(p)+n] + return out +} |