Adding upstream version 20221122+ds.upstream/20221122+dsupstream

Signed-off-by: Daniel Baumann <daniel.baumann@progress-linux.org>

34 files changed, 57205 insertions, 0 deletions

diff --git a/src/Makefile.am b/src/Makefile.am
new file mode 100644
index 0000000..cf7325c
--- /dev/null
+++ b/src/Makefile.am
@@ -0,0 +1,416 @@
+# SPDX-FileCopyrightText: 2002-2022 Ole Tange, http://ole.tange.dk and Free Software and Foundation, Inc.
+#
+# SPDX-License-Identifier: GPL-3.0-or-later
+
+bin_SCRIPTS = parallel sql niceload parcat parset parsort	\
+	env_parallel env_parallel.ash env_parallel.bash		\
+	env_parallel.csh env_parallel.dash env_parallel.fish	\
+	env_parallel.ksh env_parallel.mksh env_parallel.pdksh	\
+	env_parallel.sh env_parallel.tcsh env_parallel.zsh
+
+install-exec-hook:
+	rm "$(DESTDIR)$(bindir)"/sem || true
+	$(LN_S) parallel "$(DESTDIR)$(bindir)"/sem
+
+if DOCUMENTATION
+man_MANS = parallel.1 env_parallel.1 sem.1 sql.1 niceload.1		\
+	parallel_examples.7 parallel_tutorial.7 parallel_book.7		\
+	parallel_design.7 parallel_alternatives.7 parcat.1 parset.1	\
+	parsort.1
+doc_DATA = parallel.html env_parallel.html sem.html sql.html		\
+	niceload.html parallel_examples.html parallel_tutorial.html	\
+	parallel_book.html parallel_design.html				\
+	parallel_alternatives.html parcat.html parset.html		\
+	parsort.html \
+	parallel.texi env_parallel.texi sem.texi sql.texi		\
+	niceload.texi parallel_examples.texi parallel_tutorial.texi	\
+	parallel_book.texi parallel_design.texi				\
+	parallel_alternatives.texi parcat.texi parset.texi		\
+	parsort.texi \
+	parallel.rst env_parallel.rst sem.rst sql.rst niceload.rst	\
+	parallel_examples.rst parallel_tutorial.rst parallel_book.rst	\
+	parallel_design.rst parallel_alternatives.rst parcat.rst	\
+	parset.rst parsort.rst \
+	parallel.pdf env_parallel.pdf sem.pdf sql.pdf niceload.pdf	\
+	parallel_examples.pdf parallel_tutorial.pdf parallel_book.pdf	\
+	parallel_design.pdf parallel_alternatives.pdf parcat.pdf	\
+	parset.pdf parsort.pdf parallel_cheat_bw.pdf			\
+	parallel_options_map.pdf
+endif
+
+web: sphinx
+	true
+
+sphinx: *.rst
+	cd sphinx && make && cd ..
+
+# Build documentation file if the tool to build exists.
+# Otherwise: Use the distributed version
+parallel.1: parallel.pod
+	pod2man --release='$(PACKAGE_VERSION)' --center='$(PACKAGE_NAME)' \
+		--section=1 "$(srcdir)"/parallel.pod > "$(srcdir)"/parallel.1n \
+	&& mv "$(srcdir)"/parallel.1n "$(srcdir)"/parallel.1 \
+	|| echo "Warning: pod2man not found. Using old parallel.1"
+
+env_parallel.1: env_parallel.pod
+	pod2man --release='$(PACKAGE_VERSION)' --center='$(PACKAGE_NAME)' \
+		--section=1 "$(srcdir)"/env_parallel.pod > "$(srcdir)"/env_parallel.1n \
+	&& mv "$(srcdir)"/env_parallel.1n "$(srcdir)"/env_parallel.1 \
+	|| echo "Warning: pod2man not found. Using old env_parallel.1"
+
+parallel_examples.7: parallel_examples.pod
+	pod2man --release='$(PACKAGE_VERSION)' --center='$(PACKAGE_NAME)' \
+		--section=7 "$(srcdir)"/parallel_examples.pod > "$(srcdir)"/parallel_examples.7n \
+	&& mv "$(srcdir)"/parallel_examples.7n "$(srcdir)"/parallel_examples.7 \
+	|| echo "Warning: pod2man not found. Using old parallel_examples.7"
+
+parallel_tutorial.7: parallel_tutorial.pod
+	pod2man --release='$(PACKAGE_VERSION)' --center='$(PACKAGE_NAME)' \
+		--section=7 "$(srcdir)"/parallel_tutorial.pod > "$(srcdir)"/parallel_tutorial.7n \
+	&& mv "$(srcdir)"/parallel_tutorial.7n "$(srcdir)"/parallel_tutorial.7 \
+	|| echo "Warning: pod2man not found. Using old parallel_tutorial.7"
+
+parallel_book.7: parallel_book.pod
+	pod2man --release='$(PACKAGE_VERSION)' --center='$(PACKAGE_NAME)' \
+		--section=7 "$(srcdir)"/parallel_book.pod > "$(srcdir)"/parallel_book.7n \
+	&& mv "$(srcdir)"/parallel_book.7n "$(srcdir)"/parallel_book.7 \
+	|| echo "Warning: pod2man not found. Using old parallel_book.7"
+
+parallel_design.7: parallel_design.pod
+	pod2man --release='$(PACKAGE_VERSION)' --center='$(PACKAGE_NAME)' \
+		--section=7 "$(srcdir)"/parallel_design.pod > "$(srcdir)"/parallel_design.7n \
+	&& mv "$(srcdir)"/parallel_design.7n "$(srcdir)"/parallel_design.7 \
+	|| echo "Warning: pod2man not found. Using old parallel_design.7"
+
+parallel_alternatives.7: parallel_alternatives.pod
+	pod2man --release='$(PACKAGE_VERSION)' --center='$(PACKAGE_NAME)' \
+		--section=7 "$(srcdir)"/parallel_alternatives.pod > "$(srcdir)"/parallel_alternatives.7n \
+	&& mv "$(srcdir)"/parallel_alternatives.7n "$(srcdir)"/parallel_alternatives.7 \
+	|| echo "Warning: pod2man not found. Using old parallel_alternatives.7"
+
+sem.1: sem.pod
+	pod2man --release='$(PACKAGE_VERSION)' --center='$(PACKAGE_NAME)' \
+		--section=1 "$(srcdir)"/sem.pod > "$(srcdir)"/sem.1n \
+	&& mv "$(srcdir)"/sem.1n "$(srcdir)"/sem.1 \
+	|| echo "Warning: pod2man not found. Using old sem.1"
+
+sql.1: sql
+	pod2man --release='$(PACKAGE_VERSION)' --center='$(PACKAGE_NAME)' \
+		--section=1 "$(srcdir)"/sql > "$(srcdir)"/sql.1n \
+	&& mv "$(srcdir)"/sql.1n "$(srcdir)"/sql.1 \
+	|| echo "Warning: pod2man not found. Using old sql.1"
+
+niceload.1: niceload.pod
+	pod2man --release='$(PACKAGE_VERSION)' --center='$(PACKAGE_NAME)' \
+		--section=1 "$(srcdir)"/niceload.pod > "$(srcdir)"/niceload.1n \
+	&& mv "$(srcdir)"/niceload.1n "$(srcdir)"/niceload.1 \
+	|| echo "Warning: pod2man not found. Using old niceload.1"
+
+parcat.1: parcat.pod
+	pod2man --release='$(PACKAGE_VERSION)' --center='$(PACKAGE_NAME)' \
+		--section=1 "$(srcdir)"/parcat.pod > "$(srcdir)"/parcat.1n \
+	&& mv "$(srcdir)"/parcat.1n "$(srcdir)"/parcat.1 \
+	|| echo "Warning: pod2man not found. Using old parcat.1"
+
+parset.1: parset.pod
+	pod2man --release='$(PACKAGE_VERSION)' --center='$(PACKAGE_NAME)' \
+		--section=1 "$(srcdir)"/parset.pod > "$(srcdir)"/parset.1n \
+	&& mv "$(srcdir)"/parset.1n "$(srcdir)"/parset.1 \
+	|| echo "Warning: pod2man not found. Using old parset.1"
+
+parsort.1: parsort
+	pod2man --release='$(PACKAGE_VERSION)' --center='$(PACKAGE_NAME)' \
+		--section=1 "$(srcdir)"/parsort > "$(srcdir)"/parsort.1n \
+	&& mv "$(srcdir)"/parsort.1n "$(srcdir)"/parsort.1 \
+	|| echo "Warning: pod2man not found. Using old parsort.1"
+
+parallel.html: parallel.pod
+	pod2html --title "GNU Parallel" "$(srcdir)"/parallel.pod > "$(srcdir)"/parallel.htmln \
+	&& mv "$(srcdir)"/parallel.htmln "$(srcdir)"/parallel.html \
+	|| echo "Warning: pod2html not found. Using old parallel.html"
+	rm -f "$(srcdir)"/pod2htm*
+
+# Depending on parallel.html to avoid stupid pod2html race condition
+env_parallel.html: env_parallel.pod parallel.html
+	pod2html --title "GNU Parallel with environment" "$(srcdir)"/env_parallel.pod > "$(srcdir)"/env_parallel.htmln \
+	&& mv "$(srcdir)"/env_parallel.htmln "$(srcdir)"/env_parallel.html \
+	|| echo "Warning: pod2html not found. Using old env_parallel.html"
+	rm -f "$(srcdir)"/pod2htm*
+
+# Depending on env_parallel.html to avoid stupid pod2html race condition
+parallel_examples.html: parallel_examples.pod env_parallel.html
+	pod2html --title "GNU Parallel examples" "$(srcdir)"/parallel_examples.pod > "$(srcdir)"/parallel_examples.htmln \
+	&& mv "$(srcdir)"/parallel_examples.htmln "$(srcdir)"/parallel_examples.html \
+	|| echo "Warning: pod2html not found. Using old parallel_examples.html"
+	rm -f "$(srcdir)"/pod2htm*
+
+# Depending on parallel_examples.html to avoid stupid pod2html race condition
+parallel_tutorial.html: parallel_tutorial.pod parallel_examples.html
+	pod2html --title "GNU Parallel tutorial" "$(srcdir)"/parallel_tutorial.pod > "$(srcdir)"/parallel_tutorial.htmln \
+	&& mv "$(srcdir)"/parallel_tutorial.htmln "$(srcdir)"/parallel_tutorial.html \
+	|| echo "Warning: pod2html not found. Using old parallel_tutorial.html"
+	rm -f "$(srcdir)"/pod2htm*
+
+# Depending on parallel_tutorial.html to avoid stupid pod2html race condition
+parallel_book.html: parallel_book.pod parallel_tutorial.html
+	pod2html --title "GNU Parallel book" "$(srcdir)"/parallel_book.pod > "$(srcdir)"/parallel_book.htmln \
+	&& mv "$(srcdir)"/parallel_book.htmln "$(srcdir)"/parallel_book.html \
+	|| echo "Warning: pod2html not found. Using old parallel_book.html"
+	rm -f "$(srcdir)"/pod2htm*
+
+# Depending on parallel_book.html to avoid stupid pod2html race condition
+parallel_design.html: parallel_design.pod parallel_book.html
+	pod2html --title "GNU Parallel design" "$(srcdir)"/parallel_design.pod > "$(srcdir)"/parallel_design.htmln \
+	&& mv "$(srcdir)"/parallel_design.htmln "$(srcdir)"/parallel_design.html \
+	|| echo "Warning: pod2html not found. Using old parallel_design.html"
+	rm -f "$(srcdir)"/pod2htm*
+
+# Depending on parallel_design.html to avoid stupid pod2html race condition
+parallel_alternatives.html: parallel_alternatives.pod parallel_design.html
+	pod2html --title "GNU Parallel alternatives" "$(srcdir)"/parallel_alternatives.pod > "$(srcdir)"/parallel_alternatives.htmln \
+	&& mv "$(srcdir)"/parallel_alternatives.htmln "$(srcdir)"/parallel_alternatives.html \
+	|| echo "Warning: pod2html not found. Using old parallel_alternatives.html"
+	rm -f "$(srcdir)"/pod2htm*
+
+# Depending on parallel_alternatives.html to avoid stupid pod2html race condition
+sem.html: sem.pod parallel_alternatives.html
+	pod2html --title "sem (GNU Parallel)" "$(srcdir)"/sem.pod > "$(srcdir)"/sem.htmln \
+	&& mv "$(srcdir)"/sem.htmln "$(srcdir)"/sem.html \
+	|| echo "Warning: pod2html not found. Using old sem.html"
+	rm -f "$(srcdir)"/pod2htm*
+
+# Depending on sem.html to avoid stupid pod2html race condition
+sql.html: sql sem.html
+	pod2html --title "GNU SQL" "$(srcdir)"/sql > "$(srcdir)"/sql.htmln \
+	&& mv "$(srcdir)"/sql.htmln "$(srcdir)"/sql.html \
+	|| echo "Warning: pod2html not found. Using old sql.html"
+	rm -f "$(srcdir)"/pod2htm*
+
+# Depending on sql.html to avoid stupid pod2html race condition
+niceload.html: niceload.pod sql.html
+	pod2html --title "GNU niceload" "$(srcdir)"/niceload.pod > "$(srcdir)"/niceload.htmln \
+	&& mv "$(srcdir)"/niceload.htmln "$(srcdir)"/niceload.html \
+	|| echo "Warning: pod2html not found. Using old niceload.html"
+	rm -f "$(srcdir)"/pod2htm*
+
+# Depending on niceload.html to avoid stupid pod2html race condition
+parcat.html: parcat.pod niceload.html
+	pod2html --title "GNU parcat" "$(srcdir)"/parcat.pod > "$(srcdir)"/parcat.htmln \
+	&& mv "$(srcdir)"/parcat.htmln "$(srcdir)"/parcat.html \
+	|| echo "Warning: pod2html not found. Using old parcat.html"
+	rm -f "$(srcdir)"/pod2htm*
+
+# Depending on parcat.html to avoid stupid pod2html race condition
+parset.html: parset.pod parcat.html
+	pod2html --title "GNU parset" "$(srcdir)"/parset.pod > "$(srcdir)"/parset.htmln \
+	&& mv "$(srcdir)"/parset.htmln "$(srcdir)"/parset.html \
+	|| echo "Warning: pod2html not found. Using old parset.html"
+	rm -f "$(srcdir)"/pod2htm*
+
+# Depending on parset.html to avoid stupid pod2html race condition
+parsort.html: parsort parset.html
+	pod2html --title "GNU parsort" "$(srcdir)"/parsort > "$(srcdir)"/parsort.htmln \
+	&& mv "$(srcdir)"/parsort.htmln "$(srcdir)"/parsort.html \
+	|| echo "Warning: pod2html not found. Using old parsort.html"
+	rm -f "$(srcdir)"/pod2htm*
+
+parallel.texi: parallel.pod
+	pod2texi --output="$(srcdir)"/parallel.texi "$(srcdir)"/parallel.pod \
+	|| echo "Warning: pod2texi not found. Using old parallel.texi"
+
+env_parallel.texi: env_parallel.pod
+	pod2texi --output="$(srcdir)"/env_parallel.texi "$(srcdir)"/env_parallel.pod \
+	|| echo "Warning: pod2texi not found. Using old env_parallel.texi"
+
+parallel_examples.texi: parallel_examples.pod
+	pod2texi --output="$(srcdir)"/parallel_examples.texi "$(srcdir)"/parallel_examples.pod \
+	|| echo "Warning: pod2texi not found. Using old parallel_examples.texi"
+
+parallel_tutorial.texi: parallel_tutorial.pod
+	pod2texi --output="$(srcdir)"/parallel_tutorial.texi "$(srcdir)"/parallel_tutorial.pod \
+	|| echo "Warning: pod2texi not found. Using old parallel_tutorial.texi"
+
+parallel_book.texi: parallel_book.pod
+	pod2texi --output="$(srcdir)"/parallel_book.texi "$(srcdir)"/parallel_book.pod \
+	|| echo "Warning: pod2texi not found. Using old parallel_book.texi"
+
+parallel_design.texi: parallel_design.pod
+	pod2texi --output="$(srcdir)"/parallel_design.texi "$(srcdir)"/parallel_design.pod \
+	|| echo "Warning: pod2texi not found. Using old parallel_design.texi"
+
+parallel_alternatives.texi: parallel_alternatives.pod
+	pod2texi --output="$(srcdir)"/parallel_alternatives.texi "$(srcdir)"/parallel_alternatives.pod \
+	|| echo "Warning: pod2texi not found. Using old parallel_alternatives.texi"
+
+sem.texi: sem.pod
+	pod2texi --output="$(srcdir)"/sem.texi "$(srcdir)"/sem.pod \
+	|| echo "Warning: pod2texi not found. Using old sem.texi"
+
+sql.texi: sql
+	pod2texi --output="$(srcdir)"/sql.texi "$(srcdir)"/sql \
+	|| echo "Warning: pod2texi not found. Using old sql.texi"
+
+niceload.texi: niceload.pod
+	pod2texi --output="$(srcdir)"/niceload.texi "$(srcdir)"/niceload.pod \
+	|| echo "Warning: pod2texi not found. Using old niceload.texi"
+
+parcat.texi: parcat.pod
+	pod2texi --output="$(srcdir)"/parcat.texi "$(srcdir)"/parcat.pod \
+	|| echo "Warning: pod2texi not found. Using old parcat.texi"
+
+parset.texi: parset.pod
+	pod2texi --output="$(srcdir)"/parset.texi "$(srcdir)"/parset.pod \
+	|| echo "Warning: pod2texi not found. Using old parset.texi"
+
+parsort.texi: parsort
+	pod2texi --output="$(srcdir)"/parsort.texi "$(srcdir)"/parsort \
+	|| echo "Warning: pod2texi not found. Using old parsort.texi"
+
+parallel.rst: parallel.pod
+	./pod2rst-fix < "$(srcdir)"/parallel.pod > "$(srcdir)"/parallel.rst \
+	|| echo "Warning: pod2rst not found. Using old parallel.rst"
+
+env_parallel.rst: env_parallel.pod
+	./pod2rst-fix < "$(srcdir)"/env_parallel.pod > "$(srcdir)"/env_parallel.rst \
+	|| echo "Warning: pod2rst not found. Using old env_parallel.rst"
+
+parallel_examples.rst: parallel_examples.pod
+	./pod2rst-fix < "$(srcdir)"/parallel_examples.pod > "$(srcdir)"/parallel_examples.rst \
+	|| echo "Warning: pod2rst not found. Using old parallel_examples.rst"
+
+parallel_tutorial.rst: parallel_tutorial.pod
+	./pod2rst-fix < "$(srcdir)"/parallel_tutorial.pod > "$(srcdir)"/parallel_tutorial.rst \
+	|| echo "Warning: pod2rst not found. Using old parallel_tutorial.rst"
+
+parallel_book.rst: parallel_book.pod
+	./pod2rst-fix < "$(srcdir)"/parallel_book.pod > "$(srcdir)"/parallel_book.rst \
+	|| echo "Warning: pod2rst not found. Using old parallel_book.rst"
+
+parallel_design.rst: parallel_design.pod
+	./pod2rst-fix < "$(srcdir)"/parallel_design.pod > "$(srcdir)"/parallel_design.rst \
+	|| echo "Warning: pod2rst not found. Using old parallel_design.rst"
+
+parallel_alternatives.rst: parallel_alternatives.pod
+	./pod2rst-fix < "$(srcdir)"/parallel_alternatives.pod > "$(srcdir)"/parallel_alternatives.rst \
+	|| echo "Warning: pod2rst not found. Using old parallel_alternatives.rst"
+
+sem.rst: sem.pod
+	./pod2rst-fix < "$(srcdir)"/sem.pod > "$(srcdir)"/sem.rst \
+	|| echo "Warning: pod2rst not found. Using old sem.rst"
+
+sql.rst: sql
+	./pod2rst-fix < "$(srcdir)"/sql > "$(srcdir)"/sql.rst \
+	|| echo "Warning: pod2rst not found. Using old sql.rst"
+
+niceload.rst: niceload.pod
+	./pod2rst-fix < "$(srcdir)"/niceload.pod > "$(srcdir)"/niceload.rst \
+	|| echo "Warning: pod2rst not found. Using old niceload.rst"
+
+parcat.rst: parcat.pod
+	./pod2rst-fix < "$(srcdir)"/parcat.pod > "$(srcdir)"/parcat.rst \
+	|| echo "Warning: pod2rst not found. Using old parcat.rst"
+
+parset.rst: parset.pod
+	./pod2rst-fix < "$(srcdir)"/parset.pod > "$(srcdir)"/parset.rst \
+	|| echo "Warning: pod2rst not found. Using old parset.rst"
+
+parsort.rst: parsort
+	./pod2rst-fix < "$(srcdir)"/parsort > "$(srcdir)"/parsort.rst \
+	|| echo "Warning: pod2rst not found. Using old parsort.rst"
+
+parallel.pdf: parallel.pod
+	pod2pdf --output-file "$(srcdir)"/parallel.pdf "$(srcdir)"/parallel.pod --title "GNU Parallel" \
+	|| echo "Warning: pod2pdf not found. Using old parallel.pdf"
+
+env_parallel.pdf: env_parallel.pod
+	pod2pdf --output-file "$(srcdir)"/env_parallel.pdf "$(srcdir)"/env_parallel.pod --title "GNU Parallel with environment" \
+	|| echo "Warning: pod2pdf not found. Using old env_parallel.pdf"
+
+parallel_examples.pdf: parallel_examples.pod
+	pod2pdf --output-file "$(srcdir)"/parallel_examples.pdf "$(srcdir)"/parallel_examples.pod --title "GNU Parallel Examples" \
+	|| echo "Warning: pod2pdf not found. Using old parallel_examples.pdf"
+
+parallel_tutorial.pdf: parallel_tutorial.pod
+	pod2pdf --output-file "$(srcdir)"/parallel_tutorial.pdf "$(srcdir)"/parallel_tutorial.pod --title "GNU Parallel Tutorial" \
+	|| echo "Warning: pod2pdf not found. Using old parallel_tutorial.pdf"
+
+parallel_book.pdf: parallel_book.pod
+	pod2pdf --output-file "$(srcdir)"/parallel_book.pdf "$(srcdir)"/parallel_book.pod --title "GNU Parallel Book" \
+	|| echo "Warning: pod2pdf not found. Using old parallel_book.pdf"
+
+parallel_design.pdf: parallel_design.pod
+	pod2pdf --output-file "$(srcdir)"/parallel_design.pdf "$(srcdir)"/parallel_design.pod --title "GNU Parallel Design" \
+	|| echo "Warning: pod2pdf not found. Using old parallel_design.pdf"
+
+parallel_alternatives.pdf: parallel_alternatives.pod
+	pod2pdf --output-file "$(srcdir)"/parallel_alternatives.pdf "$(srcdir)"/parallel_alternatives.pod --title "GNU Parallel alternatives" \
+	|| echo "Warning: pod2pdf not found. Using old parallel_alternatives.pdf"
+
+sem.pdf: sem.pod
+	pod2pdf --output-file "$(srcdir)"/sem.pdf "$(srcdir)"/sem.pod --title "GNU sem" \
+	|| echo "Warning: pod2pdf not found. Using old sem.pdf"
+
+sql.pdf: sql
+	pod2pdf --output-file "$(srcdir)"/sql.pdf "$(srcdir)"/sql --title "GNU SQL" \
+	|| echo "Warning: pod2pdf not found. Using old sql.pdf"
+
+niceload.pdf: niceload.pod
+	pod2pdf --output-file "$(srcdir)"/niceload.pdf "$(srcdir)"/niceload.pod --title "GNU niceload" \
+	|| echo "Warning: pod2pdf not found. Using old niceload.pdf"
+
+parcat.pdf: parcat.pod
+	pod2pdf --output-file "$(srcdir)"/parcat.pdf "$(srcdir)"/parcat.pod --title "GNU parcat" \
+	|| echo "Warning: pod2pdf not found. Using old parcat.pdf"
+
+parset.pdf: parset.pod
+	pod2pdf --output-file "$(srcdir)"/parset.pdf "$(srcdir)"/parset.pod --title "GNU parset" \
+	|| echo "Warning: pod2pdf not found. Using old parset.pdf"
+
+parsort.pdf: parsort
+	pod2pdf --output-file "$(srcdir)"/parsort.pdf "$(srcdir)"/parsort --title "GNU parsort" \
+	|| echo "Warning: pod2pdf not found. Using old parsort.pdf"
+
+parallel_cheat_bw.pdf: parallel_cheat_bw.fodt
+	libreoffice --headless --convert-to pdf parallel_cheat_bw.fodt \
+	|| echo "Warning: libreoffice failed. Using old parallel_cheat_bw.pdf"
+
+parallel_options_map.pdf: parallel.pod pod2graph
+	./pod2graph parallel.pod > parallel_options_map.pdf \
+	|| echo "Warning: pod2graph failed. Using old parallel_options_map.pdf"
+
+sem: parallel
+	ln -fs parallel sem
+
+DISTCLEANFILES = parallel.1 env_parallel.1 sem.1 sql.1 niceload.1	\
+	parallel_examples.7 parallel_tutorial.7 parallel_book.7		\
+	parallel_design.7 parallel_alternatives.7 parcat.1 parset.1	\
+	parsort.1 \
+	parallel.html env_parallel.html sem.html sql.html		\
+	niceload.html parallel_examples.html parallel_tutorial.html	\
+	parallel_book.html parallel_design.html				\
+	parallel_alternatives.html parcat.html parset.html		\
+	parsort.html \
+	parallel.texi env_parallel.texi sem.texi sql.texi		\
+	niceload.texi parallel_examples.texi parallel_tutorial.texi	\
+	parallel_book.texi parallel_design.texi				\
+	parallel_alternatives.texi parcat.texi parset.texi		\
+	parsort.texi \
+	parallel.rst env_parallel.rst sem.rst sql.rst niceload.rst	\
+	parallel_examples.rst parallel_tutorial.rst parallel_book.rst	\
+	parallel_design.rst parallel_alternatives.rst parcat.rst	\
+	parset.rst parsort.rst \
+	parallel.pdf env_parallel.pdf sem.pdf sql.pdf niceload.pdf	\
+	parallel_examples.pdf parallel_tutorial.pdf parallel_book.pdf	\
+	parallel_design.pdf parallel_alternatives.pdf parcat.pdf	\
+	parset.pdf parsort.pdf parallel_cheat_bw.pdf			\
+	parallel_options_map.pdf
+
+EXTRA_DIST = parallel sem sql niceload parcat parset parsort		\
+	env_parallel env_parallel.ash env_parallel.bash			\
+	env_parallel.csh env_parallel.dash env_parallel.fish		\
+	env_parallel.ksh env_parallel.mksh env_parallel.pdksh		\
+	env_parallel.sh env_parallel.tcsh env_parallel.zsh parcat.pod	\
+	parset.pod sem.pod parallel.pod env_parallel.pod niceload.pod	\
+	parallel_examples.pod parallel_tutorial.pod parallel_book.pod	\
+	parallel_design.pod parallel_alternatives.pod			\
+	parallel_cheat_bw.fodt pod2graph $(DISTCLEANFILES)
diff --git a/src/Makefile.in b/src/Makefile.in
new file mode 100644
index 0000000..9956b5c
--- /dev/null
+++ b/src/Makefile.in
@@ -0,0 +1,992 @@
+# Makefile.in generated by automake 1.16.5 from Makefile.am.
+# @configure_input@
+
+# Copyright (C) 1994-2021 Free Software Foundation, Inc.
+
+# This Makefile.in is free software; the Free Software Foundation
+# gives unlimited permission to copy and/or distribute it,
+# with or without modifications, as long as this notice is preserved.
+
+# This program is distributed in the hope that it will be useful,
+# but WITHOUT ANY WARRANTY, to the extent permitted by law; without
+# even the implied warranty of MERCHANTABILITY or FITNESS FOR A
+# PARTICULAR PURPOSE.
+
+@SET_MAKE@
+
+# SPDX-FileCopyrightText: 2002-2022 Ole Tange, http://ole.tange.dk and Free Software and Foundation, Inc.
+#
+# SPDX-License-Identifier: GPL-3.0-or-later
+
+
+VPATH = @srcdir@
+am__is_gnu_make = { \
+  if test -z '$(MAKELEVEL)'; then \
+    false; \
+  elif test -n '$(MAKE_HOST)'; then \
+    true; \
+  elif test -n '$(MAKE_VERSION)' && test -n '$(CURDIR)'; then \
+    true; \
+  else \
+    false; \
+  fi; \
+}
+am__make_running_with_option = \
+  case $${target_option-} in \
+      ?) ;; \
+      *) echo "am__make_running_with_option: internal error: invalid" \
+              "target option '$${target_option-}' specified" >&2; \
+         exit 1;; \
+  esac; \
+  has_opt=no; \
+  sane_makeflags=$$MAKEFLAGS; \
+  if $(am__is_gnu_make); then \
+    sane_makeflags=$$MFLAGS; \
+  else \
+    case $$MAKEFLAGS in \
+      *\\[\ \	]*) \
+        bs=\\; \
+        sane_makeflags=`printf '%s\n' "$$MAKEFLAGS" \
+          | sed "s/$$bs$$bs[$$bs $$bs	]*//g"`;; \
+    esac; \
+  fi; \
+  skip_next=no; \
+  strip_trailopt () \
+  { \
+    flg=`printf '%s\n' "$$flg" | sed "s/$$1.*$$//"`; \
+  }; \
+  for flg in $$sane_makeflags; do \
+    test $$skip_next = yes && { skip_next=no; continue; }; \
+    case $$flg in \
+      *=*|--*) continue;; \
+        -*I) strip_trailopt 'I'; skip_next=yes;; \
+      -*I?*) strip_trailopt 'I';; \
+        -*O) strip_trailopt 'O'; skip_next=yes;; \
+      -*O?*) strip_trailopt 'O';; \
+        -*l) strip_trailopt 'l'; skip_next=yes;; \
+      -*l?*) strip_trailopt 'l';; \
+      -[dEDm]) skip_next=yes;; \
+      -[JT]) skip_next=yes;; \
+    esac; \
+    case $$flg in \
+      *$$target_option*) has_opt=yes; break;; \
+    esac; \
+  done; \
+  test $$has_opt = yes
+am__make_dryrun = (target_option=n; $(am__make_running_with_option))
+am__make_keepgoing = (target_option=k; $(am__make_running_with_option))
+pkgdatadir = $(datadir)/@PACKAGE@
+pkgincludedir = $(includedir)/@PACKAGE@
+pkglibdir = $(libdir)/@PACKAGE@
+pkglibexecdir = $(libexecdir)/@PACKAGE@
+am__cd = CDPATH="$${ZSH_VERSION+.}$(PATH_SEPARATOR)" && cd
+install_sh_DATA = $(install_sh) -c -m 644
+install_sh_PROGRAM = $(install_sh) -c
+install_sh_SCRIPT = $(install_sh) -c
+INSTALL_HEADER = $(INSTALL_DATA)
+transform = $(program_transform_name)
+NORMAL_INSTALL = :
+PRE_INSTALL = :
+POST_INSTALL = :
+NORMAL_UNINSTALL = :
+PRE_UNINSTALL = :
+POST_UNINSTALL = :
+subdir = src
+ACLOCAL_M4 = $(top_srcdir)/aclocal.m4
+am__aclocal_m4_deps = $(top_srcdir)/configure.ac
+am__configure_deps = $(am__aclocal_m4_deps) $(CONFIGURE_DEPENDENCIES) \
+	$(ACLOCAL_M4)
+DIST_COMMON = $(srcdir)/Makefile.am $(am__DIST_COMMON)
+mkinstalldirs = $(install_sh) -d
+CONFIG_HEADER = $(top_builddir)/config.h
+CONFIG_CLEAN_FILES =
+CONFIG_CLEAN_VPATH_FILES =
+am__vpath_adj_setup = srcdirstrip=`echo "$(srcdir)" | sed 's|.|.|g'`;
+am__vpath_adj = case $$p in \
+    $(srcdir)/*) f=`echo "$$p" | sed "s|^$$srcdirstrip/||"`;; \
+    *) f=$$p;; \
+  esac;
+am__strip_dir = f=`echo $$p | sed -e 's|^.*/||'`;
+am__install_max = 40
+am__nobase_strip_setup = \
+  srcdirstrip=`echo "$(srcdir)" | sed 's/[].[^$$\\*|]/\\\\&/g'`
+am__nobase_strip = \
+  for p in $$list; do echo "$$p"; done | sed -e "s|$$srcdirstrip/||"
+am__nobase_list = $(am__nobase_strip_setup); \
+  for p in $$list; do echo "$$p $$p"; done | \
+  sed "s| $$srcdirstrip/| |;"' / .*\//!s/ .*/ ./; s,\( .*\)/[^/]*$$,\1,' | \
+  $(AWK) 'BEGIN { files["."] = "" } { files[$$2] = files[$$2] " " $$1; \
+    if (++n[$$2] == $(am__install_max)) \
+      { print $$2, files[$$2]; n[$$2] = 0; files[$$2] = "" } } \
+    END { for (dir in files) print dir, files[dir] }'
+am__base_list = \
+  sed '$$!N;$$!N;$$!N;$$!N;$$!N;$$!N;$$!N;s/\n/ /g' | \
+  sed '$$!N;$$!N;$$!N;$$!N;s/\n/ /g'
+am__uninstall_files_from_dir = { \
+  test -z "$$files" \
+    || { test ! -d "$$dir" && test ! -f "$$dir" && test ! -r "$$dir"; } \
+    || { echo " ( cd '$$dir' && rm -f" $$files ")"; \
+         $(am__cd) "$$dir" && rm -f $$files; }; \
+  }
+am__installdirs = "$(DESTDIR)$(bindir)" "$(DESTDIR)$(man1dir)" \
+	"$(DESTDIR)$(man7dir)" "$(DESTDIR)$(docdir)"
+SCRIPTS = $(bin_SCRIPTS)
+AM_V_P = $(am__v_P_@AM_V@)
+am__v_P_ = $(am__v_P_@AM_DEFAULT_V@)
+am__v_P_0 = false
+am__v_P_1 = :
+AM_V_GEN = $(am__v_GEN_@AM_V@)
+am__v_GEN_ = $(am__v_GEN_@AM_DEFAULT_V@)
+am__v_GEN_0 = @echo "  GEN     " $@;
+am__v_GEN_1 = 
+AM_V_at = $(am__v_at_@AM_V@)
+am__v_at_ = $(am__v_at_@AM_DEFAULT_V@)
+am__v_at_0 = @
+am__v_at_1 = 
+SOURCES =
+DIST_SOURCES =
+am__can_run_installinfo = \
+  case $$AM_UPDATE_INFO_DIR in \
+    n|no|NO) false;; \
+    *) (install-info --version) >/dev/null 2>&1;; \
+  esac
+man1dir = $(mandir)/man1
+man7dir = $(mandir)/man7
+NROFF = nroff
+MANS = $(man_MANS)
+DATA = $(doc_DATA)
+am__tagged_files = $(HEADERS) $(SOURCES) $(TAGS_FILES) $(LISP)
+am__DIST_COMMON = $(srcdir)/Makefile.in
+DISTFILES = $(DIST_COMMON) $(DIST_SOURCES) $(TEXINFOS) $(EXTRA_DIST)
+ACLOCAL = @ACLOCAL@
+AMTAR = @AMTAR@
+AM_DEFAULT_VERBOSITY = @AM_DEFAULT_VERBOSITY@
+AUTOCONF = @AUTOCONF@
+AUTOHEADER = @AUTOHEADER@
+AUTOMAKE = @AUTOMAKE@
+AWK = @AWK@
+CSCOPE = @CSCOPE@
+CTAGS = @CTAGS@
+CYGPATH_W = @CYGPATH_W@
+DEFS = @DEFS@
+ECHO_C = @ECHO_C@
+ECHO_N = @ECHO_N@
+ECHO_T = @ECHO_T@
+ETAGS = @ETAGS@
+INSTALL = @INSTALL@
+INSTALL_DATA = @INSTALL_DATA@
+INSTALL_PROGRAM = @INSTALL_PROGRAM@
+INSTALL_SCRIPT = @INSTALL_SCRIPT@
+INSTALL_STRIP_PROGRAM = @INSTALL_STRIP_PROGRAM@
+LIBOBJS = @LIBOBJS@
+LIBS = @LIBS@
+LN_S = @LN_S@
+LTLIBOBJS = @LTLIBOBJS@
+MAKEINFO = @MAKEINFO@
+MKDIR_P = @MKDIR_P@
+PACKAGE = @PACKAGE@
+PACKAGE_BUGREPORT = @PACKAGE_BUGREPORT@
+PACKAGE_NAME = @PACKAGE_NAME@
+PACKAGE_STRING = @PACKAGE_STRING@
+PACKAGE_TARNAME = @PACKAGE_TARNAME@
+PACKAGE_URL = @PACKAGE_URL@
+PACKAGE_VERSION = @PACKAGE_VERSION@
+PATH_SEPARATOR = @PATH_SEPARATOR@
+SET_MAKE = @SET_MAKE@
+SHELL = @SHELL@
+STRIP = @STRIP@
+VERSION = @VERSION@
+abs_builddir = @abs_builddir@
+abs_srcdir = @abs_srcdir@
+abs_top_builddir = @abs_top_builddir@
+abs_top_srcdir = @abs_top_srcdir@
+am__leading_dot = @am__leading_dot@
+am__tar = @am__tar@
+am__untar = @am__untar@
+bindir = @bindir@
+build_alias = @build_alias@
+builddir = @builddir@
+datadir = @datadir@
+datarootdir = @datarootdir@
+docdir = @docdir@
+dvidir = @dvidir@
+exec_prefix = @exec_prefix@
+host_alias = @host_alias@
+htmldir = @htmldir@
+includedir = @includedir@
+infodir = @infodir@
+install_sh = @install_sh@
+libdir = @libdir@
+libexecdir = @libexecdir@
+localedir = @localedir@
+localstatedir = @localstatedir@
+mandir = @mandir@
+mkdir_p = @mkdir_p@
+oldincludedir = @oldincludedir@
+pdfdir = @pdfdir@
+prefix = @prefix@
+program_transform_name = @program_transform_name@
+psdir = @psdir@
+runstatedir = @runstatedir@
+sbindir = @sbindir@
+sharedstatedir = @sharedstatedir@
+srcdir = @srcdir@
+sysconfdir = @sysconfdir@
+target_alias = @target_alias@
+top_build_prefix = @top_build_prefix@
+top_builddir = @top_builddir@
+top_srcdir = @top_srcdir@
+bin_SCRIPTS = parallel sql niceload parcat parset parsort	\
+	env_parallel env_parallel.ash env_parallel.bash		\
+	env_parallel.csh env_parallel.dash env_parallel.fish	\
+	env_parallel.ksh env_parallel.mksh env_parallel.pdksh	\
+	env_parallel.sh env_parallel.tcsh env_parallel.zsh
+
+@DOCUMENTATION_TRUE@man_MANS = parallel.1 env_parallel.1 sem.1 sql.1 niceload.1		\
+@DOCUMENTATION_TRUE@	parallel_examples.7 parallel_tutorial.7 parallel_book.7		\
+@DOCUMENTATION_TRUE@	parallel_design.7 parallel_alternatives.7 parcat.1 parset.1	\
+@DOCUMENTATION_TRUE@	parsort.1
+
+@DOCUMENTATION_TRUE@doc_DATA = parallel.html env_parallel.html sem.html sql.html		\
+@DOCUMENTATION_TRUE@	niceload.html parallel_examples.html parallel_tutorial.html	\
+@DOCUMENTATION_TRUE@	parallel_book.html parallel_design.html				\
+@DOCUMENTATION_TRUE@	parallel_alternatives.html parcat.html parset.html		\
+@DOCUMENTATION_TRUE@	parsort.html \
+@DOCUMENTATION_TRUE@	parallel.texi env_parallel.texi sem.texi sql.texi		\
+@DOCUMENTATION_TRUE@	niceload.texi parallel_examples.texi parallel_tutorial.texi	\
+@DOCUMENTATION_TRUE@	parallel_book.texi parallel_design.texi				\
+@DOCUMENTATION_TRUE@	parallel_alternatives.texi parcat.texi parset.texi		\
+@DOCUMENTATION_TRUE@	parsort.texi \
+@DOCUMENTATION_TRUE@	parallel.rst env_parallel.rst sem.rst sql.rst niceload.rst	\
+@DOCUMENTATION_TRUE@	parallel_examples.rst parallel_tutorial.rst parallel_book.rst	\
+@DOCUMENTATION_TRUE@	parallel_design.rst parallel_alternatives.rst parcat.rst	\
+@DOCUMENTATION_TRUE@	parset.rst parsort.rst \
+@DOCUMENTATION_TRUE@	parallel.pdf env_parallel.pdf sem.pdf sql.pdf niceload.pdf	\
+@DOCUMENTATION_TRUE@	parallel_examples.pdf parallel_tutorial.pdf parallel_book.pdf	\
+@DOCUMENTATION_TRUE@	parallel_design.pdf parallel_alternatives.pdf parcat.pdf	\
+@DOCUMENTATION_TRUE@	parset.pdf parsort.pdf parallel_cheat_bw.pdf			\
+@DOCUMENTATION_TRUE@	parallel_options_map.pdf
+
+DISTCLEANFILES = parallel.1 env_parallel.1 sem.1 sql.1 niceload.1	\
+	parallel_examples.7 parallel_tutorial.7 parallel_book.7		\
+	parallel_design.7 parallel_alternatives.7 parcat.1 parset.1	\
+	parsort.1 \
+	parallel.html env_parallel.html sem.html sql.html		\
+	niceload.html parallel_examples.html parallel_tutorial.html	\
+	parallel_book.html parallel_design.html				\
+	parallel_alternatives.html parcat.html parset.html		\
+	parsort.html \
+	parallel.texi env_parallel.texi sem.texi sql.texi		\
+	niceload.texi parallel_examples.texi parallel_tutorial.texi	\
+	parallel_book.texi parallel_design.texi				\
+	parallel_alternatives.texi parcat.texi parset.texi		\
+	parsort.texi \
+	parallel.rst env_parallel.rst sem.rst sql.rst niceload.rst	\
+	parallel_examples.rst parallel_tutorial.rst parallel_book.rst	\
+	parallel_design.rst parallel_alternatives.rst parcat.rst	\
+	parset.rst parsort.rst \
+	parallel.pdf env_parallel.pdf sem.pdf sql.pdf niceload.pdf	\
+	parallel_examples.pdf parallel_tutorial.pdf parallel_book.pdf	\
+	parallel_design.pdf parallel_alternatives.pdf parcat.pdf	\
+	parset.pdf parsort.pdf parallel_cheat_bw.pdf			\
+	parallel_options_map.pdf
+
+EXTRA_DIST = parallel sem sql niceload parcat parset parsort		\
+	env_parallel env_parallel.ash env_parallel.bash			\
+	env_parallel.csh env_parallel.dash env_parallel.fish		\
+	env_parallel.ksh env_parallel.mksh env_parallel.pdksh		\
+	env_parallel.sh env_parallel.tcsh env_parallel.zsh parcat.pod	\
+	parset.pod sem.pod parallel.pod env_parallel.pod niceload.pod	\
+	parallel_examples.pod parallel_tutorial.pod parallel_book.pod	\
+	parallel_design.pod parallel_alternatives.pod			\
+	parallel_cheat_bw.fodt pod2graph $(DISTCLEANFILES)
+
+all: all-am
+
+.SUFFIXES:
+$(srcdir)/Makefile.in:  $(srcdir)/Makefile.am  $(am__configure_deps)
+	@for dep in $?; do \
+	  case '$(am__configure_deps)' in \
+	    *$$dep*) \
+	      ( cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh ) \
+	        && { if test -f $@; then exit 0; else break; fi; }; \
+	      exit 1;; \
+	  esac; \
+	done; \
+	echo ' cd $(top_srcdir) && $(AUTOMAKE) --foreign src/Makefile'; \
+	$(am__cd) $(top_srcdir) && \
+	  $(AUTOMAKE) --foreign src/Makefile
+Makefile: $(srcdir)/Makefile.in $(top_builddir)/config.status
+	@case '$?' in \
+	  *config.status*) \
+	    cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh;; \
+	  *) \
+	    echo ' cd $(top_builddir) && $(SHELL) ./config.status $(subdir)/$@ $(am__maybe_remake_depfiles)'; \
+	    cd $(top_builddir) && $(SHELL) ./config.status $(subdir)/$@ $(am__maybe_remake_depfiles);; \
+	esac;
+
+$(top_builddir)/config.status: $(top_srcdir)/configure $(CONFIG_STATUS_DEPENDENCIES)
+	cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh
+
+$(top_srcdir)/configure:  $(am__configure_deps)
+	cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh
+$(ACLOCAL_M4):  $(am__aclocal_m4_deps)
+	cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh
+$(am__aclocal_m4_deps):
+install-binSCRIPTS: $(bin_SCRIPTS)
+	@$(NORMAL_INSTALL)
+	@list='$(bin_SCRIPTS)'; test -n "$(bindir)" || list=; \
+	if test -n "$$list"; then \
+	  echo " $(MKDIR_P) '$(DESTDIR)$(bindir)'"; \
+	  $(MKDIR_P) "$(DESTDIR)$(bindir)" || exit 1; \
+	fi; \
+	for p in $$list; do \
+	  if test -f "$$p"; then d=; else d="$(srcdir)/"; fi; \
+	  if test -f "$$d$$p"; then echo "$$d$$p"; echo "$$p"; else :; fi; \
+	done | \
+	sed -e 'p;s,.*/,,;n' \
+	    -e 'h;s|.*|.|' \
+	    -e 'p;x;s,.*/,,;$(transform)' | sed 'N;N;N;s,\n, ,g' | \
+	$(AWK) 'BEGIN { files["."] = ""; dirs["."] = 1; } \
+	  { d=$$3; if (dirs[d] != 1) { print "d", d; dirs[d] = 1 } \
+	    if ($$2 == $$4) { files[d] = files[d] " " $$1; \
+	      if (++n[d] == $(am__install_max)) { \
+		print "f", d, files[d]; n[d] = 0; files[d] = "" } } \
+	    else { print "f", d "/" $$4, $$1 } } \
+	  END { for (d in files) print "f", d, files[d] }' | \
+	while read type dir files; do \
+	     if test "$$dir" = .; then dir=; else dir=/$$dir; fi; \
+	     test -z "$$files" || { \
+	       echo " $(INSTALL_SCRIPT) $$files '$(DESTDIR)$(bindir)$$dir'"; \
+	       $(INSTALL_SCRIPT) $$files "$(DESTDIR)$(bindir)$$dir" || exit $$?; \
+	     } \
+	; done
+
+uninstall-binSCRIPTS:
+	@$(NORMAL_UNINSTALL)
+	@list='$(bin_SCRIPTS)'; test -n "$(bindir)" || exit 0; \
+	files=`for p in $$list; do echo "$$p"; done | \
+	       sed -e 's,.*/,,;$(transform)'`; \
+	dir='$(DESTDIR)$(bindir)'; $(am__uninstall_files_from_dir)
+install-man1: $(man_MANS)
+	@$(NORMAL_INSTALL)
+	@list1=''; \
+	list2='$(man_MANS)'; \
+	test -n "$(man1dir)" \
+	  && test -n "`echo $$list1$$list2`" \
+	  || exit 0; \
+	echo " $(MKDIR_P) '$(DESTDIR)$(man1dir)'"; \
+	$(MKDIR_P) "$(DESTDIR)$(man1dir)" || exit 1; \
+	{ for i in $$list1; do echo "$$i"; done;  \
+	if test -n "$$list2"; then \
+	  for i in $$list2; do echo "$$i"; done \
+	    | sed -n '/\.1[a-z]*$$/p'; \
+	fi; \
+	} | while read p; do \
+	  if test -f $$p; then d=; else d="$(srcdir)/"; fi; \
+	  echo "$$d$$p"; echo "$$p"; \
+	done | \
+	sed -e 'n;s,.*/,,;p;h;s,.*\.,,;s,^[^1][0-9a-z]*$$,1,;x' \
+	      -e 's,\.[0-9a-z]*$$,,;$(transform);G;s,\n,.,' | \
+	sed 'N;N;s,\n, ,g' | { \
+	list=; while read file base inst; do \
+	  if test "$$base" = "$$inst"; then list="$$list $$file"; else \
+	    echo " $(INSTALL_DATA) '$$file' '$(DESTDIR)$(man1dir)/$$inst'"; \
+	    $(INSTALL_DATA) "$$file" "$(DESTDIR)$(man1dir)/$$inst" || exit $$?; \
+	  fi; \
+	done; \
+	for i in $$list; do echo "$$i"; done | $(am__base_list) | \
+	while read files; do \
+	  test -z "$$files" || { \
+	    echo " $(INSTALL_DATA) $$files '$(DESTDIR)$(man1dir)'"; \
+	    $(INSTALL_DATA) $$files "$(DESTDIR)$(man1dir)" || exit $$?; }; \
+	done; }
+
+uninstall-man1:
+	@$(NORMAL_UNINSTALL)
+	@list=''; test -n "$(man1dir)" || exit 0; \
+	files=`{ for i in $$list; do echo "$$i"; done; \
+	l2='$(man_MANS)'; for i in $$l2; do echo "$$i"; done | \
+	  sed -n '/\.1[a-z]*$$/p'; \
+	} | sed -e 's,.*/,,;h;s,.*\.,,;s,^[^1][0-9a-z]*$$,1,;x' \
+	      -e 's,\.[0-9a-z]*$$,,;$(transform);G;s,\n,.,'`; \
+	dir='$(DESTDIR)$(man1dir)'; $(am__uninstall_files_from_dir)
+install-man7: $(man_MANS)
+	@$(NORMAL_INSTALL)
+	@list1=''; \
+	list2='$(man_MANS)'; \
+	test -n "$(man7dir)" \
+	  && test -n "`echo $$list1$$list2`" \
+	  || exit 0; \
+	echo " $(MKDIR_P) '$(DESTDIR)$(man7dir)'"; \
+	$(MKDIR_P) "$(DESTDIR)$(man7dir)" || exit 1; \
+	{ for i in $$list1; do echo "$$i"; done;  \
+	if test -n "$$list2"; then \
+	  for i in $$list2; do echo "$$i"; done \
+	    | sed -n '/\.7[a-z]*$$/p'; \
+	fi; \
+	} | while read p; do \
+	  if test -f $$p; then d=; else d="$(srcdir)/"; fi; \
+	  echo "$$d$$p"; echo "$$p"; \
+	done | \
+	sed -e 'n;s,.*/,,;p;h;s,.*\.,,;s,^[^7][0-9a-z]*$$,7,;x' \
+	      -e 's,\.[0-9a-z]*$$,,;$(transform);G;s,\n,.,' | \
+	sed 'N;N;s,\n, ,g' | { \
+	list=; while read file base inst; do \
+	  if test "$$base" = "$$inst"; then list="$$list $$file"; else \
+	    echo " $(INSTALL_DATA) '$$file' '$(DESTDIR)$(man7dir)/$$inst'"; \
+	    $(INSTALL_DATA) "$$file" "$(DESTDIR)$(man7dir)/$$inst" || exit $$?; \
+	  fi; \
+	done; \
+	for i in $$list; do echo "$$i"; done | $(am__base_list) | \
+	while read files; do \
+	  test -z "$$files" || { \
+	    echo " $(INSTALL_DATA) $$files '$(DESTDIR)$(man7dir)'"; \
+	    $(INSTALL_DATA) $$files "$(DESTDIR)$(man7dir)" || exit $$?; }; \
+	done; }
+
+uninstall-man7:
+	@$(NORMAL_UNINSTALL)
+	@list=''; test -n "$(man7dir)" || exit 0; \
+	files=`{ for i in $$list; do echo "$$i"; done; \
+	l2='$(man_MANS)'; for i in $$l2; do echo "$$i"; done | \
+	  sed -n '/\.7[a-z]*$$/p'; \
+	} | sed -e 's,.*/,,;h;s,.*\.,,;s,^[^7][0-9a-z]*$$,7,;x' \
+	      -e 's,\.[0-9a-z]*$$,,;$(transform);G;s,\n,.,'`; \
+	dir='$(DESTDIR)$(man7dir)'; $(am__uninstall_files_from_dir)
+install-docDATA: $(doc_DATA)
+	@$(NORMAL_INSTALL)
+	@list='$(doc_DATA)'; test -n "$(docdir)" || list=; \
+	if test -n "$$list"; then \
+	  echo " $(MKDIR_P) '$(DESTDIR)$(docdir)'"; \
+	  $(MKDIR_P) "$(DESTDIR)$(docdir)" || exit 1; \
+	fi; \
+	for p in $$list; do \
+	  if test -f "$$p"; then d=; else d="$(srcdir)/"; fi; \
+	  echo "$$d$$p"; \
+	done | $(am__base_list) | \
+	while read files; do \
+	  echo " $(INSTALL_DATA) $$files '$(DESTDIR)$(docdir)'"; \
+	  $(INSTALL_DATA) $$files "$(DESTDIR)$(docdir)" || exit $$?; \
+	done
+
+uninstall-docDATA:
+	@$(NORMAL_UNINSTALL)
+	@list='$(doc_DATA)'; test -n "$(docdir)" || list=; \
+	files=`for p in $$list; do echo $$p; done | sed -e 's|^.*/||'`; \
+	dir='$(DESTDIR)$(docdir)'; $(am__uninstall_files_from_dir)
+tags TAGS:
+
+ctags CTAGS:
+
+cscope cscopelist:
+
+distdir: $(BUILT_SOURCES)
+	$(MAKE) $(AM_MAKEFLAGS) distdir-am
+
+distdir-am: $(DISTFILES)
+	@srcdirstrip=`echo "$(srcdir)" | sed 's/[].[^$$\\*]/\\\\&/g'`; \
+	topsrcdirstrip=`echo "$(top_srcdir)" | sed 's/[].[^$$\\*]/\\\\&/g'`; \
+	list='$(DISTFILES)'; \
+	  dist_files=`for file in $$list; do echo $$file; done | \
+	  sed -e "s|^$$srcdirstrip/||;t" \
+	      -e "s|^$$topsrcdirstrip/|$(top_builddir)/|;t"`; \
+	case $$dist_files in \
+	  */*) $(MKDIR_P) `echo "$$dist_files" | \
+			   sed '/\//!d;s|^|$(distdir)/|;s,/[^/]*$$,,' | \
+			   sort -u` ;; \
+	esac; \
+	for file in $$dist_files; do \
+	  if test -f $$file || test -d $$file; then d=.; else d=$(srcdir); fi; \
+	  if test -d $$d/$$file; then \
+	    dir=`echo "/$$file" | sed -e 's,/[^/]*$$,,'`; \
+	    if test -d "$(distdir)/$$file"; then \
+	      find "$(distdir)/$$file" -type d ! -perm -700 -exec chmod u+rwx {} \;; \
+	    fi; \
+	    if test -d $(srcdir)/$$file && test $$d != $(srcdir); then \
+	      cp -fpR $(srcdir)/$$file "$(distdir)$$dir" || exit 1; \
+	      find "$(distdir)/$$file" -type d ! -perm -700 -exec chmod u+rwx {} \;; \
+	    fi; \
+	    cp -fpR $$d/$$file "$(distdir)$$dir" || exit 1; \
+	  else \
+	    test -f "$(distdir)/$$file" \
+	    || cp -p $$d/$$file "$(distdir)/$$file" \
+	    || exit 1; \
+	  fi; \
+	done
+check-am: all-am
+check: check-am
+all-am: Makefile $(SCRIPTS) $(MANS) $(DATA)
+installdirs:
+	for dir in "$(DESTDIR)$(bindir)" "$(DESTDIR)$(man1dir)" "$(DESTDIR)$(man7dir)" "$(DESTDIR)$(docdir)"; do \
+	  test -z "$$dir" || $(MKDIR_P) "$$dir"; \
+	done
+install: install-am
+install-exec: install-exec-am
+install-data: install-data-am
+uninstall: uninstall-am
+
+install-am: all-am
+	@$(MAKE) $(AM_MAKEFLAGS) install-exec-am install-data-am
+
+installcheck: installcheck-am
+install-strip:
+	if test -z '$(STRIP)'; then \
+	  $(MAKE) $(AM_MAKEFLAGS) INSTALL_PROGRAM="$(INSTALL_STRIP_PROGRAM)" \
+	    install_sh_PROGRAM="$(INSTALL_STRIP_PROGRAM)" INSTALL_STRIP_FLAG=-s \
+	      install; \
+	else \
+	  $(MAKE) $(AM_MAKEFLAGS) INSTALL_PROGRAM="$(INSTALL_STRIP_PROGRAM)" \
+	    install_sh_PROGRAM="$(INSTALL_STRIP_PROGRAM)" INSTALL_STRIP_FLAG=-s \
+	    "INSTALL_PROGRAM_ENV=STRIPPROG='$(STRIP)'" install; \
+	fi
+mostlyclean-generic:
+
+clean-generic:
+
+distclean-generic:
+	-test -z "$(CONFIG_CLEAN_FILES)" || rm -f $(CONFIG_CLEAN_FILES)
+	-test . = "$(srcdir)" || test -z "$(CONFIG_CLEAN_VPATH_FILES)" || rm -f $(CONFIG_CLEAN_VPATH_FILES)
+	-test -z "$(DISTCLEANFILES)" || rm -f $(DISTCLEANFILES)
+
+maintainer-clean-generic:
+	@echo "This command is intended for maintainers to use"
+	@echo "it deletes files that may require special tools to rebuild."
+clean: clean-am
+
+clean-am: clean-generic mostlyclean-am
+
+distclean: distclean-am
+	-rm -f Makefile
+distclean-am: clean-am distclean-generic
+
+dvi: dvi-am
+
+dvi-am:
+
+html: html-am
+
+html-am:
+
+info: info-am
+
+info-am:
+
+install-data-am: install-docDATA install-man
+
+install-dvi: install-dvi-am
+
+install-dvi-am:
+
+install-exec-am: install-binSCRIPTS
+	@$(NORMAL_INSTALL)
+	$(MAKE) $(AM_MAKEFLAGS) install-exec-hook
+install-html: install-html-am
+
+install-html-am:
+
+install-info: install-info-am
+
+install-info-am:
+
+install-man: install-man1 install-man7
+
+install-pdf: install-pdf-am
+
+install-pdf-am:
+
+install-ps: install-ps-am
+
+install-ps-am:
+
+installcheck-am:
+
+maintainer-clean: maintainer-clean-am
+	-rm -f Makefile
+maintainer-clean-am: distclean-am maintainer-clean-generic
+
+mostlyclean: mostlyclean-am
+
+mostlyclean-am: mostlyclean-generic
+
+pdf: pdf-am
+
+pdf-am:
+
+ps: ps-am
+
+ps-am:
+
+uninstall-am: uninstall-binSCRIPTS uninstall-docDATA uninstall-man
+
+uninstall-man: uninstall-man1 uninstall-man7
+
+.MAKE: install-am install-exec-am install-strip
+
+.PHONY: all all-am check check-am clean clean-generic cscopelist-am \
+	ctags-am distclean distclean-generic distdir dvi dvi-am html \
+	html-am info info-am install install-am install-binSCRIPTS \
+	install-data install-data-am install-docDATA install-dvi \
+	install-dvi-am install-exec install-exec-am install-exec-hook \
+	install-html install-html-am install-info install-info-am \
+	install-man install-man1 install-man7 install-pdf \
+	install-pdf-am install-ps install-ps-am install-strip \
+	installcheck installcheck-am installdirs maintainer-clean \
+	maintainer-clean-generic mostlyclean mostlyclean-generic pdf \
+	pdf-am ps ps-am tags-am uninstall uninstall-am \
+	uninstall-binSCRIPTS uninstall-docDATA uninstall-man \
+	uninstall-man1 uninstall-man7
+
+.PRECIOUS: Makefile
+
+
+install-exec-hook:
+	rm "$(DESTDIR)$(bindir)"/sem || true
+	$(LN_S) parallel "$(DESTDIR)$(bindir)"/sem
+
+web: sphinx
+	true
+
+sphinx: *.rst
+	cd sphinx && make && cd ..
+
+# Build documentation file if the tool to build exists.
+# Otherwise: Use the distributed version
+parallel.1: parallel.pod
+	pod2man --release='$(PACKAGE_VERSION)' --center='$(PACKAGE_NAME)' \
+		--section=1 "$(srcdir)"/parallel.pod > "$(srcdir)"/parallel.1n \
+	&& mv "$(srcdir)"/parallel.1n "$(srcdir)"/parallel.1 \
+	|| echo "Warning: pod2man not found. Using old parallel.1"
+
+env_parallel.1: env_parallel.pod
+	pod2man --release='$(PACKAGE_VERSION)' --center='$(PACKAGE_NAME)' \
+		--section=1 "$(srcdir)"/env_parallel.pod > "$(srcdir)"/env_parallel.1n \
+	&& mv "$(srcdir)"/env_parallel.1n "$(srcdir)"/env_parallel.1 \
+	|| echo "Warning: pod2man not found. Using old env_parallel.1"
+
+parallel_examples.7: parallel_examples.pod
+	pod2man --release='$(PACKAGE_VERSION)' --center='$(PACKAGE_NAME)' \
+		--section=7 "$(srcdir)"/parallel_examples.pod > "$(srcdir)"/parallel_examples.7n \
+	&& mv "$(srcdir)"/parallel_examples.7n "$(srcdir)"/parallel_examples.7 \
+	|| echo "Warning: pod2man not found. Using old parallel_examples.7"
+
+parallel_tutorial.7: parallel_tutorial.pod
+	pod2man --release='$(PACKAGE_VERSION)' --center='$(PACKAGE_NAME)' \
+		--section=7 "$(srcdir)"/parallel_tutorial.pod > "$(srcdir)"/parallel_tutorial.7n \
+	&& mv "$(srcdir)"/parallel_tutorial.7n "$(srcdir)"/parallel_tutorial.7 \
+	|| echo "Warning: pod2man not found. Using old parallel_tutorial.7"
+
+parallel_book.7: parallel_book.pod
+	pod2man --release='$(PACKAGE_VERSION)' --center='$(PACKAGE_NAME)' \
+		--section=7 "$(srcdir)"/parallel_book.pod > "$(srcdir)"/parallel_book.7n \
+	&& mv "$(srcdir)"/parallel_book.7n "$(srcdir)"/parallel_book.7 \
+	|| echo "Warning: pod2man not found. Using old parallel_book.7"
+
+parallel_design.7: parallel_design.pod
+	pod2man --release='$(PACKAGE_VERSION)' --center='$(PACKAGE_NAME)' \
+		--section=7 "$(srcdir)"/parallel_design.pod > "$(srcdir)"/parallel_design.7n \
+	&& mv "$(srcdir)"/parallel_design.7n "$(srcdir)"/parallel_design.7 \
+	|| echo "Warning: pod2man not found. Using old parallel_design.7"
+
+parallel_alternatives.7: parallel_alternatives.pod
+	pod2man --release='$(PACKAGE_VERSION)' --center='$(PACKAGE_NAME)' \
+		--section=7 "$(srcdir)"/parallel_alternatives.pod > "$(srcdir)"/parallel_alternatives.7n \
+	&& mv "$(srcdir)"/parallel_alternatives.7n "$(srcdir)"/parallel_alternatives.7 \
+	|| echo "Warning: pod2man not found. Using old parallel_alternatives.7"
+
+sem.1: sem.pod
+	pod2man --release='$(PACKAGE_VERSION)' --center='$(PACKAGE_NAME)' \
+		--section=1 "$(srcdir)"/sem.pod > "$(srcdir)"/sem.1n \
+	&& mv "$(srcdir)"/sem.1n "$(srcdir)"/sem.1 \
+	|| echo "Warning: pod2man not found. Using old sem.1"
+
+sql.1: sql
+	pod2man --release='$(PACKAGE_VERSION)' --center='$(PACKAGE_NAME)' \
+		--section=1 "$(srcdir)"/sql > "$(srcdir)"/sql.1n \
+	&& mv "$(srcdir)"/sql.1n "$(srcdir)"/sql.1 \
+	|| echo "Warning: pod2man not found. Using old sql.1"
+
+niceload.1: niceload.pod
+	pod2man --release='$(PACKAGE_VERSION)' --center='$(PACKAGE_NAME)' \
+		--section=1 "$(srcdir)"/niceload.pod > "$(srcdir)"/niceload.1n \
+	&& mv "$(srcdir)"/niceload.1n "$(srcdir)"/niceload.1 \
+	|| echo "Warning: pod2man not found. Using old niceload.1"
+
+parcat.1: parcat.pod
+	pod2man --release='$(PACKAGE_VERSION)' --center='$(PACKAGE_NAME)' \
+		--section=1 "$(srcdir)"/parcat.pod > "$(srcdir)"/parcat.1n \
+	&& mv "$(srcdir)"/parcat.1n "$(srcdir)"/parcat.1 \
+	|| echo "Warning: pod2man not found. Using old parcat.1"
+
+parset.1: parset.pod
+	pod2man --release='$(PACKAGE_VERSION)' --center='$(PACKAGE_NAME)' \
+		--section=1 "$(srcdir)"/parset.pod > "$(srcdir)"/parset.1n \
+	&& mv "$(srcdir)"/parset.1n "$(srcdir)"/parset.1 \
+	|| echo "Warning: pod2man not found. Using old parset.1"
+
+parsort.1: parsort
+	pod2man --release='$(PACKAGE_VERSION)' --center='$(PACKAGE_NAME)' \
+		--section=1 "$(srcdir)"/parsort > "$(srcdir)"/parsort.1n \
+	&& mv "$(srcdir)"/parsort.1n "$(srcdir)"/parsort.1 \
+	|| echo "Warning: pod2man not found. Using old parsort.1"
+
+parallel.html: parallel.pod
+	pod2html --title "GNU Parallel" "$(srcdir)"/parallel.pod > "$(srcdir)"/parallel.htmln \
+	&& mv "$(srcdir)"/parallel.htmln "$(srcdir)"/parallel.html \
+	|| echo "Warning: pod2html not found. Using old parallel.html"
+	rm -f "$(srcdir)"/pod2htm*
+
+# Depending on parallel.html to avoid stupid pod2html race condition
+env_parallel.html: env_parallel.pod parallel.html
+	pod2html --title "GNU Parallel with environment" "$(srcdir)"/env_parallel.pod > "$(srcdir)"/env_parallel.htmln \
+	&& mv "$(srcdir)"/env_parallel.htmln "$(srcdir)"/env_parallel.html \
+	|| echo "Warning: pod2html not found. Using old env_parallel.html"
+	rm -f "$(srcdir)"/pod2htm*
+
+# Depending on env_parallel.html to avoid stupid pod2html race condition
+parallel_examples.html: parallel_examples.pod env_parallel.html
+	pod2html --title "GNU Parallel examples" "$(srcdir)"/parallel_examples.pod > "$(srcdir)"/parallel_examples.htmln \
+	&& mv "$(srcdir)"/parallel_examples.htmln "$(srcdir)"/parallel_examples.html \
+	|| echo "Warning: pod2html not found. Using old parallel_examples.html"
+	rm -f "$(srcdir)"/pod2htm*
+
+# Depending on parallel_examples.html to avoid stupid pod2html race condition
+parallel_tutorial.html: parallel_tutorial.pod parallel_examples.html
+	pod2html --title "GNU Parallel tutorial" "$(srcdir)"/parallel_tutorial.pod > "$(srcdir)"/parallel_tutorial.htmln \
+	&& mv "$(srcdir)"/parallel_tutorial.htmln "$(srcdir)"/parallel_tutorial.html \
+	|| echo "Warning: pod2html not found. Using old parallel_tutorial.html"
+	rm -f "$(srcdir)"/pod2htm*
+
+# Depending on parallel_tutorial.html to avoid stupid pod2html race condition
+parallel_book.html: parallel_book.pod parallel_tutorial.html
+	pod2html --title "GNU Parallel book" "$(srcdir)"/parallel_book.pod > "$(srcdir)"/parallel_book.htmln \
+	&& mv "$(srcdir)"/parallel_book.htmln "$(srcdir)"/parallel_book.html \
+	|| echo "Warning: pod2html not found. Using old parallel_book.html"
+	rm -f "$(srcdir)"/pod2htm*
+
+# Depending on parallel_book.html to avoid stupid pod2html race condition
+parallel_design.html: parallel_design.pod parallel_book.html
+	pod2html --title "GNU Parallel design" "$(srcdir)"/parallel_design.pod > "$(srcdir)"/parallel_design.htmln \
+	&& mv "$(srcdir)"/parallel_design.htmln "$(srcdir)"/parallel_design.html \
+	|| echo "Warning: pod2html not found. Using old parallel_design.html"
+	rm -f "$(srcdir)"/pod2htm*
+
+# Depending on parallel_design.html to avoid stupid pod2html race condition
+parallel_alternatives.html: parallel_alternatives.pod parallel_design.html
+	pod2html --title "GNU Parallel alternatives" "$(srcdir)"/parallel_alternatives.pod > "$(srcdir)"/parallel_alternatives.htmln \
+	&& mv "$(srcdir)"/parallel_alternatives.htmln "$(srcdir)"/parallel_alternatives.html \
+	|| echo "Warning: pod2html not found. Using old parallel_alternatives.html"
+	rm -f "$(srcdir)"/pod2htm*
+
+# Depending on parallel_alternatives.html to avoid stupid pod2html race condition
+sem.html: sem.pod parallel_alternatives.html
+	pod2html --title "sem (GNU Parallel)" "$(srcdir)"/sem.pod > "$(srcdir)"/sem.htmln \
+	&& mv "$(srcdir)"/sem.htmln "$(srcdir)"/sem.html \
+	|| echo "Warning: pod2html not found. Using old sem.html"
+	rm -f "$(srcdir)"/pod2htm*
+
+# Depending on sem.html to avoid stupid pod2html race condition
+sql.html: sql sem.html
+	pod2html --title "GNU SQL" "$(srcdir)"/sql > "$(srcdir)"/sql.htmln \
+	&& mv "$(srcdir)"/sql.htmln "$(srcdir)"/sql.html \
+	|| echo "Warning: pod2html not found. Using old sql.html"
+	rm -f "$(srcdir)"/pod2htm*
+
+# Depending on sql.html to avoid stupid pod2html race condition
+niceload.html: niceload.pod sql.html
+	pod2html --title "GNU niceload" "$(srcdir)"/niceload.pod > "$(srcdir)"/niceload.htmln \
+	&& mv "$(srcdir)"/niceload.htmln "$(srcdir)"/niceload.html \
+	|| echo "Warning: pod2html not found. Using old niceload.html"
+	rm -f "$(srcdir)"/pod2htm*
+
+# Depending on niceload.html to avoid stupid pod2html race condition
+parcat.html: parcat.pod niceload.html
+	pod2html --title "GNU parcat" "$(srcdir)"/parcat.pod > "$(srcdir)"/parcat.htmln \
+	&& mv "$(srcdir)"/parcat.htmln "$(srcdir)"/parcat.html \
+	|| echo "Warning: pod2html not found. Using old parcat.html"
+	rm -f "$(srcdir)"/pod2htm*
+
+# Depending on parcat.html to avoid stupid pod2html race condition
+parset.html: parset.pod parcat.html
+	pod2html --title "GNU parset" "$(srcdir)"/parset.pod > "$(srcdir)"/parset.htmln \
+	&& mv "$(srcdir)"/parset.htmln "$(srcdir)"/parset.html \
+	|| echo "Warning: pod2html not found. Using old parset.html"
+	rm -f "$(srcdir)"/pod2htm*
+
+# Depending on parset.html to avoid stupid pod2html race condition
+parsort.html: parsort parset.html
+	pod2html --title "GNU parsort" "$(srcdir)"/parsort > "$(srcdir)"/parsort.htmln \
+	&& mv "$(srcdir)"/parsort.htmln "$(srcdir)"/parsort.html \
+	|| echo "Warning: pod2html not found. Using old parsort.html"
+	rm -f "$(srcdir)"/pod2htm*
+
+parallel.texi: parallel.pod
+	pod2texi --output="$(srcdir)"/parallel.texi "$(srcdir)"/parallel.pod \
+	|| echo "Warning: pod2texi not found. Using old parallel.texi"
+
+env_parallel.texi: env_parallel.pod
+	pod2texi --output="$(srcdir)"/env_parallel.texi "$(srcdir)"/env_parallel.pod \
+	|| echo "Warning: pod2texi not found. Using old env_parallel.texi"
+
+parallel_examples.texi: parallel_examples.pod
+	pod2texi --output="$(srcdir)"/parallel_examples.texi "$(srcdir)"/parallel_examples.pod \
+	|| echo "Warning: pod2texi not found. Using old parallel_examples.texi"
+
+parallel_tutorial.texi: parallel_tutorial.pod
+	pod2texi --output="$(srcdir)"/parallel_tutorial.texi "$(srcdir)"/parallel_tutorial.pod \
+	|| echo "Warning: pod2texi not found. Using old parallel_tutorial.texi"
+
+parallel_book.texi: parallel_book.pod
+	pod2texi --output="$(srcdir)"/parallel_book.texi "$(srcdir)"/parallel_book.pod \
+	|| echo "Warning: pod2texi not found. Using old parallel_book.texi"
+
+parallel_design.texi: parallel_design.pod
+	pod2texi --output="$(srcdir)"/parallel_design.texi "$(srcdir)"/parallel_design.pod \
+	|| echo "Warning: pod2texi not found. Using old parallel_design.texi"
+
+parallel_alternatives.texi: parallel_alternatives.pod
+	pod2texi --output="$(srcdir)"/parallel_alternatives.texi "$(srcdir)"/parallel_alternatives.pod \
+	|| echo "Warning: pod2texi not found. Using old parallel_alternatives.texi"
+
+sem.texi: sem.pod
+	pod2texi --output="$(srcdir)"/sem.texi "$(srcdir)"/sem.pod \
+	|| echo "Warning: pod2texi not found. Using old sem.texi"
+
+sql.texi: sql
+	pod2texi --output="$(srcdir)"/sql.texi "$(srcdir)"/sql \
+	|| echo "Warning: pod2texi not found. Using old sql.texi"
+
+niceload.texi: niceload.pod
+	pod2texi --output="$(srcdir)"/niceload.texi "$(srcdir)"/niceload.pod \
+	|| echo "Warning: pod2texi not found. Using old niceload.texi"
+
+parcat.texi: parcat.pod
+	pod2texi --output="$(srcdir)"/parcat.texi "$(srcdir)"/parcat.pod \
+	|| echo "Warning: pod2texi not found. Using old parcat.texi"
+
+parset.texi: parset.pod
+	pod2texi --output="$(srcdir)"/parset.texi "$(srcdir)"/parset.pod \
+	|| echo "Warning: pod2texi not found. Using old parset.texi"
+
+parsort.texi: parsort
+	pod2texi --output="$(srcdir)"/parsort.texi "$(srcdir)"/parsort \
+	|| echo "Warning: pod2texi not found. Using old parsort.texi"
+
+parallel.rst: parallel.pod
+	./pod2rst-fix < "$(srcdir)"/parallel.pod > "$(srcdir)"/parallel.rst \
+	|| echo "Warning: pod2rst not found. Using old parallel.rst"
+
+env_parallel.rst: env_parallel.pod
+	./pod2rst-fix < "$(srcdir)"/env_parallel.pod > "$(srcdir)"/env_parallel.rst \
+	|| echo "Warning: pod2rst not found. Using old env_parallel.rst"
+
+parallel_examples.rst: parallel_examples.pod
+	./pod2rst-fix < "$(srcdir)"/parallel_examples.pod > "$(srcdir)"/parallel_examples.rst \
+	|| echo "Warning: pod2rst not found. Using old parallel_examples.rst"
+
+parallel_tutorial.rst: parallel_tutorial.pod
+	./pod2rst-fix < "$(srcdir)"/parallel_tutorial.pod > "$(srcdir)"/parallel_tutorial.rst \
+	|| echo "Warning: pod2rst not found. Using old parallel_tutorial.rst"
+
+parallel_book.rst: parallel_book.pod
+	./pod2rst-fix < "$(srcdir)"/parallel_book.pod > "$(srcdir)"/parallel_book.rst \
+	|| echo "Warning: pod2rst not found. Using old parallel_book.rst"
+
+parallel_design.rst: parallel_design.pod
+	./pod2rst-fix < "$(srcdir)"/parallel_design.pod > "$(srcdir)"/parallel_design.rst \
+	|| echo "Warning: pod2rst not found. Using old parallel_design.rst"
+
+parallel_alternatives.rst: parallel_alternatives.pod
+	./pod2rst-fix < "$(srcdir)"/parallel_alternatives.pod > "$(srcdir)"/parallel_alternatives.rst \
+	|| echo "Warning: pod2rst not found. Using old parallel_alternatives.rst"
+
+sem.rst: sem.pod
+	./pod2rst-fix < "$(srcdir)"/sem.pod > "$(srcdir)"/sem.rst \
+	|| echo "Warning: pod2rst not found. Using old sem.rst"
+
+sql.rst: sql
+	./pod2rst-fix < "$(srcdir)"/sql > "$(srcdir)"/sql.rst \
+	|| echo "Warning: pod2rst not found. Using old sql.rst"
+
+niceload.rst: niceload.pod
+	./pod2rst-fix < "$(srcdir)"/niceload.pod > "$(srcdir)"/niceload.rst \
+	|| echo "Warning: pod2rst not found. Using old niceload.rst"
+
+parcat.rst: parcat.pod
+	./pod2rst-fix < "$(srcdir)"/parcat.pod > "$(srcdir)"/parcat.rst \
+	|| echo "Warning: pod2rst not found. Using old parcat.rst"
+
+parset.rst: parset.pod
+	./pod2rst-fix < "$(srcdir)"/parset.pod > "$(srcdir)"/parset.rst \
+	|| echo "Warning: pod2rst not found. Using old parset.rst"
+
+parsort.rst: parsort
+	./pod2rst-fix < "$(srcdir)"/parsort > "$(srcdir)"/parsort.rst \
+	|| echo "Warning: pod2rst not found. Using old parsort.rst"
+
+parallel.pdf: parallel.pod
+	pod2pdf --output-file "$(srcdir)"/parallel.pdf "$(srcdir)"/parallel.pod --title "GNU Parallel" \
+	|| echo "Warning: pod2pdf not found. Using old parallel.pdf"
+
+env_parallel.pdf: env_parallel.pod
+	pod2pdf --output-file "$(srcdir)"/env_parallel.pdf "$(srcdir)"/env_parallel.pod --title "GNU Parallel with environment" \
+	|| echo "Warning: pod2pdf not found. Using old env_parallel.pdf"
+
+parallel_examples.pdf: parallel_examples.pod
+	pod2pdf --output-file "$(srcdir)"/parallel_examples.pdf "$(srcdir)"/parallel_examples.pod --title "GNU Parallel Examples" \
+	|| echo "Warning: pod2pdf not found. Using old parallel_examples.pdf"
+
+parallel_tutorial.pdf: parallel_tutorial.pod
+	pod2pdf --output-file "$(srcdir)"/parallel_tutorial.pdf "$(srcdir)"/parallel_tutorial.pod --title "GNU Parallel Tutorial" \
+	|| echo "Warning: pod2pdf not found. Using old parallel_tutorial.pdf"
+
+parallel_book.pdf: parallel_book.pod
+	pod2pdf --output-file "$(srcdir)"/parallel_book.pdf "$(srcdir)"/parallel_book.pod --title "GNU Parallel Book" \
+	|| echo "Warning: pod2pdf not found. Using old parallel_book.pdf"
+
+parallel_design.pdf: parallel_design.pod
+	pod2pdf --output-file "$(srcdir)"/parallel_design.pdf "$(srcdir)"/parallel_design.pod --title "GNU Parallel Design" \
+	|| echo "Warning: pod2pdf not found. Using old parallel_design.pdf"
+
+parallel_alternatives.pdf: parallel_alternatives.pod
+	pod2pdf --output-file "$(srcdir)"/parallel_alternatives.pdf "$(srcdir)"/parallel_alternatives.pod --title "GNU Parallel alternatives" \
+	|| echo "Warning: pod2pdf not found. Using old parallel_alternatives.pdf"
+
+sem.pdf: sem.pod
+	pod2pdf --output-file "$(srcdir)"/sem.pdf "$(srcdir)"/sem.pod --title "GNU sem" \
+	|| echo "Warning: pod2pdf not found. Using old sem.pdf"
+
+sql.pdf: sql
+	pod2pdf --output-file "$(srcdir)"/sql.pdf "$(srcdir)"/sql --title "GNU SQL" \
+	|| echo "Warning: pod2pdf not found. Using old sql.pdf"
+
+niceload.pdf: niceload.pod
+	pod2pdf --output-file "$(srcdir)"/niceload.pdf "$(srcdir)"/niceload.pod --title "GNU niceload" \
+	|| echo "Warning: pod2pdf not found. Using old niceload.pdf"
+
+parcat.pdf: parcat.pod
+	pod2pdf --output-file "$(srcdir)"/parcat.pdf "$(srcdir)"/parcat.pod --title "GNU parcat" \
+	|| echo "Warning: pod2pdf not found. Using old parcat.pdf"
+
+parset.pdf: parset.pod
+	pod2pdf --output-file "$(srcdir)"/parset.pdf "$(srcdir)"/parset.pod --title "GNU parset" \
+	|| echo "Warning: pod2pdf not found. Using old parset.pdf"
+
+parsort.pdf: parsort
+	pod2pdf --output-file "$(srcdir)"/parsort.pdf "$(srcdir)"/parsort --title "GNU parsort" \
+	|| echo "Warning: pod2pdf not found. Using old parsort.pdf"
+
+parallel_cheat_bw.pdf: parallel_cheat_bw.fodt
+	libreoffice --headless --convert-to pdf parallel_cheat_bw.fodt \
+	|| echo "Warning: libreoffice failed. Using old parallel_cheat_bw.pdf"
+
+parallel_options_map.pdf: parallel.pod pod2graph
+	./pod2graph parallel.pod > parallel_options_map.pdf \
+	|| echo "Warning: pod2graph failed. Using old parallel_options_map.pdf"
+
+sem: parallel
+	ln -fs parallel sem
+
+# Tell versions [3.59,3.63) of GNU make to not export all variables.
+# Otherwise a system limit (for SysV at least) may be exceeded.
+.NOEXPORT:
diff --git a/src/env_parallel b/src/env_parallel
new file mode 100755
index 0000000..3f968fc
--- /dev/null
+++ b/src/env_parallel
@@ -0,0 +1,143 @@
+#!/usr/bin/env bash
+
+# Copyright (C) 2016-2022 Ole Tange, http://ole.tange.dk and Free
+# Software Foundation, Inc.
+#
+# This program is free software; you can redistribute it and/or modify
+# it under the terms of the GNU General Public License as published by
+# the Free Software Foundation; either version 3 of the License, or
+# (at your option) any later version.
+#
+# This program is distributed in the hope that it will be useful, but
+# WITHOUT ANY WARRANTY; without even the implied warranty of
+# MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the GNU
+# General Public License for more details.
+#
+# You should have received a copy of the GNU General Public License
+# along with this program; if not, see <http://www.gnu.org/licenses/>
+# or write to the Free Software Foundation, Inc., 51 Franklin St,
+# Fifth Floor, Boston, MA 02110-1301 USA
+#
+# SPDX-FileCopyrightText: 2021-2022 Ole Tange, http://ole.tange.dk and Free Software and Foundation, Inc.
+# SPDX-License-Identifier: GPL-3.0-or-later
+
+grepq() {
+    # grep -q for systems without -q
+    grep >/dev/null 2>/dev/null "$@"
+}
+
+installer() {
+    source="$1"
+    script="$2"
+    into="$3"
+    if grepq $script "$into"; then
+	true already installed
+    else
+	echo $source \`which $script\` >> "$into"
+    fi
+}
+
+while test $# -gt 0; do
+  key="$1"
+
+  case $key in
+      -i|--install)
+	  installer . env_parallel.bash  "$HOME"/.bashrc
+	  installer . env_parallel.sh  "$HOME"/.shrc
+	  installer . env_parallel.zsh   "$HOME"/.zshenv
+	  installer source env_parallel.ksh "$HOME"/.kshrc
+	  installer source env_parallel.mksh "$HOME"/.mkshrc
+	  echo $SHELL | grepq /pdksh &&
+	      installer . env_parallel.pdksh "$HOME"/.profile
+	  echo $SHELL | grepq /ash &&
+	      installer . env_parallel.ash "$HOME"/.profile
+	  echo $SHELL | grepq /dash &&
+	      installer . env_parallel.dash "$HOME"/.profile
+	  installer source env_parallel.csh "$HOME"/.cshrc
+	  installer source env_parallel.tcsh "$HOME"/.tcshrc
+	  mkdir -p "$HOME"/.config/fish
+	  grepq env_parallel.fish "$HOME"/.config/fish/config.fish ||
+  	    echo '. (which env_parallel.fish)' >> "$HOME"/.config/fish/config.fish
+  	  echo 'Installed env_parallel in:'
+  	  echo "    " "$HOME"/.bashrc
+  	  echo "    " "$HOME"/.shrc
+  	  echo "    " "$HOME"/.zshenv
+  	  echo "    " "$HOME"/.config/fish/config.fish
+  	  echo "    " "$HOME"/.kshrc
+  	  echo "    " "$HOME"/.mkshrc
+  	  echo "    " "$HOME"/.profile
+  	  echo "    " "$HOME"/.cshrc
+  	  echo "    " "$HOME"/.tcshrc
+  	  exit
+      ;;
+      *)
+  	echo "Unknown option: $key"
+      ;;
+  esac
+  shift # past argument or value
+done
+
+
+cat <<'_EOS'
+env_parallel only works if it is a function.
+
+Do this and restart your shell:
+
+bash:  Put this in $HOME/.bashrc:  . `which env_parallel.bash`
+       E.g. by doing:  echo '. `which env_parallel.bash`' >> $HOME/.bashrc
+       Supports: variables, aliases, functions, arrays
+
+fish:  Put this in $HOME/.config/fish/config.fish:  . (which env_parallel.fish)
+       E.g. by doing:
+         echo '. (which env_parallel.fish)' >> $HOME/.config/fish/config.fish
+       Supports: variables, aliases, functions, arrays
+
+ksh:   Put this in $HOME/.kshrc:  source `which env_parallel.ksh`
+       E.g. by doing:  echo 'source `which env_parallel.ksh`' >> $HOME/.kshrc
+       Supports: variables, aliases, functions, arrays
+
+mksh:  Put this in $HOME/.mkshrc:  source `which env_parallel.mksh`
+       E.g. by doing:  echo 'source `which env_parallel.mksh`' >> $HOME/.mkshrc
+       Supports: variables, aliases, functions, arrays
+
+pdksh: Put this in $HOME/.profile:  source `which env_parallel.pdksh`
+       E.g. by doing:  echo '. `which env_parallel.pdksh`' >> $HOME/.profile
+       Supports: variables, aliases, functions, arrays
+
+zsh:   Put this in $HOME/.zshrc:  . `which env_parallel.zsh`
+       E.g. by doing:  echo '. `which env_parallel.zsh`' >> $HOME/.zshenv
+       Supports: variables, functions, arrays
+
+ash:   Put this in $HOME/.profile:  . `which env_parallel.ash`
+       E.g. by doing:  echo '. `which env_parallel.ash`' >> $HOME/.profile
+       Supports: variables, aliases
+
+dash:  Put this in $HOME/.profile:  . `which env_parallel.dash`
+       E.g. by doing:  echo '. `which env_parallel.dash`' >> $HOME/.profile
+       Supports: variables, aliases
+
+csh:   Put this in $HOME/.cshrc:  source `which env_parallel.csh`
+       E.g. by doing:  echo 'source `which env_parallel.csh`' >> $HOME/.cshrc
+       Supports: variables, aliases, arrays with no special chars
+
+tcsh:  Put this in $HOME/.tcshrc:  source `which env_parallel.tcsh`
+       E.g. by doing:  echo 'source `which env_parallel.tcsh`' >> $HOME/.tcshrc
+       Supports: variables, aliases, arrays with no special chars
+
+To install in all shells run:
+
+  env_parallel --install
+
+In a script you need to run this before using env_parallel:
+
+bash:  . `which env_parallel.bash`
+ksh:   source `which env_parallel.ksh`
+mksh:  source `which env_parallel.mksh`
+pdksh: source `which env_parallel.pdksh`
+zsh:   . `which env_parallel.zsh`
+ash:   . `which env_parallel.ash`
+dash:  . `which env_parallel.dash`
+
+For details: see  man env_parallel
+
+_EOS
diff --git a/src/env_parallel.ash b/src/env_parallel.ash
new file mode 100755
index 0000000..a3a24d5
--- /dev/null
+++ b/src/env_parallel.ash
@@ -0,0 +1,430 @@
+#!/usr/bin/env ash
+
+# This file must be sourced in ash:
+#
+#   . `which env_parallel.ash`
+#
+# after which 'env_parallel' works
+#
+#
+# Copyright (C) 2016-2022 Ole Tange, http://ole.tange.dk and Free
+# Software Foundation, Inc.
+#
+# This program is free software; you can redistribute it and/or modify
+# it under the terms of the GNU General Public License as published by
+# the Free Software Foundation; either version 3 of the License, or
+# (at your option) any later version.
+#
+# This program is distributed in the hope that it will be useful, but
+# WITHOUT ANY WARRANTY; without even the implied warranty of
+# MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the GNU
+# General Public License for more details.
+#
+# You should have received a copy of the GNU General Public License
+# along with this program; if not, see <http://www.gnu.org/licenses/>
+# or write to the Free Software Foundation, Inc., 51 Franklin St,
+# Fifth Floor, Boston, MA 02110-1301 USA
+#
+# SPDX-FileCopyrightText: 2021-2022 Ole Tange, http://ole.tange.dk and Free Software and Foundation, Inc.
+# SPDX-License-Identifier: GPL-3.0-or-later
+# shellcheck disable=SC2006 shell=dash
+
+env_parallel() {
+    # based on env_parallel.sh
+
+    _names_of_ALIASES() {
+	# alias fails on Unixware 5
+	for _i in `alias 2>/dev/null | perl -ne 's/^alias //;s/^(\S+)=.*/$1/ && print' 2>/dev/null`; do
+	    # Check if this name really is an alias
+	    # or just part of a multiline alias definition
+	    if alias "$_i" >/dev/null 2>/dev/null; then
+		echo "$_i"
+	    fi
+	done
+    }
+    _bodies_of_ALIASES() {
+	# alias may return:
+	#   myalias='definition' (GNU/Linux ash)
+	#   alias myalias='definition' (FreeBSD ash)
+	# so remove 'alias ' from first line
+	for _i in "$@"; do
+		echo 'alias '"`alias "$_i" | perl -pe '1..1 and s/^alias //'`"
+	done
+    }
+    _names_of_maybe_FUNCTIONS() {
+	set | perl -ne '/^([A-Z_0-9]+)\s*\(\)\s*\{?$/i and print "$1\n"'
+    }
+    _names_of_FUNCTIONS() {
+	# myfunc is a function
+	# shellcheck disable=SC2046
+	LANG=C type `_names_of_maybe_FUNCTIONS` |
+	    perl -ne '/^(\S+) is a function$/ and not $seen{$1}++ and print "$1\n"'
+    }
+    _bodies_of_FUNCTIONS() {
+	LANG=C type "$@" | perl -ne '/^(\S+) is a function$/ or print'
+    }
+    _names_of_VARIABLES() {
+	# This may screw up if variables contain \n and =
+	set | perl -ne 's/^(\S+?)=.*/$1/ and print;'
+    }
+    _bodies_of_VARIABLES() {
+	# Crappy typeset -p
+	for _i in "$@"
+	do
+	    perl -e 'print @ARGV' "$_i="
+	    eval echo "\"\$$_i\"" | perl -e '$/=undef; $a=<>; chop($a); print $a' |
+		perl -pe 's/[\002-\011\013-\032\\\#\?\`\(\)\{\}\[\]\^\*\<\=\>\~\|\; \"\!\$\&\202-\377]/\\$&/go;'"s/'/\\\'/g; s/[\n]/'\\n'/go;";
+	    echo
+	done
+    }
+    _ignore_HARDCODED() {
+	# These names cannot be detected
+	echo '(_|TIMEOUT|IFS)'
+    }
+    _ignore_READONLY() {
+	# shellcheck disable=SC1078,SC1079,SC2026
+	readonly | perl -e '@r = map {
+                chomp;
+                # sh on UnixWare: readonly TIMEOUT
+	        # ash: readonly var='val'
+	        # ksh: var='val'
+		# mksh: PIPESTATUS[0]
+                s/^(readonly )?([^=\[ ]*?)(\[\d+\])?(=.*|)$/$2/ or
+	        # bash: declare -ar BASH_VERSINFO=([0]="4" [1]="4")
+	        # zsh: typeset -r var='val'
+                  s/^\S+\s+\S+\s+(\S[^=]*)(=.*|$)/$1/;
+                $_ } <>;
+            $vars = join "|",map { quotemeta $_ } @r;
+            print $vars ? "($vars)" : "(,,nO,,VaRs,,)";
+            '
+    }
+    _remove_bad_NAMES() {
+	# Do not transfer vars and funcs from env_parallel
+	# shellcheck disable=SC2006
+	_ignore_RO="`_ignore_READONLY`"
+	# shellcheck disable=SC2006
+	_ignore_HARD="`_ignore_HARDCODED`"
+	# Macos-grep does not like long patterns
+	# Old Solaris grep does not support -E
+	# Perl Version of:
+	# grep -Ev '^(...)$' |
+	perl -ne '/^(
+		     PARALLEL_ENV|
+		     PARALLEL_TMP|
+		     _alias_NAMES|
+		     _bodies_of_ALIASES|
+		     _bodies_of_FUNCTIONS|
+		     _bodies_of_VARIABLES|
+		     _error_PAR|
+		     _function_NAMES|
+		     _get_ignored_VARS|
+		     _grep_REGEXP|
+		     _ignore_HARD|
+		     _ignore_HARDCODED|
+		     _ignore_READONLY|
+		     _ignore_RO|
+		     _ignore_UNDERSCORE|
+		     _list_alias_BODIES|
+		     _list_function_BODIES|
+		     _list_variable_VALUES|
+		     _make_grep_REGEXP|
+		     _names_of_ALIASES|
+		     _names_of_FUNCTIONS|
+		     _names_of_VARIABLES|
+		     _names_of_maybe_FUNCTIONS|
+		     _parallel_exit_CODE|
+		     _prefix_PARALLEL_ENV|
+		     _prefix_PARALLEL_ENV|
+		     _remove_bad_NAMES|
+		     _remove_readonly|
+		     _variable_NAMES|
+		     _warning_PAR|
+		     _which_PAR)$/x and next;
+	    # Filter names matching --env
+	    /^'"$_grep_REGEXP"'$/ or next;
+            /^'"$_ignore_UNDERSCORE"'$/ and next;
+	    # Remove readonly variables
+            /^'"$_ignore_RO"'$/ and next;
+            /^'"$_ignore_HARD"'$/ and next;
+            print;'
+    }
+    _get_ignored_VARS() {
+        perl -e '
+            for(@ARGV){
+                $next_is_env and push @envvar, split/,/, $_;
+                $next_is_env=/^--env$/;
+            }
+            if(grep { /^_$/ } @envvar) {
+                if(not open(IN, "<", "$ENV{HOME}/.parallel/ignored_vars")) {
+             	    print STDERR "parallel: Error: ",
+            	    "Run \"parallel --record-env\" in a clean environment first.\n";
+                } else {
+            	    chomp(@ignored_vars = <IN>);
+                }
+            }
+            if($ENV{PARALLEL_IGNORED_NAMES}) {
+                push @ignored_vars, split/\s+/, $ENV{PARALLEL_IGNORED_NAMES};
+                chomp @ignored_vars;
+            }
+            $vars = join "|",map { quotemeta $_ } @ignored_vars;
+	    print $vars ? "($vars)" : "(,,nO,,VaRs,,)";
+            ' -- "$@"
+    }
+
+    # Get the --env variables if set
+    # --env _ should be ignored
+    # and convert  a b c  to (a|b|c)
+    # If --env not set: Match everything (.*)
+    _make_grep_REGEXP() {
+        perl -e '
+            for(@ARGV){
+                /^_$/ and $next_is_env = 0;
+                $next_is_env and push @envvar, split/,/, $_;
+                $next_is_env = /^--env$/;
+            }
+            $vars = join "|",map { quotemeta $_ } @envvar;
+            print $vars ? "($vars)" : "(.*)";
+            ' -- "$@"
+    }
+    _which_PAR() {
+	# type returns:
+	#   ll is an alias for ls -l (in ash)
+	#   bash is a tracked alias for /bin/bash
+	#   true is a shell builtin (in bash)
+	#   myfunc is a function (in bash)
+	#   myfunc is a shell function (in zsh)
+	#   which is /usr/bin/which (in sh, bash)
+	#   which is hashed (/usr/bin/which)
+	#   gi is aliased to `grep -i' (in bash)
+	#   aliased to `alias | /usr/bin/which --tty-only --read-alias --show-dot --show-tilde'
+	# Return 0 if found, 1 otherwise
+	LANG=C type "$@" |
+	    perl -pe '$exit += (s/ is an alias for .*// ||
+	                        s/ is aliased to .*// ||
+                                s/ is a function// ||
+                                s/ is a shell function// ||
+                                s/ is a shell builtin// ||
+                                s/.* is hashed .(\S+).$/$1/ ||
+                                s/.* is (a tracked alias for )?//);
+                      END { exit not $exit }'
+    }
+    _warning_PAR() {
+	echo "env_parallel: Warning: $*" >&2
+    }
+    _error_PAR() {
+	echo "env_parallel: Error: $*" >&2
+    }
+
+    if _which_PAR parallel >/dev/null; then
+	true parallel found in path
+    else
+	# shellcheck disable=SC2016
+	_error_PAR 'parallel must be in $PATH.'
+	return 255
+    fi
+
+    # Grep regexp for vars given by --env
+    # shellcheck disable=SC2006
+    _grep_REGEXP="`_make_grep_REGEXP \"$@\"`"
+    unset _make_grep_REGEXP
+
+    # Deal with --env _
+    # shellcheck disable=SC2006
+    _ignore_UNDERSCORE="`_get_ignored_VARS \"$@\"`"
+    unset _get_ignored_VARS
+
+    # --record-env
+    if perl -e 'exit grep { /^--record-env$/ } @ARGV' -- "$@"; then
+	true skip
+    else
+	(_names_of_ALIASES;
+	 _names_of_FUNCTIONS;
+	 _names_of_VARIABLES) |
+	    cat > "$HOME"/.parallel/ignored_vars
+	return 0
+    fi
+
+    # --session
+    if perl -e 'exit grep { /^--session$/ } @ARGV' -- "$@"; then
+	true skip
+    else
+	# Insert ::: between each level of session
+	# so you can pop off the last ::: at --end-session
+	# shellcheck disable=SC2006
+	PARALLEL_IGNORED_NAMES="`echo \"$PARALLEL_IGNORED_NAMES\";
+          echo :::;
+          (_names_of_ALIASES;
+	   _names_of_FUNCTIONS;
+	   _names_of_VARIABLES) | perl -ne '
+	    BEGIN{
+	      map { $ignored_vars{$_}++ }
+                split/\s+/, $ENV{PARALLEL_IGNORED_NAMES};
+	    }
+	    chomp;
+	    for(split/\s+/) {
+	      if(not $ignored_vars{$_}) {
+	        print $_,\"\\n\";
+	      }
+            }
+	    '`"
+	export PARALLEL_IGNORED_NAMES
+	return 0
+    fi
+    if perl -e 'exit grep { /^--end.?session$/ } @ARGV' -- "$@"; then
+	true skip
+    else
+	# Pop off last ::: from PARALLEL_IGNORED_NAMES
+	# shellcheck disable=SC2006
+	PARALLEL_IGNORED_NAMES="`perl -e '
+          $ENV{PARALLEL_IGNORED_NAMES} =~ s/(.*):::.*?$/$1/s;
+	  print $ENV{PARALLEL_IGNORED_NAMES}
+        '`"
+	return 0
+    fi
+    # Grep alias names
+    # shellcheck disable=SC2006
+    _alias_NAMES="`_names_of_ALIASES | _remove_bad_NAMES | xargs echo`"
+    _list_alias_BODIES="_bodies_of_ALIASES $_alias_NAMES"
+    if [ "$_alias_NAMES" = "" ] ; then
+	# no aliases selected
+	_list_alias_BODIES="true"
+    fi
+    unset _alias_NAMES
+
+    # Grep function names
+    # shellcheck disable=SC2006
+    _function_NAMES="`_names_of_FUNCTIONS | _remove_bad_NAMES | xargs echo`"
+    _list_function_BODIES="_bodies_of_FUNCTIONS $_function_NAMES"
+    if [ "$_function_NAMES" = "" ] ; then
+	# no functions selected
+	_list_function_BODIES="true"
+    fi
+    unset _function_NAMES
+
+    # Grep variable names
+    # shellcheck disable=SC2006
+    _variable_NAMES="`_names_of_VARIABLES | _remove_bad_NAMES | xargs echo`"
+    _list_variable_VALUES="_bodies_of_VARIABLES $_variable_NAMES"
+    if [ "$_variable_NAMES" = "" ] ; then
+	# no variables selected
+	_list_variable_VALUES="true"
+    fi
+    unset _variable_NAMES
+
+    # shellcheck disable=SC2006
+    PARALLEL_ENV="`
+        $_list_alias_BODIES;
+        $_list_function_BODIES;
+        $_list_variable_VALUES;
+    `"
+    export PARALLEL_ENV
+    unset _list_alias_BODIES _list_variable_VALUES _list_function_BODIES
+    unset _bodies_of_ALIASES _bodies_of_VARIABLES _bodies_of_FUNCTIONS
+    unset _names_of_ALIASES _names_of_VARIABLES _names_of_FUNCTIONS
+    unset _ignore_HARDCODED _ignore_READONLY _ignore_UNDERSCORE
+    unset _remove_bad_NAMES _grep_REGEXP
+    unset _prefix_PARALLEL_ENV
+    # Test if environment is too big by running 'true'
+    # shellcheck disable=SC2006,SC2092
+    if `_which_PAR true` >/dev/null 2>/dev/null ; then
+	parallel "$@"
+	_parallel_exit_CODE=$?
+	# Clean up variables/functions
+	unset PARALLEL_ENV
+	unset _which_PAR _which_TRUE
+	unset _warning_PAR _error_PAR
+	# Unset _parallel_exit_CODE before return
+	eval "unset _parallel_exit_CODE; return $_parallel_exit_CODE"
+    else
+	unset PARALLEL_ENV;
+	_error_PAR "Your environment is too big."
+	_error_PAR "You can try 3 different approaches:"
+	_error_PAR "1. Run 'env_parallel --session' before you set"
+	_error_PAR "   variables or define functions."
+	_error_PAR "2. Use --env and only mention the names to copy."
+	_error_PAR "3. Try running this in a clean environment once:"
+	_error_PAR "     env_parallel --record-env"
+	_error_PAR "   And then use '--env _'"
+	_error_PAR "For details see: man env_parallel"
+	return 255
+    fi
+}
+
+parset() {
+    _parset_PARALLEL_PRG=parallel
+    _parset_main "$@"
+}
+
+env_parset() {
+    _parset_PARALLEL_PRG=env_parallel
+    _parset_main "$@"
+}
+
+_parset_main() {
+    # If $1 contains ',' or space:
+    #   Split on , to get the destination variable names
+    # If $1 is a single destination variable name:
+    #   Treat it as the name of an array
+    #
+    #   # Create array named myvar
+    #   parset myvar echo ::: {1..10}
+    #   echo ${myvar[5]}
+    #
+    #   # Put output into $var_a $var_b $var_c
+    #   varnames=(var_a var_b var_c)
+    #   parset "${varnames[*]}" echo ::: {1..3}
+    #   echo $var_c
+    #
+    #   # Put output into $var_a4 $var_b4 $var_c4
+    #   parset "var_a4 var_b4 var_c4" echo ::: {1..3}
+    #   echo $var_c4
+
+    _parset_NAME="$1"
+    if [ "$_parset_NAME" = "" ] ; then
+	echo parset: Error: No destination variable given. >&2
+	echo parset: Error: Try: >&2
+	echo parset: Error: ' ' parset myarray echo ::: foo bar >&2
+	return 255
+    fi
+    if [ "$_parset_NAME" = "--help" ] ; then
+	echo parset: Error: Usage: >&2
+	echo parset: Error: ' ' parset varname GNU Parallel options and command >&2
+	echo
+	parallel --help
+	return 255
+    fi
+    if [ "$_parset_NAME" = "--version" ] ; then
+	# shellcheck disable=SC2006
+	echo "parset 20221122 (GNU parallel `parallel --minversion 1`)"
+	echo "Copyright (C) 2007-2022 Ole Tange, http://ole.tange.dk and Free Software"
+	echo "Foundation, Inc."
+	echo "License GPLv3+: GNU GPL version 3 or later <https://gnu.org/licenses/gpl.html>"
+	echo "This is free software: you are free to change and redistribute it."
+	echo "GNU parallel comes with no warranty."
+	echo
+	echo "Web site: https://www.gnu.org/software/parallel"
+	echo
+	echo "When using programs that use GNU Parallel to process data for publication"
+	echo "please cite as described in 'parallel --citation'."
+	echo
+	return 255
+    fi
+    shift
+
+    # Bash: declare -A myassoc=( )
+    # Zsh: typeset -A myassoc=( )
+    # Ksh: typeset -A myassoc=( )
+    # shellcheck disable=SC2039,SC2169
+    if (typeset -p "$_parset_NAME" 2>/dev/null; echo) |
+	    perl -ne 'exit not (/^declare[^=]+-A|^typeset[^=]+-A/)' ; then
+	# This is an associative array
+	# shellcheck disable=SC2006
+	eval "`$_parset_PARALLEL_PRG -k --_parset assoc,"$_parset_NAME" "$@"`"
+	# The eval returns the function!
+    else
+	# This is a normal array or a list of variable names
+	# shellcheck disable=SC2006
+	eval "`$_parset_PARALLEL_PRG -k --_parset var,"$_parset_NAME" "$@"`"
+	# The eval returns the function!
+    fi
+}
diff --git a/src/env_parallel.bash b/src/env_parallel.bash
new file mode 100755
index 0000000..1165a60
--- /dev/null
+++ b/src/env_parallel.bash
@@ -0,0 +1,432 @@
+#!/usr/bin/env bash
+
+# This file must be sourced in bash:
+#
+#   source `which env_parallel.bash`
+#
+# after which 'env_parallel' works
+#
+#
+# Copyright (C) 2016-2022 Ole Tange, http://ole.tange.dk and Free
+# Software Foundation, Inc.
+#
+# This program is free software; you can redistribute it and/or modify
+# it under the terms of the GNU General Public License as published by
+# the Free Software Foundation; either version 3 of the License, or
+# (at your option) any later version.
+#
+# This program is distributed in the hope that it will be useful, but
+# WITHOUT ANY WARRANTY; without even the implied warranty of
+# MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the GNU
+# General Public License for more details.
+#
+# You should have received a copy of the GNU General Public License
+# along with this program; if not, see <http://www.gnu.org/licenses/>
+# or write to the Free Software Foundation, Inc., 51 Franklin St,
+# Fifth Floor, Boston, MA 02110-1301 USA
+#
+# SPDX-FileCopyrightText: 2021-2022 Ole Tange, http://ole.tange.dk and Free Software and Foundation, Inc.
+# SPDX-License-Identifier: GPL-3.0-or-later
+# shellcheck disable=SC2006
+
+env_parallel() {
+    # env_parallel.bash
+
+    _names_of_ALIASES() {
+	# No aliases will return false. This error should be ignored.
+	compgen -a || true
+    }
+    _bodies_of_ALIASES() {
+	local _i
+	for _i in "$@"; do
+	    # shellcheck disable=SC2046
+	    if [ $(alias "$_i" | wc -l) == 1 ] ; then
+		true Alias is a single line. Good.
+	    else
+		_warning_PAR "Alias '$_i' contains newline."
+		_warning_PAR "Make sure the command has at least one newline after '$_i'."
+		_warning_PAR "See BUGS in 'man env_parallel'."
+	    fi
+	done
+	alias "$@"
+    }
+    _names_of_FUNCTIONS() {
+	compgen -A function
+    }
+    _bodies_of_FUNCTIONS() {
+	typeset -f "$@"
+    }
+    _names_of_VARIABLES() {
+	compgen -A variable
+    }
+    _bodies_of_VARIABLES() {
+	typeset -p "$@"
+    }
+    _ignore_HARDCODED() {
+	# Copying $RANDOM will cause it not to be random
+	# The rest cannot be detected as read-only
+	echo '(RANDOM|_|TIMEOUT|GROUPS|FUNCNAME|DIRSTACK|PIPESTATUS|USERNAME|BASHPID|BASH_[A-Z_]+)'
+    }
+    _ignore_READONLY() {
+	# shellcheck disable=SC1078,SC1079,SC2026
+	readonly | perl -e '@r = map {
+                chomp;
+                # sh on UnixWare: readonly TIMEOUT
+	        # ash: readonly var='val'
+	        # ksh: var='val'
+		# mksh: PIPESTATUS[0]
+                s/^(readonly )?([^=\[ ]*?)(\[\d+\])?(=.*|)$/$2/ or
+	        # bash: declare -ar BASH_VERSINFO=([0]="4" [1]="4")
+	        # zsh: typeset -r var='val'
+                  s/^\S+\s+\S+\s+(\S[^=]*)(=.*|$)/$1/;
+                $_ } <>;
+            $vars = join "|",map { quotemeta $_ } @r;
+            print $vars ? "($vars)" : "(,,nO,,VaRs,,)";
+            '
+    }
+    _remove_bad_NAMES() {
+	# Do not transfer vars and funcs from env_parallel
+	# shellcheck disable=SC2006
+	_ignore_RO="`_ignore_READONLY`"
+	# shellcheck disable=SC2006
+	_ignore_HARD="`_ignore_HARDCODED`"
+	# Macos-grep does not like long patterns
+	# Old Solaris grep does not support -E
+	# Perl Version of:
+	# grep -Ev '^(...)$' |
+	perl -ne '/^(
+		     PARALLEL_ENV|
+		     PARALLEL_TMP|
+		     _alias_NAMES|
+		     _bodies_of_ALIASES|
+		     _bodies_of_FUNCTIONS|
+		     _bodies_of_VARIABLES|
+		     _error_PAR|
+		     _function_NAMES|
+		     _get_ignored_VARS|
+		     _grep_REGEXP|
+		     _ignore_HARD|
+		     _ignore_HARDCODED|
+		     _ignore_READONLY|
+		     _ignore_RO|
+		     _ignore_UNDERSCORE|
+		     _list_alias_BODIES|
+		     _list_function_BODIES|
+		     _list_variable_VALUES|
+		     _make_grep_REGEXP|
+		     _names_of_ALIASES|
+		     _names_of_FUNCTIONS|
+		     _names_of_VARIABLES|
+		     _names_of_maybe_FUNCTIONS|
+		     _parallel_exit_CODE|
+		     _prefix_PARALLEL_ENV|
+		     _prefix_PARALLEL_ENV|
+		     _remove_bad_NAMES|
+		     _remove_readonly|
+		     _variable_NAMES|
+		     _warning_PAR|
+		     _which_PAR)$/x and next;
+	    # Filter names matching --env
+	    /^'"$_grep_REGEXP"'$/ or next;
+            /^'"$_ignore_UNDERSCORE"'$/ and next;
+	    # Remove readonly variables
+            /^'"$_ignore_RO"'$/ and next;
+            /^'"$_ignore_HARD"'$/ and next;
+            print;'
+    }
+    _prefix_PARALLEL_ENV() {
+        shopt 2>/dev/null |
+        perl -pe 's:\s+off:;: and s/^/shopt -u /;
+                  s:\s+on:;: and s/^/shopt -s /;
+                  s:;$:&>/dev/null;:';
+        echo 'shopt -s expand_aliases &>/dev/null';
+    }
+
+    _get_ignored_VARS() {
+        perl -e '
+            for(@ARGV){
+                $next_is_env and push @envvar, split/,/, $_;
+                $next_is_env=/^--env$/;
+            }
+            if(grep { /^_$/ } @envvar) {
+                if(not open(IN, "<", "$ENV{HOME}/.parallel/ignored_vars")) {
+             	    print STDERR "parallel: Error: ",
+            	    "Run \"parallel --record-env\" in a clean environment first.\n";
+                } else {
+            	    chomp(@ignored_vars = <IN>);
+                }
+            }
+            if($ENV{PARALLEL_IGNORED_NAMES}) {
+                push @ignored_vars, split/\s+/, $ENV{PARALLEL_IGNORED_NAMES};
+                chomp @ignored_vars;
+            }
+            $vars = join "|",map { quotemeta $_ } @ignored_vars;
+	    print $vars ? "($vars)" : "(,,nO,,VaRs,,)";
+            ' -- "$@"
+    }
+
+    # Get the --env variables if set
+    # --env _ should be ignored
+    # and convert  a b c  to (a|b|c)
+    # If --env not set: Match everything (.*)
+    _make_grep_REGEXP() {
+        perl -e '
+            for(@ARGV){
+                /^_$/ and $next_is_env = 0;
+                $next_is_env and push @envvar, split/,/, $_;
+                $next_is_env = /^--env$/;
+            }
+            $vars = join "|",map { quotemeta $_ } @envvar;
+            print $vars ? "($vars)" : "(.*)";
+            ' -- "$@"
+    }
+    _which_PAR() {
+	# type returns:
+	#   ll is an alias for ls -l (in ash)
+	#   bash is a tracked alias for /bin/bash
+	#   true is a shell builtin (in bash)
+	#   myfunc is a function (in bash)
+	#   myfunc is a shell function (in zsh)
+	#   which is /usr/bin/which (in sh, bash)
+	#   which is hashed (/usr/bin/which)
+	#   gi is aliased to `grep -i' (in bash)
+	#   aliased to `alias | /usr/bin/which --tty-only --read-alias --show-dot --show-tilde'
+	# Return 0 if found, 1 otherwise
+	LANG=C type "$@" |
+	    perl -pe '$exit += (s/ is an alias for .*// ||
+	                        s/ is aliased to .*// ||
+                                s/ is a function// ||
+                                s/ is a shell function// ||
+                                s/ is a shell builtin// ||
+                                s/.* is hashed .(\S+).$/$1/ ||
+                                s/.* is (a tracked alias for )?//);
+                      END { exit not $exit }'
+    }
+    _warning_PAR() {
+	echo "env_parallel: Warning: $*" >&2
+    }
+    _error_PAR() {
+	echo "env_parallel: Error: $*" >&2
+    }
+
+    # Bash is broken in version 3.2.25 and 4.2.39
+    # The crazy '[ "`...`" == "" ]' is needed for the same reason
+    if [ "`_which_PAR parallel`" == "" ]; then
+	# shellcheck disable=SC2016
+	_error_PAR 'parallel must be in $PATH.'
+	return 255
+    fi
+
+    # Grep regexp for vars given by --env
+    # shellcheck disable=SC2006
+    _grep_REGEXP="`_make_grep_REGEXP \"$@\"`"
+    unset _make_grep_REGEXP
+
+    # Deal with --env _
+    # shellcheck disable=SC2006
+    _ignore_UNDERSCORE="`_get_ignored_VARS \"$@\"`"
+    unset _get_ignored_VARS
+
+    # --record-env
+    # Bash is broken in version 3.2.25 and 4.2.39
+    # The crazy '[ "`...`" == 0 ]' is needed for the same reason
+    if [ "`perl -e 'exit grep { /^--record-env$/ } @ARGV' -- "$@"; echo $?`" == 0 ] ; then
+	true skip
+    else
+	(_names_of_ALIASES;
+	 _names_of_FUNCTIONS;
+	 _names_of_VARIABLES) |
+	    cat > "$HOME"/.parallel/ignored_vars
+	return 0
+    fi
+
+    # --session
+    # Bash is broken in version 3.2.25 and 4.2.39
+    # The crazy '[ "`...`" == 0 ]' is needed for the same reason
+    if [ "`perl -e 'exit grep { /^--session$/ } @ARGV' -- "$@"; echo $?`" == 0 ] ; then
+	true skip
+    else
+	# Insert ::: between each level of session
+	# so you can pop off the last ::: at --end-session
+	# shellcheck disable=SC2006
+	PARALLEL_IGNORED_NAMES="`echo \"$PARALLEL_IGNORED_NAMES\";
+          echo :::;
+          (_names_of_ALIASES;
+	   _names_of_FUNCTIONS;
+	   _names_of_VARIABLES) | perl -ne '
+	    BEGIN{
+	      map { $ignored_vars{$_}++ }
+                split/\s+/, $ENV{PARALLEL_IGNORED_NAMES};
+	    }
+	    chomp;
+	    for(split/\s+/) {
+	      if(not $ignored_vars{$_}) {
+	        print $_,\"\\n\";
+	      }
+            }
+	    '`"
+	export PARALLEL_IGNORED_NAMES
+	return 0
+    fi
+    # Bash is broken in version 3.2.25 and 4.2.39
+    # The crazy '[ "`...`" == 0 ]' is needed for the same reason
+    if [ "`perl -e 'exit grep { /^--end.?session$/ } @ARGV' -- "$@"; echo $?`" == 0 ] ; then
+	true skip
+    else
+	# Pop off last ::: from PARALLEL_IGNORED_NAMES
+	# shellcheck disable=SC2006
+	PARALLEL_IGNORED_NAMES="`perl -e '
+          $ENV{PARALLEL_IGNORED_NAMES} =~ s/(.*):::.*?$/$1/s;
+	  print $ENV{PARALLEL_IGNORED_NAMES}
+        '`"
+	return 0
+    fi
+    # Grep alias names
+    # shellcheck disable=SC2006
+    _alias_NAMES="`_names_of_ALIASES | _remove_bad_NAMES | xargs echo`"
+    _list_alias_BODIES="_bodies_of_ALIASES $_alias_NAMES"
+    if [ "$_alias_NAMES" = "" ] ; then
+	# no aliases selected
+	_list_alias_BODIES="true"
+    fi
+    unset _alias_NAMES
+
+    # Grep function names
+    # shellcheck disable=SC2006
+    _function_NAMES="`_names_of_FUNCTIONS | _remove_bad_NAMES | xargs echo`"
+    _list_function_BODIES="_bodies_of_FUNCTIONS $_function_NAMES"
+    if [ "$_function_NAMES" = "" ] ; then
+	# no functions selected
+	_list_function_BODIES="true"
+    fi
+    unset _function_NAMES
+
+    # Grep variable names
+    # shellcheck disable=SC2006
+    _variable_NAMES="`_names_of_VARIABLES | _remove_bad_NAMES | xargs echo`"
+    _list_variable_VALUES="_bodies_of_VARIABLES $_variable_NAMES"
+    if [ "$_variable_NAMES" = "" ] ; then
+	# no variables selected
+	_list_variable_VALUES="true"
+    fi
+    unset _variable_NAMES
+
+    _which_TRUE="`_which_PAR true`"
+    # Copy shopt (so e.g. extended globbing works)
+    # But force expand_aliases as aliases otherwise do not work
+    PARALLEL_ENV="`
+        _prefix_PARALLEL_ENV
+        $_list_alias_BODIES;
+        $_list_function_BODIES;
+        $_list_variable_VALUES;
+    `"
+    export PARALLEL_ENV
+    unset _list_alias_BODIES _list_variable_VALUES _list_function_BODIES
+    unset _bodies_of_ALIASES _bodies_of_VARIABLES _bodies_of_FUNCTIONS
+    unset _names_of_ALIASES _names_of_VARIABLES _names_of_FUNCTIONS
+    unset _ignore_HARDCODED _ignore_READONLY _ignore_UNDERSCORE
+    unset _remove_bad_NAMES _grep_REGEXP
+    unset _prefix_PARALLEL_ENV
+    # Test if environment is too big
+    if [ "`_which_PAR true`" == "$_which_TRUE" ] ; then
+	parallel "$@"
+	_parallel_exit_CODE=$?
+	# Clean up variables/functions
+	unset PARALLEL_ENV
+	unset _which_PAR _which_TRUE
+	unset _warning_PAR _error_PAR
+	# Unset _parallel_exit_CODE before return
+	eval "unset _parallel_exit_CODE; return $_parallel_exit_CODE"
+    else
+	unset PARALLEL_ENV;
+	_error_PAR "Your environment is too big."
+	_error_PAR "You can try 3 different approaches:"
+	_error_PAR "1. Run 'env_parallel --session' before you set"
+	_error_PAR "   variables or define functions."
+	_error_PAR "2. Use --env and only mention the names to copy."
+	_error_PAR "3. Try running this in a clean environment once:"
+	_error_PAR "     env_parallel --record-env"
+	_error_PAR "   And then use '--env _'"
+	_error_PAR "For details see: man env_parallel"
+	return 255
+    fi
+}
+
+parset() {
+    _parset_PARALLEL_PRG=parallel
+    _parset_main "$@"
+}
+
+env_parset() {
+    _parset_PARALLEL_PRG=env_parallel
+    _parset_main "$@"
+}
+
+_parset_main() {
+    # If $1 contains ',' or space:
+    #   Split on , to get the destination variable names
+    # If $1 is a single destination variable name:
+    #   Treat it as the name of an array
+    #
+    #   # Create array named myvar
+    #   parset myvar echo ::: {1..10}
+    #   echo ${myvar[5]}
+    #
+    #   # Put output into $var_a $var_b $var_c
+    #   varnames=(var_a var_b var_c)
+    #   parset "${varnames[*]}" echo ::: {1..3}
+    #   echo $var_c
+    #
+    #   # Put output into $var_a4 $var_b4 $var_c4
+    #   parset "var_a4 var_b4 var_c4" echo ::: {1..3}
+    #   echo $var_c4
+
+    _parset_NAME="$1"
+    if [ "$_parset_NAME" = "" ] ; then
+	echo parset: Error: No destination variable given. >&2
+	echo parset: Error: Try: >&2
+	echo parset: Error: ' ' parset myarray echo ::: foo bar >&2
+	return 255
+    fi
+    if [ "$_parset_NAME" = "--help" ] ; then
+	echo parset: Error: Usage: >&2
+	echo parset: Error: ' ' parset varname GNU Parallel options and command >&2
+	echo
+	parallel --help
+	return 255
+    fi
+    if [ "$_parset_NAME" = "--version" ] ; then
+	# shellcheck disable=SC2006
+	echo "parset 20221122 (GNU parallel `parallel --minversion 1`)"
+	echo "Copyright (C) 2007-2022 Ole Tange, http://ole.tange.dk and Free Software"
+	echo "Foundation, Inc."
+	echo "License GPLv3+: GNU GPL version 3 or later <https://gnu.org/licenses/gpl.html>"
+	echo "This is free software: you are free to change and redistribute it."
+	echo "GNU parallel comes with no warranty."
+	echo
+	echo "Web site: https://www.gnu.org/software/parallel"
+	echo
+	echo "When using programs that use GNU Parallel to process data for publication"
+	echo "please cite as described in 'parallel --citation'."
+	echo
+	return 255
+    fi
+    shift
+
+    # Bash: declare -A myassoc=( )
+    # Zsh: typeset -A myassoc=( )
+    # Ksh: typeset -A myassoc=( )
+    # shellcheck disable=SC2039,SC2169
+    if (typeset -p "$_parset_NAME" 2>/dev/null; echo) |
+	    perl -ne 'exit not (/^declare[^=]+-A|^typeset[^=]+-A/)' ; then
+	# This is an associative array
+	# shellcheck disable=SC2006
+	eval "`$_parset_PARALLEL_PRG -k --_parset assoc,"$_parset_NAME" "$@"`"
+	# The eval returns the function!
+    else
+	# This is a normal array or a list of variable names
+	# shellcheck disable=SC2006
+	eval "`$_parset_PARALLEL_PRG -k --_parset var,"$_parset_NAME" "$@"`"
+	# The eval returns the function!
+    fi
+}
diff --git a/src/env_parallel.csh b/src/env_parallel.csh
new file mode 100755
index 0000000..b36e4be
--- /dev/null
+++ b/src/env_parallel.csh
@@ -0,0 +1,142 @@
+#!/usr/bin/env csh
+
+# This file must be sourced in csh:
+#
+#   source `which env_parallel.csh`
+#
+# after which 'env_parallel' works
+#
+#
+# Copyright (C) 2016-2022 Ole Tange, http://ole.tange.dk and Free
+# Software Foundation, Inc.
+#
+# This program is free software; you can redistribute it and/or modify
+# it under the terms of the GNU General Public License as published by
+# the Free Software Foundation; either version 3 of the License, or
+# (at your option) any later version.
+#
+# This program is distributed in the hope that it will be useful, but
+# WITHOUT ANY WARRANTY; without even the implied warranty of
+# MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the GNU
+# General Public License for more details.
+#
+# You should have received a copy of the GNU General Public License
+# along with this program; if not, see <http://www.gnu.org/licenses/>
+# or write to the Free Software Foundation, Inc., 51 Franklin St,
+# Fifth Floor, Boston, MA 02110-1301 USA
+#
+# SPDX-FileCopyrightText: 2021-2022 Ole Tange, http://ole.tange.dk and Free Software and Foundation, Inc.
+# SPDX-License-Identifier: GPL-3.0-or-later
+
+set _parallel_exit_CODE=0
+if ("`alias env_parallel`" == '' || ! $?PARALLEL_CSH) then
+  # Activate alias
+  alias env_parallel '(setenv PARALLEL_CSH "\!*"; source `which env_parallel.csh`)'
+else
+  # Get the --env variables if set
+  # --env _ should be ignored
+  # and convert  a b c  to (a|b|c)
+  # If --env not set: Match everything (.*)
+
+  # simple 'tempfile': Return nonexisting filename: /tmp/parXXXXX
+  alias _tempfile 'perl -e do\{\$t\=\"/tmp/par\".join\"\",map\{\(0..9,\"a\"..\"z\",\"A\"..\"Z\"\)\[rand\(62\)\]\}\(1..5\)\;\}while\(-e\$t\)\;print\"\$t\\n\"'
+  set _tMpscRIpt=`_tempfile`
+
+  cat <<'EOF' > $_tMpscRIpt
+            #!/usr/bin/perl
+
+            for(@ARGV){
+                /^_$/ and $next_is_env = 0;
+                $next_is_env and push @envvar, split/,/, $_;
+                $next_is_env = /^--env$/;
+            }
+            $vars = join "|",map { quotemeta $_ } @envvar;
+            print $vars ? "($vars)" : "(.*)";
+'EOF'
+  set _grep_REGEXP="`perl $_tMpscRIpt -- $PARALLEL_CSH`"
+
+  # Deal with --env _
+  cat <<'EOF' > $_tMpscRIpt
+            #!/usr/bin/perl
+
+            for(@ARGV){
+                $next_is_env and push @envvar, split/,/, $_;
+                $next_is_env=/^--env$/;
+            }
+            if(grep { /^_$/ } @envvar) {
+                if(not open(IN, "<", "$ENV{HOME}/.parallel/ignored_vars")) {
+             	    print STDERR "parallel: Error: ",
+            	    "Run \"parallel --record-env\" in a clean environment first.\n";
+                } else {
+            	    chomp(@ignored_vars = <IN>);
+            	    $vars = join "|",map { quotemeta $_ } @ignored_vars;
+		    print $vars ? "($vars)" : "(,,nO,,VaRs,,)";
+                }
+            }
+'EOF'
+  set _ignore_UNDERSCORE="`perl $_tMpscRIpt -- $PARALLEL_CSH`"
+  rm $_tMpscRIpt
+
+  # Get the scalar and array variable names
+  set _vARnAmES=(`set | perl -ne 's/\s.*//; /^(#|_|killring|prompt2|command|PARALLEL_ENV|PARALLEL_TMP)$/ and next; /^'"$_grep_REGEXP"'$/ or next; /^'"$_ignore_UNDERSCORE"'$/ and next; print'`)
+
+  # Make a tmpfile for the variable definitions
+  set _tMpvARfILe=`_tempfile`
+  touch $_tMpvARfILe
+  # Make a tmpfile for the variable definitions + alias
+  set _tMpaLLfILe=`_tempfile`
+  foreach _vARnAmE ($_vARnAmES);
+    # These 3 lines break in csh ver. 20110502-3
+    # if not defined: next
+    eval if'(! $?'$_vARnAmE') continue'
+    # if $#myvar <= 1 echo scalar_myvar=$var
+    eval if'(${#'$_vARnAmE'} <= 1) echo scalar_'$_vARnAmE'='\"\$$_vARnAmE\" >> $_tMpvARfILe;
+    # if $#myvar > 1 echo array_myvar=$var
+    eval if'(${#'$_vARnAmE'} > 1) echo array_'$_vARnAmE'="$'$_vARnAmE'"' >> $_tMpvARfILe;
+  end
+  unset _vARnAmE _vARnAmES
+  # shell quote variables (--plain needed due to ignore if $PARALLEL is set)
+  # Convert 'scalar_myvar=...' to 'set myvar=...'
+  # Convert 'array_myvar=...' to 'set array=(...)'
+  cat $_tMpvARfILe | parallel --plain --shellquote |  perl -pe 's/^scalar_(\S+).=/set $1=/ or s/^array_(\S+).=(.*)/set $1=($2)/ && s/\\ / /g;' > $_tMpaLLfILe
+  # Cleanup
+  rm $_tMpvARfILe; unset _tMpvARfILe
+
+# ALIAS TO EXPORT ALIASES:
+
+#   Quote ' by putting it inside "
+#   s/'/'"'"'/g;
+#   ' => \047 " => \042
+#   s/\047/\047\042\047\042\047/g;
+#   Quoted: s/\\047/\\047\\042\\047\\042\\047/g\;
+
+#   Remove () from second column
+#   s/^(\S+)(\s+)\((.*)\)/\1\2\3/;
+#   Quoted: s/\^\(\\S+\)\(\\s+\)\\\(\(.\*\)\\\)/\\1\\2\\3/\;
+
+#   Add ' around second column
+#   s/^(\S+)(\s+)(.*)/\1\2'\3'/
+#   \047 => '
+#   s/^(\S+)(\s+)(.*)/\1\2\047\3\047/;
+#   Quoted: s/\^\(\\S+\)\(\\s+\)\(.\*\)/\\1\\2\\047\\3\\047/\;
+
+#   Quote ! as \!
+#   s/\!/\\\!/g;
+#   Quoted: s/\\\!/\\\\\\\!/g;
+
+#   Prepend with "\nalias "
+#   s/^/\001alias /;
+#   Quoted: s/\^/\\001alias\ /\;
+  alias | \
+    perl -ne '/^'"$_grep_REGEXP"'/ or next; /^'"$_ignore_UNDERSCORE"'[^_a-zA-Z]/ and next; print' | \
+    perl -pe s/\\047/\\047\\042\\047\\042\\047/g\;s/\^\(\\S+\)\(\\s+\)\\\(\(.\*\)\\\)/\\1\\2\\3/\;s/\^\(\\S+\)\(\\s+\)\(.\*\)/\\1\\2\\047\\3\\047/\;s/\^/\\001alias\ /\;s/\\\!/\\\\\\\!/g >> $_tMpaLLfILe
+
+  setenv PARALLEL_ENV "`cat $_tMpaLLfILe; rm $_tMpaLLfILe`";
+  unset _tMpaLLfILe;
+  # Use $PARALLEL_CSH set in calling alias
+  parallel
+  set _parallel_exit_CODE=$status
+  setenv PARALLEL_ENV
+  setenv PARALLEL_CSH
+endif
+(exit $_parallel_exit_CODE)
diff --git a/src/env_parallel.dash b/src/env_parallel.dash
new file mode 100755
index 0000000..e73991d
--- /dev/null
+++ b/src/env_parallel.dash
@@ -0,0 +1,430 @@
+#!/usr/bin/env dash
+
+# This file must be sourced in dash:
+#
+#   . `which env_parallel.dash`
+#
+# after which 'env_parallel' works
+#
+#
+# Copyright (C) 2016-2022 Ole Tange, http://ole.tange.dk and Free
+# Software Foundation, Inc.
+#
+# This program is free software; you can redistribute it and/or modify
+# it under the terms of the GNU General Public License as published by
+# the Free Software Foundation; either version 3 of the License, or
+# (at your option) any later version.
+#
+# This program is distributed in the hope that it will be useful, but
+# WITHOUT ANY WARRANTY; without even the implied warranty of
+# MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the GNU
+# General Public License for more details.
+#
+# You should have received a copy of the GNU General Public License
+# along with this program; if not, see <http://www.gnu.org/licenses/>
+# or write to the Free Software Foundation, Inc., 51 Franklin St,
+# Fifth Floor, Boston, MA 02110-1301 USA
+#
+# SPDX-FileCopyrightText: 2021-2022 Ole Tange, http://ole.tange.dk and Free Software and Foundation, Inc.
+# SPDX-License-Identifier: GPL-3.0-or-later
+# shellcheck disable=SC2006
+
+env_parallel() {
+    # based on env_parallel.sh
+
+    _names_of_ALIASES() {
+	# alias fails on Unixware 5
+	for _i in `alias 2>/dev/null | perl -ne 's/^alias //;s/^(\S+)=.*/$1/ && print' 2>/dev/null`; do
+	    # Check if this name really is an alias
+	    # or just part of a multiline alias definition
+	    if alias "$_i" >/dev/null 2>/dev/null; then
+		echo "$_i"
+	    fi
+	done
+    }
+    _bodies_of_ALIASES() {
+	# alias may return:
+	#   myalias='definition' (GNU/Linux ash)
+	#   alias myalias='definition' (FreeBSD ash)
+	# so remove 'alias ' from first line
+	for _i in "$@"; do
+		echo 'alias '"`alias "$_i" | perl -pe '1..1 and s/^alias //'`"
+	done
+    }
+    _names_of_maybe_FUNCTIONS() {
+	set | perl -ne '/^([A-Z_0-9]+)\s*\(\)\s*\{?$/i and print "$1\n"'
+    }
+    _names_of_FUNCTIONS() {
+	# myfunc is a function
+	# shellcheck disable=SC2046
+	LANG=C type `_names_of_maybe_FUNCTIONS` |
+	    perl -ne '/^(\S+) is a function$/ and not $seen{$1}++ and print "$1\n"'
+    }
+    _bodies_of_FUNCTIONS() {
+	LANG=C type "$@" | perl -ne '/^(\S+) is a function$/ or print'
+    }
+    _names_of_VARIABLES() {
+	# This may screw up if variables contain \n and =
+	set | perl -ne 's/^(\S+?)=.*/$1/ and print;'
+    }
+    _bodies_of_VARIABLES() {
+	# Crappy typeset -p
+	for _i in "$@"
+	do
+	    perl -e 'print @ARGV' "$_i="
+	    eval echo "\"\$$_i\"" | perl -e '$/=undef; $a=<>; chop($a); print $a' |
+		perl -pe 's/[\002-\011\013-\032\\\#\?\`\(\)\{\}\[\]\^\*\<\=\>\~\|\; \"\!\$\&\202-\377]/\\$&/go;'"s/'/\\\'/g; s/[\n]/'\\n'/go;";
+	    echo
+	done
+    }
+    _ignore_HARDCODED() {
+	# These names cannot be detected
+	echo '(_|TIMEOUT|IFS)'
+    }
+    _ignore_READONLY() {
+	# shellcheck disable=SC1078,SC1079,SC2026
+	readonly | perl -e '@r = map {
+                chomp;
+                # sh on UnixWare: readonly TIMEOUT
+	        # ash: readonly var='val'
+	        # ksh: var='val'
+		# mksh: PIPESTATUS[0]
+                s/^(readonly )?([^=\[ ]*?)(\[\d+\])?(=.*|)$/$2/ or
+	        # bash: declare -ar BASH_VERSINFO=([0]="4" [1]="4")
+	        # zsh: typeset -r var='val'
+                  s/^\S+\s+\S+\s+(\S[^=]*)(=.*|$)/$1/;
+                $_ } <>;
+            $vars = join "|",map { quotemeta $_ } @r;
+            print $vars ? "($vars)" : "(,,nO,,VaRs,,)";
+            '
+    }
+    _remove_bad_NAMES() {
+	# Do not transfer vars and funcs from env_parallel
+	# shellcheck disable=SC2006
+	_ignore_RO="`_ignore_READONLY`"
+	# shellcheck disable=SC2006
+	_ignore_HARD="`_ignore_HARDCODED`"
+	# Macos-grep does not like long patterns
+	# Old Solaris grep does not support -E
+	# Perl Version of:
+	# grep -Ev '^(...)$' |
+	perl -ne '/^(
+		     PARALLEL_ENV|
+		     PARALLEL_TMP|
+		     _alias_NAMES|
+		     _bodies_of_ALIASES|
+		     _bodies_of_FUNCTIONS|
+		     _bodies_of_VARIABLES|
+		     _error_PAR|
+		     _function_NAMES|
+		     _get_ignored_VARS|
+		     _grep_REGEXP|
+		     _ignore_HARD|
+		     _ignore_HARDCODED|
+		     _ignore_READONLY|
+		     _ignore_RO|
+		     _ignore_UNDERSCORE|
+		     _list_alias_BODIES|
+		     _list_function_BODIES|
+		     _list_variable_VALUES|
+		     _make_grep_REGEXP|
+		     _names_of_ALIASES|
+		     _names_of_FUNCTIONS|
+		     _names_of_VARIABLES|
+		     _names_of_maybe_FUNCTIONS|
+		     _parallel_exit_CODE|
+		     _prefix_PARALLEL_ENV|
+		     _prefix_PARALLEL_ENV|
+		     _remove_bad_NAMES|
+		     _remove_readonly|
+		     _variable_NAMES|
+		     _warning_PAR|
+		     _which_PAR)$/x and next;
+	    # Filter names matching --env
+	    /^'"$_grep_REGEXP"'$/ or next;
+            /^'"$_ignore_UNDERSCORE"'$/ and next;
+	    # Remove readonly variables
+            /^'"$_ignore_RO"'$/ and next;
+            /^'"$_ignore_HARD"'$/ and next;
+            print;'
+    }
+    _get_ignored_VARS() {
+        perl -e '
+            for(@ARGV){
+                $next_is_env and push @envvar, split/,/, $_;
+                $next_is_env=/^--env$/;
+            }
+            if(grep { /^_$/ } @envvar) {
+                if(not open(IN, "<", "$ENV{HOME}/.parallel/ignored_vars")) {
+             	    print STDERR "parallel: Error: ",
+            	    "Run \"parallel --record-env\" in a clean environment first.\n";
+                } else {
+            	    chomp(@ignored_vars = <IN>);
+                }
+            }
+            if($ENV{PARALLEL_IGNORED_NAMES}) {
+                push @ignored_vars, split/\s+/, $ENV{PARALLEL_IGNORED_NAMES};
+                chomp @ignored_vars;
+            }
+            $vars = join "|",map { quotemeta $_ } @ignored_vars;
+	    print $vars ? "($vars)" : "(,,nO,,VaRs,,)";
+            ' -- "$@"
+    }
+
+    # Get the --env variables if set
+    # --env _ should be ignored
+    # and convert  a b c  to (a|b|c)
+    # If --env not set: Match everything (.*)
+    _make_grep_REGEXP() {
+        perl -e '
+            for(@ARGV){
+                /^_$/ and $next_is_env = 0;
+                $next_is_env and push @envvar, split/,/, $_;
+                $next_is_env = /^--env$/;
+            }
+            $vars = join "|",map { quotemeta $_ } @envvar;
+            print $vars ? "($vars)" : "(.*)";
+            ' -- "$@"
+    }
+    _which_PAR() {
+	# type returns:
+	#   ll is an alias for ls -l (in ash)
+	#   bash is a tracked alias for /bin/bash
+	#   true is a shell builtin (in bash)
+	#   myfunc is a function (in bash)
+	#   myfunc is a shell function (in zsh)
+	#   which is /usr/bin/which (in sh, bash)
+	#   which is hashed (/usr/bin/which)
+	#   gi is aliased to `grep -i' (in bash)
+	#   aliased to `alias | /usr/bin/which --tty-only --read-alias --show-dot --show-tilde'
+	# Return 0 if found, 1 otherwise
+	LANG=C type "$@" |
+	    perl -pe '$exit += (s/ is an alias for .*// ||
+	                        s/ is aliased to .*// ||
+                                s/ is a function// ||
+                                s/ is a shell function// ||
+                                s/ is a shell builtin// ||
+                                s/.* is hashed .(\S+).$/$1/ ||
+                                s/.* is (a tracked alias for )?//);
+                      END { exit not $exit }'
+    }
+    _warning_PAR() {
+	echo "env_parallel: Warning: $*" >&2
+    }
+    _error_PAR() {
+	echo "env_parallel: Error: $*" >&2
+    }
+
+    if _which_PAR parallel >/dev/null; then
+	true parallel found in path
+    else
+	# shellcheck disable=SC2016
+	_error_PAR 'parallel must be in $PATH.'
+	return 255
+    fi
+
+    # Grep regexp for vars given by --env
+    # shellcheck disable=SC2006
+    _grep_REGEXP="`_make_grep_REGEXP \"$@\"`"
+    unset _make_grep_REGEXP
+
+    # Deal with --env _
+    # shellcheck disable=SC2006
+    _ignore_UNDERSCORE="`_get_ignored_VARS \"$@\"`"
+    unset _get_ignored_VARS
+
+    # --record-env
+    if perl -e 'exit grep { /^--record-env$/ } @ARGV' -- "$@"; then
+	true skip
+    else
+	(_names_of_ALIASES;
+	 _names_of_FUNCTIONS;
+	 _names_of_VARIABLES) |
+	    cat > "$HOME"/.parallel/ignored_vars
+	return 0
+    fi
+
+    # --session
+    if perl -e 'exit grep { /^--session$/ } @ARGV' -- "$@"; then
+	true skip
+    else
+	# Insert ::: between each level of session
+	# so you can pop off the last ::: at --end-session
+	# shellcheck disable=SC2006
+	PARALLEL_IGNORED_NAMES="`echo \"$PARALLEL_IGNORED_NAMES\";
+          echo :::;
+          (_names_of_ALIASES;
+	   _names_of_FUNCTIONS;
+	   _names_of_VARIABLES) | perl -ne '
+	    BEGIN{
+	      map { $ignored_vars{$_}++ }
+                split/\s+/, $ENV{PARALLEL_IGNORED_NAMES};
+	    }
+	    chomp;
+	    for(split/\s+/) {
+	      if(not $ignored_vars{$_}) {
+	        print $_,\"\\n\";
+	      }
+            }
+	    '`"
+	export PARALLEL_IGNORED_NAMES
+	return 0
+    fi
+    if perl -e 'exit grep { /^--end.?session$/ } @ARGV' -- "$@"; then
+	true skip
+    else
+	# Pop off last ::: from PARALLEL_IGNORED_NAMES
+	# shellcheck disable=SC2006
+	PARALLEL_IGNORED_NAMES="`perl -e '
+          $ENV{PARALLEL_IGNORED_NAMES} =~ s/(.*):::.*?$/$1/s;
+	  print $ENV{PARALLEL_IGNORED_NAMES}
+        '`"
+	return 0
+    fi
+    # Grep alias names
+    # shellcheck disable=SC2006
+    _alias_NAMES="`_names_of_ALIASES | _remove_bad_NAMES | xargs echo`"
+    _list_alias_BODIES="_bodies_of_ALIASES $_alias_NAMES"
+    if [ "$_alias_NAMES" = "" ] ; then
+	# no aliases selected
+	_list_alias_BODIES="true"
+    fi
+    unset _alias_NAMES
+
+    # Grep function names
+    # shellcheck disable=SC2006
+    _function_NAMES="`_names_of_FUNCTIONS | _remove_bad_NAMES | xargs echo`"
+    _list_function_BODIES="_bodies_of_FUNCTIONS $_function_NAMES"
+    if [ "$_function_NAMES" = "" ] ; then
+	# no functions selected
+	_list_function_BODIES="true"
+    fi
+    unset _function_NAMES
+
+    # Grep variable names
+    # shellcheck disable=SC2006
+    _variable_NAMES="`_names_of_VARIABLES | _remove_bad_NAMES | xargs echo`"
+    _list_variable_VALUES="_bodies_of_VARIABLES $_variable_NAMES"
+    if [ "$_variable_NAMES" = "" ] ; then
+	# no variables selected
+	_list_variable_VALUES="true"
+    fi
+    unset _variable_NAMES
+
+    # shellcheck disable=SC2006
+    PARALLEL_ENV="`
+        $_list_alias_BODIES;
+        $_list_function_BODIES;
+        $_list_variable_VALUES;
+    `"
+    export PARALLEL_ENV
+    unset _list_alias_BODIES _list_variable_VALUES _list_function_BODIES
+    unset _bodies_of_ALIASES _bodies_of_VARIABLES _bodies_of_FUNCTIONS
+    unset _names_of_ALIASES _names_of_VARIABLES _names_of_FUNCTIONS
+    unset _ignore_HARDCODED _ignore_READONLY _ignore_UNDERSCORE
+    unset _remove_bad_NAMES _grep_REGEXP
+    unset _prefix_PARALLEL_ENV
+    # Test if environment is too big by running 'true'
+    # shellcheck disable=SC2006,SC2092
+    if `_which_PAR true` >/dev/null 2>/dev/null ; then
+	parallel "$@"
+	_parallel_exit_CODE=$?
+	# Clean up variables/functions
+	unset PARALLEL_ENV
+	unset _which_PAR _which_TRUE
+	unset _warning_PAR _error_PAR
+	# Unset _parallel_exit_CODE before return
+	eval "unset _parallel_exit_CODE; return $_parallel_exit_CODE"
+    else
+	unset PARALLEL_ENV;
+	_error_PAR "Your environment is too big."
+	_error_PAR "You can try 3 different approaches:"
+	_error_PAR "1. Run 'env_parallel --session' before you set"
+	_error_PAR "   variables or define functions."
+	_error_PAR "2. Use --env and only mention the names to copy."
+	_error_PAR "3. Try running this in a clean environment once:"
+	_error_PAR "     env_parallel --record-env"
+	_error_PAR "   And then use '--env _'"
+	_error_PAR "For details see: man env_parallel"
+	return 255
+    fi
+}
+
+parset() {
+    _parset_PARALLEL_PRG=parallel
+    _parset_main "$@"
+}
+
+env_parset() {
+    _parset_PARALLEL_PRG=env_parallel
+    _parset_main "$@"
+}
+
+_parset_main() {
+    # If $1 contains ',' or space:
+    #   Split on , to get the destination variable names
+    # If $1 is a single destination variable name:
+    #   Treat it as the name of an array
+    #
+    #   # Create array named myvar
+    #   parset myvar echo ::: {1..10}
+    #   echo ${myvar[5]}
+    #
+    #   # Put output into $var_a $var_b $var_c
+    #   varnames=(var_a var_b var_c)
+    #   parset "${varnames[*]}" echo ::: {1..3}
+    #   echo $var_c
+    #
+    #   # Put output into $var_a4 $var_b4 $var_c4
+    #   parset "var_a4 var_b4 var_c4" echo ::: {1..3}
+    #   echo $var_c4
+
+    _parset_NAME="$1"
+    if [ "$_parset_NAME" = "" ] ; then
+	echo parset: Error: No destination variable given. >&2
+	echo parset: Error: Try: >&2
+	echo parset: Error: ' ' parset myarray echo ::: foo bar >&2
+	return 255
+    fi
+    if [ "$_parset_NAME" = "--help" ] ; then
+	echo parset: Error: Usage: >&2
+	echo parset: Error: ' ' parset varname GNU Parallel options and command >&2
+	echo
+	parallel --help
+	return 255
+    fi
+    if [ "$_parset_NAME" = "--version" ] ; then
+	# shellcheck disable=SC2006
+	echo "parset 20221122 (GNU parallel `parallel --minversion 1`)"
+	echo "Copyright (C) 2007-2022 Ole Tange, http://ole.tange.dk and Free Software"
+	echo "Foundation, Inc."
+	echo "License GPLv3+: GNU GPL version 3 or later <https://gnu.org/licenses/gpl.html>"
+	echo "This is free software: you are free to change and redistribute it."
+	echo "GNU parallel comes with no warranty."
+	echo
+	echo "Web site: https://www.gnu.org/software/parallel"
+	echo
+	echo "When using programs that use GNU Parallel to process data for publication"
+	echo "please cite as described in 'parallel --citation'."
+	echo
+	return 255
+    fi
+    shift
+
+    # Bash: declare -A myassoc=( )
+    # Zsh: typeset -A myassoc=( )
+    # Ksh: typeset -A myassoc=( )
+    # shellcheck disable=SC2039,SC2169
+    if (typeset -p "$_parset_NAME" 2>/dev/null; echo) |
+	    perl -ne 'exit not (/^declare[^=]+-A|^typeset[^=]+-A/)' ; then
+	# This is an associative array
+	# shellcheck disable=SC2006
+	eval "`$_parset_PARALLEL_PRG -k --_parset assoc,"$_parset_NAME" "$@"`"
+	# The eval returns the function!
+    else
+	# This is a normal array or a list of variable names
+	# shellcheck disable=SC2006
+	eval "`$_parset_PARALLEL_PRG -k --_parset var,"$_parset_NAME" "$@"`"
+	# The eval returns the function!
+    fi
+}
diff --git a/src/env_parallel.fish b/src/env_parallel.fish
new file mode 100755
index 0000000..f4568e7
--- /dev/null
+++ b/src/env_parallel.fish
@@ -0,0 +1,194 @@
+#!/usr/bin/env fish
+
+# This file must be sourced in fish:
+#
+#   . (which env_parallel.fish)
+#
+# after which 'env_parallel' works
+#
+#
+# Copyright (C) 2016-2022 Ole Tange, http://ole.tange.dk and Free
+# Software Foundation, Inc.
+#
+# This program is free software; you can redistribute it and/or modify
+# it under the terms of the GNU General Public License as published by
+# the Free Software Foundation; either version 3 of the License, or
+# (at your option) any later version.
+#
+# This program is distributed in the hope that it will be useful, but
+# WITHOUT ANY WARRANTY; without even the implied warranty of
+# MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the GNU
+# General Public License for more details.
+#
+# You should have received a copy of the GNU General Public License
+# along with this program; if not, see <http://www.gnu.org/licenses/>
+# or write to the Free Software Foundation, Inc., 51 Franklin St,
+# Fifth Floor, Boston, MA 02110-1301 USA
+#
+# SPDX-FileCopyrightText: 2021-2022 Ole Tange, http://ole.tange.dk and Free Software and Foundation, Inc.
+# SPDX-License-Identifier: GPL-3.0-or-later
+
+# If you are a fisherman feel free to improve the code
+#
+# The code needs to deal with variables like:
+#   set funky (perl -e 'print pack "c*", 2..254')
+#
+# Problem:
+#   Tell the difference between:
+#     set tmp "a'  'b'  'c"
+#     set tmparr1 "a'  'b"  'c'
+#     set tmparr2 'a'  "b'  'c"
+#   The output from `set` is exactly the same.
+# Solution:
+#   for-loop for each variable. Each value is separated with a
+#   separator.
+
+function env_parallel
+  # env_parallel.fish
+
+  # --session
+  perl -e 'exit grep { /^--session/ } @ARGV' -- $argv; or begin;
+    setenv PARALLEL_IGNORED_NAMES (
+        begin;
+	  functions -n
+	  set -n;
+	end | perl -pe 's/\n/,/g';
+    )
+    return 0
+  end;
+  setenv PARALLEL_ENV (
+    begin;
+      set _grep_REGEXP (
+        begin;
+          perl -e '
+	    for(@ARGV){
+                /^_$/ and $next_is_env = 0;
+                $next_is_env and push @envvar, split/,/, $_;
+                $next_is_env = /^--env$/;
+            }
+            $vars = join "|",map { quotemeta $_ } @envvar;
+            print $vars ? "($vars)" : "(.*)";
+            ' -- $argv;
+        end;
+      )
+      # Deal with --env _
+      set _ignore_UNDERSCORE (
+        begin;
+          perl -e '
+            for(@ARGV){
+                $next_is_env and push @envvar, split/,/, $_;
+                $next_is_env=/^--env$/;
+            }
+            if(grep { /^_$/ } @envvar) {
+                if(not open(IN, "<", "$ENV{HOME}/.parallel/ignored_vars")) {
+             	    print STDERR "parallel: Error: ",
+            	    "Run \"parallel --record-env\" in a clean environment first.\n";
+                } else {
+            	    chomp(@ignored_vars = <IN>);
+                }
+            }
+            if($ENV{PARALLEL_IGNORED_NAMES}) {
+                push @ignored_vars, split/,/, $ENV{PARALLEL_IGNORED_NAMES};
+                chomp @ignored_vars;
+            }
+            $vars = join "|",map { quotemeta $_ } @ignored_vars;
+	    print $vars ? "($vars)" : "(,,nO,,VaRs,,)";
+            ' -- $argv;
+        end;
+      )
+
+      # --record-env
+      perl -e 'exit grep { /^--record-env$/ } @ARGV' -- $argv; or begin;
+        begin;
+	  functions -n | perl -pe 's/,/\n/g';
+	  set -n;
+	end | cat > $HOME/.parallel/ignored_vars;
+      end;
+
+      # Export function definitions
+      # Keep the ones from --env
+      # Ignore the ones from ~/.parallel/ignored_vars
+      # Dump each function defition
+      # Replace \001 with \002 because \001 is used by env_parallel
+      # Convert \n to \001
+      functions -n | perl -pe 's/,/\n/g' | \
+        grep -Ev '^(PARALLEL_ENV|PARALLEL_TMP)$' | \
+        grep -E "^$_grep_REGEXP"\$ | grep -vE "^$_ignore_UNDERSCORE"\$ | \
+        while read d; functions $d; end | \
+        perl -pe 's/\001/\002/g and not $printed++ and print STDERR
+          "env_parallel: Warning: ASCII value 1 in functions is not supported\n";
+                  s/\n/\001/g';
+      # Convert scalar vars to fish \XX quoting
+      # Keep the ones from --env
+      # Ignore the ones from ~/.parallel/ignored_vars
+      # Ignore read only vars
+      # Execute 'set' of the content
+      eval (set -L | \
+        grep -Ev '^(PARALLEL_TMP)$' | \
+        grep -E "^$_grep_REGEXP " | grep -vE "^$_ignore_UNDERSCORE " | \
+        perl -ne 'chomp;
+          ($name,$val)=split(/ /,$_,2);
+          $name=~/^(HOME|USER|COLUMNS|FISH_VERSION|LINES|PWD|SHLVL|_|
+                    history|status|version)$|\./x and next;
+          if($val=~/^'"'"'/) { next; }
+          print "set $name \"\$$name\";\n";
+        ')
+      # Generate commands to set scalar variables
+      # Keep the ones from --env
+      # Ignore the ones from ~/.parallel/ignored_vars
+      #
+      begin;
+        for v in (set -n | \
+          grep -Ev '^(PARALLEL_TMP)$' | \
+          grep -E "^$_grep_REGEXP\$" | grep -vE "^$_ignore_UNDERSCORE\$");
+          # Separate variables with the string: \000
+	  # array_name1 val1\0
+	  # array_name1 val2\0
+	  # array_name2 val3\0
+	  # array_name2 val4\0
+          eval "for i in \$$v;
+            echo -n $v \$i;
+    	    perl -e print\\\"\\\\0\\\";
+          end;"
+        end;
+        # A final line to flush the last variable in Perl
+        perl -e print\"\\0\";
+      end | perl -0 -ne '
+        # Remove separator string \0
+        chop;
+	# Split line into name and value
+        ($name,$val)=split(/ /,$_,2);
+        # Ignore read-only vars
+        $name=~/^(HOME|USER|COLUMNS|FISH_VERSION|LINES|PWD|SHLVL|_|
+                  fish_pid|history|hostname|status|version)$/x and next;
+        # Single quote $val
+	if($val =~ /[^-_.+a-z0-9\/]/i) {
+	  $val =~ s/\047/\047"\047"\047/g;  # "-quote single quotes
+  	  $val = "\047$val\047";            # single-quote entire string
+	  $val =~ s/^\047\047|\047\047$//g; # Remove unneeded '' at ends
+	} elsif ($val eq "") {
+	  $val = "\047\047";
+	}
+
+        if($name ne $last and $last) {
+          # The $name is different, so this is a new variable.
+          # Print the last one.
+          # Separate list elements by 2 spaces
+          $"="  ";
+          print "set $last @qval;\n";
+          @qval=();
+        }
+        push @qval,$val;
+        $last=$name;
+        '| \
+        perl -pe 's/\001/\002/g and not $printed++ and print STDERR
+          "env_parallel: Warning: ASCII value 1 in variables is not supported\n";
+          s/\n/\001/g'
+    end;
+    )
+  # If --record-env: exit
+  perl -e 'exit grep { /^--record-env$/ } @ARGV' -- $argv; and parallel $argv;
+  set _parallel_exit_CODE $status
+  set -e PARALLEL_ENV
+  return $_parallel_exit_CODE
+end
diff --git a/src/env_parallel.ksh b/src/env_parallel.ksh
new file mode 100755
index 0000000..a6e3b53
--- /dev/null
+++ b/src/env_parallel.ksh
@@ -0,0 +1,413 @@
+#!/usr/bin/env ksh
+
+# This file must be sourced in ksh:
+#
+#   source `which env_parallel.ksh`
+#
+# after which 'env_parallel' works
+#
+#
+# Copyright (C) 2016-2022 Ole Tange, http://ole.tange.dk and Free
+# Software Foundation, Inc.
+#
+# This program is free software; you can redistribute it and/or modify
+# it under the terms of the GNU General Public License as published by
+# the Free Software Foundation; either version 3 of the License, or
+# (at your option) any later version.
+#
+# This program is distributed in the hope that it will be useful, but
+# WITHOUT ANY WARRANTY; without even the implied warranty of
+# MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the GNU
+# General Public License for more details.
+#
+# You should have received a copy of the GNU General Public License
+# along with this program; if not, see <http://www.gnu.org/licenses/>
+# or write to the Free Software Foundation, Inc., 51 Franklin St,
+# Fifth Floor, Boston, MA 02110-1301 USA
+#
+# SPDX-FileCopyrightText: 2021-2022 Ole Tange, http://ole.tange.dk and Free Software and Foundation, Inc.
+# SPDX-License-Identifier: GPL-3.0-or-later
+# shellcheck disable=SC2006
+
+env_parallel() {
+    # env_parallel.ksh
+
+    _names_of_ALIASES() {
+	alias | perl -pe 's/=.*//'
+    }
+    _bodies_of_ALIASES() {
+	alias "$@" | perl -pe 's/^/alias /;
+                     sub warning { print STDERR "env_parallel: Warning: @_\n"; }
+                     if(/^alias (\S+)=\$.*\\n/) {
+ 		         warning("Alias \"$1\" contains newline.");
+		         warning("Make sure the command has at least one newline after \"$1\".");
+		         warning("See BUGS in \"man env_parallel\".");
+                     }'
+
+    }
+    _names_of_maybe_FUNCTIONS() {
+	true not used
+    }
+    _names_of_FUNCTIONS() {
+	typeset +p -f | perl -pe 's/\(\).*//'
+    }
+    _bodies_of_FUNCTIONS() {
+	functions "$@"
+    }
+    _names_of_VARIABLES() {
+	typeset +p | perl -pe 's/^typeset .. //'
+    }
+    _bodies_of_VARIABLES() {
+	typeset -p "$@"
+    }
+    _ignore_HARDCODED() {
+	# These names cannot be detected
+	echo '(_|TIMEOUT|IFS)'
+    }
+    _ignore_READONLY() {
+	# shellcheck disable=SC1078,SC1079,SC2026
+	readonly | perl -e '@r = map {
+                chomp;
+                # sh on UnixWare: readonly TIMEOUT
+	        # ash: readonly var='val'
+	        # ksh: var='val'
+		# mksh: PIPESTATUS[0]
+                s/^(readonly )?([^=\[ ]*?)(\[\d+\])?(=.*|)$/$2/ or
+	        # bash: declare -ar BASH_VERSINFO=([0]="4" [1]="4")
+	        # zsh: typeset -r var='val'
+                  s/^\S+\s+\S+\s+(\S[^=]*)(=.*|$)/$1/;
+                $_ } <>;
+            $vars = join "|",map { quotemeta $_ } @r;
+            print $vars ? "($vars)" : "(,,nO,,VaRs,,)";
+            '
+    }
+    _remove_bad_NAMES() {
+	# Do not transfer vars and funcs from env_parallel
+	# shellcheck disable=SC2006
+	_ignore_RO="`_ignore_READONLY`"
+	# shellcheck disable=SC2006
+	_ignore_HARD="`_ignore_HARDCODED`"
+	# Macos-grep does not like long patterns
+	# Old Solaris grep does not support -E
+	# Perl Version of:
+	# grep -Ev '^(...)$' |
+	perl -ne '/^(
+		     PARALLEL_ENV|
+		     PARALLEL_TMP|
+		     _alias_NAMES|
+		     _bodies_of_ALIASES|
+		     _bodies_of_FUNCTIONS|
+		     _bodies_of_VARIABLES|
+		     _error_PAR|
+		     _function_NAMES|
+		     _get_ignored_VARS|
+		     _grep_REGEXP|
+		     _ignore_HARD|
+		     _ignore_HARDCODED|
+		     _ignore_READONLY|
+		     _ignore_RO|
+		     _ignore_UNDERSCORE|
+		     _list_alias_BODIES|
+		     _list_function_BODIES|
+		     _list_variable_VALUES|
+		     _make_grep_REGEXP|
+		     _names_of_ALIASES|
+		     _names_of_FUNCTIONS|
+		     _names_of_VARIABLES|
+		     _names_of_maybe_FUNCTIONS|
+		     _parallel_exit_CODE|
+		     _prefix_PARALLEL_ENV|
+		     _prefix_PARALLEL_ENV|
+		     _remove_bad_NAMES|
+		     _remove_readonly|
+		     _variable_NAMES|
+		     _warning_PAR|
+		     _which_PAR)$/x and next;
+	    # Filter names matching --env
+	    /^'"$_grep_REGEXP"'$/ or next;
+            /^'"$_ignore_UNDERSCORE"'$/ and next;
+	    # Remove readonly variables
+            /^'"$_ignore_RO"'$/ and next;
+            /^'"$_ignore_HARD"'$/ and next;
+            print;'
+    }
+    _get_ignored_VARS() {
+        perl -e '
+            for(@ARGV){
+                $next_is_env and push @envvar, split/,/, $_;
+                $next_is_env=/^--env$/;
+            }
+            if(grep { /^_$/ } @envvar) {
+                if(not open(IN, "<", "$ENV{HOME}/.parallel/ignored_vars")) {
+             	    print STDERR "parallel: Error: ",
+            	    "Run \"parallel --record-env\" in a clean environment first.\n";
+                } else {
+            	    chomp(@ignored_vars = <IN>);
+                }
+            }
+            if($ENV{PARALLEL_IGNORED_NAMES}) {
+                push @ignored_vars, split/\s+/, $ENV{PARALLEL_IGNORED_NAMES};
+                chomp @ignored_vars;
+            }
+            $vars = join "|",map { quotemeta $_ } @ignored_vars;
+	    print $vars ? "($vars)" : "(,,nO,,VaRs,,)";
+            ' -- "$@"
+    }
+
+    # Get the --env variables if set
+    # --env _ should be ignored
+    # and convert  a b c  to (a|b|c)
+    # If --env not set: Match everything (.*)
+    _make_grep_REGEXP() {
+        perl -e '
+            for(@ARGV){
+                /^_$/ and $next_is_env = 0;
+                $next_is_env and push @envvar, split/,/, $_;
+                $next_is_env = /^--env$/;
+            }
+            $vars = join "|",map { quotemeta $_ } @envvar;
+            print $vars ? "($vars)" : "(.*)";
+            ' -- "$@"
+    }
+    _which_PAR() {
+	# type returns:
+	#   ll is an alias for ls -l (in ash)
+	#   bash is a tracked alias for /bin/bash
+	#   true is a shell builtin (in bash)
+	#   myfunc is a function (in bash)
+	#   myfunc is a shell function (in zsh)
+	#   which is /usr/bin/which (in sh, bash)
+	#   which is hashed (/usr/bin/which)
+	#   gi is aliased to `grep -i' (in bash)
+	#   aliased to `alias | /usr/bin/which --tty-only --read-alias --show-dot --show-tilde'
+	# Return 0 if found, 1 otherwise
+	LANG=C type "$@" |
+	    perl -pe '$exit += (s/ is an alias for .*// ||
+	                        s/ is aliased to .*// ||
+                                s/ is a function// ||
+                                s/ is a shell function// ||
+                                s/ is a shell builtin// ||
+                                s/.* is hashed .(\S+).$/$1/ ||
+                                s/.* is (a tracked alias for )?//);
+                      END { exit not $exit }'
+    }
+    _warning_PAR() {
+	echo "env_parallel: Warning: $*" >&2
+    }
+    _error_PAR() {
+	echo "env_parallel: Error: $*" >&2
+    }
+
+    if _which_PAR parallel >/dev/null; then
+	true parallel found in path
+    else
+	# shellcheck disable=SC2016
+	_error_PAR 'parallel must be in $PATH.'
+	return 255
+    fi
+
+    # Grep regexp for vars given by --env
+    # shellcheck disable=SC2006
+    _grep_REGEXP="`_make_grep_REGEXP \"$@\"`"
+    unset _make_grep_REGEXP
+
+    # Deal with --env _
+    # shellcheck disable=SC2006
+    _ignore_UNDERSCORE="`_get_ignored_VARS \"$@\"`"
+    unset _get_ignored_VARS
+
+    # --record-env
+    if perl -e 'exit grep { /^--record-env$/ } @ARGV' -- "$@"; then
+	true skip
+    else
+	(_names_of_ALIASES;
+	 _names_of_FUNCTIONS;
+	 _names_of_VARIABLES) |
+	    cat > "$HOME"/.parallel/ignored_vars
+	return 0
+    fi
+
+    # --session
+    if perl -e 'exit grep { /^--session$/ } @ARGV' -- "$@"; then
+	true skip
+    else
+	# Insert ::: between each level of session
+	# so you can pop off the last ::: at --end-session
+	# shellcheck disable=SC2006
+	PARALLEL_IGNORED_NAMES="`echo \"$PARALLEL_IGNORED_NAMES\";
+          echo :::;
+          (_names_of_ALIASES;
+	   _names_of_FUNCTIONS;
+	   _names_of_VARIABLES) | perl -ne '
+	    BEGIN{
+	      map { $ignored_vars{$_}++ }
+                split/\s+/, $ENV{PARALLEL_IGNORED_NAMES};
+	    }
+	    chomp;
+	    for(split/\s+/) {
+	      if(not $ignored_vars{$_}) {
+	        print $_,\"\\n\";
+	      }
+            }
+	    '`"
+	export PARALLEL_IGNORED_NAMES
+	return 0
+    fi
+    if perl -e 'exit grep { /^--end.?session$/ } @ARGV' -- "$@"; then
+	true skip
+    else
+	# Pop off last ::: from PARALLEL_IGNORED_NAMES
+	# shellcheck disable=SC2006
+	PARALLEL_IGNORED_NAMES="`perl -e '
+          $ENV{PARALLEL_IGNORED_NAMES} =~ s/(.*):::.*?$/$1/s;
+	  print $ENV{PARALLEL_IGNORED_NAMES}
+        '`"
+	return 0
+    fi
+    # Grep alias names
+    # shellcheck disable=SC2006
+    _alias_NAMES="`_names_of_ALIASES | _remove_bad_NAMES | xargs echo`"
+    _list_alias_BODIES="_bodies_of_ALIASES $_alias_NAMES"
+    if [ "$_alias_NAMES" = "" ] ; then
+	# no aliases selected
+	_list_alias_BODIES="true"
+    fi
+    unset _alias_NAMES
+
+    # Grep function names
+    # shellcheck disable=SC2006
+    _function_NAMES="`_names_of_FUNCTIONS | _remove_bad_NAMES | xargs echo`"
+    _list_function_BODIES="_bodies_of_FUNCTIONS $_function_NAMES"
+    if [ "$_function_NAMES" = "" ] ; then
+	# no functions selected
+	_list_function_BODIES="true"
+    fi
+    unset _function_NAMES
+
+    # Grep variable names
+    # shellcheck disable=SC2006
+    _variable_NAMES="`_names_of_VARIABLES | _remove_bad_NAMES | xargs echo`"
+    _list_variable_VALUES="_bodies_of_VARIABLES $_variable_NAMES"
+    if [ "$_variable_NAMES" = "" ] ; then
+	# no variables selected
+	_list_variable_VALUES="true"
+    fi
+    unset _variable_NAMES
+
+    # shellcheck disable=SC2006
+    PARALLEL_ENV="`
+        $_list_alias_BODIES;
+        $_list_function_BODIES;
+        $_list_variable_VALUES;
+    `"
+    export PARALLEL_ENV
+    unset _list_alias_BODIES _list_variable_VALUES _list_function_BODIES
+    unset _bodies_of_ALIASES _bodies_of_VARIABLES _bodies_of_FUNCTIONS
+    unset _names_of_ALIASES _names_of_VARIABLES _names_of_FUNCTIONS
+    unset _ignore_HARDCODED _ignore_READONLY _ignore_UNDERSCORE
+    unset _remove_bad_NAMES _grep_REGEXP
+    unset _prefix_PARALLEL_ENV
+    # Test if environment is too big by running 'true'
+    # shellcheck disable=SC2006,SC2092
+    if `_which_PAR true` >/dev/null 2>/dev/null ; then
+	parallel "$@"
+	_parallel_exit_CODE=$?
+	# Clean up variables/functions
+	unset PARALLEL_ENV
+	unset _which_PAR _which_TRUE
+	unset _warning_PAR _error_PAR
+	# Unset _parallel_exit_CODE before return
+	eval "unset _parallel_exit_CODE; return $_parallel_exit_CODE"
+    else
+	unset PARALLEL_ENV;
+	_error_PAR "Your environment is too big."
+	_error_PAR "You can try 3 different approaches:"
+	_error_PAR "1. Run 'env_parallel --session' before you set"
+	_error_PAR "   variables or define functions."
+	_error_PAR "2. Use --env and only mention the names to copy."
+	_error_PAR "3. Try running this in a clean environment once:"
+	_error_PAR "     env_parallel --record-env"
+	_error_PAR "   And then use '--env _'"
+	_error_PAR "For details see: man env_parallel"
+	return 255
+    fi
+}
+
+parset() {
+    _parset_PARALLEL_PRG=parallel
+    _parset_main "$@"
+}
+
+env_parset() {
+    _parset_PARALLEL_PRG=env_parallel
+    _parset_main "$@"
+}
+
+_parset_main() {
+    # If $1 contains ',' or space:
+    #   Split on , to get the destination variable names
+    # If $1 is a single destination variable name:
+    #   Treat it as the name of an array
+    #
+    #   # Create array named myvar
+    #   parset myvar echo ::: {1..10}
+    #   echo ${myvar[5]}
+    #
+    #   # Put output into $var_a $var_b $var_c
+    #   varnames=(var_a var_b var_c)
+    #   parset "${varnames[*]}" echo ::: {1..3}
+    #   echo $var_c
+    #
+    #   # Put output into $var_a4 $var_b4 $var_c4
+    #   parset "var_a4 var_b4 var_c4" echo ::: {1..3}
+    #   echo $var_c4
+
+    _parset_NAME="$1"
+    if [ "$_parset_NAME" = "" ] ; then
+	echo parset: Error: No destination variable given. >&2
+	echo parset: Error: Try: >&2
+	echo parset: Error: ' ' parset myarray echo ::: foo bar >&2
+	return 255
+    fi
+    if [ "$_parset_NAME" = "--help" ] ; then
+	echo parset: Error: Usage: >&2
+	echo parset: Error: ' ' parset varname GNU Parallel options and command >&2
+	echo
+	parallel --help
+	return 255
+    fi
+    if [ "$_parset_NAME" = "--version" ] ; then
+	# shellcheck disable=SC2006
+	echo "parset 20221122 (GNU parallel `parallel --minversion 1`)"
+	echo "Copyright (C) 2007-2022 Ole Tange, http://ole.tange.dk and Free Software"
+	echo "Foundation, Inc."
+	echo "License GPLv3+: GNU GPL version 3 or later <https://gnu.org/licenses/gpl.html>"
+	echo "This is free software: you are free to change and redistribute it."
+	echo "GNU parallel comes with no warranty."
+	echo
+	echo "Web site: https://www.gnu.org/software/parallel"
+	echo
+	echo "When using programs that use GNU Parallel to process data for publication"
+	echo "please cite as described in 'parallel --citation'."
+	echo
+	return 255
+    fi
+    shift
+
+    # Bash: declare -A myassoc=( )
+    # Zsh: typeset -A myassoc=( )
+    # Ksh: typeset -A myassoc=( )
+    # shellcheck disable=SC2039,SC2169
+    if (typeset -p "$_parset_NAME" 2>/dev/null; echo) |
+	    perl -ne 'exit not (/^declare[^=]+-A|^typeset[^=]+-A/)' ; then
+	# This is an associative array
+	# shellcheck disable=SC2006
+	eval "`$_parset_PARALLEL_PRG -k --_parset assoc,"$_parset_NAME" "$@"`"
+	# The eval returns the function!
+    else
+	# This is a normal array or a list of variable names
+	# shellcheck disable=SC2006
+	eval "`$_parset_PARALLEL_PRG -k --_parset var,"$_parset_NAME" "$@"`"
+	# The eval returns the function!
+    fi
+}
diff --git a/src/env_parallel.mksh b/src/env_parallel.mksh
new file mode 100644
index 0000000..52cd1bb
--- /dev/null
+++ b/src/env_parallel.mksh
@@ -0,0 +1,415 @@
+#!/usr/bin/env ksh
+
+# This file must be sourced in mksh:
+#
+#   source `which env_parallel.mksh`
+#
+# after which 'env_parallel' works
+#
+#
+# Copyright (C) 2016-2022 Ole Tange, http://ole.tange.dk and Free
+# Software Foundation, Inc.
+#
+# This program is free software; you can redistribute it and/or modify
+# it under the terms of the GNU General Public License as published by
+# the Free Software Foundation; either version 3 of the License, or
+# (at your option) any later version.
+#
+# This program is distributed in the hope that it will be useful, but
+# WITHOUT ANY WARRANTY; without even the implied warranty of
+# MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the GNU
+# General Public License for more details.
+#
+# You should have received a copy of the GNU General Public License
+# along with this program; if not, see <http://www.gnu.org/licenses/>
+# or write to the Free Software Foundation, Inc., 51 Franklin St,
+# Fifth Floor, Boston, MA 02110-1301 USA
+#
+# SPDX-FileCopyrightText: 2021-2022 Ole Tange, http://ole.tange.dk and Free Software and Foundation, Inc.
+# SPDX-License-Identifier: GPL-3.0-or-later
+# shellcheck disable=SC2006
+
+env_parallel() {
+    # env_parallel.mksh
+
+    _names_of_ALIASES() {
+	alias | perl -pe 's/=.*//'
+    }
+    _bodies_of_ALIASES() {
+	alias "$@" | perl -pe 's/^/alias /;
+                     sub warning { print STDERR "env_parallel: Warning: @_\n"; }
+                     if(/^alias (\S+)=\$.*\\n/) {
+ 		         warning("Alias \"$1\" contains newline.");
+		         warning("Make sure the command has at least one newline after \"$1\".");
+		         warning("See BUGS in \"man env_parallel\".");
+                     }'
+
+    }
+    _names_of_maybe_FUNCTIONS() {
+	true not used
+    }
+    _names_of_FUNCTIONS() {
+	typeset +f
+    }
+    _bodies_of_FUNCTIONS() {
+	typeset -f "$@"
+    }
+    _names_of_VARIABLES() {
+	typeset +p |
+	    perl -pe 's/^(type)?set( [-+][a-zA-Z0-9]*)* //; s/(\[\d+\])?=.*//' |
+	    uniq
+    }
+    _bodies_of_VARIABLES() {
+	typeset -p "$@"
+    }
+    _ignore_HARDCODED() {
+	# These names cannot be detected
+	echo '(_)'
+    }
+    _ignore_READONLY() {
+	# shellcheck disable=SC1078,SC1079,SC2026
+	readonly | perl -e '@r = map {
+                chomp;
+                # sh on UnixWare: readonly TIMEOUT
+	        # ash: readonly var='val'
+	        # ksh: var='val'
+		# mksh: PIPESTATUS[0]
+                s/^(readonly )?([^=\[ ]*?)(\[\d+\])?(=.*|)$/$2/ or
+	        # bash: declare -ar BASH_VERSINFO=([0]="4" [1]="4")
+	        # zsh: typeset -r var='val'
+                  s/^\S+\s+\S+\s+(\S[^=]*)(=.*|$)/$1/;
+                $_ } <>;
+            $vars = join "|",map { quotemeta $_ } @r;
+            print $vars ? "($vars)" : "(,,nO,,VaRs,,)";
+            '
+    }
+    _remove_bad_NAMES() {
+	# Do not transfer vars and funcs from env_parallel
+	# shellcheck disable=SC2006
+	_ignore_RO="`_ignore_READONLY`"
+	# shellcheck disable=SC2006
+	_ignore_HARD="`_ignore_HARDCODED`"
+	# Macos-grep does not like long patterns
+	# Old Solaris grep does not support -E
+	# Perl Version of:
+	# grep -Ev '^(...)$' |
+	perl -ne '/^(
+		     PARALLEL_ENV|
+		     PARALLEL_TMP|
+		     _alias_NAMES|
+		     _bodies_of_ALIASES|
+		     _bodies_of_FUNCTIONS|
+		     _bodies_of_VARIABLES|
+		     _error_PAR|
+		     _function_NAMES|
+		     _get_ignored_VARS|
+		     _grep_REGEXP|
+		     _ignore_HARD|
+		     _ignore_HARDCODED|
+		     _ignore_READONLY|
+		     _ignore_RO|
+		     _ignore_UNDERSCORE|
+		     _list_alias_BODIES|
+		     _list_function_BODIES|
+		     _list_variable_VALUES|
+		     _make_grep_REGEXP|
+		     _names_of_ALIASES|
+		     _names_of_FUNCTIONS|
+		     _names_of_VARIABLES|
+		     _names_of_maybe_FUNCTIONS|
+		     _parallel_exit_CODE|
+		     _prefix_PARALLEL_ENV|
+		     _prefix_PARALLEL_ENV|
+		     _remove_bad_NAMES|
+		     _remove_readonly|
+		     _variable_NAMES|
+		     _warning_PAR|
+		     _which_PAR)$/x and next;
+	    # Filter names matching --env
+	    /^'"$_grep_REGEXP"'$/ or next;
+            /^'"$_ignore_UNDERSCORE"'$/ and next;
+	    # Remove readonly variables
+            /^'"$_ignore_RO"'$/ and next;
+            /^'"$_ignore_HARD"'$/ and next;
+            print;'
+    }
+    _get_ignored_VARS() {
+        perl -e '
+            for(@ARGV){
+                $next_is_env and push @envvar, split/,/, $_;
+                $next_is_env=/^--env$/;
+            }
+            if(grep { /^_$/ } @envvar) {
+                if(not open(IN, "<", "$ENV{HOME}/.parallel/ignored_vars")) {
+             	    print STDERR "parallel: Error: ",
+            	    "Run \"parallel --record-env\" in a clean environment first.\n";
+                } else {
+            	    chomp(@ignored_vars = <IN>);
+                }
+            }
+            if($ENV{PARALLEL_IGNORED_NAMES}) {
+                push @ignored_vars, split/\s+/, $ENV{PARALLEL_IGNORED_NAMES};
+                chomp @ignored_vars;
+            }
+            $vars = join "|",map { quotemeta $_ } @ignored_vars;
+	    print $vars ? "($vars)" : "(,,nO,,VaRs,,)";
+            ' -- "$@"
+    }
+
+    # Get the --env variables if set
+    # --env _ should be ignored
+    # and convert  a b c  to (a|b|c)
+    # If --env not set: Match everything (.*)
+    _make_grep_REGEXP() {
+        perl -e '
+            for(@ARGV){
+                /^_$/ and $next_is_env = 0;
+                $next_is_env and push @envvar, split/,/, $_;
+                $next_is_env = /^--env$/;
+            }
+            $vars = join "|",map { quotemeta $_ } @envvar;
+            print $vars ? "($vars)" : "(.*)";
+            ' -- "$@"
+    }
+    _which_PAR() {
+	# type returns:
+	#   ll is an alias for ls -l (in ash)
+	#   bash is a tracked alias for /bin/bash
+	#   true is a shell builtin (in bash)
+	#   myfunc is a function (in bash)
+	#   myfunc is a shell function (in zsh)
+	#   which is /usr/bin/which (in sh, bash)
+	#   which is hashed (/usr/bin/which)
+	#   gi is aliased to `grep -i' (in bash)
+	#   aliased to `alias | /usr/bin/which --tty-only --read-alias --show-dot --show-tilde'
+	# Return 0 if found, 1 otherwise
+	LANG=C type "$@" |
+	    perl -pe '$exit += (s/ is an alias for .*// ||
+	                        s/ is aliased to .*// ||
+                                s/ is a function// ||
+                                s/ is a shell function// ||
+                                s/ is a shell builtin// ||
+                                s/.* is hashed .(\S+).$/$1/ ||
+                                s/.* is (a tracked alias for )?//);
+                      END { exit not $exit }'
+    }
+    _warning_PAR() {
+	echo "env_parallel: Warning: $*" >&2
+    }
+    _error_PAR() {
+	echo "env_parallel: Error: $*" >&2
+    }
+
+    if _which_PAR parallel >/dev/null; then
+	true parallel found in path
+    else
+	# shellcheck disable=SC2016
+	_error_PAR 'parallel must be in $PATH.'
+	return 255
+    fi
+
+    # Grep regexp for vars given by --env
+    # shellcheck disable=SC2006
+    _grep_REGEXP="`_make_grep_REGEXP \"$@\"`"
+    unset _make_grep_REGEXP
+
+    # Deal with --env _
+    # shellcheck disable=SC2006
+    _ignore_UNDERSCORE="`_get_ignored_VARS \"$@\"`"
+    unset _get_ignored_VARS
+
+    # --record-env
+    if perl -e 'exit grep { /^--record-env$/ } @ARGV' -- "$@"; then
+	true skip
+    else
+	(_names_of_ALIASES;
+	 _names_of_FUNCTIONS;
+	 _names_of_VARIABLES) |
+	    cat > "$HOME"/.parallel/ignored_vars
+	return 0
+    fi
+
+    # --session
+    if perl -e 'exit grep { /^--session$/ } @ARGV' -- "$@"; then
+	true skip
+    else
+	# Insert ::: between each level of session
+	# so you can pop off the last ::: at --end-session
+	# shellcheck disable=SC2006
+	PARALLEL_IGNORED_NAMES="`echo \"$PARALLEL_IGNORED_NAMES\";
+          echo :::;
+          (_names_of_ALIASES;
+	   _names_of_FUNCTIONS;
+	   _names_of_VARIABLES) | perl -ne '
+	    BEGIN{
+	      map { $ignored_vars{$_}++ }
+                split/\s+/, $ENV{PARALLEL_IGNORED_NAMES};
+	    }
+	    chomp;
+	    for(split/\s+/) {
+	      if(not $ignored_vars{$_}) {
+	        print $_,\"\\n\";
+	      }
+            }
+	    '`"
+	export PARALLEL_IGNORED_NAMES
+	return 0
+    fi
+    if perl -e 'exit grep { /^--end.?session$/ } @ARGV' -- "$@"; then
+	true skip
+    else
+	# Pop off last ::: from PARALLEL_IGNORED_NAMES
+	# shellcheck disable=SC2006
+	PARALLEL_IGNORED_NAMES="`perl -e '
+          $ENV{PARALLEL_IGNORED_NAMES} =~ s/(.*):::.*?$/$1/s;
+	  print $ENV{PARALLEL_IGNORED_NAMES}
+        '`"
+	return 0
+    fi
+    # Grep alias names
+    # shellcheck disable=SC2006
+    _alias_NAMES="`_names_of_ALIASES | _remove_bad_NAMES | xargs echo`"
+    _list_alias_BODIES="_bodies_of_ALIASES $_alias_NAMES"
+    if [ "$_alias_NAMES" = "" ] ; then
+	# no aliases selected
+	_list_alias_BODIES="true"
+    fi
+    unset _alias_NAMES
+
+    # Grep function names
+    # shellcheck disable=SC2006
+    _function_NAMES="`_names_of_FUNCTIONS | _remove_bad_NAMES | xargs echo`"
+    _list_function_BODIES="_bodies_of_FUNCTIONS $_function_NAMES"
+    if [ "$_function_NAMES" = "" ] ; then
+	# no functions selected
+	_list_function_BODIES="true"
+    fi
+    unset _function_NAMES
+
+    # Grep variable names
+    # shellcheck disable=SC2006
+    _variable_NAMES="`_names_of_VARIABLES | _remove_bad_NAMES | xargs echo`"
+    _list_variable_VALUES="_bodies_of_VARIABLES $_variable_NAMES"
+    if [ "$_variable_NAMES" = "" ] ; then
+	# no variables selected
+	_list_variable_VALUES="true"
+    fi
+    unset _variable_NAMES
+
+    # shellcheck disable=SC2006
+    PARALLEL_ENV="`
+        $_list_alias_BODIES;
+        $_list_function_BODIES;
+        $_list_variable_VALUES;
+    `"
+    export PARALLEL_ENV
+    unset _list_alias_BODIES _list_variable_VALUES _list_function_BODIES
+    unset _bodies_of_ALIASES _bodies_of_VARIABLES _bodies_of_FUNCTIONS
+    unset _names_of_ALIASES _names_of_VARIABLES _names_of_FUNCTIONS
+    unset _ignore_HARDCODED _ignore_READONLY _ignore_UNDERSCORE
+    unset _remove_bad_NAMES _grep_REGEXP
+    unset _prefix_PARALLEL_ENV
+    # Test if environment is too big by running 'true'
+    # shellcheck disable=SC2006,SC2092
+    if `_which_PAR true` >/dev/null 2>/dev/null ; then
+	parallel "$@"
+	_parallel_exit_CODE=$?
+	# Clean up variables/functions
+	unset PARALLEL_ENV
+	unset _which_PAR _which_TRUE
+	unset _warning_PAR _error_PAR
+	# Unset _parallel_exit_CODE before return
+	eval "unset _parallel_exit_CODE; return $_parallel_exit_CODE"
+    else
+	unset PARALLEL_ENV;
+	_error_PAR "Your environment is too big."
+	_error_PAR "You can try 3 different approaches:"
+	_error_PAR "1. Run 'env_parallel --session' before you set"
+	_error_PAR "   variables or define functions."
+	_error_PAR "2. Use --env and only mention the names to copy."
+	_error_PAR "3. Try running this in a clean environment once:"
+	_error_PAR "     env_parallel --record-env"
+	_error_PAR "   And then use '--env _'"
+	_error_PAR "For details see: man env_parallel"
+	return 255
+    fi
+}
+
+parset() {
+    _parset_PARALLEL_PRG=parallel
+    _parset_main "$@"
+}
+
+env_parset() {
+    _parset_PARALLEL_PRG=env_parallel
+    _parset_main "$@"
+}
+
+_parset_main() {
+    # If $1 contains ',' or space:
+    #   Split on , to get the destination variable names
+    # If $1 is a single destination variable name:
+    #   Treat it as the name of an array
+    #
+    #   # Create array named myvar
+    #   parset myvar echo ::: {1..10}
+    #   echo ${myvar[5]}
+    #
+    #   # Put output into $var_a $var_b $var_c
+    #   varnames=(var_a var_b var_c)
+    #   parset "${varnames[*]}" echo ::: {1..3}
+    #   echo $var_c
+    #
+    #   # Put output into $var_a4 $var_b4 $var_c4
+    #   parset "var_a4 var_b4 var_c4" echo ::: {1..3}
+    #   echo $var_c4
+
+    _parset_NAME="$1"
+    if [ "$_parset_NAME" = "" ] ; then
+	echo parset: Error: No destination variable given. >&2
+	echo parset: Error: Try: >&2
+	echo parset: Error: ' ' parset myarray echo ::: foo bar >&2
+	return 255
+    fi
+    if [ "$_parset_NAME" = "--help" ] ; then
+	echo parset: Error: Usage: >&2
+	echo parset: Error: ' ' parset varname GNU Parallel options and command >&2
+	echo
+	parallel --help
+	return 255
+    fi
+    if [ "$_parset_NAME" = "--version" ] ; then
+	# shellcheck disable=SC2006
+	echo "parset 20221122 (GNU parallel `parallel --minversion 1`)"
+	echo "Copyright (C) 2007-2022 Ole Tange, http://ole.tange.dk and Free Software"
+	echo "Foundation, Inc."
+	echo "License GPLv3+: GNU GPL version 3 or later <https://gnu.org/licenses/gpl.html>"
+	echo "This is free software: you are free to change and redistribute it."
+	echo "GNU parallel comes with no warranty."
+	echo
+	echo "Web site: https://www.gnu.org/software/parallel"
+	echo
+	echo "When using programs that use GNU Parallel to process data for publication"
+	echo "please cite as described in 'parallel --citation'."
+	echo
+	return 255
+    fi
+    shift
+
+    # Bash: declare -A myassoc=( )
+    # Zsh: typeset -A myassoc=( )
+    # Ksh: typeset -A myassoc=( )
+    # shellcheck disable=SC2039,SC2169
+    if (typeset -p "$_parset_NAME" 2>/dev/null; echo) |
+	    perl -ne 'exit not (/^declare[^=]+-A|^typeset[^=]+-A/)' ; then
+	# This is an associative array
+	# shellcheck disable=SC2006
+	eval "`$_parset_PARALLEL_PRG -k --_parset assoc,"$_parset_NAME" "$@"`"
+	# The eval returns the function!
+    else
+	# This is a normal array or a list of variable names
+	# shellcheck disable=SC2006
+	eval "`$_parset_PARALLEL_PRG -k --_parset var,"$_parset_NAME" "$@"`"
+	# The eval returns the function!
+    fi
+}
diff --git a/src/env_parallel.pdksh b/src/env_parallel.pdksh
new file mode 100755
index 0000000..b530ccf
--- /dev/null
+++ b/src/env_parallel.pdksh
@@ -0,0 +1,183 @@
+#!/usr/bin/env pdksh
+
+# This file must be sourced in pdksh:
+#
+#   source `which env_parallel.pdksh`
+#
+# after which 'env_parallel' works
+#
+#
+# Copyright (C) 2016-2022 Ole Tange, http://ole.tange.dk and Free
+# Software Foundation, Inc.
+#
+# This program is free software; you can redistribute it and/or modify
+# it under the terms of the GNU General Public License as published by
+# the Free Software Foundation; either version 3 of the License, or
+# (at your option) any later version.
+#
+# This program is distributed in the hope that it will be useful, but
+# WITHOUT ANY WARRANTY; without even the implied warranty of
+# MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the GNU
+# General Public License for more details.
+#
+# You should have received a copy of the GNU General Public License
+# along with this program; if not, see <http://www.gnu.org/licenses/>
+# or write to the Free Software Foundation, Inc., 51 Franklin St,
+# Fifth Floor, Boston, MA 02110-1301 USA
+#
+# SPDX-FileCopyrightText: 2021-2022 Ole Tange, http://ole.tange.dk and Free Software and Foundation, Inc.
+# SPDX-License-Identifier: GPL-3.0-or-later
+
+env_parallel() {
+    # env_parallel.pdksh
+
+    _names_of_ALIASES() {
+	compgen -a
+    }
+    _bodies_of_ALIASES() {
+	alias "$@" | perl -pe 's/^/alias /'
+    }
+    _names_of_FUNCTIONS() {
+	compgen -A function
+    }
+    _bodies_of_FUNCTIONS() {
+	typeset -f "$@"
+    }
+    _names_of_VARIABLES() {
+	compgen -A variable
+    }
+    _bodies_of_VARIABLES() {
+	typeset -p "$@"
+    }
+    _remove_bad_NAMES() {
+	_tmp_READONLY="$(mktemp)"
+	readonly > "$_tmp_READONLY"
+	# Do not transfer vars and funcs from env_parallel
+	grep -Ev '^(_names_of_ALIASES|_bodies_of_ALIASES|_names_of_maybe_FUNCTIONS|_names_of_FUNCTIONS|_bodies_of_FUNCTIONS|_names_of_VARIABLES|_bodies_of_VARIABLES|_remove_bad_NAMES|_prefix_PARALLEL_ENV|_get_ignored_VARS|_make_grep_REGEXP|_ignore_UNDERSCORE|_alias_NAMES|_list_alias_BODIES|_function_NAMES|_list_function_BODIES|_variable_NAMES|_list_variable_VALUES|_prefix_PARALLEL_ENV|PARALLEL_ENV|PARALLEL_TMP)$' |
+	    # Filter names matching --env
+	    grep -E "^$_grep_REGEXP"\$ | grep -vE "^$_ignore_UNDERSCORE"\$ |
+            grep -vFf $_tmp_READONLY |
+            grep -Ev '^(PIPESTATUS)'
+	rm $_tmp_READONLY
+	unset _tmp_READONLY
+    }
+    _prefix_PARALLEL_ENV() {
+        shopt 2>/dev/null |
+        perl -pe 's:\s+off:;: and s/^/shopt -u /;
+                  s:\s+on:;: and s/^/shopt -s /;
+                  s:;$:&>/dev/null;:';
+        echo 'shopt -s expand_aliases &>/dev/null';
+    }
+
+    _get_ignored_VARS() {
+        perl -e '
+            for(@ARGV){
+                $next_is_env and push @envvar, split/,/, $_;
+                $next_is_env=/^--env$/;
+            }
+            if(grep { /^_$/ } @envvar) {
+                if(not open(IN, "<", "$ENV{HOME}/.parallel/ignored_vars")) {
+             	    print STDERR "parallel: Error: ",
+            	    "Run \"parallel --record-env\" in a clean environment first.\n";
+                } else {
+            	    chomp(@ignored_vars = <IN>);
+            	    $vars = join "|",map { quotemeta $_ } @ignored_vars;
+		    print $vars ? "($vars)" : "(,,nO,,VaRs,,)";
+                }
+            }
+            ' -- "$@"
+    }
+
+    # Get the --env variables if set
+    # --env _ should be ignored
+    # and convert  a b c  to (a|b|c)
+    # If --env not set: Match everything (.*)
+    _make_grep_REGEXP() {
+        perl -e '
+            for(@ARGV){
+                /^_$/ and $next_is_env = 0;
+                $next_is_env and push @envvar, split/,/, $_;
+                $next_is_env = /^--env$/;
+            }
+            $vars = join "|",map { quotemeta $_ } @envvar;
+            print $vars ? "($vars)" : "(.*)";
+            ' -- "$@"
+    }
+
+    if which parallel | grep 'no parallel in' >/dev/null; then
+	echo 'env_parallel: Error: parallel must be in $PATH.' >&2
+	return 1
+    fi
+    if which parallel >/dev/null; then
+	true which on linux
+    else
+	echo 'env_parallel: Error: parallel must be in $PATH.' >&2
+	return 1
+    fi
+
+    # Grep regexp for vars given by --env
+    _grep_REGEXP="`_make_grep_REGEXP \"$@\"`"
+    unset _make_grep_REGEXP
+    
+    # Deal with --env _
+    _ignore_UNDERSCORE="`_get_ignored_VARS \"$@\"`"
+    unset _get_ignored_VARS
+
+    # --record-env
+    if perl -e 'exit grep { /^--record-env$/ } @ARGV' -- "$@"; then
+	true skip
+    else
+	(_names_of_ALIASES;
+	 _names_of_FUNCTIONS;
+	 _names_of_VARIABLES) |
+	    cat > $HOME/.parallel/ignored_vars
+	return 0
+    fi
+    
+    # Grep alias names
+    _alias_NAMES="`_names_of_ALIASES | _remove_bad_NAMES | xargs echo`"
+    _list_alias_BODIES="_bodies_of_ALIASES $_alias_NAMES"
+    if [ "$_alias_NAMES" = "" ] ; then
+	# no aliases selected
+	_list_alias_BODIES="true"
+    fi
+    unset _alias_NAMES
+
+    # Grep function names
+    _function_NAMES="`_names_of_FUNCTIONS | _remove_bad_NAMES | xargs echo`"
+    _list_function_BODIES="_bodies_of_FUNCTIONS $_function_NAMES"
+    if [ "$_function_NAMES" = "" ] ; then
+	# no functions selected
+	_list_function_BODIES="true"
+    fi
+    unset _function_NAMES
+
+    # Grep variable names
+    _variable_NAMES="`_names_of_VARIABLES | _remove_bad_NAMES | xargs echo`"
+    _list_variable_VALUES="_bodies_of_VARIABLES $_variable_NAMES"
+    if [ "$_variable_NAMES" = "" ] ; then
+	# no variables selected
+	_list_variable_VALUES="true"
+    fi
+    unset _variable_NAMES
+
+    # eval is needed for aliases - cannot explain why
+    export PARALLEL_ENV="`
+        eval $_list_alias_BODIES;
+        $_list_function_BODIES
+        $_list_variable_VALUES;
+    `";
+    unset _list_alias_BODIES _list_variable_VALUES _list_function_BODIES
+    unset _bodies_of_ALIASES _bodies_of_VARIABLES _bodies_of_FUNCTIONS
+    unset _names_of_ALIASES _names_of_VARIABLES _names_of_FUNCTIONS
+    unset _ignore_HARDCODED _ignore_READONLY _ignore_UNDERSCORE
+    unset _remove_bad_NAMES _grep_REGEXP
+    unset _prefix_PARALLEL_ENV
+    `which parallel` "$@"
+    _parallel_exit_CODE=$?
+    unset PARALLEL_ENV;
+    unset _which_PAR _which_TRUE
+    unset _warning_PAR _error_PAR
+    # Unset _parallel_exit_CODE before return
+    eval "unset _parallel_exit_CODE; return $_parallel_exit_CODE"
+}
diff --git a/src/env_parallel.pod b/src/env_parallel.pod
new file mode 100644
index 0000000..a198258
--- /dev/null
+++ b/src/env_parallel.pod
@@ -0,0 +1,935 @@
+#!/usr/bin/perl -w
+
+# SPDX-FileCopyrightText: 2021-2022 Ole Tange, http://ole.tange.dk and Free Software and Foundation, Inc.
+# SPDX-License-Identifier: GFDL-1.3-or-later
+# SPDX-License-Identifier: CC-BY-SA-4.0
+
+=encoding utf8
+
+=head1 NAME
+
+env_parallel - export environment to GNU parallel
+
+
+=head1 SYNOPSIS
+
+B<env_parallel> [--record-env|--session|--end-session]
+  [options for GNU Parallel]
+
+
+=head1 DESCRIPTION
+
+B<env_parallel> is a shell function that exports the current
+environment to GNU B<parallel>.
+
+If the shell function is not loaded, a dummy script will be run
+instead that explains how to install the function.
+
+B<env_parallel> is 100 ms slower at startup than pure GNU
+B<parallel>, and takes up to 30% longer to start a job (typically 15 ms).
+
+Due to the problem with environment space (see below) the recommended
+usage is either:
+
+  # Do --record-env into $PARALLEL_IGNORED_NAMES
+  env_parallel --session
+
+  # Define whatever you want to use
+  myfunc() { myalias and functions $myvar work. $1.; }
+  alias myalias='echo Aliases'
+  myvar='and variables'
+
+  # env_parallel will not export names in $PARALLEL_IGNORED_NAMES
+  env_parallel -S localhost myfunc ::: Hooray
+
+Or:
+
+  # Record the "clean" environment (this only needs to be run once)
+  env_parallel --record-env
+
+  # Optionally edit ~/.parallel/ignored_vars (only needed once)
+
+  # Define whatever you want to use
+  myfunc() { myalias and functions $myvar work. $1.; }
+  alias myalias='echo Aliases'
+  myvar='and variables'
+
+  # Use --env _ to only transfer the names not in the "empty" environment
+  env_parallel --env _ -S localhost myfunc ::: Hooray
+
+In B<csh> B<--session> is not supported:
+
+  # Record the "clean" environment - this only needs to be run once
+  env_parallel --record-env
+
+  # Optionally edit ~/.parallel/ignored_vars - only needed once
+
+  # Define whatever you want to use
+  alias myalias 'echo Aliases $myvar \!*.'
+  set myvar='and variables'
+
+  # Use --env _ to only transfer the names not in the "empty" environment
+  env_parallel --env _ -S localhost myalias ::: work
+
+=head2 Environment space
+
+By default B<env_parallel> will export all environment variables,
+arrays, aliases, functions and shell options (see details for the
+individual shells below).
+
+But this only works if the size of the current environment is smaller
+than the maximal length of a command and smaller than half of the max
+if running remotely. E.g. The max size of Bash's command is 128 KB, so
+B<env_parallel> will fail if 'B<set | wc -c>' is bigger than 128
+KB. Technically the limit is in execve(1) which IPC::open3 uses.
+
+Bash completion functions are well-known for taking up well over 128
+KB of environment space and the primary reason for causing
+B<env_parallel> to fail.
+
+Instead you can use B<--env> to specify which variables, arrays,
+aliases and functions to export as this will only export those with
+the given name. Or follow the recommended usage in shown in
+DESCRIPTION.
+
+
+=head1 OPTIONS
+
+Same as GNU B<parallel> in addition to these:
+
+=over 4
+
+=item B<--end-session>
+
+Undo last B<--session>
+
+
+=item B<--record-env>
+
+Record all names currently defined to be ignored every time running
+B<env_parallel> in the future.
+
+
+=item B<--session>
+
+Ignore all names currently defined. Aliases, variables, arrays, and
+functions currently defined will not be transferred.
+
+But names defined I<after> running B<parallel --session> I<will> be
+transferred.
+
+This is only valid in the running shell, and can be undone with
+B<parallel --end-session>.
+
+You can run multiple B<--session> inside each other:
+
+  env_parallel --session
+  var=not
+  # var is transferred
+  env_parallel -Slocalhost 'echo var is $var' ::: ignored
+  env_parallel --session
+  # var is not transferred
+  env_parallel -Slocalhost 'echo var is $var' ::: ignored
+  env_parallel --end-session
+  # var is transferred again
+  env_parallel -Slocalhost 'echo var is $var' ::: ignored
+
+
+
+=back
+
+
+=head1 SUPPORTED SHELLS
+
+=head2 Ash
+
+=head3 Installation
+
+Put this in $HOME/.profile:
+
+  . `which env_parallel.ash`
+
+E.g. by doing:
+
+  echo '. `which env_parallel.ash`' >> $HOME/.profile
+
+=head3 Supported use
+
+B<--env> is supported to export only the variable, or alias with the
+given name. Multiple B<--env>s can be given.
+
+B<--session> is supported.
+
+=over 8
+
+=item aliases
+
+  alias myecho='echo aliases'
+  env_parallel myecho ::: work
+  env_parallel -S server myecho ::: work
+  env_parallel --env myecho myecho ::: work
+  env_parallel --env myecho -S server myecho ::: work
+
+  alias multiline='echo multiline
+    echo aliases'
+  env_parallel multiline ::: work
+  env_parallel -S server multiline ::: work
+  env_parallel --env multiline multiline ::: work
+  env_parallel --env multiline -S server multiline ::: work
+
+=item functions
+
+  ash cannot list defined functions - thus is not supported.
+
+=item variables
+
+  myvar=variables
+  env_parallel echo '$myvar' ::: work
+  env_parallel -S server echo '$myvar' ::: work
+  env_parallel --env myvar echo '$myvar' ::: work
+  env_parallel --env myvar -S server echo '$myvar' ::: work
+
+=item arrays
+
+Arrays are not supported by Ash.
+
+=back
+
+=head2 Bash
+
+=head3 Installation
+
+Put this in $HOME/.bashrc:
+
+  . `which env_parallel.bash`
+
+E.g. by doing:
+
+  echo '. `which env_parallel.bash`' >> $HOME/.bashrc
+
+=head3 Supported use
+
+B<--env> is supported to export only the variable, alias, function, or
+array with the given name. Multiple B<--env>s can be given.
+
+B<--session> is supported.
+
+=over 8
+
+=item aliases
+
+  alias myecho='echo aliases'
+  env_parallel myecho ::: work
+  env_parallel -S server myecho ::: work
+  env_parallel --env myecho myecho ::: work
+  env_parallel --env myecho -S server myecho ::: work
+
+  alias multiline='echo multiline
+    echo aliases'
+  env_parallel 'multiline {};
+    echo but only when followed by a newline' ::: work
+  env_parallel -S server 'multiline {};
+    echo but only when followed by a newline' ::: work
+  env_parallel --env multiline 'multiline {};
+    echo but only when followed by a newline' ::: work
+  env_parallel --env multiline -S server 'multiline {};
+    echo but only when followed by a newline' ::: work
+
+=item functions
+
+  myfunc() { echo functions $*; }
+  env_parallel myfunc ::: work
+  env_parallel -S server myfunc ::: work
+  env_parallel --env myfunc myfunc ::: work
+  env_parallel --env myfunc -S server myfunc ::: work
+
+=item variables
+
+  myvar=variables
+  env_parallel echo '$myvar' ::: work
+  env_parallel -S server echo '$myvar' ::: work
+  env_parallel --env myvar echo '$myvar' ::: work
+  env_parallel --env myvar -S server echo '$myvar' ::: work
+
+=item arrays
+
+  myarray=(arrays work, too)
+  env_parallel -k echo '${myarray[{}]}' ::: 0 1 2
+  env_parallel -k -S server echo '${myarray[{}]}' ::: 0 1 2
+  env_parallel -k --env myarray echo '${myarray[{}]}' ::: 0 1 2
+  env_parallel -k --env myarray -S server \
+    echo '${myarray[{}]}' ::: 0 1 2
+
+=back
+
+=head3 BUGS
+
+Due to a bug in Bash, aliases containing newlines must be followed by
+a newline in the command. Some systems are not affected by this bug,
+but will print a warning anyway.
+
+=head2 csh
+
+B<env_parallel> for B<csh> breaks B<$PARALLEL>, so do not use
+B<$PARALLEL>.
+
+=head3 Installation
+
+Put this in $HOME/.cshrc:
+
+  source `which env_parallel.csh`
+
+E.g. by doing:
+
+  echo 'source `which env_parallel.csh`' >> $HOME/.cshrc
+
+=head3 Supported use
+
+B<--env> is supported to export only the variable, alias, or
+array with the given name. Multiple B<--env>s can be given.
+
+=over 8
+
+=item aliases
+
+  alias myecho 'echo aliases'
+  env_parallel myecho ::: work
+  env_parallel -S server myecho ::: work
+  env_parallel --env myecho myecho ::: work
+  env_parallel --env myecho -S server myecho ::: work
+
+=item functions
+
+Not supported by B<csh>.
+
+=item variables
+
+  set myvar=variables
+  env_parallel echo '$myvar' ::: work
+  env_parallel -S server echo '$myvar' ::: work
+  env_parallel --env myvar echo '$myvar' ::: work
+  env_parallel --env myvar -S server echo '$myvar' ::: work
+
+=item arrays with no special chars
+
+  set myarray=(arrays work, too)
+  env_parallel -k echo \$'{myarray[{}]}' ::: 1 2 3
+  env_parallel -k -S server echo \$'{myarray[{}]}' ::: 1 2 3
+  env_parallel -k --env myarray echo \$'{myarray[{}]}' ::: 1 2 3
+  env_parallel -k --env myarray -S server \
+    echo \$'{myarray[{}]}' ::: 1 2 3
+
+=back
+
+
+=head2 Dash
+
+=head3 Installation
+
+Put this in $HOME/.profile:
+
+  . `which env_parallel.dash`
+
+E.g. by doing:
+
+  echo '. `which env_parallel.dash`' >> $HOME/.profile
+
+=head3 Supported use
+
+B<--env> is supported to export only the variable, or alias with the
+given name. Multiple B<--env>s can be given.
+
+B<--session> is supported.
+
+=over 8
+
+=item aliases
+
+  alias myecho='echo aliases'
+  env_parallel myecho ::: work
+  env_parallel -S server myecho ::: work
+  env_parallel --env myecho myecho ::: work
+  env_parallel --env myecho -S server myecho ::: work
+
+  alias multiline='echo multiline
+    echo aliases'
+  env_parallel multiline ::: work
+  env_parallel -S server multiline ::: work
+  env_parallel --env multiline multiline ::: work
+  env_parallel --env multiline -S server multiline ::: work
+
+=item functions
+
+  dash cannot list defined functions - thus is not supported.
+
+=item variables
+
+  myvar=variables
+  env_parallel echo '$myvar' ::: work
+  env_parallel -S server echo '$myvar' ::: work
+  env_parallel --env myvar echo '$myvar' ::: work
+  env_parallel --env myvar -S server echo '$myvar' ::: work
+
+=item arrays
+
+  dash does not support arrays.
+
+=back
+
+
+=head2 fish
+
+=head3 Installation
+
+Put this in $HOME/.config/fish/config.fish:
+
+  source (which env_parallel.fish)
+
+E.g. by doing:
+
+  echo 'source (which env_parallel.fish)' \
+    >> $HOME/.config/fish/config.fish
+
+=head3 Supported use
+
+B<--env> is supported to export only the variable, alias, function, or
+array with the given name. Multiple B<--env>s can be given.
+
+B<--session> is supported.
+
+=over 8
+
+=item aliases
+
+  alias myecho 'echo aliases'
+  env_parallel myecho ::: work
+  env_parallel -S server myecho ::: work
+  env_parallel --env myecho myecho ::: work
+  env_parallel --env myecho -S server myecho ::: work
+
+=item functions
+
+  function myfunc
+    echo functions $argv
+  end
+  env_parallel myfunc ::: work
+  env_parallel -S server myfunc ::: work
+  env_parallel --env myfunc myfunc ::: work
+  env_parallel --env myfunc -S server myfunc ::: work
+
+=item variables
+
+  set myvar variables
+  env_parallel echo '$myvar' ::: work
+  env_parallel -S server echo '$myvar' ::: work
+  env_parallel --env myvar echo '$myvar' ::: work
+  env_parallel --env myvar -S server echo '$myvar' ::: work
+
+=item arrays
+
+  set myarray arrays work, too
+  env_parallel -k echo '$myarray[{}]' ::: 1 2 3
+  env_parallel -k -S server echo '$myarray[{}]' ::: 1 2 3
+  env_parallel -k --env myarray echo '$myarray[{}]' ::: 1 2 3
+  env_parallel -k --env myarray -S server \
+    echo '$myarray[{}]' ::: 1 2 3
+
+=back
+
+
+=head2 ksh
+
+=head3 Installation
+
+Put this in $HOME/.kshrc:
+
+  source `which env_parallel.ksh`
+
+E.g. by doing:
+
+  echo 'source `which env_parallel.ksh`' >> $HOME/.kshrc
+
+=head3 Supported use
+
+B<--env> is supported to export only the variable, alias, function, or
+array with the given name. Multiple B<--env>s can be given.
+
+B<--session> is supported.
+
+=over 8
+
+=item aliases
+
+  alias myecho='echo aliases'
+  env_parallel myecho ::: work
+  env_parallel -S server myecho ::: work
+  env_parallel --env myecho myecho ::: work
+  env_parallel --env myecho -S server myecho ::: work
+
+  alias multiline='echo multiline
+    echo aliases'
+  env_parallel multiline ::: work
+  env_parallel -S server multiline ::: work
+  env_parallel --env multiline multiline ::: work
+  env_parallel --env multiline -S server multiline ::: work
+
+=item functions
+
+  myfunc() { echo functions $*; }
+  env_parallel myfunc ::: work
+  env_parallel -S server myfunc ::: work
+  env_parallel --env myfunc myfunc ::: work
+  env_parallel --env myfunc -S server myfunc ::: work
+
+=item variables
+
+  myvar=variables
+  env_parallel echo '$myvar' ::: work
+  env_parallel -S server echo '$myvar' ::: work
+  env_parallel --env myvar echo '$myvar' ::: work
+  env_parallel --env myvar -S server echo '$myvar' ::: work
+
+=item arrays
+
+  myarray=(arrays work, too)
+  env_parallel -k echo '${myarray[{}]}' ::: 0 1 2
+  env_parallel -k -S server echo '${myarray[{}]}' ::: 0 1 2
+  env_parallel -k --env myarray echo '${myarray[{}]}' ::: 0 1 2
+  env_parallel -k --env myarray -S server \
+    echo '${myarray[{}]}' ::: 0 1 2
+
+=back
+
+
+=head2 mksh
+
+=head3 Installation
+
+Put this in $HOME/.mkshrc:
+
+  source `which env_parallel.mksh`
+
+E.g. by doing:
+
+  echo 'source `which env_parallel.mksh`' >> $HOME/.mkshrc
+
+=head3 Supported use
+
+B<--env> is supported to export only the variable, alias, function, or
+array with the given name. Multiple B<--env>s can be given.
+
+B<--session> is supported.
+
+=over 8
+
+=item aliases
+
+  alias myecho='echo aliases'
+  env_parallel myecho ::: work
+  env_parallel -S server myecho ::: work
+  env_parallel --env myecho myecho ::: work
+  env_parallel --env myecho -S server myecho ::: work
+
+  alias multiline='echo multiline
+    echo aliases'
+  env_parallel multiline ::: work
+  env_parallel -S server multiline ::: work
+  env_parallel --env multiline multiline ::: work
+  env_parallel --env multiline -S server multiline ::: work
+
+=item functions
+
+  myfunc() { echo functions $*; }
+  env_parallel myfunc ::: work
+  env_parallel -S server myfunc ::: work
+  env_parallel --env myfunc myfunc ::: work
+  env_parallel --env myfunc -S server myfunc ::: work
+
+=item variables
+
+  myvar=variables
+  env_parallel echo '$myvar' ::: work
+  env_parallel -S server echo '$myvar' ::: work
+  env_parallel --env myvar echo '$myvar' ::: work
+  env_parallel --env myvar -S server echo '$myvar' ::: work
+
+=item arrays
+
+  myarray=(arrays work, too)
+  env_parallel -k echo '${myarray[{}]}' ::: 0 1 2
+  env_parallel -k -S server echo '${myarray[{}]}' ::: 0 1 2
+  env_parallel -k --env myarray echo '${myarray[{}]}' ::: 0 1 2
+  env_parallel -k --env myarray -S server \
+    echo '${myarray[{}]}' ::: 0 1 2
+
+=back
+
+
+=head2 pdksh
+
+=head3 Installation
+
+Put this in $HOME/.profile:
+
+  source `which env_parallel.pdksh`
+
+E.g. by doing:
+
+  echo 'source `which env_parallel.pdksh`' >> $HOME/.profile
+
+=head3 Supported use
+
+B<--env> is supported to export only the variable, alias, function, or
+array with the given name. Multiple B<--env>s can be given.
+
+B<--session> is supported.
+
+=over 8
+
+=item aliases
+
+  alias myecho="echo aliases";
+  env_parallel myecho ::: work;
+  env_parallel -S server myecho ::: work;
+  env_parallel --env myecho myecho ::: work;
+  env_parallel --env myecho -S server myecho ::: work
+
+=item functions
+
+  myfunc() { echo functions $*; };
+  env_parallel myfunc ::: work;
+  env_parallel -S server myfunc ::: work;
+  env_parallel --env myfunc myfunc ::: work;
+  env_parallel --env myfunc -S server myfunc ::: work
+
+=item variables
+
+  myvar=variables;
+  env_parallel echo "\$myvar" ::: work;
+  env_parallel -S server echo "\$myvar" ::: work;
+  env_parallel --env myvar echo "\$myvar" ::: work;
+  env_parallel --env myvar -S server echo "\$myvar" ::: work
+
+=item arrays
+
+  myarray=(arrays work, too);
+  env_parallel -k echo "\${myarray[{}]}" ::: 0 1 2;
+  env_parallel -k -S server echo "\${myarray[{}]}" ::: 0 1 2;
+  env_parallel -k --env myarray echo "\${myarray[{}]}" ::: 0 1 2;
+  env_parallel -k --env myarray -S server \
+    echo "\${myarray[{}]}" ::: 0 1 2
+
+=back
+
+
+=head2 sh
+
+=head3 Installation
+
+Put this in $HOME/.profile:
+
+  . `which env_parallel.sh`
+
+E.g. by doing:
+
+  echo '. `which env_parallel.sh`' >> $HOME/.profile
+
+=head3 Supported use
+
+B<--env> is supported to export only the variable, or alias with the
+given name. Multiple B<--env>s can be given.
+
+B<--session> is supported.
+
+=over 8
+
+=item aliases
+
+  sh does not support aliases.
+
+=item functions
+
+  myfunc() { echo functions $*; }
+  env_parallel myfunc ::: work
+  env_parallel -S server myfunc ::: work
+  env_parallel --env myfunc myfunc ::: work
+  env_parallel --env myfunc -S server myfunc ::: work
+
+=item variables
+
+  myvar=variables
+  env_parallel echo '$myvar' ::: work
+  env_parallel -S server echo '$myvar' ::: work
+  env_parallel --env myvar echo '$myvar' ::: work
+  env_parallel --env myvar -S server echo '$myvar' ::: work
+
+=item arrays
+
+  sh does not support arrays.
+
+=back
+
+
+=head2 tcsh
+
+B<env_parallel> for B<tcsh> breaks B<$PARALLEL>, so do not use
+B<$PARALLEL>.
+
+=head3 Installation
+
+Put this in $HOME/.tcshrc:
+
+  source `which env_parallel.tcsh`
+
+E.g. by doing:
+
+  echo 'source `which env_parallel.tcsh`' >> $HOME/.tcshrc
+
+=head3 Supported use
+
+B<--env> is supported to export only the variable, alias, or
+array with the given name. Multiple B<--env>s can be given.
+
+=over 8
+
+=item aliases
+
+  alias myecho 'echo aliases'
+  env_parallel myecho ::: work
+  env_parallel -S server myecho ::: work
+  env_parallel --env myecho myecho ::: work
+  env_parallel --env myecho -S server myecho ::: work
+
+=item functions
+
+Not supported by B<tcsh>.
+
+=item variables
+
+  set myvar=variables
+  env_parallel echo '$myvar' ::: work
+  env_parallel -S server echo '$myvar' ::: work
+  env_parallel --env myvar echo '$myvar' ::: work
+  env_parallel --env myvar -S server echo '$myvar' ::: work
+
+=item arrays with no special chars
+
+  set myarray=(arrays work, too)
+  env_parallel -k echo \$'{myarray[{}]}' ::: 1 2 3
+  env_parallel -k -S server echo \$'{myarray[{}]}' ::: 1 2 3
+  env_parallel -k --env myarray echo \$'{myarray[{}]}' ::: 1 2 3
+  env_parallel -k --env myarray -S server \
+    echo \$'{myarray[{}]}' ::: 1 2 3
+
+=back
+
+
+=head2 Zsh
+
+=head3 Installation
+
+Put this in $HOME/.zshrc:
+
+  . `which env_parallel.zsh`
+
+E.g. by doing:
+
+  echo '. `which env_parallel.zsh`' >> $HOME/.zshenv
+
+=head3 Supported use
+
+B<--env> is supported to export only the variable, alias, function, or
+array with the given name. Multiple B<--env>s can be given.
+
+B<--session> is supported.
+
+=over 8
+
+=item aliases
+
+  alias myecho='echo aliases'
+  env_parallel myecho ::: work
+  env_parallel -S server myecho ::: work
+  env_parallel --env myecho myecho ::: work
+  env_parallel --env myecho -S server myecho ::: work
+
+  alias multiline='echo multiline
+    echo aliases'
+  env_parallel multiline ::: work
+  env_parallel -S server multiline ::: work
+  env_parallel --env multiline multiline ::: work
+  env_parallel --env multiline -S server multiline ::: work
+
+=item functions
+
+  myfunc() { echo functions $*; }
+  env_parallel myfunc ::: work
+  env_parallel -S server myfunc ::: work
+  env_parallel --env myfunc myfunc ::: work
+  env_parallel --env myfunc -S server myfunc ::: work
+
+=item variables
+
+  myvar=variables
+  env_parallel echo '$myvar' ::: work
+  env_parallel -S server echo '$myvar' ::: work
+  env_parallel --env myvar echo '$myvar' ::: work
+  env_parallel --env myvar -S server echo '$myvar' ::: work
+
+=item arrays
+
+  myarray=(arrays work, too)
+  env_parallel -k echo '${myarray[{}]}' ::: 1 2 3
+  env_parallel -k -S server echo '${myarray[{}]}' ::: 1 2 3
+  env_parallel -k --env myarray echo '${myarray[{}]}' ::: 1 2 3
+  env_parallel -k --env myarray -S server \
+    echo '${myarray[{}]}' ::: 1 2 3
+
+=back
+
+
+=head1 EXIT STATUS
+
+Same as GNU B<parallel>.
+
+
+=head1 AUTHOR
+
+When using GNU B<env_parallel> for a publication please cite:
+
+O. Tange (2018): GNU Parallel 2018, March 2018, ISBN 9781387509881,
+DOI: 10.5281/zenodo.1146014.
+
+This helps funding further development; and it won't cost you a cent.
+If you pay 10000 EUR you should feel free to use GNU Parallel without citing.
+
+Copyright (C) 2007-10-18 Ole Tange, http://ole.tange.dk
+
+Copyright (C) 2008-2010 Ole Tange, http://ole.tange.dk
+
+Copyright (C) 2010-2022 Ole Tange, http://ole.tange.dk and Free
+Software Foundation, Inc.
+
+
+=head1 LICENSE
+
+This program is free software; you can redistribute it and/or modify
+it under the terms of the GNU General Public License as published by
+the Free Software Foundation; either version 3 of the License, or
+at your option any later version.
+
+This program is distributed in the hope that it will be useful,
+but WITHOUT ANY WARRANTY; without even the implied warranty of
+MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the
+GNU General Public License for more details.
+
+You should have received a copy of the GNU General Public License
+along with this program.  If not, see <http://www.gnu.org/licenses/>.
+
+=head2 Documentation license I
+
+Permission is granted to copy, distribute and/or modify this
+documentation under the terms of the GNU Free Documentation License,
+Version 1.3 or any later version published by the Free Software
+Foundation; with no Invariant Sections, with no Front-Cover Texts, and
+with no Back-Cover Texts.  A copy of the license is included in the
+file LICENSES/GFDL-1.3-or-later.txt.
+
+
+=head2 Documentation license II
+
+You are free:
+
+=over 9
+
+=item B<to Share>
+
+to copy, distribute and transmit the work
+
+=item B<to Remix>
+
+to adapt the work
+
+=back
+
+Under the following conditions:
+
+=over 9
+
+=item B<Attribution>
+
+You must attribute the work in the manner specified by the author or
+licensor (but not in any way that suggests that they endorse you or
+your use of the work).
+
+=item B<Share Alike>
+
+If you alter, transform, or build upon this work, you may distribute
+the resulting work only under the same, similar or a compatible
+license.
+
+=back
+
+With the understanding that:
+
+=over 9
+
+=item B<Waiver>
+
+Any of the above conditions can be waived if you get permission from
+the copyright holder.
+
+=item B<Public Domain>
+
+Where the work or any of its elements is in the public domain under
+applicable law, that status is in no way affected by the license.
+
+=item B<Other Rights>
+
+In no way are any of the following rights affected by the license:
+
+=over 2
+
+=item *
+
+Your fair dealing or fair use rights, or other applicable
+copyright exceptions and limitations;
+
+=item *
+
+The author's moral rights;
+
+=item *
+
+Rights other persons may have either in the work itself or in
+how the work is used, such as publicity or privacy rights.
+
+=back
+
+=back
+
+=over 9
+
+=item B<Notice>
+
+For any reuse or distribution, you must make clear to others the
+license terms of this work.
+
+=back
+
+A copy of the full license is included in the file as
+LICENCES/CC-BY-SA-4.0.txt
+
+
+=head1 DEPENDENCIES
+
+B<env_parallel> uses GNU B<parallel>.
+
+
+=head1 SEE ALSO
+
+B<parallel>(1), B<ash>(1), B<bash>(1), B<csh>(1), B<dash>(1),
+B<fish>(1), B<ksh>(1), B<pdksh>(1) B<tcsh>(1), B<zsh>(1).
+
+
+=cut
diff --git a/src/env_parallel.sh b/src/env_parallel.sh
new file mode 100755
index 0000000..666c9be
--- /dev/null
+++ b/src/env_parallel.sh
@@ -0,0 +1,430 @@
+#!/usr/bin/env sh
+
+# This file must be sourced in sh:
+#
+#   . `which env_parallel.sh`
+#
+# after which 'env_parallel' works
+#
+#
+# Copyright (C) 2016-2022 Ole Tange, http://ole.tange.dk and Free
+# Software Foundation, Inc.
+#
+# This program is free software; you can redistribute it and/or modify
+# it under the terms of the GNU General Public License as published by
+# the Free Software Foundation; either version 3 of the License, or
+# (at your option) any later version.
+#
+# This program is distributed in the hope that it will be useful, but
+# WITHOUT ANY WARRANTY; without even the implied warranty of
+# MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the GNU
+# General Public License for more details.
+#
+# You should have received a copy of the GNU General Public License
+# along with this program; if not, see <http://www.gnu.org/licenses/>
+# or write to the Free Software Foundation, Inc., 51 Franklin St,
+# Fifth Floor, Boston, MA 02110-1301 USA
+#
+# SPDX-FileCopyrightText: 2021-2022 Ole Tange, http://ole.tange.dk and Free Software and Foundation, Inc.
+# SPDX-License-Identifier: GPL-3.0-or-later
+# shellcheck disable=SC2006
+
+env_parallel() {
+    # env_parallel.sh
+
+    _names_of_ALIASES() {
+	# alias fails on Unixware 5
+	for _i in `alias 2>/dev/null | perl -ne 's/^alias //;s/^(\S+)=.*/$1/ && print' 2>/dev/null`; do
+	    # Check if this name really is an alias
+	    # or just part of a multiline alias definition
+	    if alias "$_i" >/dev/null 2>/dev/null; then
+		echo "$_i"
+	    fi
+	done
+    }
+    _bodies_of_ALIASES() {
+	# alias may return:
+	#   myalias='definition' (GNU/Linux ash)
+	#   alias myalias='definition' (FreeBSD ash)
+	# so remove 'alias ' from first line
+	for _i in "$@"; do
+		echo 'alias '"`alias "$_i" | perl -pe '1..1 and s/^alias //'`"
+	done
+    }
+    _names_of_maybe_FUNCTIONS() {
+	set | perl -ne '/^([A-Z_0-9]+)\s*\(\)\s*\{?$/i and print "$1\n"'
+    }
+    _names_of_FUNCTIONS() {
+	# myfunc is a function
+	# shellcheck disable=SC2046
+	LANG=C type `_names_of_maybe_FUNCTIONS` |
+	    perl -ne '/^(\S+) is a function$/ and not $seen{$1}++ and print "$1\n"'
+    }
+    _bodies_of_FUNCTIONS() {
+	LANG=C type "$@" | perl -ne '/^(\S+) is a function$/ or print'
+    }
+    _names_of_VARIABLES() {
+	# This may screw up if variables contain \n and =
+	set | perl -ne 's/^(\S+?)=.*/$1/ and print;'
+    }
+    _bodies_of_VARIABLES() {
+	# Crappy typeset -p
+	for _i in "$@"
+	do
+	    perl -e 'print @ARGV' "$_i="
+	    eval echo "\"\$$_i\"" | perl -e '$/=undef; $a=<>; chop($a); print $a' |
+		perl -pe 's/[\002-\011\013-\032\\\#\?\`\(\)\{\}\[\]\^\*\<\=\>\~\|\; \"\!\$\&\202-\377]/\\$&/go;'"s/'/\\\'/g; s/[\n]/'\\n'/go;";
+	    echo
+	done
+    }
+    _ignore_HARDCODED() {
+	# These names cannot be detected
+	echo '(_|TIMEOUT|IFS)'
+    }
+    _ignore_READONLY() {
+	# shellcheck disable=SC1078,SC1079,SC2026
+	readonly | perl -e '@r = map {
+                chomp;
+                # sh on UnixWare: readonly TIMEOUT
+	        # ash: readonly var='val'
+	        # ksh: var='val'
+		# mksh: PIPESTATUS[0]
+                s/^(readonly )?([^=\[ ]*?)(\[\d+\])?(=.*|)$/$2/ or
+	        # bash: declare -ar BASH_VERSINFO=([0]="4" [1]="4")
+	        # zsh: typeset -r var='val'
+                  s/^\S+\s+\S+\s+(\S[^=]*)(=.*|$)/$1/;
+                $_ } <>;
+            $vars = join "|",map { quotemeta $_ } @r;
+            print $vars ? "($vars)" : "(,,nO,,VaRs,,)";
+            '
+    }
+    _remove_bad_NAMES() {
+	# Do not transfer vars and funcs from env_parallel
+	# shellcheck disable=SC2006
+	_ignore_RO="`_ignore_READONLY`"
+	# shellcheck disable=SC2006
+	_ignore_HARD="`_ignore_HARDCODED`"
+	# Macos-grep does not like long patterns
+	# Old Solaris grep does not support -E
+	# Perl Version of:
+	# grep -Ev '^(...)$' |
+	perl -ne '/^(
+		     PARALLEL_ENV|
+		     PARALLEL_TMP|
+		     _alias_NAMES|
+		     _bodies_of_ALIASES|
+		     _bodies_of_FUNCTIONS|
+		     _bodies_of_VARIABLES|
+		     _error_PAR|
+		     _function_NAMES|
+		     _get_ignored_VARS|
+		     _grep_REGEXP|
+		     _ignore_HARD|
+		     _ignore_HARDCODED|
+		     _ignore_READONLY|
+		     _ignore_RO|
+		     _ignore_UNDERSCORE|
+		     _list_alias_BODIES|
+		     _list_function_BODIES|
+		     _list_variable_VALUES|
+		     _make_grep_REGEXP|
+		     _names_of_ALIASES|
+		     _names_of_FUNCTIONS|
+		     _names_of_VARIABLES|
+		     _names_of_maybe_FUNCTIONS|
+		     _parallel_exit_CODE|
+		     _prefix_PARALLEL_ENV|
+		     _prefix_PARALLEL_ENV|
+		     _remove_bad_NAMES|
+		     _remove_readonly|
+		     _variable_NAMES|
+		     _warning_PAR|
+		     _which_PAR)$/x and next;
+	    # Filter names matching --env
+	    /^'"$_grep_REGEXP"'$/ or next;
+            /^'"$_ignore_UNDERSCORE"'$/ and next;
+	    # Remove readonly variables
+            /^'"$_ignore_RO"'$/ and next;
+            /^'"$_ignore_HARD"'$/ and next;
+            print;'
+    }
+    _get_ignored_VARS() {
+        perl -e '
+            for(@ARGV){
+                $next_is_env and push @envvar, split/,/, $_;
+                $next_is_env=/^--env$/;
+            }
+            if(grep { /^_$/ } @envvar) {
+                if(not open(IN, "<", "$ENV{HOME}/.parallel/ignored_vars")) {
+             	    print STDERR "parallel: Error: ",
+            	    "Run \"parallel --record-env\" in a clean environment first.\n";
+                } else {
+            	    chomp(@ignored_vars = <IN>);
+                }
+            }
+            if($ENV{PARALLEL_IGNORED_NAMES}) {
+                push @ignored_vars, split/\s+/, $ENV{PARALLEL_IGNORED_NAMES};
+                chomp @ignored_vars;
+            }
+            $vars = join "|",map { quotemeta $_ } @ignored_vars;
+	    print $vars ? "($vars)" : "(,,nO,,VaRs,,)";
+            ' -- "$@"
+    }
+
+    # Get the --env variables if set
+    # --env _ should be ignored
+    # and convert  a b c  to (a|b|c)
+    # If --env not set: Match everything (.*)
+    _make_grep_REGEXP() {
+        perl -e '
+            for(@ARGV){
+                /^_$/ and $next_is_env = 0;
+                $next_is_env and push @envvar, split/,/, $_;
+                $next_is_env = /^--env$/;
+            }
+            $vars = join "|",map { quotemeta $_ } @envvar;
+            print $vars ? "($vars)" : "(.*)";
+            ' -- "$@"
+    }
+    _which_PAR() {
+	# type returns:
+	#   ll is an alias for ls -l (in ash)
+	#   bash is a tracked alias for /bin/bash
+	#   true is a shell builtin (in bash)
+	#   myfunc is a function (in bash)
+	#   myfunc is a shell function (in zsh)
+	#   which is /usr/bin/which (in sh, bash)
+	#   which is hashed (/usr/bin/which)
+	#   gi is aliased to `grep -i' (in bash)
+	#   aliased to `alias | /usr/bin/which --tty-only --read-alias --show-dot --show-tilde'
+	# Return 0 if found, 1 otherwise
+	LANG=C type "$@" |
+	    perl -pe '$exit += (s/ is an alias for .*// ||
+	                        s/ is aliased to .*// ||
+                                s/ is a function// ||
+                                s/ is a shell function// ||
+                                s/ is a shell builtin// ||
+                                s/.* is hashed .(\S+).$/$1/ ||
+                                s/.* is (a tracked alias for )?//);
+                      END { exit not $exit }'
+    }
+    _warning_PAR() {
+	echo "env_parallel: Warning: $*" >&2
+    }
+    _error_PAR() {
+	echo "env_parallel: Error: $*" >&2
+    }
+
+    if _which_PAR parallel >/dev/null; then
+	true parallel found in path
+    else
+	# shellcheck disable=SC2016
+	_error_PAR 'parallel must be in $PATH.'
+	return 255
+    fi
+
+    # Grep regexp for vars given by --env
+    # shellcheck disable=SC2006
+    _grep_REGEXP="`_make_grep_REGEXP \"$@\"`"
+    unset _make_grep_REGEXP
+
+    # Deal with --env _
+    # shellcheck disable=SC2006
+    _ignore_UNDERSCORE="`_get_ignored_VARS \"$@\"`"
+    unset _get_ignored_VARS
+
+    # --record-env
+    if perl -e 'exit grep { /^--record-env$/ } @ARGV' -- "$@"; then
+	true skip
+    else
+	(_names_of_ALIASES;
+	 _names_of_FUNCTIONS;
+	 _names_of_VARIABLES) |
+	    cat > "$HOME"/.parallel/ignored_vars
+	return 0
+    fi
+
+    # --session
+    if perl -e 'exit grep { /^--session$/ } @ARGV' -- "$@"; then
+	true skip
+    else
+	# Insert ::: between each level of session
+	# so you can pop off the last ::: at --end-session
+	# shellcheck disable=SC2006
+	PARALLEL_IGNORED_NAMES="`echo \"$PARALLEL_IGNORED_NAMES\";
+          echo :::;
+          (_names_of_ALIASES;
+	   _names_of_FUNCTIONS;
+	   _names_of_VARIABLES) | perl -ne '
+	    BEGIN{
+	      map { $ignored_vars{$_}++ }
+                split/\s+/, $ENV{PARALLEL_IGNORED_NAMES};
+	    }
+	    chomp;
+	    for(split/\s+/) {
+	      if(not $ignored_vars{$_}) {
+	        print $_,\"\\n\";
+	      }
+            }
+	    '`"
+	export PARALLEL_IGNORED_NAMES
+	return 0
+    fi
+    if perl -e 'exit grep { /^--end.?session$/ } @ARGV' -- "$@"; then
+	true skip
+    else
+	# Pop off last ::: from PARALLEL_IGNORED_NAMES
+	# shellcheck disable=SC2006
+	PARALLEL_IGNORED_NAMES="`perl -e '
+          $ENV{PARALLEL_IGNORED_NAMES} =~ s/(.*):::.*?$/$1/s;
+	  print $ENV{PARALLEL_IGNORED_NAMES}
+        '`"
+	return 0
+    fi
+    # Grep alias names
+    # shellcheck disable=SC2006
+    _alias_NAMES="`_names_of_ALIASES | _remove_bad_NAMES | xargs echo`"
+    _list_alias_BODIES="_bodies_of_ALIASES $_alias_NAMES"
+    if [ "$_alias_NAMES" = "" ] ; then
+	# no aliases selected
+	_list_alias_BODIES="true"
+    fi
+    unset _alias_NAMES
+
+    # Grep function names
+    # shellcheck disable=SC2006
+    _function_NAMES="`_names_of_FUNCTIONS | _remove_bad_NAMES | xargs echo`"
+    _list_function_BODIES="_bodies_of_FUNCTIONS $_function_NAMES"
+    if [ "$_function_NAMES" = "" ] ; then
+	# no functions selected
+	_list_function_BODIES="true"
+    fi
+    unset _function_NAMES
+
+    # Grep variable names
+    # shellcheck disable=SC2006
+    _variable_NAMES="`_names_of_VARIABLES | _remove_bad_NAMES | xargs echo`"
+    _list_variable_VALUES="_bodies_of_VARIABLES $_variable_NAMES"
+    if [ "$_variable_NAMES" = "" ] ; then
+	# no variables selected
+	_list_variable_VALUES="true"
+    fi
+    unset _variable_NAMES
+
+    # shellcheck disable=SC2006
+    PARALLEL_ENV="`
+        $_list_alias_BODIES;
+        $_list_function_BODIES;
+        $_list_variable_VALUES;
+    `"
+    export PARALLEL_ENV
+    unset _list_alias_BODIES _list_variable_VALUES _list_function_BODIES
+    unset _bodies_of_ALIASES _bodies_of_VARIABLES _bodies_of_FUNCTIONS
+    unset _names_of_ALIASES _names_of_VARIABLES _names_of_FUNCTIONS
+    unset _ignore_HARDCODED _ignore_READONLY _ignore_UNDERSCORE
+    unset _remove_bad_NAMES _grep_REGEXP
+    unset _prefix_PARALLEL_ENV
+    # Test if environment is too big by running 'true'
+    # shellcheck disable=SC2006,SC2092
+    if `_which_PAR true` >/dev/null 2>/dev/null ; then
+	parallel "$@"
+	_parallel_exit_CODE=$?
+	# Clean up variables/functions
+	unset PARALLEL_ENV
+	unset _which_PAR _which_TRUE
+	unset _warning_PAR _error_PAR
+	# Unset _parallel_exit_CODE before return
+	eval "unset _parallel_exit_CODE; return $_parallel_exit_CODE"
+    else
+	unset PARALLEL_ENV;
+	_error_PAR "Your environment is too big."
+	_error_PAR "You can try 3 different approaches:"
+	_error_PAR "1. Run 'env_parallel --session' before you set"
+	_error_PAR "   variables or define functions."
+	_error_PAR "2. Use --env and only mention the names to copy."
+	_error_PAR "3. Try running this in a clean environment once:"
+	_error_PAR "     env_parallel --record-env"
+	_error_PAR "   And then use '--env _'"
+	_error_PAR "For details see: man env_parallel"
+	return 255
+    fi
+}
+
+parset() {
+    _parset_PARALLEL_PRG=parallel
+    _parset_main "$@"
+}
+
+env_parset() {
+    _parset_PARALLEL_PRG=env_parallel
+    _parset_main "$@"
+}
+
+_parset_main() {
+    # If $1 contains ',' or space:
+    #   Split on , to get the destination variable names
+    # If $1 is a single destination variable name:
+    #   Treat it as the name of an array
+    #
+    #   # Create array named myvar
+    #   parset myvar echo ::: {1..10}
+    #   echo ${myvar[5]}
+    #
+    #   # Put output into $var_a $var_b $var_c
+    #   varnames=(var_a var_b var_c)
+    #   parset "${varnames[*]}" echo ::: {1..3}
+    #   echo $var_c
+    #
+    #   # Put output into $var_a4 $var_b4 $var_c4
+    #   parset "var_a4 var_b4 var_c4" echo ::: {1..3}
+    #   echo $var_c4
+
+    _parset_NAME="$1"
+    if [ "$_parset_NAME" = "" ] ; then
+	echo parset: Error: No destination variable given. >&2
+	echo parset: Error: Try: >&2
+	echo parset: Error: ' ' parset myarray echo ::: foo bar >&2
+	return 255
+    fi
+    if [ "$_parset_NAME" = "--help" ] ; then
+	echo parset: Error: Usage: >&2
+	echo parset: Error: ' ' parset varname GNU Parallel options and command >&2
+	echo
+	parallel --help
+	return 255
+    fi
+    if [ "$_parset_NAME" = "--version" ] ; then
+	# shellcheck disable=SC2006
+	echo "parset 20221122 (GNU parallel `parallel --minversion 1`)"
+	echo "Copyright (C) 2007-2022 Ole Tange, http://ole.tange.dk and Free Software"
+	echo "Foundation, Inc."
+	echo "License GPLv3+: GNU GPL version 3 or later <https://gnu.org/licenses/gpl.html>"
+	echo "This is free software: you are free to change and redistribute it."
+	echo "GNU parallel comes with no warranty."
+	echo
+	echo "Web site: https://www.gnu.org/software/parallel"
+	echo
+	echo "When using programs that use GNU Parallel to process data for publication"
+	echo "please cite as described in 'parallel --citation'."
+	echo
+	return 255
+    fi
+    shift
+
+    # Bash: declare -A myassoc=( )
+    # Zsh: typeset -A myassoc=( )
+    # Ksh: typeset -A myassoc=( )
+    # shellcheck disable=SC2039,SC2169
+    if (typeset -p "$_parset_NAME" 2>/dev/null; echo) |
+	    perl -ne 'exit not (/^declare[^=]+-A|^typeset[^=]+-A/)' ; then
+	# This is an associative array
+	# shellcheck disable=SC2006
+	eval "`$_parset_PARALLEL_PRG -k --_parset assoc,"$_parset_NAME" "$@"`"
+	# The eval returns the function!
+    else
+	# This is a normal array or a list of variable names
+	# shellcheck disable=SC2006
+	eval "`$_parset_PARALLEL_PRG -k --_parset var,"$_parset_NAME" "$@"`"
+	# The eval returns the function!
+    fi
+}
diff --git a/src/env_parallel.tcsh b/src/env_parallel.tcsh
new file mode 100755
index 0000000..8358ec1
--- /dev/null
+++ b/src/env_parallel.tcsh
@@ -0,0 +1,142 @@
+#!/usr/bin/env tcsh
+
+# This file must be sourced in tcsh:
+#
+#   source `which env_parallel.tcsh`
+#
+# after which 'env_parallel' works
+#
+#
+# Copyright (C) 2016-2022 Ole Tange, http://ole.tange.dk and Free
+# Software Foundation, Inc.
+#
+# This program is free software; you can redistribute it and/or modify
+# it under the terms of the GNU General Public License as published by
+# the Free Software Foundation; either version 3 of the License, or
+# (at your option) any later version.
+#
+# This program is distributed in the hope that it will be useful, but
+# WITHOUT ANY WARRANTY; without even the implied warranty of
+# MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the GNU
+# General Public License for more details.
+#
+# You should have received a copy of the GNU General Public License
+# along with this program; if not, see <http://www.gnu.org/licenses/>
+# or write to the Free Software Foundation, Inc., 51 Franklin St,
+# Fifth Floor, Boston, MA 02110-1301 USA
+#
+# SPDX-FileCopyrightText: 2021-2022 Ole Tange, http://ole.tange.dk and Free Software and Foundation, Inc.
+# SPDX-License-Identifier: GPL-3.0-or-later
+
+set _parallel_exit_CODE=0
+if ("`alias env_parallel`" == '' || ! $?PARALLEL_CSH) then
+  # Activate alias
+  alias env_parallel '(setenv PARALLEL_CSH "\!*"; source `which env_parallel.csh`)'
+else
+  # Get the --env variables if set
+  # --env _ should be ignored
+  # and convert  a b c  to (a|b|c)
+  # If --env not set: Match everything (.*)
+
+  # simple 'tempfile': Return nonexisting filename: /tmp/parXXXXX
+  alias _tempfile 'perl -e do\{\$t\=\"/tmp/par\".join\"\",map\{\(0..9,\"a\"..\"z\",\"A\"..\"Z\"\)\[rand\(62\)\]\}\(1..5\)\;\}while\(-e\$t\)\;print\"\$t\\n\"'
+  set _tMpscRIpt=`_tempfile`
+
+  cat <<'EOF' > $_tMpscRIpt
+            #!/usr/bin/perl
+
+            for(@ARGV){
+                /^_$/ and $next_is_env = 0;
+                $next_is_env and push @envvar, split/,/, $_;
+                $next_is_env = /^--env$/;
+            }
+            $vars = join "|",map { quotemeta $_ } @envvar;
+            print $vars ? "($vars)" : "(.*)";
+'EOF'
+  set _grep_REGEXP="`perl $_tMpscRIpt -- $PARALLEL_CSH`"
+
+  # Deal with --env _
+  cat <<'EOF' > $_tMpscRIpt
+            #!/usr/bin/perl
+
+            for(@ARGV){
+                $next_is_env and push @envvar, split/,/, $_;
+                $next_is_env=/^--env$/;
+            }
+            if(grep { /^_$/ } @envvar) {
+                if(not open(IN, "<", "$ENV{HOME}/.parallel/ignored_vars")) {
+             	    print STDERR "parallel: Error: ",
+            	    "Run \"parallel --record-env\" in a clean environment first.\n";
+                } else {
+            	    chomp(@ignored_vars = <IN>);
+            	    $vars = join "|",map { quotemeta $_ } @ignored_vars;
+		    print $vars ? "($vars)" : "(,,nO,,VaRs,,)";
+                }
+            }
+'EOF'
+  set _ignore_UNDERSCORE="`perl $_tMpscRIpt -- $PARALLEL_CSH`"
+  rm $_tMpscRIpt
+
+  # Get the scalar and array variable names
+  set _vARnAmES=(`set | perl -ne 's/\s.*//; /^(#|_|killring|prompt2|command|PARALLEL_ENV|PARALLEL_TMP)$/ and next; /^'"$_grep_REGEXP"'$/ or next; /^'"$_ignore_UNDERSCORE"'$/ and next; print'`)
+
+  # Make a tmpfile for the variable definitions
+  set _tMpvARfILe=`_tempfile`
+  touch $_tMpvARfILe
+  # Make a tmpfile for the variable definitions + alias
+  set _tMpaLLfILe=`_tempfile`
+  foreach _vARnAmE ($_vARnAmES);
+    # These 3 lines break in csh ver. 20110502-3
+    # if not defined: next
+    eval if'(! $?'$_vARnAmE') continue'
+    # if $#myvar <= 1 echo scalar_myvar=$var
+    eval if'(${#'$_vARnAmE'} <= 1) echo scalar_'$_vARnAmE'='\"\$$_vARnAmE\" >> $_tMpvARfILe;
+    # if $#myvar > 1 echo array_myvar=$var
+    eval if'(${#'$_vARnAmE'} > 1) echo array_'$_vARnAmE'="$'$_vARnAmE'"' >> $_tMpvARfILe;
+  end
+  unset _vARnAmE _vARnAmES
+  # shell quote variables (--plain needed due to ignore if $PARALLEL is set)
+  # Convert 'scalar_myvar=...' to 'set myvar=...'
+  # Convert 'array_myvar=...' to 'set array=(...)'
+  cat $_tMpvARfILe | parallel --plain --shellquote |  perl -pe 's/^scalar_(\S+).=/set $1=/ or s/^array_(\S+).=(.*)/set $1=($2)/ && s/\\ / /g;' > $_tMpaLLfILe
+  # Cleanup
+  rm $_tMpvARfILe; unset _tMpvARfILe
+
+# ALIAS TO EXPORT ALIASES:
+
+#   Quote ' by putting it inside "
+#   s/'/'"'"'/g;
+#   ' => \047 " => \042
+#   s/\047/\047\042\047\042\047/g;
+#   Quoted: s/\\047/\\047\\042\\047\\042\\047/g\;
+
+#   Remove () from second column
+#   s/^(\S+)(\s+)\((.*)\)/\1\2\3/;
+#   Quoted: s/\^\(\\S+\)\(\\s+\)\\\(\(.\*\)\\\)/\\1\\2\\3/\;
+
+#   Add ' around second column
+#   s/^(\S+)(\s+)(.*)/\1\2'\3'/
+#   \047 => '
+#   s/^(\S+)(\s+)(.*)/\1\2\047\3\047/;
+#   Quoted: s/\^\(\\S+\)\(\\s+\)\(.\*\)/\\1\\2\\047\\3\\047/\;
+
+#   Quote ! as \!
+#   s/\!/\\\!/g;
+#   Quoted: s/\\\!/\\\\\\\!/g;
+
+#   Prepend with "\nalias "
+#   s/^/\001alias /;
+#   Quoted: s/\^/\\001alias\ /\;
+  alias | \
+    perl -ne '/^'"$_grep_REGEXP"'/ or next; /^'"$_ignore_UNDERSCORE"'[^_a-zA-Z]/ and next; print' | \
+    perl -pe s/\\047/\\047\\042\\047\\042\\047/g\;s/\^\(\\S+\)\(\\s+\)\\\(\(.\*\)\\\)/\\1\\2\\3/\;s/\^\(\\S+\)\(\\s+\)\(.\*\)/\\1\\2\\047\\3\\047/\;s/\^/\\001alias\ /\;s/\\\!/\\\\\\\!/g >> $_tMpaLLfILe
+
+  setenv PARALLEL_ENV "`cat $_tMpaLLfILe; rm $_tMpaLLfILe`";
+  unset _tMpaLLfILe;
+  # Use $PARALLEL_CSH set in calling alias
+  parallel
+  set _parallel_exit_CODE=$status
+  setenv PARALLEL_ENV
+  setenv PARALLEL_CSH
+endif
+(exit $_parallel_exit_CODE)
diff --git a/src/env_parallel.zsh b/src/env_parallel.zsh
new file mode 100755
index 0000000..1320142
--- /dev/null
+++ b/src/env_parallel.zsh
@@ -0,0 +1,405 @@
+#!/usr/bin/env zsh
+
+# This file must be sourced in zsh:
+#
+#   source =env_parallel.zsh
+#
+# after which 'env_parallel' works
+#
+#
+# Copyright (C) 2016-2022 Ole Tange, http://ole.tange.dk and Free
+# Software Foundation, Inc.
+#
+# This program is free software; you can redistribute it and/or modify
+# it under the terms of the GNU General Public License as published by
+# the Free Software Foundation; either version 3 of the License, or
+# (at your option) any later version.
+#
+# This program is distributed in the hope that it will be useful, but
+# WITHOUT ANY WARRANTY; without even the implied warranty of
+# MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the GNU
+# General Public License for more details.
+#
+# You should have received a copy of the GNU General Public License
+# along with this program; if not, see <http://www.gnu.org/licenses/>
+# or write to the Free Software Foundation, Inc., 51 Franklin St,
+# Fifth Floor, Boston, MA 02110-1301 USA
+#
+# SPDX-FileCopyrightText: 2021-2022 Ole Tange, http://ole.tange.dk and Free Software and Foundation, Inc.
+# SPDX-License-Identifier: GPL-3.0-or-later
+# shellcheck disable=SC2006
+
+env_parallel() {
+    # env_parallel.zsh
+
+    _names_of_ALIASES() {
+	print -l ${(k)aliases}
+    }
+    _bodies_of_ALIASES() {
+	local _i
+	for _i ($@); do
+		echo 'alias '"$(alias $_i)"
+	done
+    }
+    _names_of_FUNCTIONS() {
+	print -l ${(k)functions}
+    }
+    _bodies_of_FUNCTIONS() {
+	typeset -f "$@"
+    }
+    _names_of_VARIABLES() {
+	print -l ${(k)parameters}
+    }
+    _bodies_of_VARIABLES() {
+	typeset -p "$@"
+    }
+    _ignore_HARDCODED() {
+	# These names cannot be detected
+	echo '([-\?\#\!\$\*\@\_0]|zsh_eval_context|ZSH_EVAL_CONTEXT|LINENO|IFS|commands|functions|options|aliases|EUID|EGID|UID|GID|dis_patchars|patchars|terminfo|galiases|keymaps|parameters|jobdirs|dirstack|functrace|funcsourcetrace|zsh_scheduled_events|dis_aliases|dis_reswords|dis_saliases|modules|reswords|saliases|widgets|userdirs|historywords|nameddirs|termcap|dis_builtins|dis_functions|jobtexts|funcfiletrace|dis_galiases|builtins|history|jobstates|funcstack|run-help)'
+    }
+    _ignore_READONLY() {
+	typeset -pr | perl -e '@r = map {
+                chomp;
+                # sh on UnixWare: readonly TIMEOUT
+	        # ash: readonly var='val'
+	        # ksh: var='val'
+		# mksh: PIPESTATUS[0]
+                s/^(readonly )?([^=\[ ]*?)(\[\d+\])?(=.*|)$/$2/ or
+	        # bash: declare -ar BASH_VERSINFO=([0]="4" [1]="4")
+	        # zsh: typeset -r var='val'
+                  s/^\S+\s+\S+\s+(\S[^=]*)(=.*|$)/$1/;
+                $_ } <>;
+            $vars = join "|",map { quotemeta $_ } @r;
+            print $vars ? "($vars)" : "(,,nO,,VaRs,,)";
+            '
+    }
+    _remove_bad_NAMES() {
+	# Do not transfer vars and funcs from env_parallel
+	# shellcheck disable=SC2006
+	_ignore_RO="`_ignore_READONLY`"
+	# shellcheck disable=SC2006
+	_ignore_HARD="`_ignore_HARDCODED`"
+	# Macos-grep does not like long patterns
+	# Old Solaris grep does not support -E
+	# Perl Version of:
+	# grep -Ev '^(...)$' |
+	perl -ne '/^(
+		     PARALLEL_ENV|
+		     PARALLEL_TMP|
+		     _alias_NAMES|
+		     _bodies_of_ALIASES|
+		     _bodies_of_FUNCTIONS|
+		     _bodies_of_VARIABLES|
+		     _error_PAR|
+		     _function_NAMES|
+		     _get_ignored_VARS|
+		     _grep_REGEXP|
+		     _ignore_HARD|
+		     _ignore_HARDCODED|
+		     _ignore_READONLY|
+		     _ignore_RO|
+		     _ignore_UNDERSCORE|
+		     _list_alias_BODIES|
+		     _list_function_BODIES|
+		     _list_variable_VALUES|
+		     _make_grep_REGEXP|
+		     _names_of_ALIASES|
+		     _names_of_FUNCTIONS|
+		     _names_of_VARIABLES|
+		     _names_of_maybe_FUNCTIONS|
+		     _parallel_exit_CODE|
+		     _prefix_PARALLEL_ENV|
+		     _prefix_PARALLEL_ENV|
+		     _remove_bad_NAMES|
+		     _remove_readonly|
+		     _variable_NAMES|
+		     _warning_PAR|
+		     _which_PAR)$/x and next;
+	    # Filter names matching --env
+	    /^'"$_grep_REGEXP"'$/ or next;
+            /^'"$_ignore_UNDERSCORE"'$/ and next;
+	    # Remove readonly variables
+            /^'"$_ignore_RO"'$/ and next;
+            /^'"$_ignore_HARD"'$/ and next;
+            print;'
+    }
+    _get_ignored_VARS() {
+        perl -e '
+            for(@ARGV){
+                $next_is_env and push @envvar, split/,/, $_;
+                $next_is_env=/^--env$/;
+            }
+            if(grep { /^_$/ } @envvar) {
+                if(not open(IN, "<", "$ENV{HOME}/.parallel/ignored_vars")) {
+             	    print STDERR "parallel: Error: ",
+            	    "Run \"parallel --record-env\" in a clean environment first.\n";
+                } else {
+            	    chomp(@ignored_vars = <IN>);
+                }
+            }
+            if($ENV{PARALLEL_IGNORED_NAMES}) {
+                push @ignored_vars, split/\s+/, $ENV{PARALLEL_IGNORED_NAMES};
+                chomp @ignored_vars;
+            }
+            $vars = join "|",map { quotemeta $_ } @ignored_vars;
+	    print $vars ? "($vars)" : "(,,nO,,VaRs,,)";
+            ' -- "$@"
+    }
+
+    # Get the --env variables if set
+    # --env _ should be ignored
+    # and convert  a b c  to (a|b|c)
+    # If --env not set: Match everything (.*)
+    _make_grep_REGEXP() {
+        perl -e '
+            for(@ARGV){
+                /^_$/ and $next_is_env = 0;
+                $next_is_env and push @envvar, split/,/, $_;
+                $next_is_env = /^--env$/;
+            }
+            $vars = join "|",map { quotemeta $_ } @envvar;
+            print $vars ? "($vars)" : "(.*)";
+            ' -- "$@"
+    }
+    _which_PAR() {
+	# type returns:
+	#   ll is an alias for ls -l (in ash)
+	#   bash is a tracked alias for /bin/bash
+	#   true is a shell builtin (in bash)
+	#   myfunc is a function (in bash)
+	#   myfunc is a shell function (in zsh)
+	#   which is /usr/bin/which (in sh, bash)
+	#   which is hashed (/usr/bin/which)
+	#   gi is aliased to `grep -i' (in bash)
+	#   aliased to `alias | /usr/bin/which --tty-only --read-alias --show-dot --show-tilde'
+	# Return 0 if found, 1 otherwise
+	LANG=C type "$@" |
+	    perl -pe '$exit += (s/ is an alias for .*// ||
+	                        s/ is aliased to .*// ||
+                                s/ is a function// ||
+                                s/ is a shell function// ||
+                                s/ is a shell builtin// ||
+                                s/.* is hashed .(\S+).$/$1/ ||
+                                s/.* is (a tracked alias for )?//);
+                      END { exit not $exit }'
+    }
+    _warning_PAR() {
+	echo "env_parallel: Warning: $*" >&2
+    }
+    _error_PAR() {
+	echo "env_parallel: Error: $*" >&2
+    }
+
+    if _which_PAR parallel >/dev/null; then
+	true parallel found in path
+    else
+	# shellcheck disable=SC2016
+	_error_PAR 'parallel must be in $PATH.'
+	return 255
+    fi
+
+    # Grep regexp for vars given by --env
+    # shellcheck disable=SC2006
+    _grep_REGEXP="`_make_grep_REGEXP \"$@\"`"
+    unset _make_grep_REGEXP
+
+    # Deal with --env _
+    # shellcheck disable=SC2006
+    _ignore_UNDERSCORE="`_get_ignored_VARS \"$@\"`"
+    unset _get_ignored_VARS
+
+    # --record-env
+    if perl -e 'exit grep { /^--record-env$/ } @ARGV' -- "$@"; then
+	true skip
+    else
+	(_names_of_ALIASES;
+	 _names_of_FUNCTIONS;
+	 _names_of_VARIABLES) |
+	    cat > "$HOME"/.parallel/ignored_vars
+	return 0
+    fi
+
+    # --session
+    if perl -e 'exit grep { /^--session$/ } @ARGV' -- "$@"; then
+	true skip
+    else
+	# Insert ::: between each level of session
+	# so you can pop off the last ::: at --end-session
+	# shellcheck disable=SC2006
+	PARALLEL_IGNORED_NAMES="`echo \"$PARALLEL_IGNORED_NAMES\";
+          echo :::;
+          (_names_of_ALIASES;
+	   _names_of_FUNCTIONS;
+	   _names_of_VARIABLES) | perl -ne '
+	    BEGIN{
+	      map { $ignored_vars{$_}++ }
+                split/\s+/, $ENV{PARALLEL_IGNORED_NAMES};
+	    }
+	    chomp;
+	    for(split/\s+/) {
+	      if(not $ignored_vars{$_}) {
+	        print $_,\"\\n\";
+	      }
+            }
+	    '`"
+	export PARALLEL_IGNORED_NAMES
+	return 0
+    fi
+    if perl -e 'exit grep { /^--end.?session$/ } @ARGV' -- "$@"; then
+	true skip
+    else
+	# Pop off last ::: from PARALLEL_IGNORED_NAMES
+	# shellcheck disable=SC2006
+	PARALLEL_IGNORED_NAMES="`perl -e '
+          $ENV{PARALLEL_IGNORED_NAMES} =~ s/(.*):::.*?$/$1/s;
+	  print $ENV{PARALLEL_IGNORED_NAMES}
+        '`"
+	return 0
+    fi
+    # Grep alias names
+    # shellcheck disable=SC2006
+    _alias_NAMES="`_names_of_ALIASES | _remove_bad_NAMES | xargs echo`"
+    _list_alias_BODIES="_bodies_of_ALIASES $_alias_NAMES"
+    if [ "$_alias_NAMES" = "" ] ; then
+	# no aliases selected
+	_list_alias_BODIES="true"
+    fi
+    unset _alias_NAMES
+
+    # Grep function names
+    # shellcheck disable=SC2006
+    _function_NAMES="`_names_of_FUNCTIONS | _remove_bad_NAMES | xargs echo`"
+    _list_function_BODIES="_bodies_of_FUNCTIONS $_function_NAMES"
+    if [ "$_function_NAMES" = "" ] ; then
+	# no functions selected
+	_list_function_BODIES="true"
+    fi
+    unset _function_NAMES
+
+    # Grep variable names
+    # shellcheck disable=SC2006
+    _variable_NAMES="`_names_of_VARIABLES | _remove_bad_NAMES | xargs echo`"
+    _list_variable_VALUES="_bodies_of_VARIABLES $_variable_NAMES"
+    if [ "$_variable_NAMES" = "" ] ; then
+	# no variables selected
+	_list_variable_VALUES="true"
+    fi
+    unset _variable_NAMES
+
+    # shellcheck disable=SC2006
+    PARALLEL_ENV="`
+        eval $_list_alias_BODIES;
+        eval $_list_function_BODIES;
+        eval $_list_variable_VALUES;
+    `"
+    export PARALLEL_ENV
+    unset _list_alias_BODIES _list_variable_VALUES _list_function_BODIES
+    unset _bodies_of_ALIASES _bodies_of_VARIABLES _bodies_of_FUNCTIONS
+    unset _names_of_ALIASES _names_of_VARIABLES _names_of_FUNCTIONS
+    unset _ignore_HARDCODED _ignore_READONLY _ignore_UNDERSCORE
+    unset _remove_bad_NAMES _grep_REGEXP
+    unset _prefix_PARALLEL_ENV
+    # Test if environment is too big by running 'true'
+    # shellcheck disable=SC2006,SC2092
+    if `_which_PAR true` >/dev/null 2>/dev/null ; then
+	parallel "$@"
+	_parallel_exit_CODE=$?
+	# Clean up variables/functions
+	unset PARALLEL_ENV
+	unset _which_PAR _which_TRUE
+	unset _warning_PAR _error_PAR
+	# Unset _parallel_exit_CODE before return
+	eval "unset _parallel_exit_CODE; return $_parallel_exit_CODE"
+    else
+	unset PARALLEL_ENV;
+	_error_PAR "Your environment is too big."
+	_error_PAR "You can try 3 different approaches:"
+	_error_PAR "1. Run 'env_parallel --session' before you set"
+	_error_PAR "   variables or define functions."
+	_error_PAR "2. Use --env and only mention the names to copy."
+	_error_PAR "3. Try running this in a clean environment once:"
+	_error_PAR "     env_parallel --record-env"
+	_error_PAR "   And then use '--env _'"
+	_error_PAR "For details see: man env_parallel"
+	return 255
+    fi
+}
+
+parset() {
+    _parset_PARALLEL_PRG=parallel
+    _parset_main "$@"
+}
+
+env_parset() {
+    _parset_PARALLEL_PRG=env_parallel
+    _parset_main "$@"
+}
+
+_parset_main() {
+    # If $1 contains ',' or space:
+    #   Split on , to get the destination variable names
+    # If $1 is a single destination variable name:
+    #   Treat it as the name of an array
+    #
+    #   # Create array named myvar
+    #   parset myvar echo ::: {1..10}
+    #   echo ${myvar[5]}
+    #
+    #   # Put output into $var_a $var_b $var_c
+    #   varnames=(var_a var_b var_c)
+    #   parset "${varnames[*]}" echo ::: {1..3}
+    #   echo $var_c
+    #
+    #   # Put output into $var_a4 $var_b4 $var_c4
+    #   parset "var_a4 var_b4 var_c4" echo ::: {1..3}
+    #   echo $var_c4
+
+    _parset_NAME="$1"
+    if [ "$_parset_NAME" = "" ] ; then
+	echo parset: Error: No destination variable given. >&2
+	echo parset: Error: Try: >&2
+	echo parset: Error: ' ' parset myarray echo ::: foo bar >&2
+	return 255
+    fi
+    if [ "$_parset_NAME" = "--help" ] ; then
+	echo parset: Error: Usage: >&2
+	echo parset: Error: ' ' parset varname GNU Parallel options and command >&2
+	echo
+	parallel --help
+	return 255
+    fi
+    if [ "$_parset_NAME" = "--version" ] ; then
+	# shellcheck disable=SC2006
+	echo "parset 20221122 (GNU parallel `parallel --minversion 1`)"
+	echo "Copyright (C) 2007-2022 Ole Tange, http://ole.tange.dk and Free Software"
+	echo "Foundation, Inc."
+	echo "License GPLv3+: GNU GPL version 3 or later <https://gnu.org/licenses/gpl.html>"
+	echo "This is free software: you are free to change and redistribute it."
+	echo "GNU parallel comes with no warranty."
+	echo
+	echo "Web site: https://www.gnu.org/software/parallel"
+	echo
+	echo "When using programs that use GNU Parallel to process data for publication"
+	echo "please cite as described in 'parallel --citation'."
+	echo
+	return 255
+    fi
+    shift
+
+    # Bash: declare -A myassoc=( )
+    # Zsh: typeset -A myassoc=( )
+    # Ksh: typeset -A myassoc=( )
+    # shellcheck disable=SC2039,SC2169
+    if (typeset -p "$_parset_NAME" 2>/dev/null; echo) |
+	    perl -ne 'exit not (/^declare[^=]+-A|^typeset[^=]+-A/)' ; then
+	# This is an associative array
+	# shellcheck disable=SC2006
+	eval "`$_parset_PARALLEL_PRG -k --_parset assoc,"$_parset_NAME" "$@"`"
+	# The eval returns the function!
+    else
+	# This is a normal array or a list of variable names
+	# shellcheck disable=SC2006
+	eval "`$_parset_PARALLEL_PRG -k --_parset var,"$_parset_NAME" "$@"`"
+	# The eval returns the function!
+    fi
+}
diff --git a/src/niceload b/src/niceload
new file mode 100755
index 0000000..2e59aee
--- /dev/null
+++ b/src/niceload
@@ -0,0 +1,1173 @@
+#!/usr/bin/perl -w
+
+# Copyright (C) 2004-2010 Ole Tange, http://ole.tange.dk
+#
+# Copyright (C) 2010-2022 Ole Tange, http://ole.tange.dk and
+# Free Software Foundation, Inc.
+#
+# This program is free software; you can redistribute it and/or modify
+# it under the terms of the GNU General Public License as published by
+# the Free Software Foundation; either version 3 of the License, or
+# (at your option) any later version.
+#
+# This program is distributed in the hope that it will be useful, but
+# WITHOUT ANY WARRANTY; without even the implied warranty of
+# MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the GNU
+# General Public License for more details.
+#
+# You should have received a copy of the GNU General Public License
+# along with this program; if not, see <http://www.gnu.org/licenses/>
+# or write to the Free Software Foundation, Inc., 51 Franklin St,
+# Fifth Floor, Boston, MA 02110-1301 USA
+#
+# SPDX-FileCopyrightText: 2021-2022 Ole Tange, http://ole.tange.dk and Free Software and Foundation, Inc.
+# SPDX-License-Identifier: GPL-3.0-or-later
+
+use strict;
+use Getopt::Long;
+$Global::progname="niceload";
+$Global::version = 20221122;
+Getopt::Long::Configure("bundling","require_order");
+get_options_from_array(\@ARGV) || die_usage();
+if($opt::version) {
+    version();
+    exit 0;
+}
+if($opt::help) {
+    help();
+    exit 0;
+}
+if($opt::factor and $opt::suspend) {
+    # You cannot have --suspend and --factor
+    help();
+    exit;
+}
+
+if(not (defined $opt::start_io or defined $opt::run_io
+	or defined $opt::start_load or defined $opt::run_load
+	or defined $opt::start_mem or defined $opt::run_mem
+	or defined $opt::start_noswap or defined $opt::run_noswap
+	or defined $opt::io or defined $opt::load
+	or defined $opt::mem or defined $opt::noswap)) {
+    # Default is --runload=1
+    $opt::run_load = 1;
+}
+
+if(not defined $opt::start_io) { $opt::start_io = $opt::io; }
+if(not defined $opt::run_io) { $opt::run_io = $opt::io; }
+if(not defined $opt::start_load) { $opt::start_load = $opt::load; }
+if(not defined $opt::run_load) { $opt::run_load = $opt::load; }
+if(not defined $opt::start_mem) { $opt::start_mem = $opt::mem; }
+if(not defined $opt::run_mem) { $opt::run_mem = $opt::mem; }
+if(not defined $opt::start_noswap) { $opt::start_noswap = $opt::noswap; }
+if(not defined $opt::run_noswap) { $opt::run_noswap = $opt::noswap; }
+
+if(defined $opt::load) { multiply_binary_prefix($opt::load); }
+if(defined $opt::baseline) { collect_net_baseline(); }
+
+my $limit = Limit->new();
+my $process = Process->new($opt::nice,@ARGV);
+$::exitstatus = 0;
+if(@opt::prg) {
+    # Find all pids of prg
+    my($children_of, $parent_of, $name_of) = pid_table();
+    my @exact_name_pids;
+    my @substr_name_pids;
+    for my $name (@opt::prg) {
+	push(@exact_name_pids,
+	     grep { index($name_of->{$_},$name) == 0 and $_ } keys %$name_of);
+	push(@substr_name_pids,
+	     grep { index($name_of->{$_},$name) != -1 and $_ } keys %$name_of);
+    }
+    # Remove current pid
+    @exact_name_pids = grep { $_ != $$ } @exact_name_pids;
+    @substr_name_pids = grep { $_ != $$ } @substr_name_pids;
+    my @pids;
+    if(@exact_name_pids) {
+	@pids = @exact_name_pids;
+    } elsif(@substr_name_pids) {
+	warning("@opt::prg no exact matches. Using substrings.");
+	my %name_pids;
+	for(sort @substr_name_pids) {
+	    # If the process has run for long, then time column will
+	    # enter the name, so remove leading digits
+	    $name_of->{$_} =~ s/^\d+ //;
+	    # Remove arguments
+	    $name_of->{$_} =~ s/ .*//;
+	    push @{$name_pids{$name_of->{$_}}},$_;
+	}
+	warning("Niceloading",
+		map { "$_ (".(join" ",sort @{$name_pids{$_}}).")" } keys %name_pids
+		);
+	@pids = @substr_name_pids;
+    } else {
+	error("@opt::prg no matches.");
+	exit(1);
+    }
+    $process->set_pid(@pids);
+    $::resume_process = $process;
+    $SIG{TERM} = $SIG{INT} = \&resume;
+} elsif(@opt::pid) {
+    # Support --pid 3567,25678
+    @opt::pid = map { split /,/, $_ } @opt::pid;
+    $process->set_pid(@opt::pid);
+    $::resume_process = $process;
+    $SIG{TERM} = $SIG{INT} = \&resume;
+} elsif (@ARGV) {
+    # Wait until limit is below start_limit and run_limit
+    while($limit->over_start_limit()
+	  or
+	  ($limit->hard() and $limit->over_run_limit())) {
+	$limit->sleep_for_recheck();
+    }
+    $process->start();
+}
+
+while($process->is_alive()) {
+    if($limit->over_run_limit()) {
+	$process->suspend();
+	$limit->sleep_for_recheck();
+	if(not $limit->hard()) {
+	    $process->resume();
+	    $limit->sleep_while_running();
+	}
+    } else {
+	$process->resume();
+	$limit->sleep_while_running();
+    }
+}
+
+exit($::exitstatus);
+
+{
+    my %pid_parentpid_cmd;
+
+    sub pid_table {
+	# Returns:
+	#   %children_of = { pid -> children of pid }
+	#   %parent_of = { pid -> pid of parent }
+	#   %name_of = { pid -> commandname }
+
+       	if(not %pid_parentpid_cmd) {
+	    # Filter for SysV-style `ps`
+	    my $sysv = q( ps -ef | perl -ane '1..1 and /^(.*)CO?MM?A?N?D/ and $s=length $1;).
+		q(s/^.{$s}//; print "@F[1,2] $_"' );
+	    # Crazy msys: ' is not accepted on the cmd line, but " are treated as '
+	    my $msys = q( ps -ef | perl -ane "1..1 and /^(.*)CO?MM?A?N?D/ and $s=length $1;).
+		q(s/^.{$s}//; print qq{@F[1,2] $_}" );
+	    # BSD-style `ps`
+	    my $bsd = q(ps -o pid,ppid,command -ax);
+	    %pid_parentpid_cmd =
+	    (
+	     'aix' => $sysv,
+	     'cygwin' => $sysv,
+	     'darwin' => $bsd,
+	     'dec_osf' => $sysv,
+	     'dragonfly' => $bsd,
+	     'freebsd' => $bsd,
+	     'gnu' => $sysv,
+	     'hpux' => $sysv,
+	     'linux' => $sysv,
+	     'mirbsd' => $bsd,
+	     'msys' => $msys,
+	     'MSWin32' => $sysv,
+	     'netbsd' => $bsd,
+	     'nto' => $sysv,
+	     'openbsd' => $bsd,
+	     'solaris' => $sysv,
+	     'svr5' => $sysv,
+	     'syllable' => "echo ps not supported",
+	    );
+	}
+	$pid_parentpid_cmd{$^O} or ::die_bug("pid_parentpid_cmd for $^O missing");
+
+	my (@pidtable,%parent_of,%children_of,%name_of);
+	# Table with pid -> children of pid
+	@pidtable = `$pid_parentpid_cmd{$^O}`;
+	my $p=$$;
+	for (@pidtable) {
+	    # must match: 24436 21224 busybox ash
+	    # must match: 24436 21224 <<empty on MacOSX running cubase>>
+	    #   or: perl -e 'while($0=" "){}'
+	    if(/^\s*(\S+)\s+(\S+)\s+(\S+.*)/
+	       or
+	       $^O eq "darwin" and /^\s*(\S+)\s+(\S+)\s+()$/) {
+		$parent_of{$1} = $2;
+		push @{$children_of{$2}}, $1;
+		$name_of{$1} = $3;
+	    } else {
+		::die_bug("pidtable format: $_");
+	    }
+	}
+	return(\%children_of, \%parent_of, \%name_of);
+    }
+}
+
+sub resume {
+    $::resume_process->resume();
+    exit(0);
+}
+
+sub status {
+    my @w = @_;
+    my $fh = *STDERR;
+    print $fh @w;
+    flush $fh;
+}
+
+sub warning {
+    my @w = @_;
+    my $prog = $Global::progname || "niceload";
+    status(map { ($prog, ": Warning: ", $_, "\n"); } @w);
+}
+
+sub error {
+    my @w = @_;
+    my $prog = $Global::progname || "niceload";
+    status(map { ($prog, ": Error: ", $_, "\n"); } @w);
+}
+
+sub uniq {
+    # Remove duplicates and return unique values
+    return keys %{{ map { $_ => 1 } @_ }};
+}
+
+sub multiply_binary_prefix {
+    # Evalualte numbers with binary prefix
+    # k=10^3, m=10^6, g=10^9, t=10^12, p=10^15, e=10^18, z=10^21, y=10^24
+    # K=2^10, M=2^20, G=2^30, T=2^40, P=2^50, E=2^70, Z=2^80, Y=2^80
+    # Ki=2^10, Mi=2^20, Gi=2^30, Ti=2^40, Pi=2^50, Ei=2^70, Zi=2^80, Yi=2^80
+    # ki=2^10, mi=2^20, gi=2^30, ti=2^40, pi=2^50, ei=2^70, zi=2^80, yi=2^80
+    # 13G = 13*1024*1024*1024 = 13958643712
+    my $s = shift;
+    $s =~ s/k/*1000/g;
+    $s =~ s/M/*1000*1000/g;
+    $s =~ s/G/*1000*1000*1000/g;
+    $s =~ s/T/*1000*1000*1000*1000/g;
+    $s =~ s/P/*1000*1000*1000*1000*1000/g;
+    $s =~ s/E/*1000*1000*1000*1000*1000*1000/g;
+    $s =~ s/Z/*1000*1000*1000*1000*1000*1000*1000/g;
+    $s =~ s/Y/*1000*1000*1000*1000*1000*1000*1000*1000/g;
+    $s =~ s/X/*1000*1000*1000*1000*1000*1000*1000*1000*1000/g;
+
+    $s =~ s/Ki?/*1024/gi;
+    $s =~ s/Mi?/*1024*1024/gi;
+    $s =~ s/Gi?/*1024*1024*1024/gi;
+    $s =~ s/Ti?/*1024*1024*1024*1024/gi;
+    $s =~ s/Pi?/*1024*1024*1024*1024*1024/gi;
+    $s =~ s/Ei?/*1024*1024*1024*1024*1024*1024/gi;
+    $s =~ s/Zi?/*1024*1024*1024*1024*1024*1024*1024/gi;
+    $s =~ s/Yi?/*1024*1024*1024*1024*1024*1024*1024*1024/gi;
+    $s =~ s/Xi?/*1024*1024*1024*1024*1024*1024*1024*1024*1024/gi;
+    $s = eval $s;
+    return $s;
+}
+
+sub get_options_from_array {
+    # Run GetOptions on @array
+    # Returns:
+    #   true if parsing worked
+    #   false if parsing failed
+    #   @array is changed
+    my $array_ref = shift;
+    # A bit of shuffling of @ARGV needed as GetOptionsFromArray is not
+    # supported everywhere
+    my @save_argv;
+    my $this_is_ARGV = (\@::ARGV == $array_ref);
+    if(not $this_is_ARGV) {
+	@save_argv = @::ARGV;
+	@::ARGV = @{$array_ref};
+    }
+    my @retval = GetOptions
+	("debug|D" => \$opt::debug,
+	 "factor|f=s" => \$opt::factor,
+	 "hard|H" => \$opt::hard,
+	 "soft|S" => \$opt::soft,
+	 "sensor=s" => \$opt::sensor,
+
+	 "si|sio|startio|start-io=s" => \$opt::start_io,
+	 "ri|rio|runio|run-io=s" => \$opt::run_io,
+	 "io|I=s" => \$opt::io,
+
+	 "sl|startload|start-load=s" => \$opt::start_load,
+	 "rl|runload|run-load=s" => \$opt::run_load,
+	 "load|L|l=s" => \$opt::load,
+
+	 "sm|startmem|start-mem=s" => \$opt::start_mem,
+	 "rm|runmem|run-mem=s" => \$opt::run_mem,
+	 "mem|M=s" => \$opt::mem,
+
+	 "sn|startnoswap|start-noswap|start-no-swap" => \$opt::start_noswap,
+	 "rn|runnoswap|run-noswap|run-no-swap" => \$opt::run_noswap,
+	 "noswap|N" => \$opt::noswap,
+
+	 "battery|B" => \$opt::battery,
+	 "net" => \$opt::net,
+	 "nethops=i" => \$opt::nethops,
+	 "baseline" => \$opt::baseline,
+
+	 "nice|n=i" => \$opt::nice,
+	 "program|prg=s" => \@opt::prg,
+	 "process|pid|p=s" => \@opt::pid,
+	 "suspend|s=s" => \$opt::suspend,
+	 "recheck|t=s" => \$opt::recheck,
+	 "quote|q" => \$opt::quote,
+	 "help|h" => \$opt::help,
+	 "verbose|v" => \$opt::verbose,
+	 "version|V" => \$opt::version,
+	);
+    if($opt::battery) {
+	# niceload -l -1 --sensor \
+	#   'cat /sys/class/power_supply/BAT0/status \
+	#    /proc/acpi/battery/BAT0/state 2>/dev/null |
+	#    grep -i -q discharging; echo $?'
+	$opt::sensor = ('cat /sys/class/power_supply/BAT0/status '.
+			'/proc/acpi/battery/BAT0/state 2>/dev/null | '.
+			'grep -i -q discharging; echo $?');
+	$opt::load = -1;
+    }
+    if($opt::net) {
+	$opt::nethops ||= 3;
+    }
+    if($opt::nethops) {
+	# niceload -l 0.01 --sensor 'netsensor_script'
+	$opt::sensor = netsensor_script($opt::nethops);
+	$opt::load ||= 0.01;
+    }
+    if(not $this_is_ARGV) {
+	@{$array_ref} = @::ARGV;
+	@::ARGV = @save_argv;
+    }
+    return @retval;
+}
+
+sub shell_quote_scalar {
+    # Quote for other shells
+    my $a = $_[0];
+    if(defined $a) {
+	# zsh wants '=' quoted
+	# Solaris sh wants ^ quoted.
+	# $a =~ s/([\002-\011\013-\032\\\#\?\`\(\)\{\}\[\]\^\*\>\<\~\|\; \"\!\$\&\'\202-\377])/\\$1/g;
+	# This is 1% faster than the above
+	if(($a =~ s/[\002-\011\013-\032\\\#\?\`\(\)\{\}\[\]\^\*\<\=\>\~\|\; \"\!\$\&\'\202-\377]/\\$&/go)
+	   +
+	   # quote newline as '\n'
+	   ($a =~ s/[\n]/'\n'/go)) {
+	    # A string was replaced
+	    # No need to test for "" or \0
+	} elsif($a eq "") {
+	    $a = "''";
+	} elsif($a eq "\0") {
+	    $a = "";
+	}
+    }
+    return $a;
+}
+
+sub die_usage {
+    help();
+    exit 1;
+}
+
+
+sub help {
+    print q{
+Usage:
+   niceload [-v] [-n niceness] [-L loadavg] [-I io] [-N] [-M mem]
+            [-s suspend_sec|-f factor] [-H] [-S]
+            command or -p pid
+};
+}
+
+
+sub die_bug {
+    my $bugid = shift;
+    print STDERR
+	("$Global::progname: This should not happen. You have found a bug.\n",
+	 "Please contact <parallel\@gnu.org> and include:\n",
+	 "* The version number: $Global::version\n",
+	 "* The bugid: $bugid\n",
+	 "* The command line being run\n",
+	 "* The files being read (put the files on a webserver if they are big)\n",
+	 "\n",
+	 "If you get the error on smaller/fewer files, please include those instead.\n");
+    exit(255);
+}
+
+sub now {
+    # Returns time since epoch as in seconds with 3 decimals
+    # Uses:
+    #   @Global::use
+    # Returns:
+    #   $time = time now with millisecond accuracy
+    if(not $Global::use{"Time::HiRes"}) {
+	if(eval "use Time::HiRes qw ( time );") {
+	    eval "sub TimeHiRestime { return Time::HiRes::time };";
+	} else {
+	    eval "sub TimeHiRestime { return time() };";
+	}
+	$Global::use{"Time::HiRes"} = 1;
+    }
+
+    return (int(TimeHiRestime()*1000))/1000;
+}
+
+sub usleep {
+    # Sleep this many milliseconds.
+    my $ms = shift;
+    ::debug("Sleeping ",$ms," millisecs\n");
+    my $start = now();
+    my $now;
+    do {
+	# Something makes 'select' wake up too early
+	# when using --sensor
+	select(undef, undef, undef, $ms/1000);
+	$now = now();
+    } while($now < $start + $ms/1000);
+}
+
+sub debug {
+    if($opt::debug) {
+	print STDERR @_;
+    }
+}
+
+
+sub my_dump {
+    # Returns:
+    #   ascii expression of object if Data::Dump(er) is installed
+    #   error code otherwise
+    my @dump_this = (@_);
+    eval "use Data::Dump qw(dump);";
+    if ($@) {
+        # Data::Dump not installed
+        eval "use Data::Dumper;";
+        if ($@) {
+            my $err =  "Neither Data::Dump nor Data::Dumper is installed\n".
+                "Not dumping output\n";
+            print STDERR $err;
+            return $err;
+        } else {
+            return Dumper(@dump_this);
+        }
+    } else {
+        eval "use Data::Dump qw(dump);";
+        return (Data::Dump::dump(@dump_this));
+    }
+}
+
+
+sub version {
+    # Returns: N/A
+    print join("\n",
+	       "GNU $Global::progname $Global::version",
+	       "Copyright (C) 2004,2005,2006,2007,2008,2009 Ole Tange",
+	       "Copyright (C) 2010,2011 Ole Tange and Free Software Foundation, Inc.",
+	       "License GPLv3+: GNU GPL version 3 or later <http://gnu.org/licenses/gpl.html>",
+	       "This is free software: you are free to change and redistribute it.",
+	       "GNU $Global::progname comes with no warranty.",
+	       "",
+	       "Web site: http://www.gnu.org/software/parallel\n"
+	);
+}
+
+
+sub max {
+    # Returns:
+    #   Maximum value of array
+    my $max;
+    for (@_) {
+        # Skip undefs
+        defined $_ or next;
+        defined $max or do { $max = $_; next; }; # Set $_ to the first non-undef
+        $max = ($max > $_) ? $max : $_;
+    }
+    return $max;
+}
+
+sub min {
+    # Returns:
+    #   Minimum value of array
+    my $min;
+    for (@_) {
+        # Skip undefs
+        defined $_ or next;
+        defined $min or do { $min = $_; next; }; # Set $_ to the first non-undef
+        $min = ($min < $_) ? $min : $_;
+    }
+    return $min;
+}
+
+sub collect_net_baseline {
+    # Collect what a normal (unloaded) net connection looks line
+}
+
+
+sub netsensor_script {
+    # Script for --sensor when using --net
+    my $hops = shift;
+    my $perlscript = q{
+	use Net::Traceroute;
+	use Net::Ping;
+
+	my $medtrc = MedianTraceroute->new(shift);
+	$medtrc->set_remedian($medtrc->ping());
+	$medtrc->set_remedian($medtrc->ping());
+	while(1) {
+	    my $ms = $medtrc->ping();
+	    my $m = $medtrc->remedian();
+	    if($m*1.5 < $ms) {
+		# Bad 1 = median*1.5 < current latency
+	    } else {
+		# OK 0 = median*1.5 > current latency
+		$medtrc->set_remedian($ms);
+	    }
+	    printf("%d\n",$m*1.5 < $ms);
+	    sleep(1);
+	}
+
+	package MedianTraceroute;
+
+	sub new {
+	    my $class = shift;
+	    my $hop = shift;
+	    # Find router
+	    my $tr = Net::Traceroute->new(host => "8.8.8.8",
+					  max_ttl => $hop);
+	    if($tr->found) {
+		$host = $tr->hop_query_host($hop, 0);
+	    } else {
+		# ns1.censurfridns.dk
+		$tr = Net::Traceroute->new(host => "89.233.43.71",
+					   max_ttl => $hop);
+		if($tr->found) {
+		    $host = $tr->hop_query_host($hop, 0);
+		} else {
+		    die("Cannot traceroute to 8.8.8.8 and 89.233.43.71");
+		}
+	    }
+	    my $p = Net::Ping->new();
+	    $p->hires();
+
+	    return bless {
+		'hop' => $hop,
+		'host' => $host,
+		'pinger' => $p,
+		'remedian_idx' => 0,
+		'remedian_arr' => [],
+		'remedian' => undef,
+	    }, ref($class) || $class;
+	}
+
+	sub ping {
+	    my $self = shift;
+	    for(1..3) {
+		# Ping should never take longer than 5.5 sec
+		my ($ret, $duration, $ip) =
+		    $self->{'pinger'}->ping($self->{'host'}, 5.5);
+		if($ret) {
+		    return $duration;
+		}
+	    }
+	    warn("Ping failed 3 times.");
+	}
+
+	sub remedian {
+	    my $self = shift;
+	    return $self->{'remedian'};
+	}
+
+	sub set_remedian {
+	    # Set median of the last 999^3 (=997002999) values using Remedian
+	    #
+	    # Rousseeuw, Peter J., and Gilbert W. Bassett Jr. "The remedian: A
+	    # robust averaging method for large data sets." Journal of the
+	    # American Statistical Association 85.409 (1990): 97-104.
+	    my $self = shift;
+	    my $val = shift;
+	    my $i = $self->{'remedian_idx'}++;
+	    my $rref = $self->{'remedian_arr'};
+	    $rref->[0][$i%999] = $val;
+	    $rref->[1][$i/999%999] = (sort @{$rref->[0]})[$#{$rref->[0]}/2];
+	    $rref->[2][$i/999/999%999] = (sort @{$rref->[1]})[$#{$rref->[1]}/2];
+	    $self->{'remedian'} = (sort @{$rref->[2]})[$#{$rref->[2]}/2];
+	}
+    };
+    return "perl -e ".shell_quote_scalar($perlscript)." $hops";
+}
+
+
+package Process;
+
+sub new {
+    my $class = shift;
+    my $nice = shift;
+    my @ARGV = @_;
+    if($nice) {
+	unshift(@ARGV, "nice", "-n", $nice);
+    }
+    return bless {
+	'running' => 0, # Is the process running now?
+	'command' => [@ARGV],
+    }, ref($class) || $class;
+}
+
+sub pgrp {
+    my $self = shift;
+    my @pgrp;
+    if(not $self->{'pgrp'}) {
+	for(@{$self->{'pids'}}) {
+	    push @pgrp,-getpgrp($_);
+	}
+	@pgrp = ::uniq(@pgrp);
+	@{$self->{'pgrp'}} = @pgrp;
+    }
+    return @{$self->{'pgrp'}};
+}
+
+sub set_pid {
+    my $self = shift;
+    push(@{$self->{'pids'}},@_);
+    $self->{'running'} = 1;
+    $::exitstatus = 0;
+}
+
+sub start {
+    # Start the program
+    my $self = shift;
+    ::debug("Starting @{$self->{'command'}}\n");
+    $self->{'running'} = 1;
+    if($self->{'pid'} = fork) {
+	# set signal handler to kill children if parent is killed
+	push @{$self->{'pids'}}, $self->{'pid'};
+	$Global::process = $self;
+	$SIG{CHLD} = \&REAPER;
+	$SIG{INT}=\&kill_child_INT;
+	$SIG{TSTP}=\&kill_child_TSTP;
+	$SIG{CONT}=\&kill_child_CONT;
+ 	sleep 1; # Give child time to setpgrp(0,0);
+    } else {
+ 	setpgrp(0,0);
+ 	::debug("Child pid: $$, pgrp: ",getpgrp $$,"\n");
+ 	::debug("@{$self->{'command'}}\n");
+	if($opt::quote) {
+	    system(@{$self->{'command'}});
+	} else {
+	    system("@{$self->{'command'}}");
+	}
+	$::exitstatus = $? >> 8;
+	$::exitsignal = $? & 127;
+	::debug("Child exit $::exitstatus\n");
+	exit($::exitstatus);
+    }
+}
+
+use POSIX ":sys_wait_h";
+use POSIX qw(:sys_wait_h);
+
+sub REAPER {
+    my $stiff;
+    while (($stiff = waitpid(-1, &WNOHANG)) > 0) {
+        # do something with $stiff if you want
+        $::exitstatus = $? >> 8;
+        $::exitsignal = $? & 127;
+    }
+    $SIG{CHLD} = \&REAPER;                  # install *after* calling waitpid
+}
+
+
+sub kill_child_CONT {
+    my $self = $Global::process;
+    ::debug("SIGCONT received. Killing @{$self->{'pgrp'}}\n");
+    kill CONT => $self->pgrp();
+}
+
+
+sub kill_child_TSTP {
+    my $self = $Global::process;
+    ::debug("SIGTSTP received. Killing $self->{'pid'} and self ($$)\n");
+    kill TSTP => $self->pgrp();
+    kill STOP => -$$;
+    kill STOP => $$;
+}
+
+
+sub kill_child_INT {
+    my $self = $Global::process;
+    ::debug("SIGINT received.\n");
+    if(not @opt::pid) {
+	::debug("Killing $self->{'pid'} Exit\n");
+	kill INT => $self->pgrp();
+    } else {
+	::debug("Continue pids $self->{'pid'} Exit\n");
+	kill CONT => $self->pgrp();
+    }
+    exit;
+}
+
+
+sub resume {
+    my $self = shift;
+    ::debug("Resume @{$self->{'pids'}}\n");
+    if(not $self->{'running'}) {
+	# - = PID group
+	map { kill "CONT", -$_ } @{$self->{'pids'}};
+	# If using -p it is not in a group
+	map { kill "CONT", $_ } @{$self->{'pids'}};
+	$self->{'running'} = 1;
+    }
+}
+
+
+sub suspend {
+    my $self = shift;
+    ::debug("Suspend @{$self->{'pids'}}\n");
+    if($self->{'running'}) {
+	# - = PID group
+	map { kill "STOP", -$_ } @{$self->{'pids'}};
+	# If using -p it is not in a group
+	map { kill "STOP", $_ } @{$self->{'pids'}};
+	$self->{'running'} = 0;
+    }
+}
+
+
+sub is_alive {
+    # The process is dead if none of the pids exist
+    my $self = shift;
+    my ($exists) = 0;
+    for my $pid (@{$self->{'pids'}}) {
+	if(kill 0 => $pid) { $exists++ }
+    }
+    ::debug("is_alive: $exists\n");
+    return $exists;
+}
+
+
+package Limit;
+
+sub new {
+    my $class = shift;
+    my %limits = @_;
+    my $hard = $opt::soft ? 0 : $opt::hard;
+    my $runio = $opt::run_io ? ::multiply_binary_prefix($opt::run_io) : 0;
+    my $startio = $opt::start_io ? ::multiply_binary_prefix($opt::start_io) : 0;
+    my $runload = $opt::run_load ? ::multiply_binary_prefix($opt::run_load) : 0;
+    my $startload = $opt::start_load ? ::multiply_binary_prefix($opt::start_load) : 0;
+    my $runmem = $opt::run_mem ? ::multiply_binary_prefix($opt::run_mem) : 0;
+    my $startmem = $opt::start_mem ? ::multiply_binary_prefix($opt::start_mem) : 0;
+    my $runnoswap = $opt::run_noswap ? ::multiply_binary_prefix($opt::run_noswap) : 0;
+    my $startnoswap = $opt::start_noswap ? ::multiply_binary_prefix($opt::start_noswap) : 0;
+    my $recheck = $opt::recheck ? ::multiply_binary_prefix($opt::recheck) : 1; # Default
+    my $runtime = $opt::suspend ? ::multiply_binary_prefix($opt::suspend) : 1; # Default
+
+    return bless {
+	'hard' => $hard,
+	'recheck' => $recheck,
+	'runio' => $runio,
+	'startio' => $startio,
+	'runload' => $runload,
+	'startload' => $startload,
+	'runmem' => $runmem,
+	'startmem' => $startmem,
+	'runnoswap' => $runnoswap,
+	'startnoswap' => $startnoswap,
+	'factor' => $opt::factor || 1,
+	'recheck' => $recheck,
+	'runtime' => $runtime,
+	'over_run_limit' => 1,
+	'over_start_limit' => 1,
+	'verbose' => $opt::verbose,
+    }, ref($class) || $class;
+}
+
+
+sub over_run_limit {
+    my $self = shift;
+    my $status = 0;
+    if($self->{'runmem'}) {
+	# mem should be between 0-10ish
+	# 100% available => 0 (1-1)
+	# 50% available => 1 (2-1)
+	# 10% available => 9 (10-1)
+	my $mem = $self->mem_status();
+	::debug("Run memory: $self->{'runmem'}/$mem\n");
+	$status += (::max(1,$self->{'runmem'}/$mem)-1);
+    }
+    if($self->{'runload'}) {
+	# If used with other limits load should be between 0-10ish
+	no warnings 'numeric';
+	my $load = $self->load_status();
+	if($self->{'runload'} > 0) {
+	    # Stop if the load is above the limit
+	    $status += ::max(0,$load - $self->{'runload'});
+	} else {
+	    # Stop if the load is below the limit (for sensor)
+	    $status += ::max(0,-$load - $self->{'runload'});
+	}
+    }
+    if($self->{'runnoswap'}) {
+	# swap should be between 0-10ish
+	# swap in or swap out or no swap = 0
+	# else log(swapin*swapout)
+	my $swap = $self->swap_status();
+	$status += log(::max(1, $swap - $self->{'runnoswap'}));
+    }
+    if($self->{'runio'}) {
+	my $io = $self->io_status();
+	$status += ::max(0,$io - $self->{'runio'});
+    }
+    $self->{'over_run_limit'} = $status;
+    if(not $opt::recheck) {
+	$self->{'recheck'} = $self->{'factor'} * $self->{'over_run_limit'};
+    }
+    ::debug("over_run_limit: $status\n");
+    return $self->{'over_run_limit'};
+}
+
+sub over_start_limit {
+    my $self = shift;
+    my $status = 0;
+    if($self->{'startmem'}) {
+	# mem should be between 0-10ish
+	# 100% available => 0 (1-1)
+	# 50% available => 1 (2-1)
+	# 10% available => 9 (10-1)
+	my $mem = $self->mem_status();
+	::debug("Start memory: $self->{'startmem'}/$mem\n");
+	$status += (::max(1,$self->{'startmem'}/$mem)-1);
+    }
+    if($self->{'startload'}) {
+	# load should be between 0-10ish
+	# 0 load => 0
+	no warnings 'numeric';
+	my $load = $self->load_status();
+	if($self->{'startload'} > 0) {
+	    # Stop if the load is above the limit
+	    $status += ::max(0,$load - $self->{'startload'});
+	} else {
+	    # Stop if the load is below the limit (for sensor)
+	    $status += ::max(0,-$load - $self->{'startload'});
+	}
+    }
+    if($self->{'startnoswap'}) {
+	# swap should be between 0-10ish
+	# swap in or swap out or no swap = 0
+	# else log(swapin*swapout)
+	my $swap = $self->swap_status();
+	$status += log(::max(1, $swap - $self->{'startnoswap'}));
+    }
+    if($self->{'startio'}) {
+	my $io = $self->io_status();
+	$status += ::max(0,$io - $self->{'startio'});
+    }
+    $self->{'over_start_limit'} = $status;
+    if(not $opt::recheck) {
+	$self->{'recheck'} = $self->{'factor'} * $self->{'over_start_limit'};
+    }
+    ::debug("over_start_limit: $status\n");
+    return $self->{'over_start_limit'};
+}
+
+
+sub hard {
+    my $self = shift;
+    return $self->{'hard'};
+}
+
+
+sub verbose {
+    my $self = shift;
+    return $self->{'verbose'};
+}
+
+
+sub sleep_for_recheck {
+    my $self = shift;
+    if($self->{'recheck'} < 0.01) {
+	# Never sleep less than 0.01 sec
+	$self->{'recheck'} = 0.01;
+    }
+    if($self->verbose()) {
+	$self->{'recheck'} = int($self->{'recheck'}*100)/100;
+	print STDERR "Sleeping $self->{'recheck'}s\n";
+    }
+    ::debug("recheck in $self->{'recheck'}s\n");
+    ::usleep(1000*$self->{'recheck'});
+}
+
+
+sub sleep_while_running {
+    my $self = shift;
+    ::debug("check in $self->{'runtime'}s\n");
+    if($self->verbose()) {
+	$self->{'runtime'} = int($self->{'runtime'}*100)/100;
+	print STDERR "Running $self->{'runtime'}s\n";
+    }
+    ::usleep(1000*$self->{'runtime'});
+}
+
+
+sub nonblockGetLines {
+    # An non-blocking filehandle read that returns an array of lines read
+    # Returns:  ($eof,@lines)
+    # Example: --sensor 'vmstat 1 | perl -ane '\''$|=1; 4..0 and print $F[8],"\n"'\'
+    my ($fh,$timeout) = @_;
+
+    $timeout = 0 unless defined $timeout;
+    my $rfd = '';
+    $::nonblockGetLines_last{$fh} = ''
+        unless defined $::nonblockGetLines_last{$fh};
+
+    vec($rfd,fileno($fh),1) = 1;
+    return unless select($rfd, undef, undef, $timeout)>=0;
+    # I'm not sure the following is necessary?
+    return unless vec($rfd,fileno($fh),1);
+    my $buf = '';
+    my $n = sysread($fh,$buf,1024*1024);
+
+    my $eof = eof($fh);
+    # If we're done, make sure to send the last unfinished line
+    return ($eof,$::nonblockGetLines_last{$fh}) unless $n;
+    # Prepend the last unfinished line
+    $buf = $::nonblockGetLines_last{$fh}.$buf;
+    # And save any newly unfinished lines
+    $::nonblockGetLines_last{$fh} =
+        (substr($buf,-1) !~ /[\r\n]/ && $buf =~ s/([^\r\n]*)$//)
+	? $1 : '';
+    $buf ? ($eof,split(/\n/,$buf)) : ($eof);
+}
+
+sub read_sensor {
+    my $self = shift;
+    ::debug("read_sensor: ");
+    my $fh = $self->{'sensor_fh'};
+    if(not $fh) {
+	# Start the sensor
+	$self->{'sensor_pid'} =
+	    open($fh, "-|", $opt::sensor) ||
+	    ::die_bug("Cannot open: $opt::sensor");
+	$self->{'sensor_fh'} = $fh;
+    }
+    # Read as much as we can (non_block)
+    my ($eof,@lines) = nonblockGetLines($fh);
+
+    # new load = last full line
+    foreach my $line (@lines) {
+	if(defined $line) {
+	    ::debug("Pipe saw: [$line] eof=$eof\n");
+	    $Global::last_sensor_reading = $line;
+	}
+    }
+    if($eof) {
+	# End of file => Restart the sensor
+	close $fh;
+#	waitpid($self->{'sensor_pid'},0);
+	$self->{'sensor_pid'} =
+	    open($fh, "-|", $opt::sensor) ||
+	    ::die_bug("Cannot open: $opt::sensor");
+	$self->{'sensor_fh'} = $fh;
+    }
+
+    return $Global::last_sensor_reading;
+}
+
+sub load_status {
+    # Returns:
+    #   loadavg or sensor measurement
+    my $self = shift;
+
+    if($opt::sensor) {
+	if(not defined $self->{'load_status'} or
+	   $self->{'load_status_cache_time'} + $self->{'recheck'} < time) {
+	    $self->{'load_status'} = $self->read_sensor();
+	    while (not defined $self->{'load_status'}) {
+		sleep 1;
+		$self->{'load_status'} = $self->read_sensor();
+	    }
+	    $self->{'load_status_cache_time'} = time - 0.001;
+	}
+    } else {
+	# Normal load avg
+	# Cache for some seconds
+	if(not defined $self->{'load_status'} or
+	   $self->{'load_status_cache_time'} + $self->{'recheck'} < time) {
+	    $self->{'load_status'} = load_status_linux() if $^O ne 'darwin';
+	    $self->{'load_status'} = load_status_darwin() if $^O eq 'darwin';
+	    $self->{'load_status_cache_time'} = time;
+	}
+    }
+    ::debug("load_status: ".$self->{'load_status'}."\n");
+    return $self->{'load_status'};
+}
+
+sub undef_as_zero {
+    my $a = shift;
+    return $a ? $a : 0;
+}
+
+
+sub load_status_linux {
+    my ($loadavg);
+    if(open(IN,"/proc/loadavg")) {
+	# Linux specific (but fast)
+	my $upString = <IN>;
+	if($upString =~ m/^(\d+\.\d+)/) {
+	    $loadavg = $1;
+	} else {
+	    ::die_bug("proc_loadavg");
+	}
+	close IN;
+    } elsif (open(IN,"LANG=C uptime|")) {
+	my $upString = <IN>;
+	if($upString =~ m/averages?.\s*(\d+\.\d+)/) {
+	    $loadavg = $1;
+	} else {
+	    ::die_bug("uptime");
+	}	
+	close IN;
+    }
+    return $loadavg;
+}
+
+sub load_status_darwin {
+    my $loadavg = `sysctl vm.loadavg`;
+    if($loadavg =~ /vm\.loadavg: \{ ([0-9.]+) ([0-9.]+) ([0-9.]+) \}/) {
+	$loadavg = $1;
+    } elsif (open(IN,"LANG=C uptime|")) {
+	my $upString = <IN>;
+	if($upString =~ m/averages?.\s*(\d+\.\d+)/) {
+	    $loadavg = $1;
+	} else {
+	    ::die_bug("uptime");
+	}
+	close IN;
+    }
+    return $loadavg;
+}
+
+
+sub swap_status {
+    # Returns:
+    #   (swap in)*(swap out) kb
+    my $self = shift;
+    my $status;
+    # Cache for some seconds
+    if(not defined $self->{'swap_status'} or
+       $self->{'swap_status_cache_time'}+$self->{'recheck'} < time) {
+	$status = swap_status_linux() if $^O ne 'darwin';
+	$status = swap_status_darwin() if $^O eq 'darwin';
+	$self->{'swap_status'} = ::max($status,0);
+	$self->{'swap_status_cache_time'} = time;
+    }
+    ::debug("swap_status: $self->{'swap_status'}\n");
+    return $self->{'swap_status'};
+}
+
+
+sub swap_status_linux {
+    my $swap_activity;
+    $swap_activity = "vmstat 1 2 | tail -n1 | awk '{print \$7*\$8}'";
+    # Run swap_activity measuring.
+    return qx{ $swap_activity };
+}
+
+sub swap_status_darwin {
+    # Mach Virtual Memory Statistics: (page size of 4096 bytes, cache hits 0%)
+    #   free active   spec inactive   wire   faults     copy    0fill reactive  pageins  pageout
+    # 298987 251463 162637    69437 265724 29730558   299022  2308237        1   110058        0
+    # 298991 251479 162637    69437 265726       43        4       16        0        0        0
+    my ($pagesize, $pageins, $pageouts);
+    my @vm_stat = `vm_stat 1 | head -n4`;
+    $pagesize = $1 if $vm_stat[0] =~ m/page size of (\d+) bytes/;
+    $pageins = (split(/\s+/,$vm_stat[3]))[9];
+    $pageouts = (split(/\s+/,$vm_stat[3]))[10];
+    return ($pageins*$pageouts*$pagesize)/1024;
+}
+
+
+sub mem_status {
+    # Returns:
+    #   number of bytes (free+cache)
+    my $self = shift;
+    # Cache for one second
+    if(not defined $self->{'mem_status'} or
+       $self->{'mem_status_cache_time'}+$self->{'recheck'} < time) {
+	$self->{'mem_status'} = mem_status_linux() if $^O ne 'darwin';
+	$self->{'mem_status'} = mem_status_darwin() if $^O eq 'darwin';
+	$self->{'mem_status_cache_time'} = time;
+    }
+    ::debug("mem_status: $self->{'mem_status'}\n");
+    return $self->{'mem_status'};
+}
+
+
+sub mem_status_linux {
+    #              total       used       free     shared    buffers     cached
+    # Mem:       3366496    2901664     464832          0     179228    1850692
+    # -/+ buffers/cache:     871744    2494752
+    # Swap:      6445476    1396860    5048616
+    my @free = `free`;
+    my $free = (split(/\s+/,$free[2]))[3];
+    return $free*1024;
+}
+
+sub mem_status_darwin {
+    # Mach Virtual Memory Statistics: (page size of 4096 bytes, cache hits 0%)
+    #   free active   spec inactive   wire   faults     copy    0fill reactive  pageins  pageout
+    # 298987 251463 162637    69437 265724 29730558   299022  2308237        1   110058        0
+    # 298991 251479 162637    69437 265726       43        4       16        0        0        0
+    my ($pagesize, $pages_free, $pages_speculative);
+    my @vm_stat = `vm_stat 1 | head -n4`;
+    $pagesize = $1 if $vm_stat[0] =~ m/page size of (\d+) bytes/;
+    $pages_free = (split(/\s+/,$vm_stat[3]))[0];
+    $pages_speculative = (split(/\s+/,$vm_stat[3]))[2];
+    return ($pages_free+$pages_speculative)*$pagesize;
+}
+
+
+sub io_status {
+    # Returns:
+    #   max percent for all devices
+    my $self = shift;
+    # Cache for one second
+    if(not defined $self->{'io_status'} or
+       $self->{'io_status_cache_time'}+$self->{'recheck'} < time) {
+	$self->{'io_status'} = io_status_linux() if $^O ne 'darwin';
+	$self->{'io_status'} = io_status_darwin() if $^O eq 'darwin';
+	$self->{'io_status_cache_time'} = time;
+    }
+    ::debug("io_status: $self->{'io_status'}\n");
+    return $self->{'io_status'};
+}
+
+
+sub io_status_linux {
+    # Device rrqm/s   wrqm/s     r/s     w/s    rkB/s    wkB/s avgrq-sz avgqu-sz   await r_await w_await  svctm  %util
+    # sda       0.00     0.00    0.00    0.00     0.00     0.00     0.00     0.00    0.00    0.00    0.00   0.00   0.00
+    my @iostat_out = `LANG=C iostat -x 1 2`;
+    # throw away all execpt the last Device-section
+    my @iostat;
+    for(reverse @iostat_out) {
+	/Device/ and last;
+	my @col = (split(/\s+/,$_));
+	# Util% is last column
+	push @iostat, pop @col;
+    }
+    my $io = ::max(@iostat);
+    return undef_as_zero($io)/10;
+}
+
+sub io_status_darwin {
+    #           disk0           disk1           disk2
+    #     KB/t tps  MB/s     KB/t tps  MB/s     KB/t tps  MB/s
+    #    14.95  15  0.22    11.18  35  0.38     2.00   0  0.00
+    #     0.00   0  0.00     0.00   0  0.00     0.00   0  0.00
+    my @iostat_out = `LANG=C iostat -d -w 1 -c 2`;
+    # return the MB/s of the last second (not the %util)
+    my @iostat = split(/\s+/, $iostat_out[3]);
+    my $io = $iostat[3] + $iostat[6] + $iostat[9];
+    return ::min($io, 10);
+}
+
+$::exitsignal = $::exitstatus = 0; # Dummy
diff --git a/src/niceload.pod b/src/niceload.pod
new file mode 100644
index 0000000..75656f3
--- /dev/null
+++ b/src/niceload.pod
@@ -0,0 +1,433 @@
+#!/usr/bin/perl -w
+
+# SPDX-FileCopyrightText: 2021-2022 Ole Tange, http://ole.tange.dk and Free Software and Foundation, Inc.
+# SPDX-License-Identifier: GFDL-1.3-or-later
+# SPDX-License-Identifier: CC-BY-SA-4.0
+
+=head1 NAME
+
+niceload - slow down a program when the load average is above a certain limit
+
+=head1 SYNOPSIS
+
+B<niceload> [-v] [-h] [-n nice] [-I io] [-L load] [-M mem] [-N]
+[--sensor program] [-t time] [-s time|-f factor]
+( command | -p PID [-p PID ...] | --prg program )
+
+
+=head1 DESCRIPTION
+
+GNU B<niceload> will slow down a program when the load average (or
+other system activity) is above a certain limit. When the limit is
+reached the program will be suspended for some time. Then resumed
+again for some time.  Then the load average is checked again and we
+start over.
+
+Instead of load average B<niceload> can also look at disk I/O, amount
+of free memory, or swapping activity.
+
+If the load is 3.00 then the default settings will run a program
+like this:
+
+run 1 second, suspend (3.00-1.00) seconds, run 1 second, suspend
+(3.00-1.00) seconds, run 1 second, ...
+
+=head1 OPTIONS
+
+=over 9
+
+=item B<-B>
+
+=item B<--battery>
+
+Suspend if the system is running on battery. Shorthand for:
+-l -1 --sensor 'cat /sys/class/power_supply/BAT0/status
+/proc/acpi/battery/BAT0/state 2>/dev/null | grep -i -q discharging;
+echo $?'
+
+
+=item B<-f> I<FACTOR>
+
+=item B<--factor> I<FACTOR>
+
+Suspend time factor. Dynamically set B<-s> as amount over limit *
+factor. Default is 1.
+
+
+=item B<-H>
+
+=item B<--hard>
+
+Hard limit. B<--hard> will suspend the process until the system is
+under the limits. The default is B<--soft>.
+
+
+=item B<--io> I<iolimit>
+
+=item B<-I> I<iolimit>
+
+Limit for I/O. The amount of disk I/O will be computed as a value 0 -
+10, where 0 is no I/O and 10 is at least one disk is 100% saturated.
+
+B<--io> will set both B<--start-io> and B<--run-io>.
+
+
+=item B<--load> I<loadlimit>
+
+=item B<-L> I<loadlimit>
+
+Limit for load average.
+
+B<--load> will set both B<--start-load> and B<--run-load>.
+
+
+=item B<--mem> I<memlimit>
+
+=item B<-M> I<memlimit>
+
+Limit for free memory. This is the amount of bytes available as free
++ cache. This limit is treated opposite other limits: If the system
+is above the limit the program will run, if it is below the limit the
+program will stop
+
+I<memlimit> can be postfixed with K, M, G, T, or P which would
+multiply the size with 1024, 1048576, 1073741824, or 1099511627776
+respectively.
+
+B<--mem> will set both B<--start-mem> and B<--run-mem>.
+
+
+=item B<--noswap>
+
+=item B<-N>
+
+No swapping. If the system is swapping both in and out it is a good
+indication that the system is memory stressed.
+
+B<--noswap> is over limit if the system is swapping both in and out.
+
+B<--noswap> will set both B<--start-noswap> and B<--run-noswap>.
+
+
+=item B<--net>
+
+Shorthand for B<--nethops 3>.
+
+
+=item B<--nethops> I<h>
+
+Network nice. Pause if the internet connection is overloaded.
+
+B<niceload> finds a router I<h> hops closer to the internet. It
+B<ping>s this every second. If the latency is more than 50% bigger
+than the median, it is regarded as being over the limit.
+
+B<--nethops> can be combined with B<--hard>. Without B<--hard> the
+program may be able to queue up so much traffic that it will take
+longer than the B<--suspend> time to clear it. B<--hard> is useful for
+traffic that does not break by being suspended for a longer time.
+
+B<--nethops> can be combined with a high B<--suspend>. This way a
+program can be allowed to do a bit of traffic now and then. This is
+useful to keep the connection alive.
+
+
+=item B<-n> I<niceness>
+
+=item B<--nice> I<niceness>
+
+Sets niceness. See B<nice>(1).
+
+
+=item B<-p> I<PID>[,I<PID>]
+
+=item B<--pid> I<PID>[,I<PID>]
+
+Process IDs of processes to suspend. You can specify multiple process
+IDs with multiple B<-p> I<PID> or by separating the PIDs with comma.
+
+
+=item B<--prg> I<program>
+
+=item B<--program> I<program>
+
+Name of running program to suspend. You can specify multiple programs
+with multiple B<--prg> I<program>. If no processes with the name
+I<program> is found, B<niceload> with search for substrings containing
+I<program>.
+
+
+=item B<--quote>
+
+=item B<-q>
+
+Quote the command line. Useful if the command contains chars like *,
+$, >, and " that should not be interpreted by the shell.
+
+
+=item B<--run-io> I<iolimit>
+
+=item B<--ri> I<iolimit>
+
+=item B<--run-load> I<loadlimit>
+
+=item B<--rl> I<loadlimit>
+
+=item B<--run-mem> I<memlimit>
+
+=item B<--rm> I<memlimit>
+
+Run limit. The running program will be slowed down if the system is
+above the limit. See: B<--io>, B<--load>, B<--mem>, B<--noswap>.
+
+
+=item B<--sensor> I<sensor program>
+
+Read sensor. Use I<sensor program> to read a sensor.
+
+This will keep the CPU temperature below 80 deg C on GNU/Linux:
+
+  niceload -l 80000 -f 0.001 --sensor 'sort -n /sys/devices/platform/coretemp*/temp*_input' gzip *
+
+This will stop if the disk space < 100000.
+
+  niceload -H -l -100000 --sensor "df . | awk '{ print \$4 }'" echo
+
+
+=item B<--start-io> I<iolimit>
+
+=item B<--si> I<iolimit>
+
+=item B<--start-load> I<loadlimit>
+
+=item B<--sl> I<loadlimit>
+
+=item B<--start-mem> I<memlimit>
+
+=item B<--sm> I<memlimit>
+
+Start limit. The program will not start until the system is below the
+limit. See: B<--io>, B<--load>, B<--mem>, B<--noswap>.
+
+
+=item B<--soft>
+
+=item B<-S>
+
+Soft limit. B<niceload> will suspend a process for a while and then
+let it run for a second thus only slowing down a process while the
+system is over one of the given limits. This is the default.
+
+
+=item B<--suspend> I<SEC>
+
+=item B<-s> I<SEC>
+
+Suspend time. Suspend the command this many seconds when the max load
+average is reached.
+
+
+=item B<--recheck> I<SEC>
+
+=item B<-t> I<SEC>
+
+Recheck load time. Sleep SEC seconds before checking load
+again. Default is 1 second.
+
+
+=item B<--verbose>
+
+=item B<-v>
+
+Verbose. Print some extra output on what is happening. Use B<-v> until
+you know what your are doing.
+
+=back
+
+=head1 EXAMPLE: See niceload in action
+
+In terminal 1 run: top
+
+In terminal 2 run:
+
+B<niceload -q perl -e '$|=1;do{$l==$r or print "."; $l=$r}until(($r=time-$^T)>>B<50)'>
+
+This will print a '.' every second for 50 seconds and eat a lot of
+CPU. When the load rises to 1.0 the process is suspended.
+
+
+=head1 EXAMPLE: Run updatedb
+
+Running B<updatedb> can often starve the system for disk I/O and thus result in a high load.
+
+Run B<updatedb> but suspend B<updatedb> if the load is above 2.00:
+
+B<niceload -L 2 updatedb>
+
+
+=head1 EXAMPLE: Run rsync
+
+B<rsync> can, just like B<updatedb>, starve the system for disk I/O
+and thus result in a high load.
+
+Run B<rsync> but keep load below 3.4. If load reaches 7 sleep for
+(7-3.4)*12 seconds:
+
+B<niceload -L 3.4 -f 12 rsync -Ha /home/ /backup/home/>
+
+
+=head1 EXAMPLE: Ensure enough disk cache
+
+Assume the program B<foo> uses 2 GB files intensively. B<foo> will run
+fast if the files are in disk cache and be slow as a crawl if they are
+not in the cache.
+
+To ensure 2 GB are reserved for disk cache run:
+
+B<niceload --hard --run-mem 2g foo>
+
+This will not guarantee that the 2 GB memory will be used for the
+files for B<foo>, but it will stop B<foo> if the memory for disk cache
+is too low.
+
+
+=head1 ENVIRONMENT VARIABLES
+
+None. In future versions $NICELOAD will be able to contain default settings.
+
+=head1 EXIT STATUS
+
+Exit status should be the same as the command being run (untested).
+
+=head1 REPORTING BUGS
+
+Report bugs to <bug-parallel@gnu.org>.
+
+=head1 AUTHOR
+
+Copyright (C) 2004-11-19 Ole Tange, http://ole.tange.dk
+
+Copyright (C) 2005-2010 Ole Tange, http://ole.tange.dk
+
+Copyright (C) 2010-2022 Ole Tange, http://ole.tange.dk and Free
+Software Foundation, Inc.
+
+=head1 LICENSE
+
+This program is free software; you can redistribute it and/or modify
+it under the terms of the GNU General Public License as published by
+the Free Software Foundation; either version 3 of the License, or
+at your option any later version.
+
+This program is distributed in the hope that it will be useful,
+but WITHOUT ANY WARRANTY; without even the implied warranty of
+MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the
+GNU General Public License for more details.
+
+You should have received a copy of the GNU General Public License
+along with this program.  If not, see <http://www.gnu.org/licenses/>.
+
+=head2 Documentation license I
+
+Permission is granted to copy, distribute and/or modify this
+documentation under the terms of the GNU Free Documentation License,
+Version 1.3 or any later version published by the Free Software
+Foundation; with no Invariant Sections, with no Front-Cover Texts, and
+with no Back-Cover Texts.  A copy of the license is included in the
+file LICENSES/GFDL-1.3-or-later.txt.
+
+=head2 Documentation license II
+
+You are free:
+
+=over 9
+
+=item B<to Share>
+
+to copy, distribute and transmit the work
+
+=item B<to Remix>
+
+to adapt the work
+
+=back
+
+Under the following conditions:
+
+=over 9
+
+=item B<Attribution>
+
+You must attribute the work in the manner specified by the author or
+licensor (but not in any way that suggests that they endorse you or
+your use of the work).
+
+=item B<Share Alike>
+
+If you alter, transform, or build upon this work, you may distribute
+the resulting work only under the same, similar or a compatible
+license.
+
+=back
+
+With the understanding that:
+
+=over 9
+
+=item B<Waiver>
+
+Any of the above conditions can be waived if you get permission from
+the copyright holder.
+
+=item B<Public Domain>
+
+Where the work or any of its elements is in the public domain under
+applicable law, that status is in no way affected by the license.
+
+=item B<Other Rights>
+
+In no way are any of the following rights affected by the license:
+
+=over 2
+
+=item *
+
+Your fair dealing or fair use rights, or other applicable
+copyright exceptions and limitations;
+
+=item *
+
+The author's moral rights;
+
+=item *
+
+Rights other persons may have either in the work itself or in
+how the work is used, such as publicity or privacy rights.
+
+=back
+
+=back
+
+=over 9
+
+=item B<Notice>
+
+For any reuse or distribution, you must make clear to others the
+license terms of this work.
+
+=back
+
+A copy of the full license is included in the file as
+LICENCES/CC-BY-SA-4.0.txt
+
+
+=head1 DEPENDENCIES
+
+GNU B<niceload> uses Perl, and the Perl modules POSIX, and
+Getopt::Long.
+
+=head1 SEE ALSO
+
+B<parallel>(1), B<nice>(1), B<uptime>(1)
+
+=cut
diff --git a/src/parallel b/src/parallel
new file mode 100755
index 0000000..e0b654e
--- /dev/null
+++ b/src/parallel
@@ -0,0 +1,14979 @@
+#!/usr/bin/env perl
+
+# Copyright (C) 2007-2022 Ole Tange, http://ole.tange.dk and Free
+# Software Foundation, Inc.
+#
+# This program is free software; you can redistribute it and/or modify
+# it under the terms of the GNU General Public License as published by
+# the Free Software Foundation; either version 3 of the License, or
+# (at your option) any later version.
+#
+# This program is distributed in the hope that it will be useful, but
+# WITHOUT ANY WARRANTY; without even the implied warranty of
+# MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU
+# General Public License for more details.
+#
+# You should have received a copy of the GNU General Public License
+# along with this program; if not, see <https://www.gnu.org/licenses/>
+# or write to the Free Software Foundation, Inc., 51 Franklin St,
+# Fifth Floor, Boston, MA 02110-1301 USA
+#
+# SPDX-FileCopyrightText: 2021-2022 Ole Tange, http://ole.tange.dk and Free Software and Foundation, Inc.
+# SPDX-License-Identifier: GPL-3.0-or-later
+
+# open3 used in Job::start
+use IPC::Open3;
+use POSIX;
+# gensym used in Job::start
+use Symbol qw(gensym);
+# tempfile used in Job::start
+use File::Temp qw(tempfile tempdir);
+# mkpath used in openresultsfile
+use File::Path;
+# GetOptions used in get_options_from_array
+use Getopt::Long;
+# Used to ensure code quality
+use strict;
+use File::Basename;
+
+sub set_input_source_header($$) {
+    my ($command_ref,$input_source_fh_ref) = @_;
+    if(defined $opt::header and not $opt::pipe) {
+	# split with colsep or \t
+	# $header force $colsep = \t if undef?
+	my $delimiter = defined $opt::colsep ? $opt::colsep : "\t";
+	# regexp for {=
+	my $left = "\Q$Global::parensleft\E";
+	my $l = $Global::parensleft;
+	# regexp for =}
+	my $right = "\Q$Global::parensright\E";
+	my $r = $Global::parensright;
+	if($opt::header ne "0") {
+	    my $id = 1;
+	    for my $fh (@$input_source_fh_ref) {
+		my $line = <$fh>;
+		chomp($line);
+		$line =~ s/\r$//;
+		::debug("init", "Delimiter: '$delimiter'");
+		for my $s (split /$delimiter/o, $line) {
+		    ::debug("init", "Colname: '$s'");
+		    # Replace {colname} with {2}
+		    for(@$command_ref, @Global::ret_files,
+			@Global::transfer_files, $opt::tagstring,
+			$opt::workdir, $opt::results, $opt::retries,
+			@Global::template_contents, @Global::template_names,
+			@opt::filter) {
+			# Skip if undefined
+			$_ or next;
+		      s:\{$s(|/|//|\.|/\.)\}:\{$id$1\}:g;
+			# {=header1 ... =}  =>  {=1 ... =}
+		      s:$left $s (.*?) $right:$l$id$1$r:gx;
+		    }
+		    $Global::input_source_header{$id} = $s;
+		    $id++;
+		}
+	    }
+	}
+	# Make it possible to do:
+	# parallel --header 0 echo {file2} {file1} :::: file1 file2
+	my $id = 1;
+	for my $s (@opt::a) {
+	    # ::: are put into files and given a filehandle
+	    # ignore these and only keep the filenames.
+	    fileno $s and next;
+	    for(@$command_ref, @Global::ret_files,
+		@Global::transfer_files, $opt::tagstring,
+		$opt::workdir, $opt::results, $opt::retries,
+		@Global::template_contents, @Global::template_names,
+		@opt::filter) {
+		# Skip if undefined
+		$_ or next;
+	      s:\{$s(|/|//|\.|/\.)\}:\{$id$1\}:g;
+		# {=header1 ... =}  =>  {=1 ... =}
+	      s:$left $s (.*?) $right:$l$id$1$r:gx;
+	    }
+	    $Global::input_source_header{$id} = $s;
+	    $id++;
+	}
+    } else {
+	my $id = 1;
+	for my $fh (@$input_source_fh_ref) {
+	    $Global::input_source_header{$id} = $id;
+	    $id++;
+	}
+    }
+}
+
+sub max_jobs_running() {
+    # Compute $Global::max_jobs_running as the max number of jobs
+    # running on each sshlogin.
+    # Returns:
+    #   $Global::max_jobs_running
+    if(not $Global::max_jobs_running) {
+	for my $sshlogin (values %Global::host) {
+	    $sshlogin->max_jobs_running();
+	}
+    }
+    if(not $Global::max_jobs_running) {
+	::error("Cannot run any jobs.");
+	wait_and_exit(255);
+    }
+    return $Global::max_jobs_running;
+}
+
+sub halt() {
+    # Compute exit value,
+    # wait for children to complete
+    # and exit
+    if($opt::halt and $Global::halt_when ne "never") {
+	if(not defined $Global::halt_exitstatus) {
+	    if($Global::halt_pct) {
+		$Global::halt_exitstatus =
+		    ::ceil($Global::total_failed /
+			   ($Global::total_started || 1) * 100);
+	    } elsif($Global::halt_count) {
+		$Global::halt_exitstatus =
+		    ::min(undef_as_zero($Global::total_failed),101);
+	    }
+	}
+	wait_and_exit($Global::halt_exitstatus);
+    } else {
+	if($Global::semaphore) {
+	    # --semaphore runs a single job:
+	    # Use exit value of that
+	    wait_and_exit($Global::halt_exitstatus);
+	} else {
+	    # 0 = all jobs succeeded
+	    # 1-100 = n jobs failed
+	    # 101 = >100 jobs failed
+	    wait_and_exit(min(undef_as_zero($Global::exitstatus),101));
+	}
+    }
+}
+
+
+sub __PIPE_MODE__() {}
+
+
+sub pipepart_setup() {
+    # Compute the blocksize
+    # Generate the commands to extract the blocks
+    # Push the commands on queue
+    # Changes:
+    #   @Global::cat_prepends
+    #   $Global::JobQueue
+    if($opt::tee) {
+	# Prepend each command with
+	#   < file
+	my $cat_string = "< ".Q($opt::a[0]);
+	for(1..$Global::JobQueue->total_jobs()) {
+	    push @Global::cat_appends, $cat_string;
+	    push @Global::cat_prepends, "";
+	}
+    } else {
+	if(not $opt::blocksize) {
+	    # --blocksize with 10 jobs per jobslot
+	    $opt::blocksize = -10;
+	}
+	if($opt::roundrobin) {
+	    # --blocksize with 1 job per jobslot
+	    $opt::blocksize = -1;
+	}
+	if($opt::blocksize < 0) {
+	    my $size = 0;
+	    # Compute size of -a
+	    for(@opt::a) {
+		if(-f $_) {
+		    $size += -s $_;
+		} elsif(-b $_) {
+		    $size += size_of_block_dev($_);
+		} elsif(-e $_) {
+		    ::error("$_ is neither a file nor a block device");
+		    wait_and_exit(255);
+		} else {
+		    ::error("File not found: $_");
+		    wait_and_exit(255);
+		}
+	    }
+	    # Run in total $job_slots*(- $blocksize) jobs
+	    # Set --blocksize = size / no of proc / (- $blocksize)
+	    $Global::dummy_jobs = 1;
+	    $Global::blocksize = 1 +
+		int($size / max_jobs_running() /
+		    -multiply_binary_prefix($opt::blocksize));
+	}
+	@Global::cat_prepends = (map { pipe_part_files($_) }
+				 # ::: are put into files and given a filehandle
+				 # ignore these and only keep the filenames.
+				 grep { ! fileno $_ } @opt::a);
+	# Unget the empty arg as many times as there are parts
+	$Global::JobQueue->{'commandlinequeue'}{'arg_queue'}->unget(
+	    map { [Arg->new("\0noarg")] } @Global::cat_prepends
+	    );
+    }
+}
+
+sub pipe_tee_setup() {
+    # Create temporary fifos
+    # Run 'tee fifo1 fifo2 fifo3 ... fifoN' in the background
+    # This will spread the input to fifos
+    # Generate commands that reads from fifo1..N:
+    #	cat fifo | user_command
+    # Changes:
+    #	@Global::cat_prepends
+    my @fifos;
+    for(1..$Global::JobQueue->total_jobs()) {
+	push @fifos, tmpfifo();
+    }
+    # cat foo | tee fifo1 fifo2 fifo3 fifo4 fifo5 > /dev/null
+    if(not fork()){
+	# Test if tee supports --output-error=warn-nopipe
+	`echo | tee --output-error=warn-nopipe /dev/null >/dev/null 2>/dev/null`;
+	my $opt = $? ? "" : "--output-error=warn-nopipe";
+	::debug("init","tee $opt");
+	if($opt::dryrun) {
+	    # This is not exactly what is run, but it gives the basic idea
+	    print "mkfifo @fifos\n";
+	    print "tee $opt @fifos >/dev/null &\n";
+	} else {
+	    # Let tee inherit our stdin
+	    # and redirect stdout to null
+	    open STDOUT, ">","/dev/null";
+	    if($opt) {
+		exec "tee", $opt, @fifos;
+	    } else {
+		exec "tee", @fifos;
+	    }
+	}
+	exit(0);
+    }
+    # For each fifo
+    #	(rm fifo1; grep 1) < fifo1
+    #	(rm fifo2; grep 2) < fifo2
+    #	(rm fifo3; grep 3) < fifo3
+    # Remove the tmpfifo as soon as it is open
+    @Global::cat_prepends = map { "(rm $_;" } @fifos;
+    @Global::cat_appends = map { ") < $_" } @fifos;
+}
+
+
+sub parcat_script() {
+    # TODO if script fails: Use parallel -j0 --plain --lb cat ::: fifos
+    my $script = q'{
+	use POSIX qw(:errno_h);
+	use IO::Select;
+	use strict;
+	use threads;
+	use Thread::Queue;
+	use Fcntl qw(:DEFAULT :flock);
+
+	my $opened :shared;
+	my $q = Thread::Queue->new();
+	my $okq = Thread::Queue->new();
+	my @producers;
+
+	if(not @ARGV) {
+	    if(-t *STDIN) {
+		print "Usage:\n";
+		print "  parcat file(s)\n";
+		print "  cat argfile | parcat\n";
+	    } else {
+		# Read arguments from stdin
+		chomp(@ARGV = <STDIN>);
+	    }
+	}
+	my $files_to_open = 0;
+	# Default: fd = stdout
+	my $fd = 1;
+	for (@ARGV) {
+	    # --rm = remove file when opened
+	    /^--rm$/ and do { $opt::rm = 1; next; };
+	    # -1 = output to fd 1, -2 = output to fd 2
+	    /^-(\d+)$/ and do { $fd = $1; next; };
+	    push @producers, threads->create("producer", $_, $fd);
+	    $files_to_open++;
+	}
+
+	sub producer {
+	    # Open a file/fifo, set non blocking, enqueue fileno of the file handle
+	    my $file = shift;
+	    my $output_fd = shift;
+	    open(my $fh, "<", $file) || do {
+		print STDERR "parcat: Cannot open $file\n";
+		exit(1);
+	    };
+	    # Remove file when it has been opened
+	    if($opt::rm) {
+		unlink $file;
+	    }
+	    set_fh_non_blocking($fh);
+	    $opened++;
+	    # Pass the fileno to parent
+	    $q->enqueue(fileno($fh),$output_fd);
+	    # Get an OK that the $fh is opened and we can release the $fh
+	    while(1) {
+		my $ok = $okq->dequeue();
+		if($ok == fileno($fh)) { last; }
+		# Not ours - very unlikely to happen
+		$okq->enqueue($ok);
+	    }
+	    return;
+	}
+
+	my $s = IO::Select->new();
+	my %buffer;
+
+	sub add_file {
+	    my $infd = shift;
+	    my $outfd = shift;
+	    open(my $infh, "<&=", $infd) || die;
+	    open(my $outfh, ">&=", $outfd) || die;
+	    $s->add($infh);
+	    # Tell the producer now opened here and can be released
+	    $okq->enqueue($infd);
+	    # Initialize the buffer
+	    @{$buffer{$infh}{$outfd}} = ();
+	    $Global::fh{$outfd} = $outfh;
+	}
+
+	sub add_files {
+	    # Non-blocking dequeue
+	    my ($infd,$outfd);
+	    do {
+		($infd,$outfd) = $q->dequeue_nb(2);
+		if(defined($outfd)) {
+		    add_file($infd,$outfd);
+		}
+	    } while(defined($outfd));
+	}
+
+	sub add_files_block {
+	    # Blocking dequeue
+	    my ($infd,$outfd) = $q->dequeue(2);
+	    add_file($infd,$outfd);
+	}
+
+
+	my $fd;
+	my (@ready,$infh,$rv,$buf);
+	do {
+	    # Wait until at least one file is opened
+	    add_files_block();
+	    while($q->pending or keys %buffer) {
+		add_files();
+		while(keys %buffer) {
+		    @ready = $s->can_read(0.01);
+		    if(not @ready) {
+			add_files();
+		    }
+		    for $infh (@ready) {
+			# There is only one key, namely the output file descriptor
+			for my $outfd (keys %{$buffer{$infh}}) {
+			    # TODO test if 60800 is optimal (2^17 is used elsewhere)
+			    $rv = sysread($infh, $buf, 60800);
+			    if (!$rv) {
+				if($! == EAGAIN) {
+				    # Would block: Nothing read
+				    next;
+				} else {
+				    # Nothing read, but would not block:
+				    # This file is done
+				    $s->remove($infh);
+				    for(@{$buffer{$infh}{$outfd}}) {
+					syswrite($Global::fh{$outfd},$_);
+				    }
+				    delete $buffer{$infh};
+				    # Closing the $infh causes it to block
+				    # close $infh;
+				    add_files();
+				    next;
+				}
+			    }
+			    # Something read.
+			    # Find \n or \r for full line
+			    my $i = (rindex($buf,"\n")+1);
+			    if($i) {
+				# Print full line
+				for(@{$buffer{$infh}{$outfd}}, substr($buf,0,$i)) {
+				    syswrite($Global::fh{$outfd},$_);
+				}
+				# @buffer = remaining half line
+				$buffer{$infh}{$outfd} = [substr($buf,$i,$rv-$i)];
+			    } else {
+				# Something read, but not a full line
+				push @{$buffer{$infh}{$outfd}}, $buf;
+			    }
+			    redo;
+			}
+		    }
+		}
+	    }
+	} while($opened < $files_to_open);
+
+	for (@producers) {
+	    $_->join();
+	}
+
+	sub set_fh_non_blocking {
+	    # Set filehandle as non-blocking
+	    # Inputs:
+	    #	$fh = filehandle to be blocking
+	    # Returns:
+	    #	N/A
+	    my $fh = shift;
+	    my $flags;
+	    fcntl($fh, &F_GETFL, $flags) || die $!; # Get the current flags on the filehandle
+	    $flags |= &O_NONBLOCK; # Add non-blocking to the flags
+	    fcntl($fh, &F_SETFL, $flags) || die $!; # Set the flags on the filehandle
+	}
+    }';
+    return ::spacefree(3, $script);
+}
+
+sub sharder_script() {
+    my $script = q{
+	use B;
+	# Column separator
+	my $sep = shift;
+	# Which columns to shard on (count from 1)
+	my $col = shift;
+	# Which columns to shard on (count from 0)
+	my $col0 = $col - 1;
+	# Perl expression
+	my $perlexpr = shift;
+	my $bins = @ARGV;
+	# Open fifos for writing, fh{0..$bins}
+	my $t = 0;
+	my %fh;
+	for(@ARGV) {
+	    open $fh{$t++}, ">", $_;
+	    # open blocks until it is opened by reader
+	    # so unlink only happens when it is ready
+	    unlink $_;
+	}
+	if($perlexpr) {
+	    my $subref = eval("sub { no strict; no warnings; $perlexpr }");
+	    while(<STDIN>) {
+		# Split into $col columns (no need to split into more)
+		@F = split $sep, $_, $col+1;
+		{
+		    local $_ = $F[$col0];
+		    &$subref();
+		    $fh = $fh{ hex(B::hash($_))%$bins };
+		}
+		print $fh $_;
+	    }
+	} else {
+	    while(<STDIN>) {
+		# Split into $col columns (no need to split into more)
+		@F = split $sep, $_, $col+1;
+		$fh = $fh{ hex(B::hash($F[$col0]))%$bins };
+		print $fh $_;
+	    }
+	}
+	# Close all open fifos
+	close values %fh;
+    };
+    return ::spacefree(1, $script);
+}
+
+sub binner_script() {
+    my $script = q{
+	use B;
+	# Column separator
+	my $sep = shift;
+	# Which columns to shard on (count from 1)
+	my $col = shift;
+	# Which columns to shard on (count from 0)
+	my $col0 = $col - 1;
+	# Perl expression
+	my $perlexpr = shift;
+	my $bins = @ARGV;
+	# Open fifos for writing, fh{0..$bins}
+	my $t = 0;
+	my %fh;
+	# Let the last output fifo be the 0'th
+	open $fh{$t++}, ">", pop @ARGV;
+	for(@ARGV) {
+	    open $fh{$t++}, ">", $_;
+	    # open blocks until it is opened by reader
+	    # so unlink only happens when it is ready
+	    unlink $_;
+	}
+	if($perlexpr) {
+	    my $subref = eval("sub { no strict; no warnings; $perlexpr }");
+	    while(<STDIN>) {
+		# Split into $col columns (no need to split into more)
+		@F = split $sep, $_, $col+1;
+		{
+		    local $_ = $F[$col0];
+		    &$subref();
+		    $fh = $fh{ $_%$bins };
+		}
+		print $fh $_;
+	    }
+	} else {
+	    while(<STDIN>) {
+		# Split into $col columns (no need to split into more)
+		@F = split $sep, $_, $col+1;
+		$fh = $fh{ $F[$col0]%$bins };
+		print $fh $_;
+	    }
+	}
+	# Close all open fifos
+	close values %fh;
+    };
+    return ::spacefree(1, $script);
+}
+
+sub pipe_shard_setup() {
+    # Create temporary fifos
+    # Run 'shard.pl sep col fifo1 fifo2 fifo3 ... fifoN' in the background
+    # This will spread the input to fifos
+    # Generate commands that reads from fifo1..N:
+    #	cat fifo | user_command
+    # Changes:
+    #	@Global::cat_prepends
+    my @shardfifos;
+    my @parcatfifos;
+    # TODO $opt::jobs should be evaluated (100%)
+    # TODO $opt::jobs should be number of total_jobs if there are arguments
+    max_jobs_running();
+    my $njobs = $Global::max_jobs_running;
+    for my $m (0..$njobs-1) {
+	for my $n (0..$njobs-1) {
+	    # sharding to A B C D
+	    # parcatting all As together
+	    $parcatfifos[$n][$m] = $shardfifos[$m][$n] = tmpfifo();
+	}
+    }
+    my $shardbin = ($opt::shard || $opt::bin);
+    my $script;
+    if($opt::bin) {
+	$script = binner_script();
+    } else {
+	$script = sharder_script();
+    }
+
+    # cat foo | sharder sep col fifo1 fifo2 fifo3 ... fifoN
+
+    if($shardbin =~ /^[a-z_][a-z_0-9]*(\s|$)/i) {
+	# Group by column name
+	# (Yes, this will also wrongly match a perlexpr like: chop)
+	my($read,$char,@line);
+	# A full line, but nothing more (the rest must be read by the child)
+	# $Global::header used to prepend block to each job
+	do {
+	    $read = sysread(STDIN,$char,1);
+	    push @line, $char;
+	} while($read and $char ne "\n");
+	$Global::header = join "", @line;
+    }
+    my ($col, $perlexpr, $subref) =
+	column_perlexpr($shardbin, $Global::header, $opt::colsep);
+    if(not fork()) {
+	# Let the sharder inherit our stdin
+	# and redirect stdout to null
+	open STDOUT, ">","/dev/null";
+	# The PERL_HASH_SEED must be the same for all sharders
+	# so B::hash will return the same value for any given input
+	$ENV{'PERL_HASH_SEED'} = $$;
+	exec qw(parallel --block 100k -q --pipe -j), $njobs,
+	    qw(--roundrobin -u perl -e), $script, ($opt::colsep || ","),
+	    $col, $perlexpr, '{}', (map { (':::+', @{$_}) } @parcatfifos);
+    }
+    # For each fifo
+    #	(rm fifo1; grep 1) < fifo1
+    #	(rm fifo2; grep 2) < fifo2
+    #	(rm fifo3; grep 3) < fifo3
+    my $parcat = Q(parcat_script());
+    if(not $parcat) {
+	::error("'parcat' must be in path.");
+	::wait_and_exit(255);
+    }
+    @Global::cat_prepends = map { "perl -e $parcat @$_ | " } @parcatfifos;
+}
+
+sub pipe_part_files(@) {
+    # Given the bigfile
+    # find header and split positions
+    # make commands that 'cat's the partial file
+    # Input:
+    #	$file = the file to read
+    # Returns:
+    #	@commands that will cat_partial each part
+    my ($file) = @_;
+    my $buf = "";
+    if(not -f $file and not -b $file) {
+	::error("--pipepart only works on seekable files, not streams/pipes.",
+		"$file is not a seekable file.");
+	::wait_and_exit(255);
+    }
+
+    my $fh = open_or_exit($file);
+    my $firstlinelen = 0;
+    if($opt::skip_first_line) {
+	my $newline;
+	# Read a full line one byte at a time
+	while($firstlinelen += sysread($fh,$newline,1,0)) {
+	    $newline eq "\n" and last;
+	}
+    }
+    my $header = find_header(\$buf,$fh);
+    # find positions
+    my @pos = find_split_positions($file,int($Global::blocksize),
+				   $header,$firstlinelen);
+    # Make @cat_prepends
+    my @cat_prepends = ();
+    for(my $i=0; $i<$#pos; $i++) {
+	push(@cat_prepends,
+	     cat_partial($file, $firstlinelen, $firstlinelen+length($header),
+			 $pos[$i], $pos[$i+1]));
+    }
+    return @cat_prepends;
+}
+
+sub find_header($$) {
+    # Compute the header based on $opt::header
+    # Input:
+    #	$buf_ref = reference to read-in buffer
+    #	$fh = filehandle to read from
+    # Uses:
+    #	$opt::header
+    #	$Global::blocksize
+    #	$Global::header
+    # Returns:
+    #	$header string
+    my ($buf_ref, $fh) = @_;
+    my $header = "";
+    # $Global::header may be set in group_by_loop()
+    if($Global::header) { return $Global::header }
+    if($opt::header) {
+	if($opt::header eq ":") { $opt::header = "(.*\n)"; }
+	# Number = number of lines
+	$opt::header =~ s/^(\d+)$/"(.*\n)"x$1/e;
+	while(sysread($fh,$$buf_ref,int($Global::blocksize),length $$buf_ref)) {
+	    if($$buf_ref =~ s/^($opt::header)//) {
+		$header = $1;
+		last;
+	    }
+	}
+    }
+    return $header;
+}
+
+sub find_split_positions($$$) {
+    # Find positions in bigfile where recend is followed by recstart
+    # Input:
+    #	$file = the file to read
+    #	$block = (minimal) --block-size of each chunk
+    #	$header = header to be skipped
+    # Uses:
+    #	$opt::recstart
+    #	$opt::recend
+    # Returns:
+    #	@positions of block start/end
+    my($file, $block, $header, $firstlinelen) = @_;
+    my $skiplen = $firstlinelen + length $header;
+    my $size = -s $file;
+    if(-b $file) {
+	# $file is a blockdevice
+	$size = size_of_block_dev($file);
+    }
+    $block = int $block;
+    if($opt::groupby) {
+	return split_positions_for_group_by($file,$size,$block,
+					    $header,$firstlinelen);
+    }
+    # The optimal dd blocksize for mint, redhat, solaris, openbsd = 2^17..2^20
+    # The optimal dd blocksize for freebsd = 2^15..2^17
+    # The optimal dd blocksize for ubuntu (AMD6376) = 2^16
+    my $dd_block_size = 131072; # 2^17
+    my @pos;
+    my ($recstart,$recend) = recstartrecend();
+    my $recendrecstart = $recend.$recstart;
+    my $fh = ::open_or_exit($file);
+    push(@pos,$skiplen);
+    for(my $pos = $block+$skiplen; $pos < $size; $pos += $block) {
+	my $buf;
+	if($recendrecstart eq "") {
+	    # records ends anywhere
+	    push(@pos,$pos);
+	} else {
+	    # Seek the the block start
+	    if(not sysseek($fh, $pos, 0)) {
+		::error("Cannot seek to $pos in $file");
+		edit(255);
+	    }
+	    while(sysread($fh,$buf,$dd_block_size,length $buf)) {
+		if($opt::regexp) {
+		    # If match /$recend$recstart/ => Record position
+		    if($buf =~ m:^(.*$recend)$recstart:os) {
+			# Start looking for next record _after_ this match
+			$pos += length($1);
+			push(@pos,$pos);
+			last;
+		    }
+		} else {
+		    # If match $recend$recstart => Record position
+		    # TODO optimize to only look at the appended
+		    #	$dd_block_size + len $recendrecstart
+		    # TODO increase $dd_block_size to optimize for longer records
+		    my $i = index64(\$buf,$recendrecstart);
+		    if($i != -1) {
+			# Start looking for next record _after_ this match
+			$pos += $i + length($recend);
+			push(@pos,$pos);
+			last;
+		    }
+		}
+	    }
+	}
+    }
+    if($pos[$#pos] != $size) {
+	# Last splitpoint was not at end of the file: add $size as the last
+	push @pos, $size;
+    }
+    close $fh;
+    return @pos;
+}
+
+sub split_positions_for_group_by($$$$) {
+    my($fh);
+    sub value_at($) {
+	my $pos = shift;
+	if($pos != 0) {
+	    seek($fh, $pos-1, 0) || die;
+	    # Read half line
+	    <$fh>;
+	}
+	# Read full line
+	my $linepos = tell($fh);
+	$_ = <$fh>;
+	if(defined $_) {
+	    # Not end of file
+	    my @F;
+	    if(defined $group_by::col) {
+		$opt::colsep ||= "\t";
+		@F = split /$opt::colsep/, $_;
+		$_ = $F[$group_by::col];
+	    }
+	    eval $group_by::perlexpr;
+	}
+	return ($_,$linepos);
+    }
+
+    sub binary_search_end($$$) {
+	my ($s,$spos,$epos) = @_;
+	# value_at($spos) == $s
+	# value_at($epos) != $s
+	my $posdif = $epos - $spos;
+	my ($v,$vpos);
+	while($posdif) {
+	    ($v,$vpos) = value_at($spos+$posdif);
+	    if($v eq $s) {
+		$spos = $vpos;
+		$posdif = $epos - $spos;
+	    } else {
+		$epos = $vpos;
+	    }
+	    $posdif = int($posdif/2);
+	}
+	return($v,$vpos);
+    }
+
+    sub binary_search_start($$$) {
+	my ($s,$spos,$epos) = @_;
+	# value_at($spos) != $s
+	# value_at($epos) == $s
+	my $posdif = $epos - $spos;
+	my ($v,$vpos);
+	while($posdif) {
+	    ($v,$vpos) = value_at($spos+$posdif);
+	    if($v eq $s) {
+		$epos = $vpos;
+	    } else {
+		$spos = $vpos;
+		$posdif = $epos - $spos;
+	    }
+	    $posdif = int($posdif/2);
+	}
+	return($v,$vpos);
+    }
+
+    my ($file,$size,$block,$header,$firstlinelen) = @_;
+    my ($a,$b,$c,$apos,$bpos,$cpos);
+    my @pos;
+    $fh = open_or_exit($file);
+    # Set $Global::group_by_column $Global::group_by_perlexpr
+    group_by_loop($fh,$opt::recsep);
+    # $xpos = linestart, $x = value at $xpos, $apos < $bpos < $cpos
+    $apos = $firstlinelen + length $header;
+    for(($a,$apos) = value_at($apos); $apos < $size;) {
+	push @pos, $apos;
+	$bpos = $apos + $block;
+	($b,$bpos) = value_at($bpos);
+	if(eof($fh)) {
+	    push @pos, $size; last;
+	}
+	$cpos = $bpos + $block;
+	($c,$cpos) = value_at($cpos);
+	if($a eq $b) {
+	    while($b eq $c) {
+		# Move bpos, cpos a block forward until $a == $b != $c
+		$bpos = $cpos;
+		$cpos += $block;
+		($c,$cpos) = value_at($cpos);
+		if($cpos >= $size) {
+		    $cpos = $size;
+		    last;
+		}
+	    }
+	    # $a == $b != $c
+	    # Binary search for $b ending between ($bpos,$cpos)
+	    ($b,$bpos) = binary_search_end($b,$bpos,$cpos);
+	} else {
+	    if($b eq $c) {
+		# $a != $b == $c
+		# Binary search for $b starting between ($apos,$bpos)
+		($b,$bpos) = binary_search_start($b,$apos,$bpos);
+	    } else {
+		# $a != $b != $c
+		# Binary search for $b ending between ($bpos,$cpos)
+		($b,$bpos) = binary_search_end($b,$bpos,$cpos);
+	    }
+	}
+	($a,$apos) = ($b,$bpos);
+    }
+    if($pos[$#pos] != $size) {
+	# Last splitpoint was not at end of the file: add it
+	push @pos, $size;
+    }
+    return @pos;
+}
+
+sub cat_partial($@) {
+    # Efficient command to copy from byte X to byte Y
+    # Input:
+    #	$file = the file to read
+    #	($start, $end, [$start2, $end2, ...]) = start byte, end byte
+    # Returns:
+    #	Efficient command to copy $start..$end, $start2..$end2, ... to stdout
+    my($file, @start_end) = @_;
+    my($start, $i);
+    # Convert (start,end) to (start,len)
+    my @start_len = map {
+	if(++$i % 2) { $start = $_; } else { $_-$start }
+    } @start_end;
+    # The optimal block size differs
+    # It has been measured on:
+    # AMD 6376: n*4k-1; small n
+    # AMD Neo N36L: 44k-200k
+    # Intel i7-3632QM: 55k-
+    # ARM Cortex A53: 4k-28k
+    # Intel i5-2410M: 36k-46k
+    #
+    # I choose 2^15-1 = 32767
+    # q{
+    #	expseq() {
+    #	    perl -E '
+    #		$last = pop @ARGV;
+    #	    $first = shift || 1;
+    #	    $inc = shift || 1.03;
+    #	    for($i=$first; $i<=$last;$i*=$inc) { say int $i }
+    #	    ' "$@"
+    #	}
+    #
+    #	seq 111111111 > big;
+    #	f() { ppar --test $1 -a big --pipepart --block -1 'md5sum > /dev/null'; }
+    #	export -f f;
+    #	expseq 1000 1.001 300000 | shuf | parallel -j1 --jl jl-md5sum f;
+    # };
+    my $script = spacefree
+	(0,
+	 q{
+	     while(@ARGV) {
+		 sysseek(STDIN,shift,0) || die;
+		 $left = shift;
+		 while($read =
+		       sysread(STDIN,$buf, $left > 32767 ? 32767 : $left)){
+		     $left -= $read;
+		     syswrite(STDOUT,$buf);
+		 }
+	     }
+	 });
+    return "<". Q($file) .
+	" perl -e '$script' @start_len |";
+}
+
+sub column_perlexpr($$$) {
+    # Compute the column number (if any), perlexpression from combined
+    # string (such as --shard key, --groupby key, {=n perlexpr=}
+    # Input:
+    #	$column_perlexpr = string with column and perl expression
+    #	$header = header from input file (if column is column name)
+    #	$colsep = column separator regexp
+    # Returns:
+    #	$col = column number
+    #	$perlexpr = perl expression
+    #	$subref = compiled perl expression as sub reference
+    my ($column_perlexpr, $header, $colsep) = @_;
+    my ($col, $perlexpr, $subref);
+    if($column_perlexpr =~ /^[-a-z0-9_]+(\s|$)/i) {
+	# Column name/number (possibly prefix)
+	if($column_perlexpr =~ s/^(-?\d+)(\s|$)//) {
+	    # Column number (possibly prefix)
+	    $col = $1;
+	} elsif($column_perlexpr =~ s/^([a-z0-9_]+)(\s+|$)//i) {
+	    # Column name (possibly prefix)
+	    my $colname = $1;
+	    # Split on --copsep pattern
+	    my @headers = split /$colsep/, $header;
+	    my %headers;
+	    @headers{@headers} = (1..($#headers+1));
+	    $col = $headers{$colname};
+	    if(not defined $col) {
+		::error("Column '$colname' $colsep not found in header",keys %headers);
+		::wait_and_exit(255);
+	    }
+	}
+    }
+    # What is left of $column_perlexpr is $perlexpr (possibly empty)
+    $perlexpr = $column_perlexpr;
+    $subref = eval("sub { no strict; no warnings; $perlexpr }");
+    return($col, $perlexpr, $subref);
+}
+
+sub group_by_loop($$) {
+    # Generate perl code for group-by loop
+    # Insert a $recsep when the column value changes
+    # The column value can be computed with $perlexpr
+    my($fh,$recsep) = @_;
+    my $groupby = $opt::groupby;
+    if($groupby =~ /^[a-z_][a-z_0-9]*(\s|$)/i) {
+	# Group by column name
+	# (Yes, this will also wrongly match a perlexpr like: chop)
+	my($read,$char,@line);
+	# Read a full line, but nothing more
+	# (the rest must be read by the child)
+	# $Global::header used to prepend block to each job
+	do {
+	    $read = sysread($fh,$char,1);
+	    push @line, $char;
+	} while($read and $char ne "\n");
+	$Global::header = join "", @line;
+    }
+    $opt::colsep ||= "\t";
+    ($group_by::col, $group_by::perlexpr, $group_by::subref) =
+	column_perlexpr($groupby, $Global::header, $opt::colsep);
+    # Numbered 0..n-1 due to being used by $F[n]
+    if($group_by::col) { $group_by::col--; }
+
+    my $loop = ::spacefree(0,q{
+	BEGIN{ $last = "RECSEP"; }
+	{
+	    local $_=COLVALUE;
+	    PERLEXPR;
+	    if(($last) ne $_) {
+		print "RECSEP";
+		$last = $_;
+	    }
+	}
+			   });
+    if(defined $group_by::col) {
+	$loop =~ s/COLVALUE/\$F[$group_by::col]/g;
+    } else {
+	$loop =~ s/COLVALUE/\$_/g;
+    }
+    $loop =~ s/PERLEXPR/$group_by::perlexpr/g;
+    $loop =~ s/RECSEP/$recsep/g;
+    return $loop;
+}
+
+sub pipe_group_by_setup() {
+    # Record separator with 119 bit random value
+    $opt::recend = '';
+    $opt::recstart =
+	join "", map { (0..9,"a".."z","A".."Z")[rand(62)] } (1..20);
+    $opt::remove_rec_sep = 1;
+    my @filter;
+    push @filter, "perl";
+    if($opt::groupby =~ /^[a-z0-9_]+(\s|$)/i) {
+	# This is column number/name
+	# Use -a (auto-split)
+	push @filter, "-a";
+	$opt::colsep ||= "\t";
+	my $sep = $opt::colsep;
+	$sep =~ s/\t/\\t/g;
+	$sep =~ s/\"/\\"/g;
+	# man perlrun: -Fpattern [...] You can't use literal whitespace
+	$sep =~ s/ /\\040{1}/g;
+	push @filter, "-F$sep";
+    }
+    push @filter, "-pe";
+    push @filter, group_by_loop(*STDIN,$opt::recstart);
+    ::debug("init", "@filter\n");
+    open(STDIN, '-|', @filter) || die ("Cannot start @filter");
+    if(which("mbuffer")) {
+	# You get a speed up of 30% by going through mbuffer
+	open(STDIN, '-|', "mbuffer", "-q","-m6M","-b5") ||
+	    die ("Cannot start mbuffer");
+    }
+}
+
+sub spreadstdin() {
+    # read a record
+    # Spawn a job and print the record to it.
+    # Uses:
+    #	$Global::blocksize
+    #	STDIN
+    #	$opt::r
+    #	$Global::max_lines
+    #	$Global::max_number_of_args
+    #	$opt::regexp
+    #	$Global::start_no_new_jobs
+    #	$opt::roundrobin
+    #	%Global::running
+    # Returns: N/A
+
+    my $buf = "";
+    my ($recstart,$recend) = recstartrecend();
+    my $recendrecstart = $recend.$recstart;
+    my $chunk_number = 1;
+    my $one_time_through;
+    my $two_gb = 2**31-1;
+    my $blocksize = int($Global::blocksize);
+    my $in = *STDIN;
+    my $timeout = $Global::blocktimeout;
+
+    if($opt::skip_first_line) {
+	my $newline;
+	# Read a full line one byte at a time
+	while(sysread($in,$newline,1,0)) {
+	    $newline eq "\n" and last;
+	}
+    }
+    my $header = find_header(\$buf,$in);
+    my $anything_written;
+    my $eof;
+    my $garbage_read;
+
+    sub read_block() {
+	# Read a --blocksize from STDIN
+	# possibly interrupted by --blocktimeout
+	# Add up to the next full block
+	my $readsize = $blocksize - (length $buf) % $blocksize;
+	my ($nread,$alarm);
+	eval {
+	    local $SIG{ALRM} = sub { die "alarm\n" }; # NB: \n required
+	    # --blocktimeout (or 0 if not set)
+	    alarm $timeout;
+	    if($] >= 5.026) {
+		do {
+		    $nread = sysread $in, $buf, $readsize, length $buf;
+		    $readsize -= $nread;
+		} while($readsize and $nread);
+	    } else {
+		# Less efficient reading, but 32-bit sysread compatible
+		do {
+		    $nread = sysread($in,substr($buf,length $buf,0),$readsize,0);
+		    $readsize -= $nread;
+		} while($readsize and $nread);
+	    }
+	    alarm 0;
+	};
+	if ($@) {
+	    die unless $@ eq "alarm\n";	  # propagate unexpected errors
+	    $alarm = 1;
+	} else {
+	    $alarm = 0;
+	}
+	$eof = not ($nread or $alarm);
+    }
+
+    sub pass_n_line_records() {
+	# Pass records of N lines
+	my $n_lines = $buf =~ tr/\n/\n/;
+	my $last_newline_pos = rindex64(\$buf,"\n");
+	# Go backwards until there are full n-line records
+	while($n_lines % $Global::max_lines) {
+	    $n_lines--;
+	    $last_newline_pos = rindex64(\$buf,"\n",$last_newline_pos-1);
+	}
+	# Chop at $last_newline_pos as that is where n-line record ends
+	$anything_written +=
+	    write_record_to_pipe($chunk_number++,\$header,\$buf,
+				 $recstart,$recend,$last_newline_pos+1);
+	shorten(\$buf,$last_newline_pos+1);
+    }
+
+    sub pass_n_regexps() {
+	# Pass records of N regexps
+	# -N => (start..*?end){n}
+	# -L -N => (start..*?end){n*l}
+	if(not $garbage_read) {
+	    $garbage_read = 1;
+	    if($buf !~ /^$recstart/o) {
+		# Buf does not start with $recstart => There is garbage.
+		# Make a single record of the garbage
+		if($buf =~
+		   /(?s:^)(
+		   (?:(?:(?!$recend$recstart)(?s:.))*?$recend)
+		   )
+		   # Followed by recstart
+		   (?=$recstart)/mox and length $1 > 0) {
+		    $anything_written +=
+			write_record_to_pipe($chunk_number++,\$header,\$buf,
+					     $recstart,$recend,length $1);
+		    shorten(\$buf,length $1);
+		}
+	    }
+	}
+
+	my $n_records =
+	    $Global::max_number_of_args * ($Global::max_lines || 1);
+	# (?!negative lookahead) is needed to avoid backtracking
+	# See: https://unix.stackexchange.com/questions/439356/
+	# (?s:.) = (.|[\n]) but faster
+	while($buf =~
+	      /(?s:^)(
+	      # n more times recstart.*recend
+	      (?:$recstart(?:(?!$recend$recstart)(?s:.))*?$recend){$n_records}
+	      )
+	      # Followed by recstart
+	      (?=$recstart)/mox and length $1 > 0) {
+	    $anything_written +=
+		write_record_to_pipe($chunk_number++,\$header,\$buf,
+				     $recstart,$recend,length $1);
+	    shorten(\$buf,length $1);
+	}
+    }
+
+    sub pass_regexp() {
+	# Find the last recend-recstart in $buf
+	$eof and return;
+	# (?s:.) = (.|[\n]) but faster
+	if($buf =~ /^((?s:.)*$recend)$recstart(?s:.)*?$/mox) {
+	    $anything_written +=
+		write_record_to_pipe($chunk_number++,\$header,\$buf,
+				     $recstart,$recend,length $1);
+	    shorten(\$buf,length $1);
+	}
+    }
+
+    sub pass_csv_record() {
+	# Pass CVS record
+	# We define a CSV record as an even number of " + end of line
+	# This works if you use " as quoting character
+	my $last_newline_pos = length $buf;
+	# Go backwards from the last \n and search for a position
+	# where there is an even number of "
+	do {
+	    # find last EOL
+	    $last_newline_pos = rindex64(\$buf,"\n",$last_newline_pos-1);
+	    # While uneven "
+	} while((substr($buf,0,$last_newline_pos) =~ y/"/"/)%2
+		and $last_newline_pos >= 0);
+	# Chop at $last_newline_pos as that is where CSV record ends
+	$anything_written +=
+	    write_record_to_pipe($chunk_number++,\$header,\$buf,
+				 $recstart,$recend,$last_newline_pos+1);
+	shorten(\$buf,$last_newline_pos+1);
+    }
+
+    sub pass_n() {
+	# Pass n records of --recend/--recstart
+	# -N => (start..*?end){n}
+	my $i = 0;
+	my $read_n_lines =
+	    $Global::max_number_of_args * ($Global::max_lines || 1);
+	    while(($i = nindex(\$buf,$recendrecstart,$read_n_lines)) != -1
+		  and
+		  length $buf) {
+		$i += length $recend; # find the actual splitting location
+		$anything_written +=
+		    write_record_to_pipe($chunk_number++,\$header,\$buf,
+					 $recstart,$recend,$i);
+		shorten(\$buf,$i);
+	    }
+    }
+
+    sub pass() {
+	# Pass records of --recend/--recstart
+	# Split record at fixed string
+	# Find the last recend+recstart in $buf
+	$eof and return;
+	my $i = rindex64(\$buf,$recendrecstart);
+	if($i != -1) {
+	    $i += length $recend; # find the actual splitting location
+	    $anything_written +=
+		write_record_to_pipe($chunk_number++,\$header,\$buf,
+				     $recstart,$recend,$i);
+	    shorten(\$buf,$i);
+	}
+    }
+
+    sub increase_blocksize_maybe() {
+	if(not $anything_written
+	   and not $opt::blocktimeout
+	   and not $Global::no_autoexpand_block) {
+	    # Nothing was written - maybe the block size < record size?
+	    # Increase blocksize exponentially up to 2GB-1 (2GB causes problems)
+	    if($blocksize < $two_gb) {
+		my $old_blocksize = $blocksize;
+		$blocksize = ::min(ceil($blocksize * 1.3 + 1), $two_gb);
+		::warning("A record was longer than $old_blocksize. " .
+			  "Increasing to --blocksize $blocksize.");
+	    }
+	}
+    }
+
+    while(1) {
+	$anything_written = 0;
+	read_block();
+	if($opt::r) {
+	    # Remove empty lines
+	    $buf =~ s/^\s*\n//gm;
+	    if(length $buf == 0) {
+		if($eof) {
+		    last;
+		} else {
+		    next;
+		}
+	    }
+	}
+	if($Global::max_lines and not $Global::max_number_of_args) {
+	    # Pass n-line records
+	    pass_n_line_records();
+	} elsif($opt::csv) {
+	    # Pass a full CSV record
+	    pass_csv_record();
+	} elsif($opt::regexp) {
+	    # Split record at regexp
+	    if($Global::max_number_of_args) {
+		pass_n_regexps();
+	    } else {
+		pass_regexp();
+	    }
+	} else {
+	    # Pass normal --recend/--recstart record
+	    if($Global::max_number_of_args) {
+		pass_n();
+	    } else {
+		pass();
+	    }
+	}
+	$eof and last;
+	increase_blocksize_maybe();
+	::debug("init", "Round\n");
+    }
+    ::debug("init", "Done reading input\n");
+
+    # If there is anything left in the buffer write it
+    write_record_to_pipe($chunk_number++, \$header, \$buf, $recstart,
+			 $recend, length $buf);
+
+    if($opt::retries) {
+	$Global::no_more_input = 1;
+	# We need to start no more jobs: At most we need to retry some
+	# of the already running.
+	my @running = values %Global::running;
+	# Stop any virgins.
+	for my $job (@running) {
+	    if(defined $job and $job->virgin()) {
+		close $job->fh(0,"w");
+	    }
+	}
+	# Wait for running jobs to be done
+	my $sleep = 1;
+	while($Global::total_running > 0) {
+	    $sleep = ::reap_usleep($sleep);
+	    start_more_jobs();
+	}
+    }
+    $Global::start_no_new_jobs ||= 1;
+    if($opt::roundrobin) {
+	# Flush blocks to roundrobin procs
+	my $sleep = 1;
+	while(%Global::running) {
+	    my $something_written = 0;
+	    for my $job (values %Global::running) {
+		if($job->block_length()) {
+		    $something_written += $job->non_blocking_write();
+		} else {
+		    close $job->fh(0,"w");
+		}
+	    }
+	    if($something_written) {
+		$sleep = $sleep/2+0.001;
+	    }
+	    $sleep = ::reap_usleep($sleep);
+	}
+    }
+}
+
+sub recstartrecend() {
+    # Uses:
+    #	$opt::recstart
+    #	$opt::recend
+    # Returns:
+    #	$recstart,$recend with default values and regexp conversion
+    my($recstart,$recend);
+    if(defined($opt::recstart) and defined($opt::recend)) {
+	# If both --recstart and --recend is given then both must match
+	$recstart = $opt::recstart;
+	$recend = $opt::recend;
+    } elsif(defined($opt::recstart)) {
+	# If --recstart is given it must match start of record
+	$recstart = $opt::recstart;
+	$recend = "";
+    } elsif(defined($opt::recend)) {
+	# If --recend is given then it must match end of record
+	$recstart = "";
+	$recend = $opt::recend;
+	if($opt::regexp and $recend eq '') {
+	    # --regexp --recend ''
+	    $recend = '(?s:.)';
+	}
+    }
+
+    if($opt::regexp) {
+	# Do not allow /x comments - to avoid having to quote space
+	$recstart = "(?-x:".$recstart.")";
+	$recend = "(?-x:".$recend.")";
+	# If $recstart/$recend contains '|'
+	# the | should only apply to the regexp
+	$recstart = "(?:".$recstart.")";
+	$recend = "(?:".$recend.")";
+    } else {
+	# $recstart/$recend = printf strings (\n)
+	$recstart =~ s/\\([0rnt\'\"\\])/"qq|\\$1|"/gee;
+	$recend =~ s/\\([0rnt\'\"\\])/"qq|\\$1|"/gee;
+    }
+    return ($recstart,$recend);
+}
+
+sub nindex($$) {
+    # See if string is in buffer N times
+    # Returns:
+    #	the position where the Nth copy is found
+    my ($buf_ref, $str, $n) = @_;
+    my $i = 0;
+    for(1..$n) {
+	$i = index64($buf_ref,$str,$i+1);
+	if($i == -1) { last }
+    }
+    return $i;
+}
+
+{
+    my @robin_queue;
+    my $sleep = 1;
+
+    sub round_robin_write($$$$$) {
+	# Input:
+	#   $header_ref = ref to $header string
+	#   $block_ref = ref to $block to be written
+	#   $recstart = record start string
+	#   $recend = record end string
+	#   $endpos = end position of $block
+	# Uses:
+	#   %Global::running
+	# Returns:
+	#   $something_written = amount of bytes written
+	my ($header_ref,$buffer_ref,$recstart,$recend,$endpos) = @_;
+	my $written = 0;
+	my $block_passed = 0;
+	while(not $block_passed) {
+	    # Continue flushing existing buffers
+	    # until one is empty and a new block is passed
+	    if(@robin_queue) {
+		# Rotate queue once so new blocks get a fair chance
+		# to be given to another slot
+		push @robin_queue, shift @robin_queue;
+	    } else {
+		# Make a queue to spread the blocks evenly
+		push @robin_queue, (sort { $a->seq() <=> $b->seq() }
+				    values %Global::running);
+	    }
+	    do {
+		$written = 0;
+		for my $job (@robin_queue) {
+		    if($job->block_length() > 0) {
+			$written += $job->non_blocking_write();
+		    } else {
+			$job->set_block($header_ref, $buffer_ref,
+					$endpos, $recstart, $recend);
+			$block_passed = 1;
+			$written += $job->non_blocking_write();
+			last;
+		    }
+		}
+		if($written) {
+		    $sleep = $sleep/1.5+0.001;
+		}
+		# Don't sleep if something is written
+	    } while($written and not $block_passed);
+	    $sleep = ::reap_usleep($sleep);
+	}
+	return $written;
+    }
+}
+
+sub index64($$$) {
+    # Do index on strings > 2GB.
+    # index in Perl < v5.22 does not work for > 2GB
+    # Input:
+    #	as index except STR which must be passed as a reference
+    # Output:
+    #	as index
+    my $ref = shift;
+    my $match = shift;
+    my $pos = shift || 0;
+    my $block_size = 2**31-1;
+    my $strlen = length($$ref);
+    # No point in doing extra work if we don't need to.
+    if($strlen < $block_size or $] > 5.022) {
+	return index($$ref, $match, $pos);
+    }
+
+    my $matchlen = length($match);
+    my $ret;
+    my $offset = $pos;
+    while($offset < $strlen) {
+	$ret = index(
+	    substr($$ref, $offset, $block_size),
+	    $match, $pos-$offset);
+	if($ret != -1) {
+	    return $ret + $offset;
+	}
+	$offset += ($block_size - $matchlen - 1);
+    }
+    return -1;
+}
+
+sub rindex64($@) {
+    # Do rindex on strings > 2GB.
+    # rindex in Perl < v5.22 does not work for > 2GB
+    # Input:
+    #	as rindex except STR which must be passed as a reference
+    # Output:
+    #	as rindex
+    my $ref = shift;
+    my $match = shift;
+    my $pos = shift;
+    my $block_size = 2**31-1;
+    my $strlen = length($$ref);
+    # Default: search from end
+    $pos = defined $pos ? $pos : $strlen;
+    # No point in doing extra work if we don't need to.
+    if($strlen < $block_size or $] > 5.022) {
+	return rindex($$ref, $match, $pos);
+    }
+
+    my $matchlen = length($match);
+    my $ret;
+    my $offset = $pos - $block_size + $matchlen;
+    if($offset < 0) {
+	# The offset is less than a $block_size
+	# Set the $offset to 0 and
+	# Adjust block_size accordingly
+	$block_size = $block_size + $offset;
+	$offset = 0;
+    }
+    while($offset >= 0) {
+	$ret = rindex(
+	    substr($$ref, $offset, $block_size),
+	    $match);
+	if($ret != -1) {
+	    return $ret + $offset;
+	}
+	$offset -= ($block_size - $matchlen - 1);
+    }
+    return -1;
+}
+
+sub shorten($$) {
+    # Do: substr($buf,0,$i) = "";
+    # Some Perl versions do not support $i > 2GB, so do this in 2GB chunks
+    # Input:
+    #	$buf_ref = \$buf
+    #	$i = position to shorten to
+    # Returns: N/A
+    my ($buf_ref, $i) = @_;
+    my $two_gb = 2**31-1;
+    while($i > $two_gb) {
+	substr($$buf_ref,0,$two_gb) = "";
+	$i -= $two_gb;
+    }
+    substr($$buf_ref,0,$i) = "";
+}
+
+sub write_record_to_pipe($$$$$$) {
+    # Fork then
+    # Write record from pos 0 .. $endpos to pipe
+    # Input:
+    #	$chunk_number = sequence number - to see if already run
+    #	$header_ref = reference to header string to prepend
+    #	$buffer_ref = reference to record to write
+    #	$recstart = start string of record
+    #	$recend = end string of record
+    #	$endpos = position in $buffer_ref where record ends
+    # Uses:
+    #	$Global::job_already_run
+    #	$opt::roundrobin
+    #	@Global::virgin_jobs
+    # Returns:
+    #	Number of chunks written (0 or 1)
+    my ($chunk_number, $header_ref, $buffer_ref,
+	$recstart, $recend, $endpos) = @_;
+    if($endpos == 0) { return 0; }
+    if(vec($Global::job_already_run,$chunk_number,1)) { return 1; }
+    if($opt::roundrobin) {
+	# Write the block to one of the already running jobs
+	return round_robin_write($header_ref, $buffer_ref,
+				 $recstart, $recend, $endpos);
+    }
+    # If no virgin found, backoff
+    my $sleep = 0.0001; # 0.01 ms - better performance on highend
+    while(not @Global::virgin_jobs) {
+	::debug("pipe", "No virgin jobs");
+	$sleep = ::reap_usleep($sleep);
+	# Jobs may not be started because of loadavg
+	# or too little time between each ssh login
+	# or retrying failed jobs.
+	start_more_jobs();
+    }
+    my $job = shift @Global::virgin_jobs;
+    $job->set_block($header_ref, $buffer_ref, $endpos, $recstart, $recend);
+    $job->write_block();
+    return 1;
+}
+
+
+sub __SEM_MODE__() {}
+
+
+sub acquire_semaphore() {
+    # Acquires semaphore. If needed: spawns to the background
+    # Uses:
+    #	@Global::host
+    # Returns:
+    #	The semaphore to be released when jobs is complete
+    $Global::host{':'} = SSHLogin->new(":");
+    my $sem = Semaphore->new($Semaphore::name,
+			     $Global::host{':'}->max_jobs_running());
+    $sem->acquire();
+    if($Semaphore::fg) {
+	# skip
+    } else {
+	if(fork()) {
+	    exit(0);
+	} else {
+	    # If run in the background, the PID will change
+	    $sem->pid_change();
+	}
+    }
+    return $sem;
+}
+
+
+sub __PARSE_OPTIONS__() {}
+
+sub shell_completion() {
+    if($opt::shellcompletion eq "zsh") {
+	# if shell == zsh
+	zsh_competion();
+    } elsif($opt::shellcompletion eq "bash") {
+	# if shell == bash
+	bash_competion();
+    } elsif($opt::shellcompletion eq "auto") {
+	if($Global::shell =~ m:/zsh$|^zsh$:) {
+	    # if shell == zsh
+	    zsh_competion();
+	} elsif($Global::shell =~ m:/bash$|^bash$:) {
+	    # if shell == bash
+	    bash_competion();
+	} else {
+	    ::error("--shellcompletion is not implemented for ".
+		    "'$Global::shell'.");
+	    wait_and_exit(255);
+	}
+    } else {
+	::error("--shellcompletion is not implemented for ".
+		"'$opt::shellcompletion'.");
+	wait_and_exit(255);
+    }
+}
+
+sub bash_competion() {
+    # Print:
+    #   complete -F _comp_parallel parallel;
+    #   _comp_parallel() {
+    #     COMPREPLY=($(compgen -W "--options" --
+    #                    "${COMP_WORDS[$COMP_CWORD]}"));
+    #   };
+    my @bash_completion =
+	("complete -F _comp_parallel parallel;",
+	 '_comp_parallel() { COMPREPLY=($(compgen -W "');
+    my @och = options_completion_hash();
+    while(@och) {
+	$_ = shift @och;
+	# Split input like:
+	# "joblog|jl=s[Logfile for executed jobs]:logfile:_files"
+	if(/^(.*?)(\[.*?])?(:[^:]*)?(:.*)?$/) {
+	    my $opt = $1;
+	    my $desc = $2;
+	    my $argdesc = $3;
+	    my $func = $4;
+	    # opt=s => opt
+	    $opt =~ s/[:=].$//;
+	    if($opt =~ /^_/) {
+		# internal options start with --_
+		# skip
+	    } else {
+		push @bash_completion,
+		    (map { (length $_ == 1) ? "-$_ " : "--$_ " }
+		     split /\|/, $opt);
+	    }
+	}
+	shift @och;
+    }
+    push @bash_completion,'" -- "${COMP_WORDS[$COMP_CWORD]}")); };'."\n";
+    print @bash_completion;
+}
+
+sub zsh_competion() {
+    my @zsh_completion =
+	("compdef _comp_parallel parallel; ",
+	 "setopt localoptions extended_glob; ",
+	 "local -a _comp_priv_prefix; ",
+	 "_comp_parallel() { ",
+	 "_arguments ");
+    my @och = options_completion_hash();
+    while(@och) {
+	$_ = shift @och;
+	# Split input like:
+	# "joblog|jl=s[Logfile for executed jobs]:logfile:_files"
+	if(/^(.*?)(\[.*?])?(:[^:]*)?(:.*)?$/) {
+	    my $opt = $1;
+	    my $desc = $2;
+	    my $argdesc = $3;
+	    my $func = $4;
+	    # opt=s => opt
+	    $opt =~ s/[:=].$//;
+	    if($opt =~ /^_/) {
+		# internal options start with --_
+		# skip
+	    } else {
+		# {-o,--option}
+		my $zsh_opt = join(",",
+				   (map { (length $_ == 1) ? "-$_" : "--$_" }
+				    split /\|/, $opt));
+		if($zsh_opt =~ /,/) { $zsh_opt = "{$zsh_opt}"; }
+		$desc =~ s/'/'"'"'/g;
+		$argdesc =~ s/'/'"'"'/g;
+		$func =~ s/'/'"'"'/g;
+		push @zsh_completion, $zsh_opt."'".$desc.$argdesc.$func."' ";
+	    }
+	}
+	shift @och;
+    }
+    push @zsh_completion,
+	q{'(-)1:command: _command_names -e' },
+	q{'*::arguments:{ _comp_priv_prefix=( '$words[1]' -n ${(kv)opt_args[(I)(-[ugHEP]|--(user|group|set-home|preserve-env|preserve-groups))]} ) ; _normal }'},
+	"};\n";
+    print @zsh_completion;
+}
+
+sub options_hash() {
+    # Returns:
+    #	%hash = for GetOptions
+    my %och = options_completion_hash();
+    my %oh;
+    my ($k,$v);
+    while(($k,$v) = each %och) {
+	$k =~ s/\[.*//;
+	$oh{$k} = $v;
+    }
+    return %oh;
+}
+
+sub options_completion_hash() {
+    # Returns:
+    #	%hash = for GetOptions and shell completion
+    return
+	("debug|D=s" => \$opt::D,
+	 "xargs[Insert as many arguments as the command line length permits]"
+	 => \$opt::xargs,
+	 "m[Multiple arguments]" => \$opt::m,
+	 ("X[Insert as many arguments with context as the command line ".
+	 "length permits]"
+	 => \$opt::X),
+	 "v[Verbose]" => \@opt::v,
+	 "sql=s[Use --sql-master instead (obsolete)]:DBURL" => \$opt::retired,
+	 ("sql-master|sqlmaster=s".
+	  "[Submit jobs via SQL server. DBURL must point to a table, which ".
+	  "will contain --joblog, the values, and output]:DBURL"
+	  => \$opt::sqlmaster),
+	 ("sql-worker|sqlworker=s".
+	  "[Execute jobs via SQL server. Read the input sources variables ".
+	  "from the table pointed to by DBURL.]:DBURL"
+	  => \$opt::sqlworker),
+	 ("sql-and-worker|sqlandworker=s".
+	  "[--sql-master DBURL --sql-worker DBURL]:DBURL"
+	  => \$opt::sqlandworker),
+	 ("joblog|jl=s[Logfile for executed jobs]:logfile:_files"
+	  => \$opt::joblog),
+	 ("results|result|res=s[Save the output into files]:name:_files"
+	  => \$opt::results),
+	 "resume[Resumes from the last unfinished job]" => \$opt::resume,
+	 ("resume-failed|resumefailed".
+	  "[Retry all failed and resume from the last unfinished job]"
+	  => \$opt::resume_failed),
+	 ("retry-failed|retryfailed[Retry all failed jobs in joblog]"
+	  => \$opt::retry_failed),
+	 "silent[Silent]" => \$opt::silent,
+	 ("keep-order|keeporder|k".
+	  "[Keep sequence of output same as the order of input]"
+	  => \$opt::keeporder),
+	 ("no-keep-order|nokeeporder|nok|no-k".
+	  "[Overrides an earlier --keep-order (e.g. if set in ".
+	  "~/.parallel/config)]"
+	  => \$opt::nokeeporder),
+	 "group[Group output]" => \$opt::group,
+	 "g" => \$opt::retired,
+	 ("ungroup|u".
+	  "[Output is printed as soon as possible and bypasses GNU parallel ".
+	  "internal processing]"
+	  => \$opt::ungroup),
+	 ("latest-line|latestline|ll".
+	  "[Print latest line of each job]"
+	  => \$opt::latestline),
+	 ("line-buffer|line-buffered|linebuffer|linebuffered|lb".
+	  "[Buffer output on line basis]"
+	  => \$opt::linebuffer),
+	 ("tmux".
+	  "[Use tmux for output. Start a tmux session and run each job in a ".
+	  "window in that session. No other output will be produced]"
+	  => \$opt::tmux),
+	 ("tmux-pane|tmuxpane".
+	  "[Use tmux for output but put output into panes in the first ".
+	  "window.  Useful if you want to monitor the progress of less than ".
+	  "100 concurrent jobs]"
+	  => \$opt::tmuxpane),
+	 "null|0[Use NUL as delimiter]" => \$opt::null,
+	 "quote|q[Quote command]" => \$opt::quote,
+	 # Replacement strings
+	 ("parens=s[Use parensstring instead of {==}]:parensstring"
+	  => \$opt::parens),
+	 ('rpl=s[Define replacement string]:"tag perl expression"'
+	  => \@opt::rpl),
+	 "plus[Add more replacement strings]" => \$opt::plus,
+	 ("I=s".
+	  "[Use the replacement string replace-str instead of {}]:replace-str"
+	  => \$opt::I),
+	 ("extensionreplace|er=s".
+	  "[Use the replacement string replace-str instead of {.} for input ".
+	  "line without extension]:replace-str"
+	  => \$opt::U),
+	 "U=s" => \$opt::retired,
+	 ("basenamereplace|bnr=s".
+	  "[Use the replacement string replace-str instead of {/} for ".
+	  "basename of input line]:replace-str"
+	  => \$opt::basenamereplace),
+	 ("dirnamereplace|dnr=s".
+	  "[Use the replacement string replace-str instead of {//} for ".
+	  "dirname of input line]:replace-str"
+	  => \$opt::dirnamereplace),
+	 ("basenameextensionreplace|bner=s".
+	  "[Use the replacement string replace-str instead of {/.} for ".
+	  "basename of input line without extension]:replace-str"
+	  => \$opt::basenameextensionreplace),
+	 ("seqreplace=s".
+	  "[Use the replacement string replace-str instead of {#} for job ".
+	  "sequence number]:replace-str"
+	  => \$opt::seqreplace),
+	 ("slotreplace=s".
+	  "[Use the replacement string replace-str instead of {%} for job ".
+	  "slot number]:replace-str"
+	  => \$opt::slotreplace),
+	 ("jobs|j=s".
+	  "[(Add +N to/Subtract -N from/Multiply N%) the number of CPU ".
+	  "threads or read parameter from file]:_files"
+	  => \$opt::jobs),
+	 ("delay=s".
+	  "[Delay starting next job by duration]:duration" => \$opt::delay),
+	 ("ssh-delay|sshdelay=f".
+	  "[Delay starting next ssh by duration]:duration"
+	  => \$opt::sshdelay),
+	 ("load=s".
+	  "[Only start jobs if load is less than max-load]:max-load"
+	  => \$opt::load),
+	 "noswap[Do not start job is computer is swapping]" => \$opt::noswap,
+	 ("max-line-length-allowed|maxlinelengthallowed".
+	  "[Print maximal command line length]"
+	  => \$opt::max_line_length_allowed),
+	 ("number-of-cpus|numberofcpus".
+	  "[Print the number of physical CPU cores and exit (obsolete)]"
+	  => \$opt::number_of_cpus),
+	 ("number-of-sockets|numberofsockets".
+	  "[Print the number of CPU sockets and exit]"
+	  => \$opt::number_of_sockets),
+	 ("number-of-cores|numberofcores".
+	  "[Print the number of physical CPU cores and exit]"
+	  => \$opt::number_of_cores),
+	 ("number-of-threads|numberofthreads".
+	  "[Print the number of hyperthreaded CPU cores and exit]"
+	  => \$opt::number_of_threads),
+	 ("use-sockets-instead-of-threads|usesocketsinsteadofthreads".
+	  "[Determine how GNU Parallel counts the number of CPUs]"
+	  => \$opt::use_sockets_instead_of_threads),
+	 ("use-cores-instead-of-threads|usecoresinsteadofthreads".
+	  "[Determine how GNU Parallel counts the number of CPUs]"
+	  => \$opt::use_cores_instead_of_threads),
+	 ("use-cpus-instead-of-cores|usecpusinsteadofcores".
+	  "[Determine how GNU Parallel counts the number of CPUs]"
+	  => \$opt::use_cpus_instead_of_cores),
+	 ("shell-quote|shellquote|shell_quote".
+	  "[Does not run the command but quotes it. Useful for making ".
+	  "quoted composed commands for GNU parallel]"
+	  => \@opt::shellquote),
+	 ('nice=i[Run the command at this niceness]:niceness:($(seq -20 19))'
+	  => \$opt::nice),
+	 "tag[Tag lines with arguments]" => \$opt::tag,
+	 ("tag-string|tagstring=s".
+	  "[Tag lines with a string]:str" => \$opt::tagstring),
+	 "ctag[Color tag]:str" => \$opt::ctag,
+	 "ctag-string|ctagstring=s[Colour tagstring]:str" => \$opt::ctagstring,
+	 "color|colour[Colourize output]" => \$opt::color,
+	 ("color-failed|colour-failed|colorfailed|colourfailed|".
+	  "color-fail|colour-fail|colorfail|colourfail|cf".
+	  "[Colour failed jobs red]"
+	  => \$opt::colorfailed),
+	 ("onall[Run all the jobs on all computers given with --sshlogin]"
+	  => \$opt::onall),
+	 "nonall[--onall with no arguments]" => \$opt::nonall,
+	 ("filter-hosts|filterhosts|filter-host[Remove down hosts]"
+	  => \$opt::filter_hosts),
+	 ('sshlogin|S=s'.
+	  '[Distribute jobs to remote computers]'.
+	  ':[@hostgroups/][ncpus/]sshlogin'.
+	  '[,[@hostgroups/][ncpus/]sshlogin[,...]] or @hostgroup'.
+	  ':_users') => \@opt::sshlogin,
+	 ("sshloginfile|slf=s".
+	  "[File with sshlogins on separate lines. Lines starting with '#' ".
+	  "are ignored.]:filename:_files"
+	  => \@opt::sshloginfile),
+	 ("controlmaster|M".
+	  "[Use ssh's ControlMaster to make ssh connections faster]"
+	  => \$opt::controlmaster),
+	 ("ssh=s".
+	  "[Use this command instead of ssh for remote access]:sshcommand"
+	  => \$opt::ssh),
+	 ("transfer-file|transferfile|transfer-files|transferfiles|tf=s".
+	  "[Transfer filename to remote computers]:filename:_files"
+	  => \@opt::transfer_files),
+	 ("return=s[Transfer files from remote computers]:filename:_files"
+	  => \@opt::return),
+	 ("trc=s[--transfer --return filename --cleanup]:filename:_files"
+	  => \@opt::trc),
+	 "transfer[Transfer files to remote computers]" => \$opt::transfer,
+	 "cleanup[Remove transferred files]" => \$opt::cleanup,
+	 ("basefile|bf=s".
+	  "[Transfer file to each sshlogin before first job is started]".
+	  ":file:_files"
+	  => \@opt::basefile),
+	 ("template|tmpl=s".
+	  "[Replace replacement strings in file and save it in repl]".
+	  ":file=repl:_files"
+	  => \%opt::template),
+	 "B=s" => \$opt::retired,
+	 "ctrl-c|ctrlc" => \$opt::retired,
+	 "no-ctrl-c|no-ctrlc|noctrlc" => \$opt::retired,
+	 ("work-dir|workdir|wd=s".
+	  "[Jobs will be run in the dir mydir. (default: the current dir ".
+	  "for the local machine, the login dir for remote computers)]".
+	  ":mydir:_cd"
+	  => \$opt::workdir),
+	 "W=s" => \$opt::retired,
+	 ("rsync-opts|rsyncopts=s[Options to pass on to rsync]:options"
+	  => \$opt::rsync_opts),
+	 ("tmpdir|tempdir=s[Directory for temporary files]:dirname:_cd"
+	  => \$opt::tmpdir),
+	 ("use-compress-program|compress-program|".
+	  "usecompressprogram|compressprogram=s".
+	  "[Use prg for compressing temporary files]:prg:_commands"
+	  => \$opt::compress_program),
+	 ("use-decompress-program|decompress-program|".
+	  "usedecompressprogram|decompressprogram=s".
+	  "[Use prg for decompressing temporary files]:prg:_commands"
+	  => \$opt::decompress_program),
+	 "compress[Compress temporary files]" => \$opt::compress,
+	 "open-tty|o[Open terminal tty]" => \$opt::open_tty,
+	 "tty[Open terminal tty]" => \$opt::tty,
+	 "T" => \$opt::retired,
+	 "H=i" => \$opt::retired,
+	 ("dry-run|dryrun|dr".
+	  "[Print the job to run on stdout (standard output), but do not ".
+	  "run the job]"
+	  => \$opt::dryrun),
+	 "progress[Show progress of computations]" => \$opt::progress,
+	 ("eta[Show the estimated number of seconds before finishing]"
+	  => \$opt::eta),
+	 "bar[Show progress as a progress bar]" => \$opt::bar,
+	 ("total-jobs|totaljobs|total=s".
+	  "[Set total number of jobs]" => \$opt::totaljobs),
+	 "shuf[Shuffle jobs]" => \$opt::shuf,
+	 ("arg-sep|argsep=s".
+	  "[Use sep-str instead of ::: as separator string]:sep-str"
+	  => \$opt::arg_sep),
+	 ("arg-file-sep|argfilesep=s".
+	  "[Use sep-str instead of :::: as separator string ".
+	  "between command and argument files]:sep-str"
+	  => \$opt::arg_file_sep),
+	 ('trim=s[Trim white space in input]:trim_method:'.
+	  '((n\:"No trim" l\:"Left\ trim" r\:"Right trim" '.
+	  'lr\:"Both trim" rl\:"Both trim"))'
+	  => \$opt::trim),
+	 "env=s[Copy environment variable var]:var:_vars" => \@opt::env,
+	 "recordenv|record-env[Record environment]" => \$opt::record_env,
+	 ('session'.
+	  '[Record names in current environment in $PARALLEL_IGNORED_NAMES '.
+	  'and exit. Only used with env_parallel. '.
+	  'Aliases, functions, and variables with names i]'
+	  => \$opt::session),
+	 ('plain[Ignore --profile, $PARALLEL, and ~/.parallel/config]'
+	  => \$opt::plain),
+	 ("profile|J=s".
+	  "[Use profile profilename for options]:profilename:_files"
+	  => \@opt::profile),
+	 "tollef" => \$opt::tollef,
+	 "gnu[Behave like GNU parallel]" => \$opt::gnu,
+	 "link|xapply[Link input sources]" => \$opt::link,
+	 "linkinputsource|xapplyinputsource=i" => \@opt::linkinputsource,
+	 # Before changing these lines, please read
+	 # https://www.gnu.org/software/parallel/parallel_design.html#citation-notice
+	 # https://git.savannah.gnu.org/cgit/parallel.git/tree/doc/citation-notice-faq.txt
+	 # You accept to be put in a public hall of shame by removing
+	 # these lines.
+	 ("bibtex|citation".
+	  "[Print the citation notice and BibTeX entry for GNU parallel, ".
+	  "silence citation notice for all future runs, and exit. ".
+	  "It will not run any commands]"
+	  => \$opt::citation),
+	 "will-cite|willcite|nn|nonotice|no-notice" => \$opt::willcite,
+	 # Termination and retries
+	 ('halt-on-error|haltonerror|halt=s'.
+	  '[When should GNU parallel terminate]'.
+	  ':when:((now\:"kill all running jobs and halt immediately" '.
+	  'soon\:"wait for all running jobs to complete, start no new jobs"))'
+	  => \$opt::halt),
+	 'limit=s[Dynamic job limit]:"command args"' => \$opt::limit,
+	 ("memfree=s".
+	  "[Minimum memory free when starting another job]:size"
+	  => \$opt::memfree),
+	 ("memsuspend=s".
+	  "[Suspend jobs when there is less memory available]:size"
+	  => \$opt::memsuspend),
+	 "retries=s[Try failing jobs n times]:n" => \$opt::retries,
+	 ("timeout=s".
+	  "[Time out for command. If the command runs for longer than ".
+	  "duration seconds it will get killed as per --term-seq]:duration"
+	  => \$opt::timeout),
+	 ("term-seq|termseq=s".
+	  "[Termination sequence]:sequence" => \$opt::termseq),
+	 # xargs-compatibility - implemented, man, testsuite
+	 ("max-procs|maxprocs|P=s".
+	  "[Add N to/Subtract N from/Multiply N% with/ the number of CPU ".
+	  "threads or read parameter from file]:+N/-N/N%/N/procfile:_files"
+	  => \$opt::jobs),
+	 ("delimiter|d=s[Input items are terminated by delim]:delim"
+	  => \$opt::d),
+	 ("max-chars|maxchars|s=s[Limit length of command]:max-chars"
+	  => \$opt::max_chars),
+	 ("arg-file|argfile|a=s".
+	  "[Use input-file as input source]:input-file:_files" => \@opt::a),
+	 "no-run-if-empty|norunifempty|r[Do not run empty input]" => \$opt::r,
+	 ("replace|i:s".
+	  "[This option is deprecated; use -I instead]:replace-str"
+	  => \$opt::i),
+	 "E=s" => \$opt::eof,
+	 ("eof|e:s[Set the end of file string to eof-str]:eof-str"
+	  => \$opt::eof),
+	 ("process-slot-var|processslotvar=s".
+	  "[Set this variable to job slot number]:varname"
+	  => \$opt::process_slot_var),
+	 ("max-args|maxargs|n=s".
+	  "[Use at most max-args arguments per command line]:max-args"
+	  => \$opt::max_args),
+	 ("max-replace-args|maxreplaceargs|N=s".
+	  "[Use at most max-args arguments per command line]:max-args"
+	  => \$opt::max_replace_args),
+	 "col-sep|colsep|C=s[Column separator]:regexp" => \$opt::colsep,
+	 "csv[Treat input as CSV-format]"=> \$opt::csv,
+	 ("help|h[Print a summary of the options to GNU parallel and exit]"
+	  => \$opt::help),
+	 ("L=s[When used with --pipe: Read records of recsize]:recsize"
+	  => \$opt::L),
+	 ("max-lines|maxlines|l:f".
+	  "[When used with --pipe: Read records of recsize lines]:recsize"
+	  => \$opt::max_lines),
+	 "interactive|p[Ask user before running a job]" => \$opt::interactive,
+	 ("verbose|t[Print the job to be run on stderr (standard error)]"
+	  => \$opt::verbose),
+	 ("version|V[Print the version GNU parallel and exit]"
+	  => \$opt::version),
+	 ('min-version|minversion=i'.
+	  '[Print the version GNU parallel and exit]'.
+	  ':version:($(parallel --minversion 0))'
+	  => \$opt::minversion),
+	 ("show-limits|showlimits".
+	  "[Display limits given by the operating system]"
+	  => \$opt::show_limits),
+	 ("exit|x[Exit if the size (see the -s option) is exceeded]"
+	  => \$opt::x),
+	 # Semaphore
+	 "semaphore[Work as a counting semaphore]" => \$opt::semaphore,
+	 ("semaphore-timeout|semaphoretimeout|st=s".
+	  "[If secs > 0: If the semaphore is not released within secs ".
+	  "seconds, take it anyway]:secs"
+	  => \$opt::semaphoretimeout),
+	 ("semaphore-name|semaphorename|id=s".
+	  "[Use name as the name of the semaphore]:name"
+	  => \$opt::semaphorename),
+	 "fg[Run command in foreground]" => \$opt::fg,
+	 "bg[Run command in background]" => \$opt::bg,
+	 "wait[Wait for all commands to complete]" => \$opt::wait,
+	 # Shebang #!/usr/bin/parallel --shebang
+	 ("shebang|hashbang".
+	  "[GNU parallel can be called as a shebang (#!) command as the ".
+	  "first line of a script. The content of the file will be treated ".
+	  "as inputsource]"
+	  => \$opt::shebang),
+	 ("_pipe-means-argfiles[internal]"
+	  => \$opt::_pipe_means_argfiles),
+	 "Y" => \$opt::retired,
+	 ("skip-first-line|skipfirstline".
+	  "[Do not use the first line of input]"
+	  => \$opt::skip_first_line),
+	 "bug" => \$opt::bug,
+	 # --pipe
+	 ("pipe|spreadstdin".
+	  "[Spread input to jobs on stdin (standard input)]" => \$opt::pipe),
+	 ("round-robin|roundrobin|round".
+	  "[Distribute chunks of standard input in a round robin fashion]"
+	  => \$opt::roundrobin),
+	 "recstart=s" => \$opt::recstart,
+	 ("recend=s".
+	  "[Split record between endstring and startstring]:endstring"
+	  => \$opt::recend),
+	 ("regexp|regex".
+	  "[Interpret --recstart and --recend as regular expressions]"
+	  => \$opt::regexp),
+	 ("remove-rec-sep|removerecsep|rrs".
+	  "[Remove record separator]" => \$opt::remove_rec_sep),
+	 ("output-as-files|outputasfiles|files[Save output to files]"
+	  => \$opt::files),
+	 ("block-size|blocksize|block=s".
+	  "[Size of block in bytes to read at a time]:size"
+	  => \$opt::blocksize),
+	 ("block-timeout|blocktimeout|bt=s".
+	  "[Timeout for reading block when using --pipe]:duration"
+	  => \$opt::blocktimeout),
+	 "header=s[Use regexp as header]:regexp" => \$opt::header,
+	 "cat[Create a temporary file with content]" => \$opt::cat,
+	 "fifo[Create a temporary fifo with content]" => \$opt::fifo,
+	 ("pipe-part|pipepart[Pipe parts of a physical file]"
+	  => \$opt::pipepart),
+	 "tee[Pipe all data to all jobs]" => \$opt::tee,
+	 ("shard=s".
+	  "[Use shardexpr as shard key and shard input to the jobs]:shardexpr"
+	  => \$opt::shard),
+	 ("bin=s".
+	  "[Use binexpr as binning key and bin input to the jobs]:binexpr"
+	  => \$opt::bin),
+	 "group-by|groupby=s[Group input by value]:val" => \$opt::groupby,
+	 #
+	 ("hgrp|hostgrp|hostgroup|hostgroups[Enable hostgroups on arguments]"
+	  => \$opt::hostgroups),
+	 "embed[Embed GNU parallel in a shell script]" => \$opt::embed,
+	 ("filter=s[Only run jobs where filter is true]:filter"
+	  => \@opt::filter),
+	 "_parset=s[Generate shell code for parset]" => \$opt::_parset,
+	 ("shell-completion|shellcompletion=s".
+	  "[Generate shell code for shell completion]"
+	  => \$opt::shellcompletion),
+	 # Parameter for testing optimal values
+	 "_test=s" => \$opt::_test,
+	);
+}
+
+sub get_options_from_array($@) {
+    # Run GetOptions on @array
+    # Input:
+    #	$array_ref = ref to @ARGV to parse
+    #	@keep_only = Keep only these options
+    # Uses:
+    #	@ARGV
+    # Returns:
+    #	true if parsing worked
+    #	false if parsing failed
+    #	@$array_ref is changed
+    my ($array_ref, @keep_only) = @_;
+    if(not @$array_ref) {
+	# Empty array: No need to look more at that
+	return 1;
+    }
+    # A bit of shuffling of @ARGV needed as GetOptionsFromArray is not
+    # supported everywhere
+    my @save_argv;
+    my $this_is_ARGV = (\@::ARGV == $array_ref);
+    if(not $this_is_ARGV) {
+	@save_argv = @::ARGV;
+	@::ARGV = @{$array_ref};
+    }
+    # If @keep_only set: Ignore all values except @keep_only
+    my %options = options_hash();
+    if(@keep_only) {
+	my (%keep,@dummy);
+	@keep{@keep_only} = @keep_only;
+	for my $k (grep { not $keep{$_} } keys %options) {
+	    # Store the value of the option in @dummy
+	    $options{$k} = \@dummy;
+	}
+    }
+    my $retval = GetOptions(%options);
+    if(not $this_is_ARGV) {
+	@{$array_ref} = @::ARGV;
+	@::ARGV = @save_argv;
+    }
+    return $retval;
+}
+
+sub parse_parset() {
+    $Global::progname = "parset";
+    @Global::parset_vars = split /[ ,]/, $opt::_parset;
+    my $var_or_assoc = shift @Global::parset_vars;
+    # Legal names: var _v2ar arrayentry[2]
+    my @illegal = (grep { not /^[a-zA-Z_][a-zA-Z_0-9]*(\[\d+\])?$/ }
+		   @Global::parset_vars);
+    if(@illegal) {
+	::error
+	    ("@illegal is an invalid variable name.",
+	     "Variable names must be letter followed by letters or digits.",
+	     "Usage:",
+	     "  parset varname GNU Parallel options and command");
+	wait_and_exit(255);
+    }
+    if($var_or_assoc eq "assoc") {
+	my $var = shift @Global::parset_vars;
+	print "$var=(";
+	$Global::parset = "assoc";
+	$Global::parset_endstring=")\n";
+    } elsif($var_or_assoc eq "var") {
+	if($#Global::parset_vars > 0) {
+	    $Global::parset = "var";
+	} else {
+	    my $var = shift @Global::parset_vars;
+	    print "$var=(";
+	    $Global::parset = "array";
+	    $Global::parset_endstring=")\n";
+	}
+    } else {
+	::die_bug("parset: unknown '$opt::_parset'");
+    }
+}
+
+sub parse_options(@) {
+    # Returns: N/A
+    init_globals();
+    my @argv_before = @ARGV;
+    @ARGV = read_options();
+
+    # Before changing these line, please read
+    # https://www.gnu.org/software/parallel/parallel_design.html#citation-notice
+    # https://git.savannah.gnu.org/cgit/parallel.git/tree/doc/citation-notice-faq.txt
+    # You accept to be added to a public hall of shame by
+    # removing the lines.
+    if(defined $opt::citation) {
+	citation(\@argv_before,\@ARGV);
+	wait_and_exit(0);
+    }
+    # no-* overrides *
+    if($opt::nokeeporder) { $opt::keeporder = undef; }
+
+    if(@opt::v) { $Global::verbose = $#opt::v+1; } # Convert -v -v to v=2
+    if($opt::bug) { ::die_bug("test-bug"); }
+    $Global::debug = $opt::D;
+    $Global::shell = $ENV{'PARALLEL_SHELL'} || parent_shell($$)
+	|| $ENV{'SHELL'} || "/bin/sh";
+    if(not -x $Global::shell and not which($Global::shell)) {
+	::error("Shell '$Global::shell' not found.");
+	wait_and_exit(255);
+    }
+    ::debug("init","Global::shell $Global::shell\n");
+    $Global::cshell = $Global::shell =~ m:(/[-a-z]*)?csh:;
+    if(defined $opt::_parset) { parse_parset(); }
+    if(defined $opt::X) { $Global::ContextReplace = 1; }
+    if(defined $opt::silent) { $Global::verbose = 0; }
+    if(defined $opt::null) { $/ = "\0"; }
+    if(defined $opt::d) { $/ = unquote_printf($opt::d) }
+    parse_replacement_string_options();
+    $opt::tag ||= $opt::ctag;
+    $opt::tagstring ||= $opt::ctagstring;
+    if(defined $opt::ctag or defined $opt::ctagstring
+	or defined $opt::color) {
+	$Global::color = 1;
+    }
+    if($opt::linebuffer or $opt::latestline) {
+	$Global::linebuffer = 1;
+	Job::latestline_init();
+    }
+    if(defined $opt::tag and not defined $opt::tagstring) {
+	# Default = {}
+	$opt::tagstring = $Global::parensleft.$Global::parensright;
+    }
+    if(defined $opt::tagstring) {
+	$opt::tagstring = unquote_printf($opt::tagstring);
+	if($opt::tagstring =~
+	   /\Q$Global::parensleft\E.*\S+.*\Q$Global::parensright\E/
+	   and
+	   $Global::linebuffer) {
+	    # --tagstring contains {= ... =} and --linebuffer =>
+	    #	recompute replacement string for each use (do not cache)
+	    $Global::cache_replacement_eval = 0;
+	}
+    }
+    if(defined $opt::interactive) { $Global::interactive = $opt::interactive; }
+    if(defined $opt::quote) { $Global::quoting = 1; }
+    if(defined $opt::r) { $Global::ignore_empty = 1; }
+    if(defined $opt::verbose) { $Global::stderr_verbose = 1; }
+    if(defined $opt::eof) { $Global::end_of_file_string = $opt::eof; }
+    if(defined $opt::max_args) {
+	$opt::max_args = multiply_binary_prefix($opt::max_args);
+	$Global::max_number_of_args = $opt::max_args;
+    }
+    if(defined $opt::blocktimeout) {
+	$Global::blocktimeout = int(multiply_time_units($opt::blocktimeout));
+	if($Global::blocktimeout < 1) {
+	    ::error("--block-timeout must be at least 1");
+	    wait_and_exit(255);
+	}
+    }
+    if(defined $opt::timeout) {
+	$Global::timeoutq = TimeoutQueue->new($opt::timeout);
+    }
+    if(defined $opt::tmpdir) { $ENV{'TMPDIR'} = $opt::tmpdir; }
+    $ENV{'PARALLEL_RSYNC_OPTS'} = $opt::rsync_opts ||
+	$ENV{'PARALLEL_RSYNC_OPTS'} || '-rlDzR';
+    # Default: Same nice level as GNU  Parallel is started at
+    $opt::nice ||= eval { getpriority(0,0) } || 0;
+    if(defined $opt::help) { usage(); exit(0); }
+    if(defined $opt::shellcompletion) { shell_completion(); exit(0); }
+    if(defined $opt::embed) { embed(); exit(0); }
+    if(defined $opt::sqlandworker) {
+	$opt::sqlmaster = $opt::sqlworker = $opt::sqlandworker;
+    }
+    if(defined $opt::tmuxpane) { $opt::tmux = $opt::tmuxpane; }
+    if(defined $opt::colsep) { $Global::trim = 'lr'; }
+    if(defined $opt::csv) {
+	if(not $Global::use{"Text::CSV"} ||= eval "use Text::CSV; 1;") {
+	    ::error("The perl module Text::CSV is not installed.");
+	    ::error("Try installing libtext-csv-perl or perl-Text-CSV.");
+	    wait_and_exit(255);
+	}
+	$opt::colsep = defined $opt::colsep ? $opt::colsep : ",";
+	my $csv_setting = { binary => 1, sep_char => $opt::colsep };
+	my $sep = $csv_setting->{sep_char};
+	$Global::csv = Text::CSV->new($csv_setting)
+	    or die "Cannot use CSV: ".Text::CSV->error_diag ();
+    }
+    if(defined $opt::header) {
+	$opt::colsep = defined $opt::colsep ? $opt::colsep : "\t";
+    }
+    if(defined $opt::trim) { $Global::trim = $opt::trim; }
+    if(defined $opt::arg_sep) { $Global::arg_sep = $opt::arg_sep; }
+    if(defined $opt::arg_file_sep) {
+	$Global::arg_file_sep = $opt::arg_file_sep;
+    }
+    if(not defined $opt::process_slot_var) {
+	$opt::process_slot_var = 'PARALLEL_JOBSLOT0';
+    }
+    if(defined $opt::number_of_sockets) {
+	print SSHLogin::no_of_sockets(),"\n"; wait_and_exit(0);
+    }
+    if(defined $opt::number_of_cpus) {
+	print SSHLogin::no_of_cores(),"\n"; wait_and_exit(0);
+    }
+    if(defined $opt::number_of_cores) {
+	print SSHLogin::no_of_cores(),"\n"; wait_and_exit(0);
+    }
+    if(defined $opt::number_of_threads) {
+	print SSHLogin::no_of_threads(),"\n"; wait_and_exit(0);
+    }
+    if(defined $opt::max_line_length_allowed) {
+	print Limits::Command::real_max_length(),"\n"; wait_and_exit(0);
+    }
+    if(defined $opt::max_chars) {
+	$opt::max_chars = multiply_binary_prefix($opt::max_chars);
+    }
+    if(defined $opt::version) { version(); wait_and_exit(0); }
+    if(defined $opt::record_env) { record_env(); wait_and_exit(0); }
+    if(@opt::sshlogin) { @Global::sshlogin = @opt::sshlogin; }
+    if(@opt::sshloginfile) { read_sshloginfiles(@opt::sshloginfile); }
+    if(@opt::return) { push @Global::ret_files, @opt::return; }
+    if($opt::transfer) {
+	push @Global::transfer_files, $opt::i || $opt::I || "{}";
+    }
+    push @Global::transfer_files, @opt::transfer_files;
+    if(%opt::template) {
+	while (my ($source, $template_name) = each %opt::template) {
+	    if(open(my $tmpl, "<", $source)) {
+		local $/; # $/ = undef => slurp whole file
+		my $content = <$tmpl>;
+		push @Global::template_names, $template_name;
+		push @Global::template_contents, $content;
+		::debug("tmpl","Name: $template_name\n$content\n");
+	    } else {
+		::error("Cannot open '$source'.");
+		wait_and_exit(255);
+	    }
+	}
+    }
+    if(not defined $opt::recstart and
+       not defined $opt::recend) { $opt::recend = "\n"; }
+    $Global::blocksize = multiply_binary_prefix($opt::blocksize || "1M");
+    if($Global::blocksize > 2**31-1 and not $opt::pipepart) {
+	warning("--blocksize >= 2G causes problems. Using 2G-1.");
+	$Global::blocksize = 2**31-1;
+    }
+    if($^O eq "cygwin" and
+       ($opt::pipe or $opt::pipepart or $opt::roundrobin)
+       and $Global::blocksize > 65535) {
+	warning("--blocksize >= 64K causes problems on Cygwin.");
+    }
+    $opt::memfree = multiply_binary_prefix($opt::memfree);
+    $opt::memsuspend = multiply_binary_prefix($opt::memsuspend);
+    $Global::memlimit = $opt::memsuspend + $opt::memfree;
+    check_invalid_option_combinations();
+    if((defined $opt::fifo or defined $opt::cat) and not $opt::pipepart) {
+	$opt::pipe = 1;
+    }
+    if(defined $opt::minversion) {
+	print $Global::version,"\n";
+	if($Global::version < $opt::minversion) {
+	    wait_and_exit(255);
+	} else {
+	    wait_and_exit(0);
+	}
+    }
+    if(not defined $opt::delay) {
+	# Set --delay to --sshdelay if not set
+	$opt::delay = $opt::sshdelay;
+    }
+    $Global::sshdelayauto = $opt::sshdelay =~ s/auto$//;
+    $opt::sshdelay = multiply_time_units($opt::sshdelay);
+    $Global::delayauto = $opt::delay =~ s/auto$//;
+    $opt::delay = multiply_time_units($opt::delay);
+    if($opt::compress_program) {
+	$opt::compress = 1;
+	$opt::decompress_program ||= $opt::compress_program." -dc";
+    }
+
+    if(defined $opt::results) {
+	# Is the output a dir or CSV-file?
+	if($opt::results =~ /\.csv$/i) {
+	    # CSV with , as separator
+	    $Global::csvsep = ",";
+	    $Global::membuffer ||= 1;
+	} elsif($opt::results =~ /\.tsv$/i) {
+	    # CSV with TAB as separator
+	    $Global::csvsep = "\t";
+	    $Global::membuffer ||= 1;
+	} elsif($opt::results =~ /\.json$/i) {
+	    # JSON output
+	    $Global::jsonout ||= 1;
+	    $Global::membuffer ||= 1;
+	}
+    }
+    if($opt::compress) {
+	my ($compress, $decompress) = find_compression_program();
+	$opt::compress_program ||= $compress;
+	$opt::decompress_program ||= $decompress;
+	if(($opt::results and not $Global::csvsep) or $opt::files) {
+	    # No need for decompressing
+	    $opt::decompress_program = "cat >/dev/null";
+	}
+    }
+    if(defined $opt::dryrun) {
+	# Force grouping due to bug #51039: --dry-run --timeout 3600 -u breaks
+	$opt::ungroup = 0;
+	$opt::group = 1;
+    }
+    if(defined $opt::nonall) {
+	# Append a dummy empty argument if there are no arguments
+	# on the command line to avoid reading from STDIN.
+	# arg_sep = random 50 char
+	# \0noarg => nothing (not the empty string)
+	$Global::arg_sep = join "",
+	map { (0..9,"a".."z","A".."Z")[rand(62)] } (1..50);
+	push @ARGV, $Global::arg_sep, "\0noarg";
+    }
+    if(defined $opt::tee) {
+	if(not defined $opt::jobs) {
+	    $opt::jobs = 0;
+	}
+    }
+    if(defined $opt::tty) {
+	# Defaults for --tty: -j1 -u
+	# Can be overridden with -jXXX -g
+	if(not defined $opt::jobs) {
+	    $opt::jobs = 1;
+	}
+	if(not defined $opt::group) {
+	    $opt::ungroup = 1;
+	}
+    }
+    if(@opt::trc) {
+	push @Global::ret_files, @opt::trc;
+	if(not @Global::transfer_files) {
+	    # Defaults to --transferfile {}
+	    push @Global::transfer_files, $opt::i || $opt::I || "{}";
+	}
+	$opt::cleanup = 1;
+    }
+    if(defined $opt::max_lines) {
+	if($opt::max_lines eq "-0") {
+	    # -l -0 (swallowed -0)
+	    $opt::max_lines = 1;
+	    $opt::null = 1;
+	    $/ = "\0";
+	} else {
+	    $opt::max_lines = multiply_binary_prefix($opt::max_lines);
+	    if ($opt::max_lines == 0) {
+		# If not given (or if 0 is given) => 1
+		$opt::max_lines = 1;
+	    }
+	}
+
+	$Global::max_lines = $opt::max_lines;
+	if(not $opt::pipe) {
+	    # --pipe -L means length of record - not max_number_of_args
+	    $Global::max_number_of_args ||= $Global::max_lines;
+	}
+    }
+
+    # Read more than one arg at a time (-L, -N)
+    if(defined $opt::L) {
+	$opt::L = multiply_binary_prefix($opt::L);
+	$Global::max_lines = $opt::L;
+	if(not $opt::pipe) {
+	    # --pipe -L means length of record - not max_number_of_args
+	    $Global::max_number_of_args ||= $Global::max_lines;
+	}
+    }
+    if(defined $opt::max_replace_args) {
+	$opt::max_replace_args =
+	    multiply_binary_prefix($opt::max_replace_args);
+	$Global::max_number_of_args = $opt::max_replace_args;
+	$Global::ContextReplace = 1;
+    }
+    if((defined $opt::L or defined $opt::max_replace_args)
+       and
+       not ($opt::xargs or $opt::m)) {
+	$Global::ContextReplace = 1;
+    }
+    if(grep /^$Global::arg_sep\+?$|^$Global::arg_file_sep\+?$/o, @ARGV) {
+	# Deal with ::: :::+ :::: and ::::+
+	@ARGV = read_args_from_command_line();
+    }
+    parse_semaphore();
+
+    if(defined $opt::eta) { $opt::progress = $opt::eta; }
+    if(defined $opt::bar) { $opt::progress = $opt::bar; }
+    if(defined $opt::bar or defined $opt::latestline) {
+	my $fh = $Global::status_fd || *STDERR;
+	eval q{
+	    # Enable utf8 if possible
+	    use utf8;
+	    binmode $fh, "encoding(utf8)";
+	    *decode_utf8 = \&Encode::decode_utf8;
+	};
+	if(eval { decode_utf8("x") }) {
+	    # Great: decode works
+	} else {
+	    # UTF8-decode not supported: Dummy decode
+	    eval q{sub decode_utf8($;$) { $_[0]; }};
+	}
+    }
+
+    # Funding a free software project is hard. GNU Parallel is no
+    # exception. On top of that it seems the less visible a project
+    # is, the harder it is to get funding. And the nature of GNU
+    # Parallel is that it will never be seen by "the guy with the
+    # checkbook", but only by the people doing the actual work.
+    #
+    # This problem has been covered by others - though no solution has
+    # been found:
+    # https://www.slideshare.net/NadiaEghbal/consider-the-maintainer
+    # https://www.numfocus.org/blog/why-is-numpy-only-now-getting-funded/
+    #
+    # The FAQ tells you why the citation notice exists:
+    # https://git.savannah.gnu.org/cgit/parallel.git/tree/doc/citation-notice-faq.txt
+    #
+    # If you want GNU Parallel to be maintained in the future, and not
+    # just wither away like so many other free software tools, you
+    # need to help finance the development.
+    #
+    # The citation notice is a simple way of doing so, as citations
+    # makes it possible to me to get a job where I can maintain GNU
+    # Parallel as part of the job.
+    #
+    # This means you can help financing development
+    #
+    #	WITHOUT PAYING A SINGLE CENT!
+    #
+    # Before implementing the citation notice it was discussed with
+    # the users:
+    # https://lists.gnu.org/archive/html/parallel/2013-11/msg00006.html
+    #
+    # Having to spend 10 seconds on running 'parallel --citation' once
+    # is no doubt not an ideal solution, but no one has so far come up
+    # with an ideal solution - neither for funding GNU Parallel nor
+    # other free software.
+    #
+    # If you believe you have the perfect solution, you should try it
+    # out, and if it works, you should post it on the email
+    # list. Ideas that will cost work and which have not been tested
+    # are, however, unlikely to be prioritized.
+    #
+    # Please note that GPL version 3 gives you the right to fork GNU
+    # Parallel under a new name, but it does not give you the right to
+    # distribute modified copies with the citation notice disabled in
+    # a way where the software can be confused with GNU Parallel. To
+    # do that you need to be the owner of the GNU Parallel
+    # trademark. The xt:Commerce case shows this.
+    #
+    # Description of the xt:Commerce case in OLG Duesseldorf
+    # https://web.archive.org/web/20180715073746/http://www.inta.org/INTABulletin/Pages/GERMANYGeneralPublicLicenseDoesNotPermitUseofThird-PartyTrademarksforAdvertisingModifiedVersionsofOpen-SourceSoftware.aspx
+    #
+    # The verdict in German
+    # https://www.admody.com/urteilsdatenbank/cafe6fdaeed3/OLG-Duesseldorf_Urteil_vom_28-September-2010_Az_I-20-U-41-09
+    # https://web.archive.org/web/20180715073717/https://www.admody.com/urteilsdatenbank/cafe6fdaeed3/OLG-Duesseldorf_Urteil_vom_28-September-2010_Az_I-20-U-41-09
+    #
+    # Other free software limiting derivates by the same name:
+    # https://en.wikipedia.org/wiki/Red_Hat_Enterprise_Linux_derivatives#Legal_aspects
+    # https://tm.joomla.org/trademark-faq.html
+    # https://www.mozilla.org/en-US/foundation/trademarks/faq/
+    #
+    # Running 'parallel --citation' one single time takes less than 10
+    # seconds, and will silence the citation notice for future
+    # runs. If that is too much trouble for you, why not use one of
+    # the alternatives instead?
+    # See a list in: 'man parallel_alternatives'
+    #
+    # If you want GNU Parallel to be maintained in the future you
+    # should keep this line.
+    citation_notice();
+    # *YOU* will be harming free software by removing the notice.  You
+    # accept to be added to a public hall of shame by removing the
+    # line.  This is because _YOU_ actively make it harder to justify
+    # spending time developing GNU Parallel.
+
+    parse_halt();
+
+    if($ENV{'PARALLEL_ENV'}) {
+	# Read environment and set $Global::parallel_env
+	# Must be done before is_acceptable_command_line_length()
+	my $penv = $ENV{'PARALLEL_ENV'};
+	# unset $PARALLEL_ENV: It should not be given to children
+	# because it takes up a lot of env space
+	delete $ENV{'PARALLEL_ENV'};
+	if(-e $penv) {
+	    # This is a file/fifo: Replace envvar with content of file
+	    open(my $parallel_env, "<", $penv) ||
+		::die_bug("Cannot read parallel_env from $penv");
+	    local $/; # Put <> in slurp mode
+	    $penv = <$parallel_env>;
+	    close $parallel_env;
+	}
+	# Map \001 to \n to make it easer to quote \n in $PARALLEL_ENV
+	$penv =~ s/\001/\n/g;
+	if($penv =~ /\0/) {
+	    ::warning('\0 (NUL) in environment is not supported');
+	}
+	$Global::parallel_env = $penv;
+    }
+
+    parse_sshlogin();
+    if(defined $opt::show_limits) { show_limits(); }
+
+    if(remote_hosts() and ($opt::X or $opt::m or $opt::xargs)) {
+	# As we do not know the max line length on the remote machine
+	# long commands generated by xargs may fail
+	# If $opt::max_replace_args is set, it is probably safe
+	::warning("Using -X or -m with --sshlogin may fail.");
+    }
+
+    if(not defined $opt::jobs) { $opt::jobs = "100%"; }
+    open_joblog();
+    open_json_csv();
+    if($opt::sqlmaster or $opt::sqlworker) {
+	$Global::sql = SQL->new($opt::sqlmaster || $opt::sqlworker);
+    }
+    if($opt::sqlworker) { $Global::membuffer ||= 1; }
+    # The sqlmaster groups the arguments, so the should just read one
+    if($opt::sqlworker and not $opt::sqlmaster) {
+	$Global::max_number_of_args = 1;
+    }
+    if($Global::color or $opt::colorfailed) { Job::init_color(); }
+}
+
+sub check_invalid_option_combinations() {
+    if(defined $opt::timeout and
+       $opt::timeout !~ /^\d+(\.\d+)?%?$|^(\d+(\.\d+)?[dhms])+$/i) {
+	::error("--timeout must be seconds or percentage.");
+	wait_and_exit(255);
+    }
+    if(defined $opt::fifo and defined $opt::cat) {
+	::error("--fifo cannot be combined with --cat.");
+	::wait_and_exit(255);
+    }
+    if(defined $opt::retries and defined $opt::roundrobin) {
+	::error("--retries cannot be combined with --roundrobin.");
+	::wait_and_exit(255);
+    }
+    if(defined $opt::pipepart and
+       (defined $opt::L or defined $opt::max_lines
+	or defined $opt::max_replace_args)) {
+	::error("--pipepart is incompatible with --max-replace-args, ".
+		"--max-lines, and -L.");
+	wait_and_exit(255);
+    }
+    if(defined $opt::group and $opt::ungroup) {
+	::error("--group cannot be combined with --ungroup.");
+	::wait_and_exit(255);
+    }
+    if(defined $opt::group and $opt::linebuffer) {
+	::error("--group cannot be combined with --line-buffer.");
+	::wait_and_exit(255);
+    }
+    if(defined $opt::ungroup and $opt::linebuffer) {
+	::error("--ungroup cannot be combined with --line-buffer.");
+	::wait_and_exit(255);
+    }
+    if(defined $opt::tollef and not $opt::gnu) {
+       ::error("--tollef has been retired.",
+	       "Remove --tollef or use --gnu to override --tollef.");
+       ::wait_and_exit(255);
+    }
+    if(defined $opt::retired) {
+	    ::error("-g has been retired. Use --group.",
+		    "-B has been retired. Use --bf.",
+		    "-T has been retired. Use --tty.",
+		    "-U has been retired. Use --er.",
+		    "-W has been retired. Use --wd.",
+		    "-Y has been retired. Use --shebang.",
+		    "-H has been retired. Use --halt.",
+		    "--sql has been retired. Use --sqlmaster.",
+		    "--ctrlc has been retired.",
+		    "--noctrlc has been retired.");
+	    ::wait_and_exit(255);
+    }
+    if($opt::groupby) {
+	if(not $opt::pipe and not $opt::pipepart) {
+	    $opt::pipe = 1;
+	}
+	if($opt::remove_rec_sep) {
+	    ::error("--remove-rec-sep is not compatible with --groupby");
+	    ::wait_and_exit(255);
+	}
+	if($opt::recstart) {
+	    ::error("--recstart is not compatible with --groupby");
+	    ::wait_and_exit(255);
+	}
+	if($opt::recend ne "\n") {
+	    ::error("--recend is not compatible with --groupby");
+	    ::wait_and_exit(255);
+	}
+    }
+}
+
+sub init_globals() {
+    # Defaults:
+    $Global::version = 20221122;
+    $Global::progname = 'parallel';
+    $::name = "GNU Parallel";
+    $Global::infinity = 2**31;
+    $Global::debug = 0;
+    $Global::verbose = 0;
+    # Don't quote every part of the command line
+    $Global::quoting = 0;
+    # Quote replacement strings
+    $Global::quote_replace = 1;
+    $Global::total_completed = 0;
+    $Global::cache_replacement_eval = 1;
+    # Read only table with default --rpl values
+    %Global::replace =
+	(
+	 '{}'	=> '',
+	 '{#}'	=> '1 $_=$job->seq()',
+	 '{%}'	=> '1 $_=$job->slot()',
+	 '{/}'	=> 's:.*/::',
+	 '{//}' =>
+	 ('$Global::use{"File::Basename"} ||= eval "use File::Basename; 1;"; '.
+	  '$_ = dirname($_);'),
+	 '{/.}' => 's:.*/::; s:\.[^/.]*$::;',
+	 '{.}'	=> 's:\.[^/.]*$::',
+	);
+    %Global::plus =
+	(
+	 # {} = {+/}/{/}
+	 #    = {.}.{+.}     = {+/}/{/.}.{+.}
+	 #    = {..}.{+..}   = {+/}/{/..}.{+..}
+	 #    = {...}.{+...} = {+/}/{/...}.{+...}
+	 '{+/}' => 's:/[^/]*$:: || s:.*$::',
+	 # a.b => b; a => ''
+	 '{+.}' => 's:.*\.:: || s:.*$::',
+	 # a.b.c => b.c; a.b => ''; a => ''
+	 '{+..}' => 's:.*\.([^/.]*\.[^/.]*)$:$1: || s:.*$::',
+	 '{+...}' => 's:.*\.([^/.]*\.[^/.]*\.[^/.]*)$:$1: || s:.*$::',
+	 '{..}' => 's:\.[^/.]*\.[^/.]*$::',
+	 '{...}' => 's:\.[^/.]*\.[^/.]*\.[^/.]*$::',
+	 '{/..}' => 's:.*/::; s:\.[^/.]*\.[^/.]*$::',
+	 '{/...}' => 's:.*/::; s:\.[^/.]*\.[^/.]*\.[^/.]*$::',
+	 # n choose k = Binomial coefficient
+	 '{choose_k}' => ('for $t (2..$#arg)'.
+			  '{ if($arg[$t-1] ge $arg[$t]) { skip() } }'),
+	 # unique values: Skip job if any args are the same
+	 '{uniq}' => 'if(::uniq(@arg) != @arg) { skip(); }',
+	 # {##} = number of jobs
+	 '{##}' => '1 $_=total_jobs()',
+	 # {0%} = 0-padded jobslot
+	 '{0%}' => ('1 $f=1+int((log($Global::max_jobs_running||1)/log(10)));'.
+		    '$_=sprintf("%0${f}d",slot())'),
+	 # {0%} = 0-padded seq
+	 '{0#}' => ('1 $f=1+int((log(total_jobs())/log(10)));'.
+		    '$_=sprintf("%0${f}d",seq())'),
+
+	 ## Bash inspired replacement strings
+	 # Bash ${a:-myval}
+	 '{:-([^}]+?)}' => '$_ ||= $$1',
+	 # Bash ${a:2}
+	 '{:(\d+?)}' => 'substr($_,0,$$1) = ""',
+	 # Bash ${a:2:3}
+	 '{:(\d+?):(\d+?)}' => '$_ = substr($_,$$1,$$2);',
+	 # echo {#z.*z.} ::: z.z.z.foo => z.foo
+	 # echo {##z.*z.} ::: z.z.z.foo => foo
+	 # Bash ${a#bc}
+	 '{#([^#}][^}]*?)}' =>
+	 '$nongreedy=::make_regexp_ungreedy($$1);s/^$nongreedy(.*)/$1/;',
+	 # Bash ${a##bc}
+	 '{##([^#}][^}]*?)}' => 's/^$$1//;',
+	 # echo {%.z.*z} ::: foo.z.z.z => foo.z
+	 # echo {%%.z.*z} ::: foo.z.z.z => foo
+	 # Bash ${a%def}
+	 '{%([^}]+?)}' =>
+	 '$nongreedy=::make_regexp_ungreedy($$1);s/(.*)$nongreedy$/$1/;',
+	 # Bash ${a%%def}
+	 '{%%([^}]+?)}' => 's/$$1$//;',
+	 # Bash ${a/def/ghi} ${a/def/}
+	 '{/([^#%}/]+?)/([^}]*?)}' => 's/$$1/$$2/;',
+	 # Bash ${a/#def/ghi} ${a/#def/}
+	 '{/#([^}]+?)/([^}]*?)}' => 's/^$$1/$$2/g;',
+	 # Bash ${a/%def/ghi} ${a/%def/}
+	 '{/%([^}]+?)/([^}]*?)}' => 's/$$1$/$$2/g;',
+	 # Bash ${a//def/ghi} ${a//def/}
+	 '{//([^}]+?)/([^}]*?)}' => 's/$$1/$$2/g;',
+	 # Bash ${a^a}
+	 '{^([^}]+?)}' => 's/^($$1)/uc($1)/e;',
+	 # Bash ${a^^a}
+	 '{^^([^}]+?)}' => 's/($$1)/uc($1)/eg;',
+	 # Bash ${a,A}
+	 '{,([^}]+?)}' => 's/^($$1)/lc($1)/e;',
+	 # Bash ${a,,A}
+	 '{,,([^}]+?)}' => 's/($$1)/lc($1)/eg;',
+
+	 # {slot} = $PARALLEL_JOBSLOT
+	 '{slot}' => '1 $_="\${PARALLEL_JOBSLOT}";uq()',
+	 # {host} = ssh host
+	 '{host}' => '1 $_="\${PARALLEL_SSHHOST}";uq()',
+	 # {sshlogin} = sshlogin
+	 '{sshlogin}' => '1 $_="\${PARALLEL_SSHLOGIN}";uq()',
+	 # {hgrp} = hostgroups of the host
+	 '{hgrp}' => '1 $_="\${PARALLEL_HOSTGROUPS}";uq()',
+	 # {agrp} = hostgroups of the argument
+	 '{agrp}' => '1 $_="\${PARALLEL_ARGHOSTGROUPS}";uq()',
+	);
+    # Modifiable copy of %Global::replace
+    %Global::rpl = %Global::replace;
+    $/ = "\n";
+    $Global::ignore_empty = 0;
+    $Global::interactive = 0;
+    $Global::stderr_verbose = 0;
+    $Global::default_simultaneous_sshlogins = 9;
+    $Global::exitstatus = 0;
+    $Global::arg_sep = ":::";
+    $Global::arg_file_sep = "::::";
+    $Global::trim = 'n';
+    $Global::max_jobs_running = 0;
+    $Global::job_already_run = '';
+    $ENV{'TMPDIR'} ||= "/tmp";
+    $ENV{'PARALLEL_REMOTE_TMPDIR'} ||= "/tmp";
+    $ENV{'OLDPWD'} = $ENV{'PWD'};
+    if(not $ENV{HOME}) {
+	# $ENV{HOME} is sometimes not set if called from PHP
+	::warning("\$HOME not set. Using /tmp.");
+	$ENV{HOME} = "/tmp";
+    }
+    # no warnings to allow for undefined $XDG_*
+    no warnings 'uninitialized';
+    # If $PARALLEL_HOME is set, but does not exist, try making it.
+    if(defined $ENV{'PARALLEL_HOME'}) {
+	eval { File::Path::mkpath($ENV{'PARALLEL_HOME'}); };
+    }
+    # $xdg_config_home is needed to make env_parallel.fish stop complaining
+    my $xdg_config_home = $ENV{'XDG_CONFIG_HOME'};
+    # config_dirs = $PARALLEL_HOME, $XDG_CONFIG_HOME/parallel,
+    #	$(each XDG_CONFIG_DIRS)/parallel, $HOME/.parallel
+    # Keep only dirs that exist
+    @Global::config_dirs =
+	(grep { -d $_ }
+	 $ENV{'PARALLEL_HOME'},
+	 (map { "$_/parallel" }
+	  $xdg_config_home,
+	  split /:/, $ENV{'XDG_CONFIG_DIRS'}),
+	 $ENV{'HOME'} . "/.parallel");
+    # Use first dir as config dir
+    $Global::config_dir = $Global::config_dirs[0] ||
+	$ENV{'HOME'} . "/.parallel";
+    if($ENV{'PARALLEL_HOME'} =~ /./ and not -d $ENV{'PARALLEL_HOME'}) {
+	::warning("\$PARALLEL_HOME ($ENV{'PARALLEL_HOME'}) does not exist.");
+	::warning("Using $Global::config_dir");
+    }
+    # cache_dirs = $PARALLEL_HOME, $XDG_CACHE_HOME/parallel,
+    # Keep only dirs that exist
+    @Global::cache_dirs =
+	(grep { -d $_ }
+	 $ENV{'PARALLEL_HOME'}, $ENV{'XDG_CACHE_HOME'}."/parallel");
+    $Global::cache_dir = $Global::cache_dirs[0] ||
+	$ENV{'HOME'} . "/.parallel";
+    Job::init_color();
+}
+
+sub parse_halt() {
+    # $opt::halt flavours
+    # Uses:
+    #	$opt::halt
+    #	$Global::halt_when
+    #	$Global::halt_fail
+    #	$Global::halt_success
+    #	$Global::halt_pct
+    #	$Global::halt_count
+    if(defined $opt::halt) {
+	my %halt_expansion = (
+	    "0" => "never",
+	    "1" => "soon,fail=1",
+	    "2" => "now,fail=1",
+	    "-1" => "soon,success=1",
+	    "-2" => "now,success=1",
+	);
+	# Expand -2,-1,0,1,2 into long form
+	$opt::halt = $halt_expansion{$opt::halt} || $opt::halt;
+	# --halt 5% == --halt soon,fail=5%
+	$opt::halt =~ s/^(\d+)%$/soon,fail=$1%/;
+	# Split: soon,fail=5%
+	my ($when,$fail_success,$pct_count) = split /[,=]/, $opt::halt;
+	if(not grep { $when eq $_ } qw(never soon now)) {
+	    ::error("--halt must have 'never', 'soon', or 'now'.");
+	    ::wait_and_exit(255);
+	}
+	$Global::halt_when = $when;
+	if($when ne "never") {
+	    if($fail_success eq "fail") {
+		$Global::halt_fail = 1;
+	    } elsif($fail_success eq "success") {
+		$Global::halt_success = 1;
+	    } elsif($fail_success eq "done") {
+		$Global::halt_done = 1;
+	    } else {
+		::error("--halt $when must be followed by ,success or ,fail.");
+		::wait_and_exit(255);
+	    }
+	    if($pct_count =~ /^(\d+)%$/) {
+		$Global::halt_pct = $1/100;
+	    } elsif($pct_count =~ /^(\d+)$/) {
+		$Global::halt_count = $1;
+	    } else {
+		::error("--halt $when,$fail_success ".
+			"must be followed by ,number or ,percent%.");
+		::wait_and_exit(255);
+	    }
+	}
+    }
+}
+
+sub parse_replacement_string_options() {
+    # Deal with --rpl
+    # Uses:
+    #	%Global::rpl
+    #	$Global::parensleft
+    #	$Global::parensright
+    #	$opt::parens
+    #	$Global::parensleft
+    #	$Global::parensright
+    #	$opt::plus
+    #	%Global::plus
+    #	$opt::I
+    #	$opt::U
+    #	$opt::i
+    #	$opt::basenamereplace
+    #	$opt::dirnamereplace
+    #	$opt::seqreplace
+    #	$opt::slotreplace
+    #	$opt::basenameextensionreplace
+
+    sub rpl($$) {
+	# Modify %Global::rpl
+	# Replace $old with $new
+	my ($old,$new) =  @_;
+	if($old ne $new) {
+	    $Global::rpl{$new} = $Global::rpl{$old};
+	    delete $Global::rpl{$old};
+	}
+    }
+    my $parens = "{==}";
+    if(defined $opt::parens) { $parens = $opt::parens; }
+    my $parenslen = 0.5*length $parens;
+    $Global::parensleft = substr($parens,0,$parenslen);
+    $Global::parensright = substr($parens,$parenslen);
+    if(defined $opt::plus) { %Global::rpl = (%Global::plus,%Global::rpl); }
+    if(defined $opt::I) { rpl('{}',$opt::I); }
+    if(defined $opt::i and $opt::i) { rpl('{}',$opt::i); }
+    if(defined $opt::U) { rpl('{.}',$opt::U); }
+    if(defined $opt::basenamereplace) { rpl('{/}',$opt::basenamereplace); }
+    if(defined $opt::dirnamereplace) { rpl('{//}',$opt::dirnamereplace); }
+    if(defined $opt::seqreplace) { rpl('{#}',$opt::seqreplace); }
+    if(defined $opt::slotreplace) { rpl('{%}',$opt::slotreplace); }
+    if(defined $opt::basenameextensionreplace) {
+       rpl('{/.}',$opt::basenameextensionreplace);
+    }
+    for(@opt::rpl) {
+	# Create $Global::rpl entries for --rpl options
+	# E.g: "{..} s:\.[^.]+$:;s:\.[^.]+$:;"
+	my ($shorthand,$long) = split/\s/,$_,2;
+	$Global::rpl{$shorthand} = $long;
+    }
+}
+
+sub parse_semaphore() {
+    # Semaphore defaults
+    # Must be done before computing number of processes and max_line_length
+    # because when running as a semaphore GNU Parallel does not read args
+    # Uses:
+    #	$opt::semaphore
+    #	$Global::semaphore
+    #	$opt::semaphoretimeout
+    #	$Semaphore::timeout
+    #	$opt::semaphorename
+    #	$Semaphore::name
+    #	$opt::fg
+    #	$Semaphore::fg
+    #	$opt::wait
+    #	$Semaphore::wait
+    #	$opt::bg
+    #	@opt::a
+    #	@Global::unget_argv
+    #	$Global::default_simultaneous_sshlogins
+    #	$opt::jobs
+    #	$Global::interactive
+    $Global::semaphore ||= ($0 =~ m:(^|/)sem$:); # called as 'sem'
+    if(defined $opt::semaphore) { $Global::semaphore = 1; }
+    if(defined $opt::semaphoretimeout) { $Global::semaphore = 1; }
+    if(defined $opt::semaphorename) { $Global::semaphore = 1; }
+    if(defined $opt::fg and not $opt::tmux and not $opt::tmuxpane) {
+	$Global::semaphore = 1;
+    }
+    if(defined $opt::bg) { $Global::semaphore = 1; }
+    if(defined $opt::wait and not $opt::sqlmaster) {
+	$Global::semaphore = 1; @ARGV = "true";
+    }
+    if($Global::semaphore) {
+	if(@opt::a) {
+	    # Assign the first -a to STDIN
+	    open(STDIN,"<",shift @opt::a);
+	    if(@opt::a) {
+		# We currently have no way of dealing with more -a
+		::error("A semaphore cannot take input from more files\n");
+		::wait_and_exit(255);
+	    }
+	}
+	@opt::a = ("/dev/null");
+	# Append a dummy empty argument
+	# \0 => nothing (not the empty string)
+	push(@Global::unget_argv, [Arg->new("\0noarg")]);
+	$Semaphore::timeout = int(multiply_time_units($opt::semaphoretimeout))
+	    || 0;
+	if(defined $opt::semaphorename) {
+	    $Semaphore::name = $opt::semaphorename;
+	} else {
+	    local $/ = "\n";
+	    $Semaphore::name = `tty`;
+	    chomp $Semaphore::name;
+	}
+	$Semaphore::fg = $opt::fg;
+	$Semaphore::wait = $opt::wait;
+	$Global::default_simultaneous_sshlogins = 1;
+	if(not defined $opt::jobs) {
+	    $opt::jobs = 1;
+	}
+	if($Global::interactive and $opt::bg) {
+	    ::error("Jobs running in the ".
+		    "background cannot be interactive.");
+	    ::wait_and_exit(255);
+	}
+    }
+}
+
+sub record_env() {
+    # Record current %ENV-keys in $PARALLEL_HOME/ignored_vars
+    # Returns: N/A
+    my $ignore_filename = $Global::config_dir . "/ignored_vars";
+    if(open(my $vars_fh, ">", $ignore_filename)) {
+	print $vars_fh map { $_,"\n" } keys %ENV;
+    } else {
+	::error("Cannot write to $ignore_filename.");
+	::wait_and_exit(255);
+    }
+}
+
+sub open_joblog() {
+    # Open joblog as specified by --joblog
+    # Uses:
+    #	$opt::resume
+    #	$opt::resume_failed
+    #	$opt::joblog
+    #	$opt::results
+    #	$Global::job_already_run
+    #	%Global::fh
+    my $append = 0;
+    if(($opt::resume or $opt::resume_failed)
+       and
+       not ($opt::joblog or $opt::results)) {
+	::error("--resume and --resume-failed require --joblog or --results.");
+	::wait_and_exit(255);
+    }
+    if(defined $opt::joblog and $opt::joblog =~ s/^\+//) {
+	# --joblog +filename = append to filename
+	$append = 1;
+    }
+    if($opt::joblog
+       and
+       ($opt::sqlmaster
+	or
+	not $opt::sqlworker)) {
+	# Do not log if --sqlworker
+	if($opt::resume || $opt::resume_failed || $opt::retry_failed) {
+	    if(open(my $joblog_fh, "<", $opt::joblog)) {
+		# Read the joblog
+		# Override $/ with \n because -d might be set
+		local $/ = "\n";
+		# If there is a header: Open as append later
+		$append = <$joblog_fh>;
+		my $joblog_regexp;
+		if($opt::retry_failed) {
+		    # Make a regexp that matches commands with exit+signal=0
+		    # 4 host 1360490623.067 3.445 1023 1222 0 0 command
+		    $joblog_regexp='^(\d+)(?:\t[^\t]+){5}\t0\t0\t';
+		    my @group;
+		    while(<$joblog_fh>) {
+			if(/$joblog_regexp/o) {
+			    # This is 30% faster than set_job_already_run($1);
+			    vec($Global::job_already_run,($1||0),1) = 1;
+			    $Global::total_completed++;
+			    $group[$1-1] = "true";
+			} elsif(/(\d+)\s+\S+(\s+[-0-9.]+){6}\s+(.*)$/) {
+			    # Grab out the command
+			    $group[$1-1] = $3;
+			} else {
+			    chomp;
+			    ::error("Format of '$opt::joblog' is wrong: $_");
+			    ::wait_and_exit(255);
+			}
+		    }
+		    if(@group) {
+			my ($outfh,$name) = ::tmpfile(SUFFIX => ".arg");
+			unlink($name);
+			# Put args into argfile
+			if(grep /\0/, @group) {
+			    # force --null to deal with \n in commandlines
+			    ::warning("Command lines contain newline. ".
+				      "Forcing --null.");
+			    $opt::null = 1;
+			    $/ = "\0";
+			}
+			# Replace \0 with '\n' as used in print_joblog()
+			print $outfh (map { s/\0/\n/g; $_,$/ }
+				      map { $_ } @group);
+			seek $outfh, 0, 0;
+			exit_if_disk_full();
+			# Set filehandle to -a
+			@opt::a = ($outfh);
+		    }
+		    # Remove $command (so -a is run)
+		    @ARGV = ();
+		}
+		if($opt::resume || $opt::resume_failed) {
+		    if($opt::resume_failed) {
+			# Make a regexp that matches commands with exit+signal=0
+			# 4 host 1360490623.067 3.445 1023 1222 0 0 command
+			$joblog_regexp='^(\d+)(?:\t[^\t]+){5}\t0\t0\t';
+		    } else {
+			# Just match the job number
+			$joblog_regexp='^(\d+)';
+		    }
+		    while(<$joblog_fh>) {
+			if(/$joblog_regexp/o) {
+			    # This is 30% faster than set_job_already_run($1);
+			    vec($Global::job_already_run,($1||0),1) = 1;
+			    $Global::total_completed++;
+			} elsif(not /\d+\s+[^\s]+\s+([-0-9.]+\s+){6}/) {
+			    ::error("Format of '$opt::joblog' is wrong: $_");
+			    ::wait_and_exit(255);
+			}
+		    }
+		}
+		close $joblog_fh;
+	    }
+	    # $opt::null may be set if the commands contain \n
+	    if($opt::null) { $/ = "\0"; }
+	}
+	if($opt::dryrun) {
+	    # Do not write to joblog in a dry-run
+	    if(not open($Global::joblog, ">", "/dev/null")) {
+		::error("Cannot write to --joblog $opt::joblog.");
+		::wait_and_exit(255);
+	    }
+	} elsif($append) {
+	    # Append to joblog
+	    if(not open($Global::joblog, ">>", $opt::joblog)) {
+		::error("Cannot append to --joblog $opt::joblog.");
+		::wait_and_exit(255);
+	    }
+	} else {
+	    if($opt::joblog eq "-") {
+		# Use STDOUT as joblog
+		$Global::joblog = $Global::fh{1};
+	    } elsif(not open($Global::joblog, ">", $opt::joblog)) {
+		# Overwrite the joblog
+		::error("Cannot write to --joblog $opt::joblog.");
+		::wait_and_exit(255);
+	    }
+	    print $Global::joblog
+		join("\t", "Seq", "Host", "Starttime", "JobRuntime",
+		     "Send", "Receive", "Exitval", "Signal", "Command"
+		). "\n";
+	}
+    }
+}
+
+sub open_json_csv() {
+    if($opt::results) {
+	# Output as JSON/CSV/TSV
+	if($opt::results eq "-.csv"
+	   or
+	   $opt::results eq "-.tsv"
+	   or
+	   $opt::results eq "-.json") {
+	    # Output as JSON/CSV/TSV on stdout
+	    open $Global::csv_fh, ">&", "STDOUT" or
+		::die_bug("Can't dup STDOUT in csv: $!");
+	    # Do not print any other output to STDOUT
+	    # by forcing all other output to /dev/null
+	    open my $fd, ">", "/dev/null" or
+		::die_bug("Can't >/dev/null in csv: $!");
+	    $Global::fh{1} = $fd;
+	    $Global::fh{2} = $fd;
+	} elsif($Global::csvsep or $Global::jsonout) {
+	    if(not open($Global::csv_fh,">",$opt::results)) {
+		::error("Cannot open results file `$opt::results': ".
+			"$!.");
+		wait_and_exit(255);
+	    }
+	}
+    }
+}
+
+sub find_compression_program() {
+    # Find a fast compression program
+    # Returns:
+    #	$compress_program = compress program with options
+    #	$decompress_program = decompress program with options
+
+    # Search for these. Sorted by speed on 128 core
+
+    # seq 120000000|shuf > 1gb &
+    # apt-get update
+    # apt install make g++ htop
+    # wget -O - pi.dk/3 | bash
+    # apt install zstd clzip liblz4-tool lzop pigz pxz gzip plzip pbzip2 lzma xz-utils lzip bzip2 lbzip2 lrzip pixz
+    # git clone https://github.com/facebook/zstd.git
+    # (cd zstd/contrib/pzstd; make -j; cp pzstd /usr/local/bin)
+    # echo 'lrzip -L $((-$1))'	>/usr/local/bin/lrz
+    # chmod +x /usr/local/bin/lrz
+    # wait
+    # onethread="zstd clzip lz4 lzop gzip lzma xz bzip2"
+    # multithread="pzstd pigz pxz plzip pbzip2 lzip lbzip2 lrz pixz"
+    # parallel --shuf -j1  --joblog jl-m --arg-sep ,  parallel --compress-program \'{3}" "-{2}\' cat ::: 1gb '>'/dev/null , 1 2 3 ,  {1..3} , $multithread
+    # parallel --shuf -j50% --delay 1  --joblog jl-s --arg-sep ,  parallel --compress-program \'{3}" "-{2}\' cat ::: 1gb '>'/dev/null , 1 2 3 ,	 {1..3} , $onethread
+    # sort -nk4 jl-?
+
+    # 1-core:
+    # 2-cores: pzstd zstd lz4 lzop pigz gzip lbzip2 pbzip2 lrz bzip2 lzma pxz plzip xz lzip clzip
+    # 4-cores:
+    # 8-cores: pzstd lz4 zstd pigz lzop lbzip2 pbzip2 gzip lzip lrz plzip pxz bzip2 lzma xz clzip
+    # 16-cores: pzstd lz4 pigz lzop lbzip2 pbzip2 plzip lzip lrz pxz gzip lzma xz bzip2
+    # 32-cores: pzstd lbzip2 pbzip2 zstd pigz lz4 lzop plzip lzip lrz gzip pxz lzma bzip2 xz clzip
+    # 64-cores: pzstd lbzip2 pbzip2 pigz zstd pixz lz4 plzip lzop lzip lrz gzip pxz lzma bzip2 xz clzip
+    # 128-core: pzstd lbzip2 pbzip2 zstd pixz lz4 pigz lzop plzip lzip gzip lrz pxz bzip2 lzma xz clzip
+
+    my @prg = qw(pzstd lbzip2 pbzip2 zstd pixz lz4 pigz lzop plzip lzip gzip
+		 lrz pxz bzip2 lzma xz clzip);
+    for my $p (@prg) {
+	if(which($p)) {
+	    return ("$p -c -1","$p -dc");
+	}
+    }
+    # Fall back to cat
+    return ("cat","cat");
+}
+
+sub read_options() {
+    # Read options from command line, profile and $PARALLEL
+    # Uses:
+    #	$opt::shebang_wrap
+    #	$opt::shebang
+    #	@ARGV
+    #	$opt::plain
+    #	@opt::profile
+    #	$ENV{'HOME'}
+    #	$ENV{'PARALLEL'}
+    # Returns:
+    #	@ARGV_no_opt = @ARGV without --options
+
+    # This must be done first as this may exec myself
+    if(defined $ARGV[0] and ($ARGV[0] =~ /^--shebang/ or
+			     $ARGV[0] =~ /^--shebang-?wrap/ or
+			     $ARGV[0] =~ /^--hashbang/)) {
+	# Program is called from #! line in script
+	# remove --shebang-wrap if it is set
+	$opt::shebang_wrap = ($ARGV[0] =~ s/^--shebang-?wrap *//);
+	# remove --shebang if it is set
+	$opt::shebang = ($ARGV[0] =~ s/^--shebang *//);
+	# remove --hashbang if it is set
+	$opt::shebang .= ($ARGV[0] =~ s/^--hashbang *//);
+	if($opt::shebang) {
+	    my $argfile = Q(pop @ARGV);
+	    # exec myself to split $ARGV[0] into separate fields
+	    exec "$0 --skip-first-line -a $argfile @ARGV";
+	}
+	if($opt::shebang_wrap) {
+	    my @options;
+	    my @parser;
+	    if ($^O eq 'freebsd') {
+		# FreeBSD's #! puts different values in @ARGV than Linux' does
+		my @nooptions = @ARGV;
+		get_options_from_array(\@nooptions);
+		while($#ARGV > $#nooptions) {
+		    push @options, shift @ARGV;
+		}
+		while(@ARGV and $ARGV[0] ne ":::") {
+		    push @parser, shift @ARGV;
+		}
+		if(@ARGV and $ARGV[0] eq ":::") {
+		    shift @ARGV;
+		}
+	    } else {
+		@options = shift @ARGV;
+	    }
+	    my $script = Q(shift @ARGV);
+	    # exec myself to split $ARGV[0] into separate fields
+	    exec "$0 --_pipe-means-argfiles @options @parser $script ".
+		"::: @ARGV";
+	}
+    }
+    if($ARGV[0] =~ / --shebang(-?wrap)? /) {
+	::warning("--shebang and --shebang-wrap must be the first ".
+		  "argument.\n");
+    }
+
+    Getopt::Long::Configure("bundling","require_order");
+    my @ARGV_copy = @ARGV;
+    my @ARGV_orig = @ARGV;
+    # Check if there is a --profile to set @opt::profile
+    get_options_from_array(\@ARGV_copy,"profile|J=s","plain") || die_usage();
+    my @ARGV_profile = ();
+    my @ARGV_env = ();
+    if(not $opt::plain) {
+	# Add options from $PARALLEL_HOME/config and other profiles
+	my @config_profiles = (
+	    "/etc/parallel/config",
+	    (map { "$_/config" } @Global::config_dirs),
+	    $ENV{'HOME'}."/.parallelrc");
+	my @profiles = @config_profiles;
+	if(@opt::profile) {
+	    # --profile overrides default profiles
+	    @profiles = ();
+	    for my $profile (@opt::profile) {
+		if($profile =~ m:^\./|^/:) {
+		    # Look for ./profile in .
+		    # Look for /profile in /
+		    push @profiles, grep { -r $_ } $profile;
+		} else {
+		    # Look for the $profile in @Global::config_dirs
+		    push @profiles, grep { -r $_ }
+		    map { "$_/$profile" } @Global::config_dirs;
+		}
+	    }
+	}
+	for my $profile (@profiles) {
+	    if(-r $profile) {
+		::debug("init","Read $profile\n");
+		local $/ = "\n";
+		open (my $in_fh, "<", $profile) ||
+		    ::die_bug("read-profile: $profile");
+		while(<$in_fh>) {
+		    /^\s*\#/ and next;
+		    chomp;
+		    push @ARGV_profile, shell_words($_);
+		}
+		close $in_fh;
+	    } else {
+		if(grep /^\Q$profile\E$/, @config_profiles) {
+		    # config file is not required to exist
+		} else {
+		    ::error("$profile not readable.");
+		    wait_and_exit(255);
+		}
+	    }
+	}
+	# Add options from shell variable $PARALLEL
+	if($ENV{'PARALLEL'}) {
+	    push @ARGV_env, shell_words($ENV{'PARALLEL'});
+	}
+	# Add options from env_parallel.csh via $PARALLEL_CSH
+	if($ENV{'PARALLEL_CSH'}) {
+	    push @ARGV_env, shell_words($ENV{'PARALLEL_CSH'});
+	}
+    }
+    Getopt::Long::Configure("bundling","require_order");
+    get_options_from_array(\@ARGV_profile) || die_usage();
+    get_options_from_array(\@ARGV_env) || die_usage();
+    get_options_from_array(\@ARGV) || die_usage();
+    # What were the options given on the command line?
+    # Used to start --sqlworker
+    my $ai = arrayindex(\@ARGV_orig, \@ARGV);
+    @Global::options_in_argv = @ARGV_orig[0..$ai-1];
+    # Prepend non-options to @ARGV (such as commands like 'nice')
+    unshift @ARGV, @ARGV_profile, @ARGV_env;
+    return @ARGV;
+}
+
+sub arrayindex() {
+    # Similar to Perl's index function, but for arrays
+    # Input:
+    #	$arr_ref1 = ref to @array1 to search in
+    #	$arr_ref2 = ref to @array2 to search for
+    # Returns:
+    #	$pos = position of @array1 in @array2, -1 if not found
+    my ($arr_ref1,$arr_ref2) = @_;
+    my $array1_as_string = join "", map { "\0".$_ } @$arr_ref1;
+    my $array2_as_string = join "", map { "\0".$_ } @$arr_ref2;
+    my $i = index($array1_as_string,$array2_as_string,0);
+    if($i == -1) { return -1 }
+    my @before = split /\0/, substr($array1_as_string,0,$i);
+    return $#before;
+}
+
+sub read_args_from_command_line() {
+    # Arguments given on the command line after:
+    #	::: ($Global::arg_sep)
+    #	:::: ($Global::arg_file_sep)
+    #	:::+ ($Global::arg_sep with --link)
+    #	::::+ ($Global::arg_file_sep with --link)
+    # Removes the arguments from @ARGV and:
+    # - puts filenames into -a
+    # - puts arguments into files and add the files to -a
+    # - adds --linkinputsource with 0/1 for each -a depending on :::+/::::+
+    # Input:
+    #	@::ARGV = command option ::: arg arg arg :::: argfiles
+    # Uses:
+    #	$Global::arg_sep
+    #	$Global::arg_file_sep
+    #	$opt::_pipe_means_argfiles
+    #	$opt::pipe
+    #	@opt::a
+    # Returns:
+    #	@argv_no_argsep = @::ARGV without ::: and :::: and following args
+    my @new_argv = ();
+    for(my $arg = shift @ARGV; @ARGV; $arg = shift @ARGV) {
+	if($arg eq $Global::arg_sep
+	   or
+	   $arg eq $Global::arg_sep."+"
+	   or
+	   $arg eq $Global::arg_file_sep
+	   or
+	   $arg eq $Global::arg_file_sep."+") {
+	    my $group_sep = $arg; # This group of args is args or argfiles
+	    my @group;
+	    while(defined ($arg = shift @ARGV)) {
+		if($arg eq $Global::arg_sep
+		   or
+		   $arg eq $Global::arg_sep."+"
+		   or
+		   $arg eq $Global::arg_file_sep
+		   or
+		   $arg eq $Global::arg_file_sep."+") {
+		    # exit while loop if finding new separator
+		    last;
+		} else {
+		    # If not hitting ::: :::+ :::: or ::::+
+		    # Append it to the group
+		    push @group, $arg;
+		}
+	    }
+	    my $is_linked = ($group_sep =~ /\+$/) ? 1 : 0;
+	    my $is_file = ($group_sep eq $Global::arg_file_sep
+			   or
+			   $group_sep eq $Global::arg_file_sep."+");
+	    if($is_file) {
+		# :::: / ::::+
+		push @opt::linkinputsource, map { $is_linked } @group;
+	    } else {
+		# ::: / :::+
+		push @opt::linkinputsource, $is_linked;
+	    }
+	    if($is_file
+	       or ($opt::_pipe_means_argfiles and $opt::pipe)
+		) {
+		# Group of file names on the command line.
+		# Append args into -a
+		push @opt::a, @group;
+	    } else {
+		# Group of arguments on the command line.
+		# Put them into a file.
+		# Create argfile
+		my ($outfh,$name) = ::tmpfile(SUFFIX => ".arg");
+		unlink($name);
+		# Put args into argfile
+		print $outfh map { $_,$/ } @group;
+		seek $outfh, 0, 0;
+		exit_if_disk_full();
+		# Append filehandle to -a
+		push @opt::a, $outfh;
+	    }
+	    if(defined($arg)) {
+		# $arg is ::: :::+ :::: or ::::+
+		# so there is another group
+		redo;
+	    } else {
+		# $arg is undef -> @ARGV empty
+		last;
+	    }
+	}
+	push @new_argv, $arg;
+    }
+    # Output: @ARGV = command to run with options
+    return @new_argv;
+}
+
+sub cleanup() {
+    # Returns: N/A
+    unlink keys %Global::unlink;
+    map { rmdir $_ } keys %Global::unlink;
+    if(@opt::basefile and $opt::cleanup) { cleanup_basefile(); }
+    for(keys %Global::sshmaster) {
+	# If 'ssh -M's are running: kill them
+	kill "TERM", $_;
+    }
+}
+
+
+sub __QUOTING_ARGUMENTS_FOR_SHELL__() {}
+
+sub shell_quote(@) {
+    # Input:
+    #	@strings = strings to be quoted
+    # Returns:
+    #	@shell_quoted_strings = string quoted as needed by the shell
+    return wantarray ? (map { Q($_) } @_) : (join" ",map { Q($_) } @_);
+}
+
+sub shell_quote_scalar_rc($) {
+    # Quote for the rc-shell
+    my $a = $_[0];
+    if(defined $a) {
+	if(($a =~ s/'/''/g)
+	   +
+	   ($a =~ s/[\n\002-\011\013-\032\\\#\?\`\(\)\{\}\[\]\^\*\<\=\>\~\|\; \"\!\$\&\'\202-\377]+/'$&'/go)) {
+	    # A string was replaced
+	    # No need to test for "" or \0
+	} elsif($a eq "") {
+	    $a = "''";
+	} elsif($a eq "\0") {
+	    $a = "";
+	}
+    }
+    return $a;
+}
+
+sub shell_quote_scalar_csh($) {
+    # Quote for (t)csh
+    my $a = $_[0];
+    if(defined $a) {
+	# $a =~ s/([\002-\011\013-\032\\\#\?\`\(\)\{\}\[\]\^\*\>\<\~\|\; \"\!\$\&\'\202-\377])/\\$1/g;
+	# This is 1% faster than the above
+	if(($a =~ s/[\002-\011\013-\032\\\#\?\`\(\)\{\}\[\]\^\*\<\=\>\~\|\; \"\!\$\&\'\202-\377]/\\$&/go)
+	   +
+	   # quote newline in csh as \\\n
+	   ($a =~ s/[\n]/"\\\n"/go)) {
+	    # A string was replaced
+	    # No need to test for "" or \0
+	} elsif($a eq "") {
+	    $a = "''";
+	} elsif($a eq "\0") {
+	    $a = "";
+	}
+    }
+    return $a;
+}
+
+sub shell_quote_scalar_default($) {
+    # Quote for other shells (Bourne compatibles)
+    # Inputs:
+    #	$string = string to be quoted
+    # Returns:
+    #	$shell_quoted = string quoted as needed by the shell
+    local $_ = $_[0];
+    if(/[^-_.+a-z0-9\/]/i) {
+	s/'/'"'"'/g;	# "-quote '-quotes
+	$_ = "'$_'";	# '-quote entire string
+	s/^''//;	# Remove unneeded '' at ends
+	s/''$//;	# (faster than s/^''|''$//g)
+	return $_;
+    } elsif ($_ eq "") {
+	return "''";
+    } else {
+	# No quoting needed
+	return $_;
+    }
+}
+
+sub shell_quote_scalar($) {
+    # Quote the string so the shell will not expand any special chars
+    # Inputs:
+    #	$string = string to be quoted
+    # Returns:
+    #	$shell_quoted = string quoted as needed by the shell
+
+    # Speed optimization: Choose the correct shell_quote_scalar_*
+    # and call that directly from now on
+    no warnings 'redefine';
+    if($Global::cshell) {
+	# (t)csh
+	*shell_quote_scalar = \&shell_quote_scalar_csh;
+    } elsif($Global::shell =~ m:(^|/)rc$:) {
+	# rc-shell
+	*shell_quote_scalar = \&shell_quote_scalar_rc;
+    } else {
+	# other shells
+	*shell_quote_scalar = \&shell_quote_scalar_default;
+    }
+    # The sub is now redefined. Call it
+    return shell_quote_scalar($_[0]);
+}
+
+sub Q($) {
+    # Q alias for ::shell_quote_scalar
+    my $ret = shell_quote_scalar($_[0]);
+    no warnings 'redefine';
+    *Q = \&::shell_quote_scalar;
+    return $ret;
+}
+
+sub shell_quote_file($) {
+    # Quote the string so shell will not expand any special chars
+    # and prepend ./ if needed
+    # Input:
+    #	$filename = filename to be shell quoted
+    # Returns:
+    #	$quoted_filename = filename quoted with \ and ./ if needed
+    my $a = shift;
+    if(defined $a) {
+	if($a =~ m:^/: or $a =~ m:^\./:) {
+	    # /abs/path or ./rel/path => skip
+	} else {
+	    # rel/path => ./rel/path
+	    $a = "./".$a;
+	}
+    }
+    return Q($a);
+}
+
+sub shell_words(@) {
+    # Input:
+    #	$string = shell line
+    # Returns:
+    #	@shell_words = $string split into words as shell would do
+    $Global::use{"Text::ParseWords"} ||= eval "use Text::ParseWords; 1;";
+    return Text::ParseWords::shellwords(@_);
+}
+
+sub perl_quote_scalar($) {
+    # Quote the string so perl's eval will not expand any special chars
+    # Inputs:
+    #	$string = string to be quoted
+    # Returns:
+    #	$perl_quoted = string quoted with \ as needed by perl's eval
+    my $a = $_[0];
+    if(defined $a) {
+	$a =~ s/[\\\"\$\@]/\\$&/go;
+    }
+    return $a;
+}
+
+# -w complains about prototype
+sub pQ($) {
+    # pQ alias for ::perl_quote_scalar
+    my $ret = perl_quote_scalar($_[0]);
+    *pQ = \&::perl_quote_scalar;
+    return $ret;
+}
+
+sub unquote_printf() {
+    # Convert \t \n \r \000 \0
+    # Inputs:
+    #	$string = string with \t \n \r \num \0
+    # Returns:
+    #	$replaced = string with TAB NEWLINE CR <ascii-num> NUL
+    $_ = shift;
+    s/\\t/\t/g;
+    s/\\n/\n/g;
+    s/\\r/\r/g;
+    s/\\(\d\d\d)/eval 'sprintf "\\'.$1.'"'/ge;
+    s/\\(\d)/eval 'sprintf "\\'.$1.'"'/ge;
+    return $_;
+}
+
+
+sub __FILEHANDLES__() {}
+
+
+sub save_stdin_stdout_stderr() {
+    # Remember the original STDIN, STDOUT and STDERR
+    # and file descriptors opened by the shell (e.g. 3>/tmp/foo)
+    # Uses:
+    #	%Global::fh
+    #	$Global::original_stderr
+    #	$Global::original_stdin
+    # Returns: N/A
+
+    # TODO Disabled until we have an open3 that will take n filehandles
+    # for my $fdno (1..61) {
+    # # /dev/fd/62 and above are used by bash for <(cmd)
+    # # Find file descriptors that are already opened (by the shell)
+    # Only focus on stdout+stderr for now
+    for my $fdno (1..2) {
+	my $fh;
+	# 2-argument-open is used to be compatible with old perl 5.8.0
+	# bug #43570: Perl 5.8.0 creates 61 files
+	if(open($fh,">&=$fdno")) {
+	    $Global::fh{$fdno}=$fh;
+	}
+    }
+    open $Global::original_stderr, ">&", "STDERR" or
+	::die_bug("Can't dup STDERR: $!");
+    open $Global::status_fd, ">&", "STDERR" or
+	::die_bug("Can't dup STDERR: $!");
+    open $Global::original_stdin, "<&", "STDIN" or
+	::die_bug("Can't dup STDIN: $!");
+}
+
+sub enough_file_handles() {
+    # Check that we have enough filehandles available for starting
+    # another job
+    # Uses:
+    #	$opt::ungroup
+    #	%Global::fh
+    # Returns:
+    #	1 if ungrouped (thus not needing extra filehandles)
+    #	0 if too few filehandles
+    #	1 if enough filehandles
+    if(not $opt::ungroup) {
+	my %fh;
+	my $enough_filehandles = 1;
+	# perl uses 7 filehandles for something?
+	# open3 uses 2 extra filehandles temporarily
+	# We need a filehandle for each redirected file descriptor
+	# (normally just STDOUT and STDERR)
+	for my $i (1..(7+2+keys %Global::fh)) {
+	    $enough_filehandles &&= open($fh{$i}, "<", "/dev/null");
+	}
+	for (values %fh) { close $_; }
+	return $enough_filehandles;
+    } else {
+	# Ungrouped does not need extra file handles
+	return 1;
+    }
+}
+
+sub open_or_exit($) {
+    # Open a file name or exit if the file cannot be opened
+    # Inputs:
+    #	$file = filehandle or filename to open
+    # Uses:
+    #	$Global::original_stdin
+    # Returns:
+    #	$fh = file handle to read-opened file
+    my $file = shift;
+    if($file eq "-") {
+	return ($Global::original_stdin || *STDIN);
+    }
+    if(ref $file eq "GLOB") {
+	# This is an open filehandle
+	return $file;
+    }
+    my $fh = gensym;
+    if(not open($fh, "<", $file)) {
+	::error("Cannot open input file `$file': No such file or directory.");
+	wait_and_exit(255);
+    }
+    return $fh;
+}
+
+sub set_fh_blocking($) {
+    # Set filehandle as blocking
+    # Inputs:
+    #	$fh = filehandle to be blocking
+    # Returns:
+    #	N/A
+    my $fh = shift;
+    $Global::use{"Fcntl"} ||= eval "use Fcntl qw(:DEFAULT :flock); 1;";
+    my $flags;
+    # Get the current flags on the filehandle
+    fcntl($fh, &F_GETFL, $flags) || die $!;
+    # Remove non-blocking from the flags
+    $flags &= ~&O_NONBLOCK;
+    # Set the flags on the filehandle
+    fcntl($fh, &F_SETFL, $flags) || die $!;
+}
+
+sub set_fh_non_blocking($) {
+    # Set filehandle as non-blocking
+    # Inputs:
+    #	$fh = filehandle to be blocking
+    # Returns:
+    #	N/A
+    my $fh = shift;
+    $Global::use{"Fcntl"} ||= eval "use Fcntl qw(:DEFAULT :flock); 1;";
+    my $flags;
+    # Get the current flags on the filehandle
+    fcntl($fh, &F_GETFL, $flags) || die $!;
+    # Add non-blocking to the flags
+    $flags |= &O_NONBLOCK;
+    # Set the flags on the filehandle
+    fcntl($fh, &F_SETFL, $flags) || die $!;
+}
+
+
+sub __RUNNING_THE_JOBS_AND_PRINTING_PROGRESS__() {}
+
+
+# Variable structure:
+#
+#    $Global::running{$pid} = Pointer to Job-object
+#    @Global::virgin_jobs = Pointer to Job-object that have received no input
+#    $Global::host{$sshlogin} = Pointer to SSHLogin-object
+#    $Global::total_running = total number of running jobs
+#    $Global::total_started = total jobs started
+#    $Global::max_procs_file = filename if --jobs is given a filename
+#    $Global::JobQueue = JobQueue object for the queue of jobs
+#    $Global::timeoutq = queue of times where jobs timeout
+#    $Global::newest_job = Job object of the most recent job started
+#    $Global::newest_starttime = timestamp of $Global::newest_job
+#    @Global::sshlogin
+#    $Global::minimal_command_line_length = min len supported by all sshlogins
+#    $Global::start_no_new_jobs = should more jobs be started?
+#    $Global::original_stderr = file handle for STDERR when the program started
+#    $Global::total_started = total number of jobs started
+#    $Global::joblog = filehandle of joblog
+#    $Global::debug = Is debugging on?
+#    $Global::exitstatus = status code of GNU Parallel
+#    $Global::quoting = quote the command to run
+
+sub init_run_jobs() {
+    # Set Global variables and progress signal handlers
+    # Do the copying of basefiles
+    # Returns: N/A
+    $Global::total_running = 0;
+    $Global::total_started = 0;
+    $SIG{USR1} = \&list_running_jobs;
+    $SIG{USR2} = \&toggle_progress;
+    if(@opt::basefile) { setup_basefile(); }
+}
+
+{
+    my $last_time;
+    my %last_mtime;
+    my $max_procs_file_last_mod;
+
+    sub changed_procs_file {
+	# If --jobs is a file and it is modfied:
+	# Force recomputing of max_jobs_running for each $sshlogin
+	# Uses:
+	#   $Global::max_procs_file
+	#   %Global::host
+	# Returns: N/A
+	if($Global::max_procs_file) {
+	    # --jobs filename
+	    my $mtime = (stat($Global::max_procs_file))[9];
+	    $max_procs_file_last_mod ||= 0;
+	    if($mtime > $max_procs_file_last_mod) {
+		# file changed: Force re-computing max_jobs_running
+		$max_procs_file_last_mod = $mtime;
+		for my $sshlogin (values %Global::host) {
+		    $sshlogin->set_max_jobs_running(undef);
+		}
+	    }
+	}
+    }
+
+    sub changed_sshloginfile {
+	# If --slf is changed:
+	#   reload --slf
+	#   filter_hosts
+	#   setup_basefile
+	# Uses:
+	#   @opt::sshloginfile
+	#   @Global::sshlogin
+	#   %Global::host
+	#   $opt::filter_hosts
+	# Returns: N/A
+	if(@opt::sshloginfile) {
+	    # Is --sshloginfile changed?
+	    for my $slf (@opt::sshloginfile) {
+		my $actual_file = expand_slf_shorthand($slf);
+		my $mtime = (stat($actual_file))[9];
+		$last_mtime{$actual_file} ||= $mtime;
+		if($mtime - $last_mtime{$actual_file} > 1) {
+		    ::debug("run",
+			    "--sshloginfile $actual_file changed. reload\n");
+		    $last_mtime{$actual_file} = $mtime;
+		    # Reload $slf
+		    # Empty sshlogins
+		    @Global::sshlogin = ();
+		    for (values %Global::host) {
+			# Don't start new jobs on any host
+			# except the ones added back later
+			$_->set_max_jobs_running(0);
+		    }
+		    # This will set max_jobs_running on the SSHlogins
+		    read_sshloginfile($actual_file);
+		    parse_sshlogin();
+		    $opt::filter_hosts and filter_hosts();
+		    setup_basefile();
+		}
+	    }
+	}
+    }
+
+    sub start_more_jobs {
+	# Run start_another_job() but only if:
+	#   * not $Global::start_no_new_jobs set
+	#   * not JobQueue is empty
+	#   * not load on server is too high
+	#   * not server swapping
+	#   * not too short time since last remote login
+	# Uses:
+	#   %Global::host
+	#   $Global::start_no_new_jobs
+	#   $Global::JobQueue
+	#   $opt::pipe
+	#   $opt::load
+	#   $opt::noswap
+	#   $opt::delay
+	#   $Global::newest_starttime
+	# Returns:
+	#   $jobs_started = number of jobs started
+	my $jobs_started = 0;
+	if($Global::start_no_new_jobs) {
+	    return $jobs_started;
+	}
+	if(time - ($last_time||0) > 1) {
+	    # At most do this every second
+	    $last_time = time;
+	    changed_procs_file();
+	    changed_sshloginfile();
+	}
+	# This will start 1 job on each --sshlogin (if possible)
+	# thus distribute the jobs on the --sshlogins round robin
+	for my $sshlogin (values %Global::host) {
+	    if($Global::JobQueue->empty() and not $opt::pipe) {
+		# No more jobs in the queue
+		last;
+	    }
+	    debug("run", "Running jobs before on ", $sshlogin->string(), ": ",
+		  $sshlogin->jobs_running(), "\n");
+	    if ($sshlogin->jobs_running() < $sshlogin->max_jobs_running()) {
+		if($opt::delay
+		   and
+		   $opt::delay-0.008 > ::now()-$Global::newest_starttime) {
+		    # It has been too short since last start
+		    next;
+		}
+		if($opt::load and $sshlogin->loadavg_too_high()) {
+		    # The load is too high or unknown
+		    next;
+		}
+		if($opt::noswap and $sshlogin->swapping()) {
+		    # The server is swapping
+		    next;
+		}
+		if($opt::limit and $sshlogin->limit()) {
+		    # Over limit
+		    next;
+		}
+		if(($opt::memfree or $opt::memsuspend)
+		   and
+		   $sshlogin->memfree() < $Global::memlimit) {
+		    # The server has not enough mem free
+		    ::debug("mem", "Not starting job: not enough mem\n");
+		    next;
+		}
+		if($sshlogin->too_fast_remote_login()) {
+		    # It has been too short since last login
+		    next;
+		}
+		debug("run", $sshlogin->string(),
+		      " has ", $sshlogin->jobs_running(),
+		      " out of ", $sshlogin->max_jobs_running(),
+		      " jobs running. Start another.\n");
+		if(start_another_job($sshlogin) == 0) {
+		    # No more jobs to start on this $sshlogin
+		    debug("run","No jobs started on ",
+			  $sshlogin->string(), "\n");
+		    next;
+		}
+		$sshlogin->inc_jobs_running();
+		$sshlogin->set_last_login_at(::now());
+		$jobs_started++;
+	    }
+	    debug("run","Running jobs after on ", $sshlogin->string(), ": ",
+		  $sshlogin->jobs_running(), " of ",
+		  $sshlogin->max_jobs_running(), "\n");
+	}
+
+	return $jobs_started;
+    }
+}
+
+{
+    my $no_more_file_handles_warned;
+
+    sub start_another_job() {
+	# If there are enough filehandles
+	#   and JobQueue not empty
+	#   and not $job is in joblog
+	# Then grab a job from Global::JobQueue,
+	#   start it at sshlogin
+	#   mark it as virgin_job
+	# Inputs:
+	#   $sshlogin = the SSHLogin to start the job on
+	# Uses:
+	#   $Global::JobQueue
+	#   $opt::pipe
+	#   $opt::results
+	#   $opt::resume
+	#   @Global::virgin_jobs
+	# Returns:
+	#   1 if another jobs was started
+	#   0 otherwise
+	my $sshlogin = shift;
+	# Do we have enough file handles to start another job?
+	if(enough_file_handles()) {
+	    if($Global::JobQueue->empty() and not $opt::pipe) {
+		# No more commands to run
+		debug("start", "Not starting: JobQueue empty\n");
+		return 0;
+	    } else {
+		my $job;
+		# Skip jobs already in job log
+		# Skip jobs already in results
+		do {
+		    $job = get_job_with_sshlogin($sshlogin);
+		    if(not defined $job) {
+			# No command available for that sshlogin
+			debug("start", "Not starting: no jobs available for ",
+			      $sshlogin->string(), "\n");
+			return 0;
+		    }
+		    if($job->is_already_in_joblog()) {
+			$job->free_slot();
+		    }
+		} while ($job->is_already_in_joblog()
+			 or
+			 ($opt::results and $opt::resume
+			  and $job->is_already_in_results()));
+		debug("start", "Command to run on '",
+		      $job->sshlogin()->string(), "': '",
+		      $job->replaced(),"'\n");
+		if($job->start()) {
+		    if($opt::pipe) {
+			if($job->virgin()) {
+			    push(@Global::virgin_jobs,$job);
+			} else {
+			    # Block already set: This is a retry
+			    $job->write_block();
+			}
+		    }
+		    debug("start", "Started as seq ", $job->seq(),
+			  " pid:", $job->pid(), "\n");
+		    return 1;
+		} else {
+		    # Not enough processes to run the job.
+		    # Put it back on the queue.
+		    $Global::JobQueue->unget($job);
+		    # Count down the number of jobs to run for this SSHLogin.
+		    my $max = $sshlogin->max_jobs_running();
+		    if($max > 1) { $max--; } else {
+			my @arg;
+			for my $record (@{$job->{'commandline'}{'arg_list'}}) {
+			    push @arg, map { $_->orig() } @$record;
+			}
+			::error("No more processes: cannot run a single job. ".
+				"Something is wrong at @arg.");
+			::wait_and_exit(255);
+		    }
+		    $sshlogin->set_max_jobs_running($max);
+		    # Sleep up to 300 ms to give other processes time to die
+		    ::usleep(rand()*300);
+		    ::warning("No more processes: ".
+			      "Decreasing number of running jobs to $max.",
+			      "Try increasing 'ulimit -u' (try: ulimit -u `ulimit -Hu`)",
+			      "or increasing 'nproc' in /etc/security/limits.conf",
+			      "or increasing /proc/sys/kernel/pid_max");
+		    return 0;
+		}
+	    }
+	} else {
+	    # No more file handles
+	    $no_more_file_handles_warned++ or
+		::warning("No more file handles. ",
+			  "Try running 'parallel -j0 -N 100 --pipe parallel -j0'",
+			  "or increasing 'ulimit -n' (try: ulimit -n `ulimit -Hn`)",
+			  "or increasing 'nofile' in /etc/security/limits.conf",
+			  "or increasing /proc/sys/fs/file-max");
+	    debug("start", "No more file handles. ");
+	    return 0;
+	}
+    }
+}
+
+sub init_progress() {
+    # Uses:
+    #	$opt::bar
+    # Returns:
+    #	list of computers for progress output
+    $|=1;
+    if($opt::bar) {
+	return("","");
+    }
+    my %progress = progress();
+    return ("\nComputers / CPU cores / Max jobs to run\n",
+	    $progress{'workerlist'});
+}
+
+sub drain_job_queue(@) {
+    # Uses:
+    #	$opt::progress
+    #	$Global::total_running
+    #	$Global::max_jobs_running
+    #	%Global::running
+    #	$Global::JobQueue
+    #	%Global::host
+    #	$Global::start_no_new_jobs
+    # Returns: N/A
+    my @command = @_;
+    if($opt::progress) {
+	::status_no_nl(init_progress());
+    }
+    my $last_header = "";
+    my $sleep = 0.2;
+    my $sleepsum = 0;
+    do {
+	while($Global::total_running > 0) {
+	    debug("init",$Global::total_running, "==", scalar
+		  keys %Global::running," slots: ", $Global::max_jobs_running);
+	    if($opt::pipe) {
+		# When using --pipe sometimes file handles are not
+		# closed properly
+		for my $job (values %Global::running) {
+		    close $job->fh(0,"w");
+		}
+	    }
+	    if($opt::progress) {
+		my %progress = progress();
+		if($last_header ne $progress{'header'}) {
+		    ::status("", $progress{'header'});
+		    $last_header = $progress{'header'};
+		}
+		::status_no_nl("\r",$progress{'status'});
+	    }
+	    if($Global::total_running < $Global::max_jobs_running
+	       and not $Global::JobQueue->empty()) {
+		# These jobs may not be started because of loadavg
+		# or too little time between each ssh login.
+		if(start_more_jobs() > 0) {
+		    # Exponential back-on if jobs were started
+		    $sleep = $sleep/2+0.001;
+		}
+	    }
+	    # Exponential back-off sleeping
+	    $sleep = ::reap_usleep($sleep);
+	    $sleepsum += $sleep;
+	    if($sleepsum >= 1000) {
+		# At most do this every second
+		$sleepsum = 0;
+		changed_procs_file();
+		changed_sshloginfile();
+		start_more_jobs();
+	    }
+	}
+	if(not $Global::JobQueue->empty()) {
+	    # These jobs may not be started:
+	    # * because there the --filter-hosts has removed all
+	    if(not %Global::host) {
+		::error("There are no hosts left to run on.");
+		::wait_and_exit(255);
+	    }
+	    # * because of loadavg
+	    # * because of too little time between each ssh login.
+	    $sleep = ::reap_usleep($sleep);
+	    start_more_jobs();
+	    if($Global::max_jobs_running == 0) {
+		::warning("There are no job slots available. Increase --jobs.");
+	    }
+	}
+	while($opt::sqlmaster and not $Global::sql->finished()) {
+	    # SQL master
+	    $sleep = ::reap_usleep($sleep);
+	    start_more_jobs();
+	    if($Global::start_sqlworker) {
+		# Start an SQL worker as we are now sure there is work to do
+		$Global::start_sqlworker = 0;
+		if(my $pid = fork()) {
+		    $Global::unkilled_sqlworker = $pid;
+		} else {
+		    # Replace --sql/--sqlandworker with --sqlworker
+		    my @ARGV = (map { s/^--sql(andworker)?$/--sqlworker/; $_ }
+				@Global::options_in_argv);
+		    # exec the --sqlworker
+		    exec($0,@ARGV,@command);
+		}
+	    }
+	}
+    } while ($Global::total_running > 0
+	     or
+	     not $Global::start_no_new_jobs and not $Global::JobQueue->empty()
+	     or
+	     $opt::sqlmaster and not $Global::sql->finished());
+    if($opt::progress) {
+	my %progress = progress();
+	::status("\r".$progress{'status'});
+    }
+}
+
+sub toggle_progress() {
+    # Turn on/off progress view
+    # Uses:
+    #	$opt::progress
+    # Returns: N/A
+    $opt::progress = not $opt::progress;
+    if($opt::progress) {
+	::status_no_nl(init_progress());
+    }
+}
+
+sub progress() {
+    # Uses:
+    #	$opt::bar
+    #	$opt::eta
+    #	%Global::host
+    #	$Global::total_started
+    # Returns:
+    #	$workerlist = list of workers
+    #	$header = that will fit on the screen
+    #	$status = message that will fit on the screen
+    if($opt::bar) {
+	return ("workerlist" => "", "header" => "", "status" => bar());
+    }
+    my $eta = "";
+    my ($status,$header)=("","");
+    if($opt::eta) {
+	my($total, $completed, $left, $pctcomplete, $avgtime, $this_eta) =
+	    compute_eta();
+	$eta = sprintf("ETA: %ds Left: %d AVG: %.2fs  ",
+		       $this_eta, $left, $avgtime);
+    }
+    my $termcols = terminal_columns();
+    my @workers = sort keys %Global::host;
+    my %sshlogin = map { $_ eq ":" ? ($_ => "local") : ($_ => $_) } @workers;
+    my $workerno = 1;
+    my %workerno = map { ($_=>$workerno++) } @workers;
+    my $workerlist = "";
+    for my $w (@workers) {
+	$workerlist .=
+	$workerno{$w}.":".$sshlogin{$w} ." / ".
+	    ($Global::host{$w}->ncpus() || "-")." / ".
+	    $Global::host{$w}->max_jobs_running()."\n";
+    }
+    $status = "c"x($termcols+1);
+    # Select an output format that will fit on a single line
+    if(length $status > $termcols) {
+	# sshlogin1:XX/XX/XX%/XX.Xs s2:XX/XX/XX%/XX.Xs s3:XX/XX/XX%/XX.Xs
+	$header = "Computer:jobs running/jobs completed/".
+	    "%of started jobs/Average seconds to complete";
+	$status = $eta .
+	    join(" ",map
+		 {
+		     if($Global::total_started) {
+			 my $completed =
+			     ($Global::host{$_}->jobs_completed()||0);
+			 my $running = $Global::host{$_}->jobs_running();
+			 my $time = $completed ? (time-$^T)/($completed) : "0";
+			 sprintf("%s:%d/%d/%d%%/%.1fs ",
+				 $sshlogin{$_}, $running, $completed,
+				 ($running+$completed)*100
+				 / $Global::total_started, $time);
+		     }
+		 } @workers);
+    }
+    if(length $status > $termcols) {
+	# 1:XX/XX/XX%/X.Xs 2:XX/XX/XX%/X.Xs 3:XX/XX/XX%/X.Xs 4:XX/XX/XX%/X.Xs
+	$header = "Computer:jobs running/jobs completed/%of started jobs";
+	$status = $eta .
+	    join(" ",map
+		 {
+		     if($Global::total_started) {
+			 my $completed =
+			     ($Global::host{$_}->jobs_completed()||0);
+			 my $running = $Global::host{$_}->jobs_running();
+			 my $time = $completed ? (time-$^T)/($completed) : "0";
+			 sprintf("%s:%d/%d/%d%%/%.1fs ",
+				 $workerno{$_}, $running, $completed,
+				 ($running+$completed)*100
+				 / $Global::total_started, $time);
+		     }
+		 } @workers);
+    }
+    if(length $status > $termcols) {
+	# sshlogin1:XX/XX/XX% sshlogin2:XX/XX/XX% sshlogin3:XX/XX/XX%
+	$header = "Computer:jobs running/jobs completed/%of started jobs";
+	$status = $eta .
+	    join(" ",map
+		 {
+		     if($Global::total_started) {
+			 sprintf("%s:%d/%d/%d%%",
+				 $sshlogin{$_},
+				 $Global::host{$_}->jobs_running(),
+				 ($Global::host{$_}->jobs_completed()||0),
+				 ($Global::host{$_}->jobs_running()+
+				  ($Global::host{$_}->jobs_completed()||0))*100
+				 / $Global::total_started)
+		     }
+		 }
+		 @workers);
+    }
+    if(length $status > $termcols) {
+	# 1:XX/XX/XX% 2:XX/XX/XX% 3:XX/XX/XX% 4:XX/XX/XX% 5:XX/XX/XX%
+	$header = "Computer:jobs running/jobs completed/%of started jobs";
+	$status = $eta .
+	    join(" ",map
+		 {
+		     if($Global::total_started) {
+			 sprintf("%s:%d/%d/%d%%",
+				 $workerno{$_},
+				 $Global::host{$_}->jobs_running(),
+				 ($Global::host{$_}->jobs_completed()||0),
+				 ($Global::host{$_}->jobs_running()+
+				  ($Global::host{$_}->jobs_completed()||0))*100
+				 / $Global::total_started)
+		     }
+		 }
+		 @workers);
+    }
+    if(length $status > $termcols) {
+	# sshlogin1:XX/XX/XX% sshlogin2:XX/XX/XX% sshlogin3:XX/XX
+	$header = "Computer:jobs running/jobs completed";
+	$status = $eta .
+	    join(" ",
+		 map { sprintf("%s:%d/%d",
+			       $sshlogin{$_}, $Global::host{$_}->jobs_running(),
+			       ($Global::host{$_}->jobs_completed()||0)) }
+		 @workers);
+    }
+    if(length $status > $termcols) {
+	# sshlogin1:XX/XX sshlogin2:XX/XX sshlogin3:XX/XX sshlogin4:XX/XX
+	$header = "Computer:jobs running/jobs completed";
+	$status = $eta .
+	    join(" ",
+		 map { sprintf("%s:%d/%d",
+			       $sshlogin{$_}, $Global::host{$_}->jobs_running(),
+			       ($Global::host{$_}->jobs_completed()||0)) }
+		 @workers);
+    }
+    if(length $status > $termcols) {
+	# 1:XX/XX 2:XX/XX 3:XX/XX 4:XX/XX 5:XX/XX 6:XX/XX
+	$header = "Computer:jobs running/jobs completed";
+	$status = $eta .
+	    join(" ",
+		 map { sprintf("%s:%d/%d", $workerno{$_},
+			       $Global::host{$_}->jobs_running(),
+			       ($Global::host{$_}->jobs_completed()||0)) }
+		 @workers);
+    }
+    if(length $status > $termcols) {
+	# sshlogin1:XX sshlogin2:XX sshlogin3:XX sshlogin4:XX sshlogin5:XX
+	$header = "Computer:jobs completed";
+	$status = $eta .
+	    join(" ",
+		 map { sprintf("%s:%d", $sshlogin{$_},
+			       ($Global::host{$_}->jobs_completed()||0)) }
+		 @workers);
+    }
+    if(length $status > $termcols) {
+	# 1:XX 2:XX 3:XX 4:XX 5:XX 6:XX
+	$header = "Computer:jobs completed";
+	$status = $eta .
+	    join(" ",
+		 map { sprintf("%s:%d",
+			       $workerno{$_},
+			       ($Global::host{$_}->jobs_completed()||0)) }
+		 @workers);
+    }
+    return ("workerlist" => $workerlist, "header" => $header,
+	    "status" => $status);
+}
+
+{
+
+    my ($first_completed, $smoothed_avg_time, $last_eta);
+
+    sub compute_eta {
+	# Calculate important numbers for ETA
+	# Returns:
+	#   $total = number of jobs in total
+	#   $completed = number of jobs completed
+	#   $left = number of jobs left
+	#   $pctcomplete = percent of jobs completed
+	#   $avgtime = averaged time
+	#   $eta = smoothed eta
+	my $completed = $Global::total_completed;
+	# In rare cases with -X will $completed > total_jobs()
+	my $total = ::max($Global::JobQueue->total_jobs(),$completed);
+	my $left = $total - $completed;
+	if(not $completed) {
+	    return($total, $completed, $left, 0, 0, 0);
+	}
+	my $pctcomplete = ::min($completed / $total,100);
+	$first_completed ||= time;
+	my $timepassed = (time - $first_completed);
+	my $avgtime = $timepassed / $completed;
+	$smoothed_avg_time ||= $avgtime;
+	# Smooth the eta so it does not jump wildly
+	$smoothed_avg_time = (1 - $pctcomplete) * $smoothed_avg_time +
+	    $pctcomplete * $avgtime;
+	my $eta = int($left * $smoothed_avg_time);
+	if($eta*0.90 < $last_eta and $last_eta < $eta) {
+	    # Eta jumped less that 10% up: Keep the last eta instead
+	    $eta = $last_eta;
+	} else {
+	    $last_eta = $eta;
+	}
+	return($total, $completed, $left, $pctcomplete, $avgtime, $eta);
+    }
+}
+
+{
+    my ($rev,$reset);
+
+    sub bar() {
+	# Return:
+	#   $status = bar with eta, completed jobs, arg and pct
+	$rev ||= "\033[7m";
+	$reset ||= "\033[0m";
+	my($total, $completed, $left, $pctcomplete, $avgtime, $eta) =
+	    compute_eta();
+	my $arg = $Global::newest_job ?
+	    $Global::newest_job->{'commandline'}->
+	    replace_placeholders(["\257<\257>"],0,0) : "";
+	$arg = decode_utf8($arg);
+	my $eta_dhms = ::seconds_to_time_units($eta);
+	my $bar_text =
+	    sprintf("%d%% %d:%d=%s %s",
+		    $pctcomplete*100, $completed, $left, $eta_dhms, $arg);
+	my $terminal_width = terminal_columns();
+	my $s = sprintf("%-${terminal_width}s",
+			substr($bar_text." "x$terminal_width,
+			       0,$terminal_width));
+	my $width = int($terminal_width * $pctcomplete);
+	substr($s,$width,0) = $reset;
+	my $zenity = sprintf("%-${terminal_width}s",
+			     substr("#   $eta sec $arg",
+				    0,$terminal_width));
+	# Prefix with zenity header
+	$s = "\r" . $zenity . "\r" . $pctcomplete*100 .
+	    "\r" . $rev . $s . $reset;
+	return $s;
+    }
+}
+
+{
+    my ($rows,$columns,$last_update_time);
+
+    sub compute_terminal_size() {
+	# && true is to force spawning a shell and not just exec'ing
+	my @tput = qx{ tput lines cols </dev/tty 2>/dev/null && true };
+	$rows = 0 + $tput[0];
+	$columns = 0 + $tput[1];
+	if(not ($rows && $columns)) {
+	    # && true is to force spawning a shell and not just exec'ing
+	    my $stty = qx{ stty -a </dev/tty 2>/dev/null && true };
+	    # FreeBSD/OpenBSD/NetBSD/Dragonfly/MirOS
+	    # MacOSX/IRIX/AIX/Tru64
+	    $stty =~ /(\d+) columns/ and do { $columns = $1; };
+	    $stty =~ /(\d+) rows/ and do { $rows = $1; };
+	    # GNU/Linux/Solaris
+	    $stty =~ /columns (\d+)/ and do { $columns = $1; };
+	    $stty =~ /rows (\d+)/ and do { $rows = $1; };
+	    # Solaris-x86/HPUX/SCOsysV/UnixWare/OpenIndiana
+	    $stty =~ /columns = (\d+)/ and do { $columns = $1; };
+	    $stty =~ /rows = (\d+)/ and do { $rows = $1; };
+	    # QNX
+	    $stty =~ /rows=(\d+),(\d+)/ and do { ($rows,$columns) = ($1,$2); };
+	}
+	if(not ($rows && $columns)) {
+	    # && true is to force spawning a shell and not just exec'ing
+	    my $resize = qx{ resize 2>/dev/null && true };
+	    $resize =~ /COLUMNS=(\d+);/ and do { $columns ||= $1; };
+	    $resize =~ /LINES=(\d+);/ and do { $rows ||= $1; };
+	}
+	$rows ||= 24;
+	$columns ||= 80;
+    }
+
+    sub update_terminal_size() {
+	# Only update once per second.
+	if($last_update_time < time) {
+	    $last_update_time = time;
+	    compute_terminal_size();
+	    # Set signal WINdow CHange to force recompute
+	    $SIG{WINCH} = \&compute_terminal_size;
+	}
+    }
+
+    sub terminal_rows() {
+	# Get the number of rows of the terminal.
+	# Returns:
+	#   number of rows of the screen
+	update_terminal_size();
+	return $rows;
+    }
+
+    sub terminal_columns() {
+	# Get the number of columns of the terminal.
+	# Returns:
+	#   number of columns of the screen
+	update_terminal_size();
+	return $columns;
+    }
+}
+
+# Prototype forwarding
+sub get_job_with_sshlogin($);
+sub get_job_with_sshlogin($) {
+    # Input:
+    #	$sshlogin = which host should the job be run on?
+    # Uses:
+    #	$opt::hostgroups
+    #	$Global::JobQueue
+    # Returns:
+    #	$job = next job object for $sshlogin if any available
+    my $sshlogin = shift;
+    my $job;
+
+    if ($opt::hostgroups) {
+	my @other_hostgroup_jobs = ();
+
+	while($job = $Global::JobQueue->get()) {
+	    if($sshlogin->in_hostgroups($job->hostgroups())) {
+		# Found a job to be run on a hostgroup of this
+		# $sshlogin
+		last;
+	    } else {
+		# This job was not in the hostgroups of $sshlogin
+		push @other_hostgroup_jobs, $job;
+	    }
+	}
+	$Global::JobQueue->unget(@other_hostgroup_jobs);
+	if(not defined $job) {
+	    # No more jobs
+	    return undef;
+	}
+    } else {
+	$job = $Global::JobQueue->get();
+	if(not defined $job) {
+	    # No more jobs
+	    ::debug("start", "No more jobs: JobQueue empty\n");
+	    return undef;
+	}
+    }
+    if(not $job->suspended()) {
+	$job->set_sshlogin($sshlogin);
+    }
+    if(defined $opt::retries and $job->failed_here()) {
+	# This command with these args failed for this sshlogin
+	my ($no_of_failed_sshlogins,$min_failures) = $job->min_failed();
+	# Only look at the Global::host that have > 0 jobslots
+	if($no_of_failed_sshlogins ==
+	   grep { $_->max_jobs_running() > 0 } values %Global::host
+	   and $job->failed_here() == $min_failures) {
+	    # It failed the same or more times on another host:
+	    # run it on this host
+	} else {
+	    # If it failed fewer times on another host:
+	    # Find another job to run
+	    my $nextjob;
+	    if(not $Global::JobQueue->empty()) {
+		# This can potentially recurse for all args
+		no warnings 'recursion';
+		$nextjob = get_job_with_sshlogin($sshlogin);
+	    }
+	    # Push the command back on the queue
+	    $Global::JobQueue->unget($job);
+	    return $nextjob;
+	}
+    }
+    return $job;
+}
+
+
+sub __REMOTE_SSH__() {}
+
+
+sub read_sshloginfiles(@) {
+    # Read a list of --slf's
+    # Input:
+    #	@files = files or symbolic file names to read
+    # Returns: N/A
+    for my $s (@_) {
+	read_sshloginfile(expand_slf_shorthand($s));
+    }
+}
+
+sub expand_slf_shorthand($) {
+    # Expand --slf shorthand into a read file name
+    # Input:
+    #	$file = file or symbolic file name to read
+    # Returns:
+    #	$file = actual file name to read
+    my $file = shift;
+    if($file eq "-") {
+	# skip: It is stdin
+    } elsif($file eq "..") {
+	$file = $Global::config_dir."/sshloginfile";
+    } elsif($file eq ".") {
+	$file = "/etc/parallel/sshloginfile";
+    } elsif(not -r $file) {
+	for(@Global::config_dirs) {
+	    if(not -r $_."/".$file) {
+		# Try prepending $PARALLEL_HOME
+		::error("Cannot open $file.");
+		::wait_and_exit(255);
+	    } else {
+		$file = $_."/".$file;
+		last;
+	    }
+	}
+    }
+    return $file;
+}
+
+sub read_sshloginfile($) {
+    # Read sshloginfile into @Global::sshlogin
+    # Input:
+    #	$file = file to read
+    # Uses:
+    #	@Global::sshlogin
+    # Returns: N/A
+    local $/ = "\n";
+    my $file = shift;
+    my $close = 1;
+    my $in_fh;
+    ::debug("init","--slf ",$file);
+    if($file eq "-") {
+	$in_fh = *STDIN;
+	$close = 0;
+    } else {
+	if(not open($in_fh, "<", $file)) {
+	    # Try the filename
+	    ::error("Cannot open $file.");
+	    ::wait_and_exit(255);
+	}
+    }
+    while(<$in_fh>) {
+	chomp;
+	/^\s*#/ and next;
+	/^\s*$/ and next;
+	push @Global::sshlogin, $_;
+    }
+    if($close) {
+	close $in_fh;
+    }
+}
+
+sub parse_sshlogin() {
+    # Parse @Global::sshlogin into %Global::host.
+    # Keep only hosts that are in one of the given ssh hostgroups.
+    # Uses:
+    #	@Global::sshlogin
+    #	$Global::minimal_command_line_length
+    #	%Global::host
+    #	$opt::transfer
+    #	@opt::return
+    #	$opt::cleanup
+    #	@opt::basefile
+    #	@opt::trc
+    # Returns: N/A
+    my @login;
+    if(not @Global::sshlogin) { @Global::sshlogin = (":"); }
+    for my $sshlogin (@Global::sshlogin) {
+	# Split up -S sshlogin,sshlogin
+	# Parse ,, and \, as , but do not split on that
+	#   -S "ssh -J jump1,,jump2 host1,host2" =>
+	#     ssh -J jump1,jump2 host1
+	#     host2
+	# Protect \, and ,, as \0
+	$sshlogin =~ s/\\,|,,/\0/g;
+	for my $s (split /,|\n/, $sshlogin) {
+	    # Replace \0 => ,
+	    $s =~ s/\0/,/g;
+	    if ($s eq ".." or $s eq "-") {
+		# This may add to @Global::sshlogin - possibly bug
+		read_sshloginfile(expand_slf_shorthand($s));
+	    } else {
+		$s =~ s/\s*$//;
+		push (@login, $s);
+	    }
+	}
+    }
+    $Global::minimal_command_line_length = 100_000_000;
+    my @allowed_hostgroups;
+    for my $ncpu_sshlogin_string (::uniq(@login)) {
+	my $sshlogin = SSHLogin->new($ncpu_sshlogin_string);
+	my $sshlogin_string = $sshlogin->string();
+	if($sshlogin_string eq "") {
+	    # This is an ssh group: -S @webservers
+	    push @allowed_hostgroups, $sshlogin->hostgroups();
+	    next;
+	}
+	if($Global::host{$sshlogin_string}) {
+	    # This sshlogin has already been added:
+	    # It is probably a host that has come back
+	    # Set the max_jobs_running back to the original
+	    debug("run","Already seen $sshlogin_string\n");
+	    if($sshlogin->{'ncpus'}) {
+		# If ncpus set by '#/' of the sshlogin, overwrite it:
+		$Global::host{$sshlogin_string}->set_ncpus($sshlogin->ncpus());
+	    }
+	    $Global::host{$sshlogin_string}->set_max_jobs_running(undef);
+	    next;
+	}
+	$sshlogin->set_maxlength(Limits::Command::max_length());
+
+	$Global::minimal_command_line_length =
+	    ::min($Global::minimal_command_line_length, $sshlogin->maxlength());
+	$Global::host{$sshlogin_string} = $sshlogin;
+    }
+    $Global::usable_command_line_length =
+	# Usable len = maxlen - 3000 for wrapping, div 2 for hexing
+	int(($Global::minimal_command_line_length - 3000)/2);
+    if($opt::max_chars) {
+	if($opt::max_chars <= $Global::usable_command_line_length) {
+	    $Global::usable_command_line_length = $opt::max_chars;
+	} else {
+	    ::warning("Value for option -s should be < ".
+		      $Global::usable_command_line_length.".");
+	}
+    }
+    if(@allowed_hostgroups) {
+	# Remove hosts that are not in these groups
+	while (my ($string, $sshlogin) = each %Global::host) {
+	    if(not $sshlogin->in_hostgroups(@allowed_hostgroups)) {
+		delete $Global::host{$string};
+	    }
+	}
+    }
+
+    # debug("start", "sshlogin: ", my_dump(%Global::host),"\n");
+    if(@Global::transfer_files or @opt::return
+       or $opt::cleanup or @opt::basefile) {
+	if(not remote_hosts()) {
+	    # There are no remote hosts
+	    if(@opt::trc) {
+		::warning("--trc ignored as there are no remote --sshlogin.");
+	    } elsif (defined $opt::transfer) {
+		::warning("--transfer ignored as there are ".
+			  "no remote --sshlogin.");
+	    } elsif (@opt::transfer_files) {
+		::warning("--transferfile ignored as there ".
+			  "are no remote --sshlogin.");
+	    } elsif (@opt::return) {
+		::warning("--return ignored as there are no remote --sshlogin.");
+	    } elsif (defined $opt::cleanup and not %opt::template) {
+		::warning("--cleanup ignored as there ".
+			  "are no remote --sshlogin.");
+	    } elsif (@opt::basefile) {
+		::warning("--basefile ignored as there ".
+			  "are no remote --sshlogin.");
+	    }
+	}
+    }
+}
+
+sub remote_hosts() {
+    # Return sshlogins that are not ':'
+    # Uses:
+    #	%Global::host
+    # Returns:
+    #	list of sshlogins with ':' removed
+    return grep !/^:$/, keys %Global::host;
+}
+
+sub setup_basefile() {
+    # Transfer basefiles to each $sshlogin
+    # This needs to be done before first jobs on $sshlogin is run
+    # Uses:
+    #	%Global::host
+    #	@opt::basefile
+    # Returns: N/A
+    my @cmd;
+    my $rsync_destdir;
+    my $workdir;
+    for my $sshlogin (values %Global::host) {
+      if($sshlogin->local()) { next }
+      for my $file (@opt::basefile) {
+	if($file !~ m:^/: and $opt::workdir eq "...") {
+	  ::error("Work dir '...' will not work with relative basefiles.");
+	  ::wait_and_exit(255);
+	}
+	if(not $workdir) {
+	    my $dummycmdline =
+		CommandLine->new(1,["true"],{},0,0,[],[],[],[],{},{});
+	    my $dummyjob = Job->new($dummycmdline);
+	    $workdir = $dummyjob->workdir();
+	}
+	push @cmd, $sshlogin->rsync_transfer_cmd($file,$workdir);
+      }
+    }
+    debug("init", "basesetup: @cmd\n");
+    my ($exitstatus,$stdout_ref,$stderr_ref) =
+	run_gnu_parallel((join "\n",@cmd),"-j0","--retries",5);
+    if($exitstatus) {
+	my @stdout = @$stdout_ref;
+	my @stderr = @$stderr_ref;
+	::error("Copying of --basefile failed: @stdout@stderr");
+	::wait_and_exit(255);
+    }
+}
+
+sub cleanup_basefile() {
+    # Remove the basefiles transferred
+    # Uses:
+    #	%Global::host
+    #	@opt::basefile
+    # Returns: N/A
+    my @cmd;
+    my $workdir;
+    if(not $workdir) {
+	my $dummycmdline = CommandLine->new(1,["true"],{},0,0,[],[],[],[],{},{});
+	my $dummyjob = Job->new($dummycmdline);
+	$workdir = $dummyjob->workdir();
+    }
+    for my $sshlogin (values %Global::host) {
+	if($sshlogin->local()) { next }
+	for my $file (@opt::basefile) {
+	    push @cmd, $sshlogin->cleanup_cmd($file,$workdir);
+	}
+    }
+    debug("init", "basecleanup: @cmd\n");
+    my ($exitstatus,$stdout_ref,$stderr_ref) =
+	run_gnu_parallel(join("\n",@cmd),"-j0","--retries",5);
+    if($exitstatus) {
+	my @stdout = @$stdout_ref;
+	my @stderr = @$stderr_ref;
+	::error("Cleanup of --basefile failed: @stdout@stderr");
+	::wait_and_exit(255);
+    }
+}
+
+sub run_gnu_parallel() {
+    my ($stdin,@args) = @_;
+    my $cmd = join "",map { " $_ & " } split /\n/, $stdin;
+    print $Global::original_stderr ` $cmd wait` ;
+    return 0
+}
+
+sub _run_gnu_parallel() {
+    # Run GNU Parallel
+    # This should ideally just fork an internal copy
+    # and not start it through a shell
+    # Input:
+    #	$stdin = data to provide on stdin for GNU   Parallel
+    #	@args = command line arguments
+    # Returns:
+    #	$exitstatus = exitcode of GNU Parallel run
+    #	\@stdout = standard output
+    #	\@stderr = standard error
+    my ($stdin,@args) = @_;
+    my ($exitstatus,@stdout,@stderr);
+    my ($stdin_fh,$stdout_fh)=(gensym(),gensym());
+    my ($stderr_fh, $stderrname) = ::tmpfile(SUFFIX => ".par");
+    unlink $stderrname;
+
+    my $pid = ::open3($stdin_fh,$stdout_fh,$stderr_fh,
+		      $0,qw(--plain --shell /bin/sh --will-cite), @args);
+    if(my $writerpid = fork()) {
+	close $stdin_fh;
+	@stdout = <$stdout_fh>;
+	# Now stdout is closed:
+	# These pids should be dead or die very soon
+	while(kill 0, $writerpid) { ::usleep(1); }
+	die;
+#	reap $writerpid;
+#	while(kill 0, $pid) { ::usleep(1); }
+#	reap $writerpid;
+	$exitstatus = $?;
+	seek $stderr_fh, 0, 0;
+	@stderr = <$stderr_fh>;
+	close $stdout_fh;
+	close $stderr_fh;
+    } else {
+	close $stdout_fh;
+	close $stderr_fh;
+	print $stdin_fh $stdin;
+	close $stdin_fh;
+	exit(0);
+    }
+    return ($exitstatus,\@stdout,\@stderr);
+}
+
+sub filter_hosts() {
+    # Remove down --sshlogins from active duty.
+    # Find ncpus, ncores, maxlen, time-to-login for each host.
+    # Uses:
+    #	%Global::host
+    #	$Global::minimal_command_line_length
+    #	$opt::use_sockets_instead_of_threads
+    #	$opt::use_cores_instead_of_threads
+    #	$opt::use_cpus_instead_of_cores
+    # Returns: N/A
+
+    my ($nsockets_ref,$ncores_ref, $nthreads_ref, $time_to_login_ref,
+	$maxlen_ref, $echo_ref, $down_hosts_ref) =
+	parse_host_filtering(parallelized_host_filtering());
+
+    delete @Global::host{@$down_hosts_ref};
+    @$down_hosts_ref and ::warning("Removed @$down_hosts_ref.");
+
+    $Global::minimal_command_line_length = 100_000_000;
+    while (my ($string, $sshlogin) = each %Global::host) {
+	if($sshlogin->local()) { next }
+	my ($nsockets,$ncores,$nthreads,$time_to_login,$maxlen) =
+	    ($nsockets_ref->{$string},$ncores_ref->{$string},
+	     $nthreads_ref->{$string},$time_to_login_ref->{$string},
+	     $maxlen_ref->{$string});
+	defined $nsockets or ::die_bug("nsockets missing: $string");
+	defined $ncores or ::die_bug("ncores missing: $string");
+	defined $nthreads or ::die_bug("nthreads missing: $string");
+	defined $time_to_login or ::die_bug("time_to_login missing: $string");
+	defined $maxlen or ::die_bug("maxlen missing: $string");
+	# ncpus may be set by 4/hostname or may be undefined yet
+	my $ncpus = $sshlogin->{'ncpus'};
+	# $nthreads may be 0 if GNU Parallel is not installed remotely
+	$ncpus = $nthreads || $ncpus || $sshlogin->ncpus();
+	if($opt::use_cpus_instead_of_cores) {
+	    $ncpus = $ncores || $ncpus;
+	} elsif($opt::use_sockets_instead_of_threads) {
+	    $ncpus = $nsockets || $ncpus;
+	} elsif($opt::use_cores_instead_of_threads) {
+	    $ncpus = $ncores || $ncpus;
+	}
+	$sshlogin->set_ncpus($ncpus);
+	$sshlogin->set_time_to_login($time_to_login);
+	$maxlen = $maxlen || Limits::Command::max_length();
+	$sshlogin->set_maxlength($maxlen);
+	::debug("init", "Timing from -S:$string ",
+		" ncpus:", $ncpus,
+		" nsockets:",$nsockets,
+		" ncores:", $ncores,
+		" nthreads:",$nthreads,
+		" time_to_login:", $time_to_login,
+		" maxlen:", $maxlen,
+		" min_max_len:", $Global::minimal_command_line_length,"\n");
+    }
+}
+
+sub parse_host_filtering() {
+    # Input:
+    #	@lines = output from parallelized_host_filtering()
+    # Returns:
+    #	\%nsockets = number of sockets of {host}
+    #	\%ncores = number of cores of {host}
+    #	\%nthreads = number of hyperthreaded cores of {host}
+    #	\%time_to_login = time_to_login on {host}
+    #	\%maxlen = max command len on {host}
+    #	\%echo = echo received from {host}
+    #	\@down_hosts = list of hosts with no answer
+    local $/ = "\n";
+    my (%nsockets, %ncores, %nthreads, %time_to_login, %maxlen, %echo,
+	@down_hosts);
+    for (@_) {
+	::debug("init","Read: ",$_);
+	chomp;
+	my @col = split /\t/, $_;
+	if($col[0] =~ /^parallel: Warning:/) {
+	    # Timed out job: Ignore it
+	    next;
+	} elsif(defined $col[6]) {
+	    # This is a line from --joblog
+	    # seq host time spent sent received exit signal command
+	    # 2 : 1372607672.654 0.675 0 0 0 0 eval true\ m\;ssh\ m\ parallel\ --number-of-cores
+	    if($col[0] eq "Seq" and $col[1] eq "Host" and
+		    $col[2] eq "Starttime") {
+		# Header => skip
+		next;
+	    }
+	    # Get server from: eval true server\;
+	    $col[8] =~ /eval .?true.?\s([^\;]+);/ or
+		::die_bug("col8 does not contain host: $col[8] in $_");
+	    my $host = $1;
+	    $host =~ tr/\\//d;
+	    $Global::host{$host} or next;
+	    if($col[6] eq "255" or $col[6] eq "-1" or $col[6] eq "1") {
+		# exit == 255 or exit == timeout (-1): ssh failed/timedout
+		# exit == 1: lsh failed
+		# Remove sshlogin
+		::debug("init", "--filtered $host\n");
+		push(@down_hosts, $host);
+	    } elsif($col[6] eq "127") {
+		# signal == 127: parallel not installed remote
+		# Set nsockets, ncores, nthreads = 1
+		::warning("Could not figure out ".
+			  "number of cpus on $host. Using 1.");
+		$nsockets{$host} = 1;
+		$ncores{$host} = 1;
+		$nthreads{$host} = 1;
+		$maxlen{$host} = Limits::Command::max_length();
+	    } elsif($col[0] =~ /^\d+$/ and $Global::host{$host}) {
+		# Remember how log it took to log in
+		# 2 : 1372607672.654 0.675 0 0 0 0 eval true\ m\;ssh\ m\ echo
+		$time_to_login{$host} = ::min($time_to_login{$host},$col[3]);
+	    } else {
+		::die_bug("host check unmatched long jobline: $_");
+	    }
+	} elsif($Global::host{$col[0]}) {
+	    # This output from --number-of-cores, --number-of-cpus,
+	    # --max-line-length-allowed
+	    # ncores: server	   8
+	    # ncpus:  server	   2
+	    # maxlen: server	   131071
+	    if(/parallel: Warning: Cannot figure out number of/) {
+		next;
+	    }
+	    if(/\t(perl: warning:|LANGUAGE =|LC_ALL =|LANG =|are supported and installed|Disconnected from|Received disconnect from)/
+		    or
+		    /\tWarning: /
+		) {
+		# Skip these (from perl):
+		#   perl: warning: Setting locale failed.
+		#   perl: warning: Please check that your locale settings:
+		#   	  LANGUAGE = (unset),
+		#   	  LC_ALL = (unset),
+		#   	  LANG = "en_US.UTF-8"
+		#       are supported and installed on your system.
+		#   perl: warning: Falling back to the standard locale ("C").
+		#   Disconnected from 127.0.0.1 port 22
+		#
+		# Skip these (from ssh):
+		#   Warning: Permanently added * to the list of known hosts.
+		#   Warning: Identity file * not accessible: *
+	    } elsif(not defined $nsockets{$col[0]}) {
+		$nsockets{$col[0]} = $col[1];
+	    } elsif(not defined $ncores{$col[0]}) {
+		$ncores{$col[0]} = $col[1];
+	    } elsif(not defined $nthreads{$col[0]}) {
+		$nthreads{$col[0]} = $col[1];
+	    } elsif(not defined $maxlen{$col[0]}) {
+		$maxlen{$col[0]} = $col[1];
+	    } elsif(not defined $echo{$col[0]}) {
+		$echo{$col[0]} = $col[1];
+	    } else {
+		::die_bug("host check too many col0: $_");
+	    }
+	} else {
+	    ::die_bug("host check unmatched short jobline ($col[0]): $_");
+	}
+    }
+    @down_hosts = uniq(@down_hosts);
+    return(\%nsockets, \%ncores, \%nthreads, \%time_to_login,
+	   \%maxlen, \%echo, \@down_hosts);
+}
+
+sub parallelized_host_filtering() {
+    # Uses:
+    #	%Global::host
+    # Returns:
+    #	text entries with:
+    #	* joblog line
+    #	* hostname \t number of cores
+    #	* hostname \t number of cpus
+    #	* hostname \t max-line-length-allowed
+    #	* hostname \t empty
+
+    sub sshwrapped {
+	# Wrap with ssh and --env
+	# Return $default_value if command fails
+	my $sshlogin = shift;
+	my $command = shift;
+	# wrapper that returns output "0\n" if the command fails
+	# E.g. parallel not installed => "0\n"
+	my $wcmd = q(perl -e '$a=`).$command.q(`; print $? ? "0".v010 : $a');
+	my $commandline = CommandLine->new(1,[$wcmd],{},0,0,[],[],[],[],{},{});
+	my $job = Job->new($commandline);
+	$job->set_sshlogin($sshlogin);
+	$job->wrapped();
+	return($job->{'wrapped'});
+    }
+
+    my(@sockets, @cores, @threads, @maxline, @echo);
+    while (my ($host, $sshlogin) = each %Global::host) {
+	if($host eq ":") { next }
+	# The 'true' is used to get the $host out later
+	push(@sockets, $host."\t"."true $host; ".
+	     sshwrapped($sshlogin,"parallel --number-of-sockets")."\n\0");
+	push(@cores, $host."\t"."true $host; ".
+	     sshwrapped($sshlogin,"parallel --number-of-cores")."\n\0");
+	push(@threads, $host."\t"."true $host; ".
+	     sshwrapped($sshlogin,"parallel --number-of-threads")."\n\0");
+	push(@maxline, $host."\t"."true $host; ".
+	     sshwrapped($sshlogin,
+			"parallel --max-line-length-allowed")."\n\0");
+	# 'echo' is used to get the fastest possible ssh login time
+	push(@echo, $host."\t"."true $host; ".
+	     $sshlogin->wrap("echo $host")."\n\0");
+    }
+    # --timeout 10: Setting up an SSH connection and running a simple
+    #		    command should never take > 10 sec.
+    # --delay 0.1:  If multiple sshlogins use the same proxy the delay
+    #		    will make it less likely to overload the ssh daemon.
+    # --retries 3:  If the ssh daemon is overloaded, try 3 times
+    my $cmd =
+	"$0 -j0 --timeout 10 --joblog - --plain --delay 0.1 --retries 3 ".
+	"--tag --tagstring '{1}' -0 --colsep '\t' -k eval '{2}' && true ";
+    $cmd = $Global::shell." -c ".Q($cmd);
+    ::debug("init", $cmd, "\n");
+    my @out;
+    my $prepend = "";
+
+    my ($host_fh,$in,$err);
+    open3($in, $host_fh, $err, $cmd) || ::die_bug("parallel host check: $cmd");
+    ::debug("init", map { $_,"\n" } @sockets, @cores, @threads, @maxline, @echo);
+
+    if(not fork()) {
+	# Give the commands to run to the $cmd
+	close $host_fh;
+	print $in @sockets, @cores, @threads, @maxline, @echo;
+	close $in;
+	exit();
+    }
+    close $in;
+    # If -0: $/ must be \n
+    local $/ = "\n";
+    for(<$host_fh>) {
+	# TODO incompatible with '-quoting. Needs to be fixed differently
+	#if(/\'$/) {
+	#    # if last char = ' then append next line
+	#    # This may be due to quoting of \n in environment var
+	#    $prepend .= $_;
+	#    next;
+	#}
+	$_ = $prepend . $_;
+	$prepend = "";
+	push @out, $_;
+    }
+    close $host_fh;
+    return @out;
+}
+
+sub onall($@) {
+    # Runs @command on all hosts.
+    # Uses parallel to run @command on each host.
+    # --jobs = number of hosts to run on simultaneously.
+    # For each host a parallel command with the args will be running.
+    # Uses:
+    #	$Global::debug
+    #	$Global::exitstatus
+    #	$Global::joblog
+    #	$Global::quoting
+    #	$opt::D
+    #	$opt::arg_file_sep
+    #	$opt::arg_sep
+    #	$opt::colsep
+    #	$opt::files
+    #	$opt::group
+    #	$opt::joblog
+    #	$opt::jobs
+    #	$opt::keeporder
+    #	$opt::linebuffer
+    #	$opt::max_chars
+    #	$opt::plain
+    #	$opt::retries
+    #	$opt::tag
+    #	$opt::tee
+    #	$opt::timeout
+    #	$opt::ungroup
+    #	%Global::host
+    #	@opt::basefile
+    #	@opt::env
+    #	@opt::v
+    # Input:
+    #	@command = command to run on all hosts
+    # Returns: N/A
+    sub tmp_joblog {
+	# Input:
+	#   $joblog = filename of joblog - undef if none
+	# Returns:
+	#   $tmpfile = temp file for joblog - undef if none
+	my $joblog = shift;
+	if(not defined $joblog) {
+	    return undef;
+	}
+	my ($fh, $tmpfile) = ::tmpfile(SUFFIX => ".log");
+	close $fh;
+	return $tmpfile;
+    }
+    my ($input_source_fh_ref,@command) = @_;
+    if($Global::quoting) {
+       @command = shell_quote(@command);
+    }
+
+    # Copy all @input_source_fh (-a and :::) into tempfiles
+    my @argfiles = ();
+    for my $fh (@$input_source_fh_ref) {
+	my ($outfh, $name) = ::tmpfile(SUFFIX => ".all", UNLINK => not $opt::D);
+	print $outfh (<$fh>);
+	close $outfh;
+	push @argfiles, $name;
+    }
+    if(@opt::basefile) { setup_basefile(); }
+    # for each sshlogin do:
+    # parallel -S $sshlogin $command :::: @argfiles
+    #
+    # Pass some of the options to the sub-parallels, not all of them as
+    # -P should only go to the first, and -S should not be copied at all.
+    my $options =
+	join(" ",
+	     ((defined $opt::sshdelay) ? "--delay ".$opt::sshdelay : ""),
+	     ((defined $opt::memfree) ? "--memfree ".$opt::memfree : ""),
+	     ((defined $opt::memsuspend) ? "--memfree ".$opt::memsuspend : ""),
+	     ((defined $opt::D) ? "-D $opt::D" : ""),
+	     ((defined $opt::group) ? "--group" : ""),
+	     ((defined $opt::jobs) ? "-P $opt::jobs" : ""),
+	     ((defined $opt::keeporder) ? "--keeporder" : ""),
+	     ((defined $opt::linebuffer) ? "--linebuffer" : ""),
+	     ((defined $opt::max_chars) ? "--max-chars ".$opt::max_chars : ""),
+	     ((defined $opt::plain) ? "--plain" : ""),
+	     (($opt::ungroup == 1) ? "-u" : ""),
+	     ((defined $opt::tee) ? "--tee" : ""),
+	);
+    my $suboptions =
+	join(" ",
+	     ((defined $opt::sshdelay) ? "--delay ".$opt::sshdelay : ""),
+	     ((defined $opt::D) ? "-D $opt::D" : ""),
+	     ((defined $opt::arg_file_sep) ? "--arg-file-sep ".$opt::arg_file_sep : ""),
+	     ((defined $opt::arg_sep) ? "--arg-sep ".$opt::arg_sep : ""),
+	     ((defined $opt::colsep) ? "--colsep ".shell_quote($opt::colsep) : ""),
+	     ((defined $opt::files) ? "--files" : ""),
+	     ((defined $opt::group) ? "--group" : ""),
+	     ((defined $opt::cleanup) ? "--cleanup" : ""),
+	     ((defined $opt::keeporder) ? "--keeporder" : ""),
+	     ((defined $opt::linebuffer) ? "--linebuffer" : ""),
+	     ((defined $opt::max_chars) ? "--max-chars ".$opt::max_chars : ""),
+	     ((defined $opt::plain) ? "--plain" : ""),
+	     ((defined $opt::plus) ? "--plus" : ""),
+	     ((defined $opt::retries) ? "--retries ".$opt::retries : ""),
+	     ((defined $opt::timeout) ? "--timeout ".$opt::timeout : ""),
+	     (($opt::ungroup == 1) ? "-u" : ""),
+	     ((defined $opt::ssh) ? "--ssh '".$opt::ssh."'" : ""),
+	     ((defined $opt::tee) ? "--tee" : ""),
+	     ((defined $opt::workdir) ? "--wd ".Q($opt::workdir) : ""),
+	     (@Global::transfer_files ? map { "--tf ".Q($_) }
+	      @Global::transfer_files : ""),
+	     (@Global::ret_files ? map { "--return ".Q($_) }
+	      @Global::ret_files : ""),
+	     (@opt::env ? map { "--env ".Q($_) } @opt::env : ""),
+	     (map { "-v" } @opt::v),
+	);
+    ::debug("init", "| $0 $options\n");
+    open(my $parallel_fh, "|-", "$0 -0 --will-cite -j0 $options") ||
+	::die_bug("This does not run GNU Parallel: $0 $options");
+    my @joblogs;
+    for my $host (sort keys %Global::host) {
+	my $sshlogin = $Global::host{$host};
+	my $joblog = tmp_joblog($opt::joblog);
+	if($joblog) {
+	    push @joblogs, $joblog;
+	    $joblog = "--joblog $joblog";
+	}
+	my $quad = $opt::arg_file_sep || "::::";
+	# If PARALLEL_ENV is set: Pass it on
+	my $penv=$Global::parallel_env ?
+	    "PARALLEL_ENV=".Q($Global::parallel_env) :
+	    '';
+	::debug("init", "$penv $0 $suboptions -j1 $joblog ",
+	    ((defined $opt::tag) ?
+	     "--tagstring ".Q($sshlogin->string()) : ""),
+	     " -S ", Q($sshlogin->string())," ",
+	     join(" ",shell_quote(@command))," $quad @argfiles\n");
+	print $parallel_fh "$penv $0 $suboptions -j1 $joblog ",
+	    ((defined $opt::tag) ?
+	     "--tagstring ".Q($sshlogin->string()) : ""),
+	     " -S ", Q($sshlogin->string())," ",
+	     join(" ",shell_quote(@command))," $quad @argfiles\0";
+    }
+    close $parallel_fh;
+    $Global::exitstatus = $? >> 8;
+    debug("init", "--onall exitvalue ", $?);
+    if(@opt::basefile and $opt::cleanup) { cleanup_basefile(); }
+    $Global::debug or unlink(@argfiles);
+    my %seen;
+    for my $joblog (@joblogs) {
+	# Append to $joblog
+	open(my $fh, "<", $joblog) ||
+	    ::die_bug("Cannot open tmp joblog $joblog");
+	# Skip first line (header);
+	<$fh>;
+	print $Global::joblog (<$fh>);
+	close $fh;
+	unlink($joblog);
+    }
+}
+
+
+sub __SIGNAL_HANDLING__() {}
+
+
+sub sigtstp() {
+    # Send TSTP signal (Ctrl-Z) to all children process groups
+    # Uses:
+    #	%SIG
+    # Returns: N/A
+    signal_children("TSTP");
+}
+
+sub sigpipe() {
+    # Send SIGPIPE signal to all children process groups
+    # Uses:
+    #	%SIG
+    # Returns: N/A
+    signal_children("PIPE");
+}
+
+sub signal_children() {
+    # Send signal to all children process groups
+    # and GNU	Parallel itself
+    # Uses:
+    #	%SIG
+    # Returns: N/A
+    my $signal = shift;
+    debug("run", "Sending $signal ");
+    kill $signal, map { -$_ } keys %Global::running;
+    # Use default signal handler for GNU Parallel itself
+    $SIG{$signal} = undef;
+    kill $signal, $$;
+}
+
+sub save_original_signal_handler() {
+    # Remember the original signal handler
+    # Uses:
+    #	%Global::original_sig
+    # Returns: N/A
+    $SIG{INT} = sub {
+	if($opt::tmux) { ::qqx("tmux kill-session -t p$$"); }
+	wait_and_exit(255);
+    };
+    $SIG{TERM} = sub {
+	if($opt::tmux) { ::qqx("tmux kill-session -t p$$"); }
+	wait_and_exit(255);
+    };
+    %Global::original_sig = %SIG;
+    $SIG{TERM} = sub {}; # Dummy until jobs really start
+    $SIG{ALRM} = 'IGNORE';
+    # Allow Ctrl-Z to suspend and `fg` to continue
+    $SIG{TSTP} = \&sigtstp;
+    $SIG{PIPE} = \&sigpipe;
+    $SIG{CONT} = sub {
+	# Set $SIG{TSTP} again (it is undef'ed in sigtstp() )
+	$SIG{TSTP} = \&sigtstp;
+	for my $job (values %Global::running) {
+	    if($job->suspended()) {
+		# Force jobs to suspend, if they are marked as suspended.
+		# --memsupspend can suspend a job that will be resumed
+		# if the user presses CTRL-Z followed by `fg`.
+		$job->suspend();
+	    } else {
+		# Resume the rest of the jobs
+		$job->resume();
+	    }
+	}
+    };
+}
+
+sub list_running_jobs() {
+    # Print running jobs on tty
+    # Uses:
+    #	%Global::running
+    # Returns: N/A
+    for my $job (values %Global::running) {
+	::status("$Global::progname: ".$job->replaced());
+    }
+}
+
+sub start_no_new_jobs() {
+    # Start no more jobs
+    # Uses:
+    #	 %Global::original_sig
+    #	 %Global::unlink
+    #	 $Global::start_no_new_jobs
+    # Returns: N/A
+    unlink keys %Global::unlink;
+    ::status
+	("$Global::progname: SIGHUP received. No new jobs will be started.",
+	 "$Global::progname: Waiting for these ".(keys %Global::running).
+	 " jobs to finish. Send SIGTERM to stop now.");
+    list_running_jobs();
+    $Global::start_no_new_jobs ||= 1;
+}
+
+sub reapers() {
+    # Run reaper until there are no more left
+    # Returns:
+    #	@pids_reaped = pids of reaped processes
+    my @pids_reaped;
+    my $pid;
+    while($pid = reaper()) {
+	push @pids_reaped, $pid;
+    }
+    return @pids_reaped;
+}
+
+sub reaper() {
+    # A job finished:
+    # * Set exitstatus, exitsignal, endtime.
+    # * Free ressources for new job
+    # * Update median runtime
+    # * Print output
+    # * If --halt = now: Kill children
+    # * Print progress
+    # Uses:
+    #	%Global::running
+    #	$opt::timeout
+    #	$Global::timeoutq
+    #	$opt::keeporder
+    #	$Global::total_running
+    # Returns:
+    #	$stiff = PID of child finished
+    my $stiff;
+    debug("run", "Reaper ");
+    if(($stiff = waitpid(-1, &WNOHANG)) <= 0) {
+	# No jobs waiting to be reaped
+	return 0;
+    }
+
+    # $stiff = pid of dead process
+    my $job = $Global::running{$stiff};
+
+    # '-a <(seq 10)' will give us a pid not in %Global::running
+    # The same will one of the ssh -M: ignore
+    $job or return 0;
+    delete $Global::running{$stiff};
+    $Global::total_running--;
+    if($job->{'commandline'}{'skip'}) {
+	# $job->skip() was called
+	$job->set_exitstatus(-2);
+	$job->set_exitsignal(0);
+    } else {
+	$job->set_exitstatus($? >> 8);
+	$job->set_exitsignal($? & 127);
+    }
+
+    debug("run", "\nseq ",$job->seq()," died (", $job->exitstatus(), ")");
+    if($Global::delayauto or $Global::sshdelayauto) {
+	if($job->exitstatus()) {
+	    # Job failed: Increase delay (if $opt::(ssh)delay set)
+	    $opt::delay &&= $opt::delay * 1.3;
+	    $opt::sshdelay &&= $opt::sshdelay * 1.3;
+	} else {
+	    # Job succeeded: Decrease delay (if $opt::(ssh)delay set)
+	    $opt::delay &&= $opt::delay * 0.9;
+	    $opt::sshdelay &&= $opt::sshdelay * 0.9;
+	}
+	debug("run", "delay:$opt::delay ssh:$opt::sshdelay ");
+    }
+    $job->set_endtime(::now());
+    my $sshlogin = $job->sshlogin();
+    $sshlogin->dec_jobs_running();
+    if($job->should_be_retried()) {
+	# Free up file handles
+	$job->free_ressources();
+    } else {
+	# The job is done
+	$sshlogin->inc_jobs_completed();
+	# Free the jobslot
+	$job->free_slot();
+	if($opt::timeout and not $job->exitstatus()) {
+	    # Update average runtime for timeout only for successful jobs
+	    $Global::timeoutq->update_median_runtime($job->runtime());
+	}
+	if($opt::keeporder and not $opt::latestline) {
+	    # --latestline fixes --keeporder in Job::row()
+	    $job->print_earlier_jobs();
+	} else {
+	    $job->print();
+	}
+	if($job->should_we_halt() eq "now") {
+	    # Kill children
+	    ::kill_sleep_seq($job->pid());
+	    ::killall();
+	    ::wait_and_exit($Global::halt_exitstatus);
+	}
+    }
+    $job->cleanup();
+
+    if($opt::progress) {
+	my %progress = progress();
+	::status_no_nl("\r",$progress{'status'});
+    }
+
+    debug("run", "jobdone \n");
+    return $stiff;
+}
+
+
+sub __USAGE__() {}
+
+
+sub killall() {
+    # Kill all jobs by killing their process groups
+    # Uses:
+    #	$Global::start_no_new_jobs = we are stopping
+    #	$Global::killall = Flag to not run reaper
+    $Global::start_no_new_jobs ||= 1;
+    # Do not reap killed children: Ignore them instead
+    $Global::killall ||= 1;
+    kill_sleep_seq(keys %Global::running);
+}
+
+sub kill_sleep_seq(@) {
+    # Send jobs TERM,TERM,KILL to processgroups
+    # Input:
+    #	@pids = list of pids that are also processgroups
+    # Convert pids to process groups ($processgroup = -$pid)
+    my @pgrps = map { -$_ } @_;
+    my @term_seq = split/,/,$opt::termseq;
+    if(not @term_seq) {
+	@term_seq = ("TERM",200,"TERM",100,"TERM",50,"KILL",25);
+    }
+    # for each signal+waittime: kill process groups still not dead
+    while(@term_seq) {
+	@pgrps = kill_sleep(shift @term_seq, shift @term_seq, @pgrps);
+    }
+}
+
+sub kill_sleep() {
+    # Kill pids with a signal and wait a while for them to die
+    # Input:
+    #	$signal = signal to send to @pids
+    #	$sleep_max = number of ms to sleep at most before returning
+    #	@pids = pids to kill (actually process groups)
+    # Uses:
+    #	$Global::killall = set by killall() to avoid calling reaper
+    # Returns:
+    #	@pids = pids still alive
+    my ($signal, $sleep_max, @pids) = @_;
+    ::debug("kill","kill_sleep $signal ",(join " ",sort @pids),"\n");
+    kill $signal, @pids;
+    my $sleepsum = 0;
+    my $sleep = 0.001;
+
+    while(@pids and $sleepsum < $sleep_max) {
+	if($Global::killall) {
+	    # Killall => don't run reaper
+	    while(waitpid(-1, &WNOHANG) > 0) {
+		$sleep = $sleep/2+0.001;
+	    }
+	} elsif(reapers()) {
+	    $sleep = $sleep/2+0.001;
+	}
+	$sleep *= 1.1;
+	::usleep($sleep);
+	$sleepsum += $sleep;
+	# Keep only living children
+	@pids = grep { kill(0, $_) } @pids;
+    }
+    return @pids;
+}
+
+sub wait_and_exit($) {
+    # If we do not wait, we sometimes get segfault
+    # Returns: N/A
+    my $error = shift;
+    unlink keys %Global::unlink;
+    if($error) {
+	# Kill all jobs without printing
+	killall();
+    }
+    for (keys %Global::unkilled_children) {
+	# Kill any (non-jobs) children (e.g. reserved processes)
+	kill 9, $_;
+	waitpid($_,0);
+	delete $Global::unkilled_children{$_};
+    }
+    if($Global::unkilled_sqlworker) {
+	waitpid($Global::unkilled_sqlworker,0);
+    }
+    # Avoid: Warning: unable to close filehandle properly: No space
+    #	     left on device during global destruction.
+    $SIG{__WARN__} = sub {};
+    if($opt::_parset) {
+	# Make the shell script return $error
+	print "$Global::parset_endstring\nreturn $error";
+    }
+    exit($error);
+}
+
+sub die_usage() {
+    # Returns: N/A
+    usage();
+    wait_and_exit(255);
+}
+
+sub usage() {
+    # Returns: N/A
+    print join
+	("\n",
+	 "Usage:",
+	 "",
+	 "$Global::progname [options] [command [arguments]] < list_of_arguments",
+	 "$Global::progname [options] [command [arguments]] (::: arguments|:::: argfile(s))...",
+	 "cat ... | $Global::progname --pipe [options] [command [arguments]]",
+	 "",
+	 "-j n            Run n jobs in parallel",
+	 "-k              Keep same order",
+	 "-X              Multiple arguments with context replace",
+	 "--colsep regexp Split input on regexp for positional replacements",
+	 "{} {.} {/} {/.} {#} {%} {= perl code =} Replacement strings",
+	 "{3} {3.} {3/} {3/.} {=3 perl code =}    Positional replacement strings",
+	 "With --plus:    {} = {+/}/{/} = {.}.{+.} = {+/}/{/.}.{+.} = {..}.{+..} =",
+	 "                {+/}/{/..}.{+..} = {...}.{+...} = {+/}/{/...}.{+...}",
+	 "",
+	 "-S sshlogin     Example: foo\@server.example.com",
+	 "--slf ..        Use ~/.parallel/sshloginfile as the list of sshlogins",
+	 "--trc {}.bar    Shorthand for --transfer --return {}.bar --cleanup",
+	 "--onall         Run the given command with argument on all sshlogins",
+	 "--nonall        Run the given command with no arguments on all sshlogins",
+	 "",
+	 "--pipe          Split stdin (standard input) to multiple jobs.",
+	 "--recend str    Record end separator for --pipe.",
+	 "--recstart str  Record start separator for --pipe.",
+	 "",
+	 "GNU Parallel can do much more. See 'man $Global::progname' for details",
+	 "",
+	 "Academic tradition requires you to cite works you base your article on.",
+	 "If you use programs that use GNU Parallel to process data for an article in a",
+	 "scientific publication, please cite:",
+	 "",
+	 "  Tange, O. (2022, November 22). GNU Parallel 20221122 ('Херсо́н').",
+	 "  Zenodo. https://doi.org/10.5281/zenodo.7347980",
+	 "",
+	 # Before changing these lines,	 please read
+	 # https://www.gnu.org/software/parallel/parallel_design.html#citation-notice
+	 # https://git.savannah.gnu.org/cgit/parallel.git/tree/doc/citation-notice-faq.txt
+	 # You accept to be put in a public hall of shame by removing
+	 # these lines.
+	 "This helps funding further development; AND IT WON'T COST YOU A CENT.",
+	 "If you pay 10000 EUR you should feel free to use GNU Parallel without citing.",
+	 "",
+	 "",);
+}
+
+sub citation_notice() {
+    # if --will-cite or --plain: do nothing
+    # if stderr redirected: do nothing
+    # if $PARALLEL_HOME/will-cite: do nothing
+    # else: print citation notice to stderr
+    if($opt::willcite
+       or
+       $opt::plain
+       or
+       not -t $Global::original_stderr
+       or
+       grep { -e "$_/will-cite" } @Global::config_dirs) {
+	# skip
+    } else {
+	::status
+	    ("Academic tradition requires you to cite works you base your article on.",
+	     "If you use programs that use GNU Parallel to process data for an article in a",
+	     "scientific publication, please cite:",
+	     "",
+	     "  Tange, O. (2022, November 22). GNU Parallel 20221122 ('Херсо́н').",
+	     "  Zenodo. https://doi.org/10.5281/zenodo.7347980",
+	     "",
+	     # Before changing these line,  please read
+	     # https://www.gnu.org/software/parallel/parallel_design.html#citation-notice and
+	     # https://git.savannah.gnu.org/cgit/parallel.git/tree/doc/citation-notice-faq.txt
+	     # You accept to be put in a public hall of shame by
+	     # removing these lines.
+	     "This helps funding further development; AND IT WON'T COST YOU A CENT.",
+	     "If you pay 10000 EUR you should feel free to use GNU Parallel without citing.",
+	     "",
+	     "More about funding GNU Parallel and the citation notice:",
+	     "https://www.gnu.org/software/parallel/parallel_design.html#citation-notice",
+	     "",
+	     "To silence this citation notice: run 'parallel --citation' once.",
+	     ""
+	    );
+	mkdir $Global::config_dir;
+	# Number of times the user has run GNU Parallel without showing
+	# willingness to cite
+	my $runs = 0;
+	if(open (my $fh, "<", $Global::config_dir.
+		 "/runs-without-willing-to-cite")) {
+	    $runs = <$fh>;
+	    close $fh;
+	}
+	$runs++;
+	if(open (my $fh, ">", $Global::config_dir.
+		 "/runs-without-willing-to-cite")) {
+	    print $fh $runs;
+	    close $fh;
+	    if($runs >= 10) {
+		::status("Come on: You have run parallel $runs times. ".
+			 "Isn't it about time ",
+			 "you run 'parallel --citation' once to silence ".
+			 "the citation notice?",
+			 "");
+	    }
+	}
+    }
+}
+
+sub status(@) {
+    my @w = @_;
+    my $fh = $Global::status_fd || *STDERR;
+    print $fh map { ($_, "\n") } @w;
+    flush $fh;
+}
+
+sub status_no_nl(@) {
+    my @w = @_;
+    my $fh = $Global::status_fd || *STDERR;
+    print $fh @w;
+    flush $fh;
+}
+
+sub warning(@) {
+    my @w = @_;
+    my $prog = $Global::progname || "parallel";
+    status_no_nl(map { ($prog, ": Warning: ", $_, "\n"); } @w);
+}
+
+{
+    my %warnings;
+    sub warning_once(@) {
+	my @w = @_;
+	my $prog = $Global::progname || "parallel";
+	$warnings{@w}++ or
+	    status_no_nl(map { ($prog, ": Warning: ", $_, "\n"); } @w);
+    }
+}
+
+sub error(@) {
+    my @w = @_;
+    my $prog = $Global::progname || "parallel";
+    status(map { ($prog.": Error: ". $_); } @w);
+}
+
+sub die_bug($) {
+    my $bugid = shift;
+    print STDERR
+	("$Global::progname: This should not happen. You have found a bug. ",
+	 "Please follow\n",
+	 "https://www.gnu.org/software/parallel/man.html#reporting-bugs\n",
+	 "\n",
+	 "Include this in the report:\n",
+	 "* The version number: $Global::version\n",
+	 "* The bugid: $bugid\n",
+	 "* The command line being run\n",
+	 "* The files being read (put the files on a webserver if they are big)\n",
+	 "\n",
+	 "If you get the error on smaller/fewer files, please include those instead.\n");
+    ::wait_and_exit(255);
+}
+
+sub version() {
+    # Returns: N/A
+    print join
+	("\n",
+	 "GNU $Global::progname $Global::version",
+	 "Copyright (C) 2007-2022 Ole Tange, http://ole.tange.dk and Free Software",
+	 "Foundation, Inc.",
+	 "License GPLv3+: GNU GPL version 3 or later <https://gnu.org/licenses/gpl.html>",
+	 "This is free software: you are free to change and redistribute it.",
+	 "GNU $Global::progname comes with no warranty.",
+	 "",
+	 "Web site: https://www.gnu.org/software/${Global::progname}\n",
+	 "When using programs that use GNU Parallel to process data for publication",
+	 "please cite as described in 'parallel --citation'.\n",
+	);
+}
+
+sub citation() {
+    # Returns: N/A
+    my ($all_argv_ref,$argv_options_removed_ref) = @_;
+    my $all_argv = "@$all_argv_ref";
+    my $no_opts = "@$argv_options_removed_ref";
+    $all_argv=~s/--citation//;
+    if($all_argv ne $no_opts) {
+	::warning("--citation ignores all other options and arguments.");
+	::status("");
+    }
+
+    ::status(
+	"Academic tradition requires you to cite works you base your article on.",
+	"If you use programs that use GNU Parallel to process data for an article in a",
+	"scientific publication, please cite:",
+	"",
+	"\@software{tange_2022_7347980,",
+	"      author       = {Tange, Ole},",
+	"      title        = {GNU Parallel 20221122 ('Херсо́н')},",
+	"      month        = Nov,",
+	"      year         = 2022,",
+	"      note         = {{GNU Parallel is a general parallelizer to run",
+	"                       multiple serial command line programs in parallel",
+	"                       without changing them.}},",
+	"      publisher    = {Zenodo},",
+	"      doi          = {10.5281/zenodo.7347980},",
+	"      url          = {https://doi.org/10.5281/zenodo.7347980}",
+	"}",
+	"",
+	"(Feel free to use \\nocite{tange_2022_7347980})",
+	"",
+	# Before changing these lines, please read
+	# https://www.gnu.org/software/parallel/parallel_design.html#citation-notice and
+	# https://git.savannah.gnu.org/cgit/parallel.git/tree/doc/citation-notice-faq.txt
+	# You accept to be put in a public hall of shame by removing
+	# these lines.
+	"This helps funding further development; AND IT WON'T COST YOU A CENT.",
+	"If you pay 10000 EUR you should feel free to use GNU Parallel without citing.",
+	"",
+	"More about funding GNU Parallel and the citation notice:",
+	"https://lists.gnu.org/archive/html/parallel/2013-11/msg00006.html",
+	"https://www.gnu.org/software/parallel/parallel_design.html#citation-notice",
+	"https://git.savannah.gnu.org/cgit/parallel.git/tree/doc/citation-notice-faq.txt",
+	"",
+	"If you send a copy of your published article to tange\@gnu.org, it will be",
+	"mentioned in the release notes of next version of GNU Parallel.",
+	""
+	);
+    while(not grep { -e "$_/will-cite" } @Global::config_dirs) {
+	print "\nType: 'will cite' and press enter.\n> ";
+	my $input = <STDIN>;
+	if(not defined $input) {
+	    exit(255);
+	}
+	if($input =~ /will cite/i) {
+	    mkdir $Global::config_dir;
+	    if(open (my $fh, ">", $Global::config_dir."/will-cite")) {
+		close $fh;
+		::status(
+		    "",
+		    "Thank you for your support: You are the reason why there is funding to",
+		    "continue maintaining GNU Parallel. On behalf of future versions of",
+		    "GNU Parallel, which would not exist without your support:",
+		    "",
+		    "  THANK YOU SO MUCH",
+		    "",
+		    "It is really appreciated. The citation notice is now silenced.",
+		    "");
+	    } else {
+		::status(
+		      "",
+		      "Thank you for your support. It is much appreciated. The citation",
+		      "cannot permanently be silenced. Use '--will-cite' instead.",
+		      "",
+		      "If you use '--will-cite' in scripts to be run by others you are making",
+		      "it harder for others to see the citation notice.  The development of",
+		      "GNU Parallel is indirectly financed through citations, so if users",
+		      "do not know they should cite then you are making it harder to finance",
+		      "development. However, if you pay 10000 EUR, you should feel free to",
+		      "use '--will-cite' in scripts.",
+		      "");
+		last;
+	    }
+	}
+    }
+}
+
+sub show_limits() {
+    # Returns: N/A
+    print("Maximal size of command: ",Limits::Command::real_max_length(),"\n",
+	  "Maximal usable size of command: ",
+	  $Global::usable_command_line_length,"\n",
+	  "\n",
+	  "Execution will continue now, ",
+	  "and it will try to read its input\n",
+	  "and run commands; if this is not ",
+	  "what you wanted to happen, please\n",
+	  "press CTRL-D or CTRL-C\n");
+}
+
+sub embed() {
+    # Give an embeddable version of GNU	 Parallel
+    # Tested with: bash, zsh, ksh, ash, dash, sh
+    my $randomstring = "cut-here-".join"",
+	map { (0..9,"a".."z","A".."Z")[rand(62)] } (1..20);
+    if(not -f $0 or not -r $0) {
+	::error("--embed only works if parallel is a readable file");
+	exit(255);
+    }
+    if(open(my $fh, "<", $0)) {
+	# Read the source from $0
+	my @source = <$fh>;
+	my $user = $ENV{LOGNAME} || $ENV{USERNAME} || $ENV{USER};
+	my @env_parallel_source = ();
+	my $shell = $Global::shell;
+	$shell =~ s:.*/::;
+	for(which("env_parallel.$shell")) {
+	    -r $_ or next;
+	    # Read the source of env_parallel.shellname
+	    open(my $env_parallel_source_fh, $_) || die;
+	    @env_parallel_source = <$env_parallel_source_fh>;
+	    close $env_parallel_source_fh;
+	    last;
+	}
+	print "#!$Global::shell
+
+# Copyright (C) 2007-2022 $user, Ole Tange, http://ole.tange.dk
+# and Free Software Foundation, Inc.
+#
+# This program is free software; you can redistribute it and/or modify
+# it under the terms of the GNU General Public License as published by
+# the Free Software Foundation; either version 3 of the License, or
+# (at your option) any later version.
+#
+# This program is distributed in the hope that it will be useful, but
+# WITHOUT ANY WARRANTY; without even the implied warranty of
+# MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the GNU
+# General Public License for more details.
+#
+# You should have received a copy of the GNU General Public License
+# along with this program; if not, see <https://www.gnu.org/licenses/>
+# or write to the Free Software Foundation, Inc., 51 Franklin St,
+# Fifth Floor, Boston, MA 02110-1301 USA
+";
+
+	print q!
+# Embedded GNU Parallel created with --embed
+parallel() {
+    # Start GNU	 Parallel without leaving temporary files
+    #
+    # Not all shells support 'perl <(cat ...)'
+    # This is a complex way of doing:
+    #	perl <(cat <<'cut-here'
+    #	  [...]
+    #	  ) "$@"
+    # and also avoiding:
+    #	[1]+  Done   cat
+
+    # Make a temporary fifo that perl can read from
+    _fifo_with_GNU_Parallel_source=`perl -e 'use POSIX qw(mkfifo);
+      do {
+	$f = "/tmp/parallel-".join"",
+	  map { (0..9,"a".."z","A".."Z")[rand(62)] } (1..5);
+      } while(-e $f);
+      mkfifo($f,0600);
+      print $f;'`
+    # Put source code into temporary file
+    # so it is easy to copy to the fifo
+    _file_with_GNU_Parallel_source=`mktemp`;
+!,
+	"cat <<'$randomstring' > \$_file_with_GNU_Parallel_source\n",
+	@source,
+	$randomstring,"\n",
+	q!
+    # Copy the source code from the file to the fifo
+    # and remove the file and fifo ASAP
+    # 'sh -c' is needed to avoid
+    #	[1]+  Done   cat
+    sh -c "(rm $_file_with_GNU_Parallel_source; cat >$_fifo_with_GNU_Parallel_source; rm $_fifo_with_GNU_Parallel_source) < $_file_with_GNU_Parallel_source &"
+
+    # Read the source from the fifo
+    perl $_fifo_with_GNU_Parallel_source "$@"
+}
+!,
+	@env_parallel_source,
+	q!
+
+# This will call the functions above
+parallel -k echo ::: Put your code here
+env_parallel --session
+env_parallel -k echo ::: Put your code here
+parset p,y,c,h -k echo ::: Put your code here
+echo $p $y $c $h
+echo You can also activate GNU Parallel for interactive use by:
+echo . "$0"
+!;
+    } else {
+	::error("Cannot open $0");
+	exit(255);
+    }
+    ::status("Redirect the output to a file and add your changes at the end:",
+	"  $0 --embed > new_script");
+}
+
+
+sub __GENERIC_COMMON_FUNCTION__() {}
+
+
+sub mkdir_or_die($) {
+    # If dir is not executable: die
+    my $dir = shift;
+    # The eval is needed to catch exception from mkdir
+    eval { File::Path::mkpath($dir); };
+    if(not -x $dir) {
+	::error("Cannot change into non-executable dir $dir: $!");
+	::wait_and_exit(255);
+    }
+}
+
+sub tmpfile(@) {
+    # Create tempfile as $TMPDIR/parXXXXX
+    # Returns:
+    #	$filehandle = opened file handle
+    #	$filename = file name created
+    my($filehandle,$filename) =
+	::tempfile(DIR=>$ENV{'TMPDIR'}, TEMPLATE => 'parXXXXX', @_);
+    if(wantarray) {
+	return($filehandle,$filename);
+    } else {
+	# Separate unlink due to NFS dealing badly with File::Temp
+	unlink $filename;
+	return $filehandle;
+    }
+}
+
+sub tmpname($) {
+    # Select a name that does not exist
+    # Do not create the file as it may be used for creating a socket (by tmux)
+    # Remember the name in $Global::unlink to avoid hitting the same name twice
+    my $name = shift;
+    my($tmpname);
+    if(not -w $ENV{'TMPDIR'}) {
+	if(not -e $ENV{'TMPDIR'}) {
+	    ::error("Tmpdir '$ENV{'TMPDIR'}' does not exist.","Try 'mkdir $ENV{'TMPDIR'}'");
+	} else {
+	    ::error("Tmpdir '$ENV{'TMPDIR'}' is not writable.","Try 'chmod +w $ENV{'TMPDIR'}'");
+	}
+	::wait_and_exit(255);
+    }
+    do {
+	$tmpname = $ENV{'TMPDIR'}."/".$name.
+	    join"", map { (0..9,"a".."z","A".."Z")[rand(62)] } (1..5);
+    } while(-e $tmpname or $Global::unlink{$tmpname}++);
+    return $tmpname;
+}
+
+sub tmpfifo() {
+    # Find an unused name and mkfifo on it
+    my $tmpfifo = tmpname("fif");
+    mkfifo($tmpfifo,0600);
+    return $tmpfifo;
+}
+
+sub rm(@) {
+    # Remove file and remove it from %Global::unlink
+    # Uses:
+    #	%Global::unlink
+    delete @Global::unlink{@_};
+    unlink @_;
+}
+
+sub size_of_block_dev() {
+    # Like -s but for block devices
+    # Input:
+    #	$blockdev = file name of block device
+    # Returns:
+    #	$size = in bytes, undef if error
+    my $blockdev = shift;
+    if(open(my $fh, "<", $blockdev)) {
+	seek($fh,0,2) || ::die_bug("cannot seek $blockdev");
+	my $size = tell($fh);
+	close $fh;
+	return $size;
+    } else {
+	::error("cannot open $blockdev");
+	wait_and_exit(255);
+    }
+}
+
+sub qqx(@) {
+    # Like qx but with clean environment (except for @keep)
+    # and STDERR ignored
+    # This is needed if the environment contains functions
+    # that /bin/sh does not understand
+    my %env;
+    # ssh with ssh-agent needs PATH SSH_AUTH_SOCK SSH_AGENT_PID
+    # ssh with Kerberos needs KRB5CCNAME
+    # sshpass needs SSHPASS
+    # tmux needs LC_CTYPE
+    # lsh needs HOME LOGNAME
+    my @keep = qw(PATH SSH_AUTH_SOCK SSH_AGENT_PID KRB5CCNAME LC_CTYPE
+		  HOME LOGNAME SSHPASS);
+    @env{@keep} = @ENV{@keep};
+    local %ENV;
+    %ENV = %env;
+    if($Global::debug) {
+	# && true is to force spawning a shell and not just exec'ing
+	return qx{ @_ && true };
+    } else {
+	# CygWin does not respect 2>/dev/null
+	# so we do that by hand
+	# This trick does not work:
+	# https://stackoverflow.com/q/13833088/363028
+	# local *STDERR;
+	# open(STDERR, ">", "/dev/null");
+	open(local *CHILD_STDIN,  '<', '/dev/null') or die $!;
+	open(local *CHILD_STDERR, '>', '/dev/null') or die $!;
+	my $out;
+	# eval is needed if open3 fails (e.g. command line too long)
+	eval {
+	    my $pid = open3(
+		'<&CHILD_STDIN',
+		$out,
+		'>&CHILD_STDERR',
+		# && true is to force spawning a shell and not just exec'ing
+		"@_ && true");
+	    my @arr = <$out>;
+	    close $out;
+	    # Make sure $? is set
+	    waitpid($pid, 0);
+	    return wantarray ? @arr : join "",@arr;
+	} or do {
+	    # If eval fails, force $?=false
+	    `false`;
+	};
+    }
+}
+
+sub uniq(@) {
+    # Remove duplicates and return unique values
+    return keys %{{ map { $_ => 1 } @_ }};
+}
+
+sub min(@) {
+    # Returns:
+    #	Minimum value of array
+    my $min;
+    for (@_) {
+	# Skip undefs
+	defined $_ or next;
+	defined $min or do { $min = $_; next; }; # Set $_ to the first non-undef
+	$min = ($min < $_) ? $min : $_;
+    }
+    return $min;
+}
+
+sub max(@) {
+    # Returns:
+    #	Maximum value of array
+    my $max;
+    for (@_) {
+	# Skip undefs
+	defined $_ or next;
+	defined $max or do { $max = $_; next; }; # Set $_ to the first non-undef
+	$max = ($max > $_) ? $max : $_;
+    }
+    return $max;
+}
+
+sub sum(@) {
+    # Returns:
+    #	Sum of values of array
+    my @args = @_;
+    my $sum = 0;
+    for (@args) {
+	# Skip undefs
+	$_ and do { $sum += $_; }
+    }
+    return $sum;
+}
+
+sub undef_as_zero($) {
+    my $a = shift;
+    return $a ? $a : 0;
+}
+
+sub undef_as_empty($) {
+    my $a = shift;
+    return $a ? $a : "";
+}
+
+sub undef_if_empty($) {
+    if(defined($_[0]) and $_[0] eq "") {
+	return undef;
+    }
+    return $_[0];
+}
+
+sub multiply_binary_prefix(@) {
+    # Evalualte numbers with binary prefix
+    # Ki=2^10, Mi=2^20, Gi=2^30, Ti=2^40, Pi=2^50, Ei=2^70, Zi=2^80, Yi=2^80
+    # ki=2^10, mi=2^20, gi=2^30, ti=2^40, pi=2^50, ei=2^70, zi=2^80, yi=2^80
+    # K =2^10, M =2^20, G =2^30, T =2^40, P =2^50, E =2^70, Z =2^80, Y =2^80
+    # k =10^3, m =10^6, g =10^9, t=10^12, p=10^15, e=10^18, z=10^21, y=10^24
+    # 13G = 13*1024*1024*1024 = 13958643712
+    # Input:
+    #	$s = string with prefixes
+    # Returns:
+    #	$value = int with prefixes multiplied
+    my @v = @_;
+    for(@v) {
+	defined $_ or next;
+	s/ki/*1024/gi;
+	s/mi/*1024*1024/gi;
+	s/gi/*1024*1024*1024/gi;
+	s/ti/*1024*1024*1024*1024/gi;
+	s/pi/*1024*1024*1024*1024*1024/gi;
+	s/ei/*1024*1024*1024*1024*1024*1024/gi;
+	s/zi/*1024*1024*1024*1024*1024*1024*1024/gi;
+	s/yi/*1024*1024*1024*1024*1024*1024*1024*1024/gi;
+	s/xi/*1024*1024*1024*1024*1024*1024*1024*1024*1024/gi;
+
+	s/K/*1024/g;
+	s/M/*1024*1024/g;
+	s/G/*1024*1024*1024/g;
+	s/T/*1024*1024*1024*1024/g;
+	s/P/*1024*1024*1024*1024*1024/g;
+	s/E/*1024*1024*1024*1024*1024*1024/g;
+	s/Z/*1024*1024*1024*1024*1024*1024*1024/g;
+	s/Y/*1024*1024*1024*1024*1024*1024*1024*1024/g;
+	s/X/*1024*1024*1024*1024*1024*1024*1024*1024*1024/g;
+
+	s/k/*1000/g;
+	s/m/*1000*1000/g;
+	s/g/*1000*1000*1000/g;
+	s/t/*1000*1000*1000*1000/g;
+	s/p/*1000*1000*1000*1000*1000/g;
+	s/e/*1000*1000*1000*1000*1000*1000/g;
+	s/z/*1000*1000*1000*1000*1000*1000*1000/g;
+	s/y/*1000*1000*1000*1000*1000*1000*1000*1000/g;
+	s/x/*1000*1000*1000*1000*1000*1000*1000*1000*1000/g;
+
+	$_ = eval $_;
+    }
+    return wantarray ? @v : $v[0];
+}
+
+sub multiply_time_units($) {
+    # Evalualte numbers with time units
+    # s=1, m=60, h=3600, d=86400
+    # Input:
+    #	$s = string time units
+    # Returns:
+    #	$value = int in seconds
+    my @v = @_;
+    for(@v) {
+	defined $_ or next;
+	if(/[dhms]/i) {
+	    s/s/*1+/gi;
+	    s/m/*60+/gi;
+	    s/h/*3600+/gi;
+	    s/d/*86400+/gi;
+	    # 1m/3 => 1*60+/3 => 1*60/3
+	    s/\+(\D)/$1/gi;
+	}
+	$_ = eval $_."-0";
+    }
+    return wantarray ? @v : $v[0];
+}
+
+sub seconds_to_time_units() {
+    # Convert seconds into ??d??h??m??s
+    # s=1, m=60, h=3600, d=86400
+    # Input:
+    #	$s = int in seconds
+    # Returns:
+    #	$str = string time units
+    my $s = shift;
+    my $str;
+    my $d = int($s/86400);
+    $s -= $d * 86400;
+    my $h = int($s/3600);
+    $s -= $h * 3600;
+    my $m = int($s/60);
+    $s -= $m * 60;
+    if($d) {
+	$str = sprintf("%dd%02dh%02dm%02ds",$d,$h,$m,$s);
+    } elsif($h) {
+	$str = sprintf("%dh%02dm%02ds",$h,$m,$s);
+    } elsif($m) {
+	$str = sprintf("%dm%02ds",$m,$s);
+    } else {
+	$str = sprintf("%ds",$s);
+    }
+    return $str;
+}
+
+{
+    my ($disk_full_fh, $b8193, $error_printed);
+    sub exit_if_disk_full() {
+	# Checks if $TMPDIR is full by writing 8kb to a tmpfile
+	# If the disk is full: Exit immediately.
+	# Returns:
+	#   N/A
+	if(not $disk_full_fh) {
+	    $disk_full_fh = ::tmpfile(SUFFIX => ".df");
+	    $b8193 = "b"x8193;
+	}
+	# Linux does not discover if a disk is full if writing <= 8192
+	# Tested on:
+	# bfs btrfs cramfs ext2 ext3 ext4 ext4dev jffs2 jfs minix msdos
+	# ntfs reiserfs tmpfs ubifs vfat xfs
+	# TODO this should be tested on different OS similar to this:
+	#
+	# doit() {
+	#   sudo mount /dev/ram0 /mnt/loop; sudo chmod 1777 /mnt/loop
+	#   seq 100000 | parallel --tmpdir /mnt/loop/ true &
+	#   seq 6900000 > /mnt/loop/i && echo seq OK
+	#   seq 6980868 > /mnt/loop/i
+	#   seq 10000 > /mnt/loop/ii
+	#   sleep 3
+	#   sudo umount /mnt/loop/ || sudo umount -l /mnt/loop/
+	#   echo >&2
+	# }
+	print $disk_full_fh $b8193;
+	if(not $disk_full_fh
+	   or
+	   tell $disk_full_fh != 8193) {
+	    # On raspbian the disk can be full except for 10 chars.
+	    if(not $error_printed) {
+		::error("Output is incomplete.",
+			"Cannot append to buffer file in $ENV{'TMPDIR'}.",
+			"Is the disk full?",
+			"Change \$TMPDIR with --tmpdir or use --compress.");
+		$error_printed = 1;
+	    }
+	    ::wait_and_exit(255);
+	}
+	truncate $disk_full_fh, 0;
+	seek($disk_full_fh, 0, 0) || die;
+    }
+}
+
+sub spacefree($$) {
+    # Remove comments and spaces
+    # Inputs:
+    #	$spaces = keep 1 space?
+    #	$s = string to remove spaces from
+    # Returns:
+    #	$s = with spaces removed
+    my $spaces = shift;
+    my $s = shift;
+    $s =~ s/#.*//mg;
+    if(1 == $spaces) {
+	$s =~ s/\s+/ /mg;
+    } elsif(2 == $spaces) {
+	# Keep newlines
+	$s =~ s/\n\n+/\n/sg;
+	$s =~ s/[ \t]+/ /mg;
+    } elsif(3 == $spaces) {
+	# Keep perl code required space
+	$s =~ s{([^a-zA-Z0-9/])\s+}{$1}sg;
+	$s =~ s{([a-zA-Z0-9/])\s+([^:a-zA-Z0-9/])}{$1$2}sg;
+    } else {
+	$s =~ s/\s//mg;
+    }
+    return $s;
+}
+
+{
+    my $hostname;
+    sub hostname() {
+	local $/ = "\n";
+	if(not $hostname) {
+	    $hostname = `hostname`;
+	    chomp($hostname);
+	    $hostname ||= "nohostname";
+	}
+	return $hostname;
+    }
+}
+
+sub which(@) {
+    # Input:
+    #	@programs = programs to find the path to
+    # Returns:
+    #	@full_path = full paths to @programs. Nothing if not found
+    my @which;
+    for my $prg (@_) {
+	push(@which, grep { not -d $_ and -x $_ }
+	     map { $_."/".$prg } split(":",$ENV{'PATH'}));
+	if($prg =~ m:/:) {
+	    # Test if program with full path exists
+	    push(@which, grep { not -d $_ and -x $_ } $prg);
+	}
+    }
+    ::debug("which", "$which[0] in $ENV{'PATH'}\n");
+    return wantarray ? @which : $which[0];
+}
+
+{
+    my ($regexp,$shell,%fakename);
+
+    sub parent_shell {
+	# Input:
+	#   $pid = pid to see if (grand)*parent is a shell
+	# Returns:
+	#   $shellpath = path to shell - undef if no shell found
+	my $pid = shift;
+	::debug("init","Parent of $pid\n");
+	if(not $regexp) {
+	    # All shells known to mankind
+	    #
+	    # ash bash csh dash fdsh fish fizsh ksh ksh93 mksh pdksh
+	    # posh rbash rc rush rzsh sash sh static-sh tcsh yash zsh
+
+	    my @shells = (qw(ash bash bsd-csh csh dash fdsh fish fizsh ksh
+			  ksh93 lksh mksh pdksh posh rbash rc rush rzsh sash sh
+			  static-sh tcsh yash zsh -sh -csh -bash),
+			  '-sh (sh)' # sh on FreeBSD
+		);
+	    # Can be formatted as:
+	    #	[sh]  -sh  sh  busybox sh  -sh (sh)
+	    #	/bin/sh /sbin/sh /opt/csw/sh
+	    # But not: foo.sh sshd crash flush pdflush scosh fsflush ssh
+	    $shell = "(?:".join("|",map { "\Q$_\E" } @shells).")";
+	    $regexp = '^((\[)(-?)('. $shell. ')(\])|(|\S+/|busybox )'.
+		'(-?)('. $shell. '))( *$| [^(])';
+	    %fakename = (
+		# sh disguises itself as -sh (sh) on FreeBSD
+		"-sh (sh)" => ["sh"],
+		# csh and tcsh disguise themselves as -sh/-csh
+		# E.g.: ssh -tt csh@lo 'ps aux;true' |egrep ^csh
+		# but sh also disguises itself as -sh
+		# (TODO When does that happen?)
+		"-sh" => ["sh"],
+		"-csh" => ["tcsh", "csh"],
+		# ash disguises itself as -ash
+		"-ash" => ["ash", "dash", "sh"],
+		# dash disguises itself as -dash
+		"-dash" => ["dash", "ash", "sh"],
+		# bash disguises itself as -bash
+		"-bash" => ["bash", "sh"],
+		# ksh disguises itself as -ksh
+		"-ksh" => ["ksh", "sh"],
+		# zsh disguises itself as -zsh
+		"-zsh" => ["zsh", "sh"],
+		);
+	}
+	if($^O eq "linux") {
+	    # Optimized for GNU/Linux
+	    my $testpid = $pid;
+	    my $shellpath;
+	    my $shellline;
+	    while($testpid) {
+		if(open(my $fd, "<", "/proc/$testpid/cmdline")) {
+		    local $/="\0";
+		    chomp($shellline = <$fd>);
+		    if($shellline =~ /$regexp/o) {
+			my $shellname = $4 || $8;
+			my $dash = $3 || $7;
+			if($shellname eq "sh" and $dash) {
+			    # -sh => csh or sh
+			    if($shellpath = readlink "/proc/$testpid/exe") {
+				::debug("init","procpath $shellpath\n");
+				if($shellpath =~ m:/$shell$:o) {
+				    ::debug("init",
+					    "proc which ".$shellpath." => ");
+				    return $shellpath;
+				}
+			    }
+			}
+			::debug("init", "which ".$shellname." => ");
+			$shellpath = (which($shellname,
+					    @{$fakename{$shellname}}))[0];
+			::debug("init", "shell path $shellpath\n");
+			return $shellpath;
+		    }
+		}
+		# Get parent pid
+		if(open(my $fd, "<", "/proc/$testpid/stat")) {
+		    my $line = <$fd>;
+		    close $fd;
+		    # Parent pid is field 4
+		    $testpid = (split /\s+/, $line)[3];
+		} else {
+		    # Something is wrong: fall back to old method
+		    last;
+		}
+	    }
+	}
+	# if -sh or -csh try readlink /proc/$$/exe
+	my ($children_of_ref, $parent_of_ref, $name_of_ref) = pid_table();
+	my $shellpath;
+	my $testpid = $pid;
+	while($testpid) {
+	    if($name_of_ref->{$testpid} =~ /$regexp/o) {
+		my $shellname = $4 || $8;
+		my $dash = $3 || $7;
+		if($shellname eq "sh" and $dash) {
+		    # -sh => csh or sh
+		    if($shellpath = readlink "/proc/$testpid/exe") {
+			::debug("init","procpath $shellpath\n");
+			if($shellpath =~ m:/$shell$:o) {
+			    ::debug("init", "proc which ".$shellpath." => ");
+			    return $shellpath;
+			}
+		    }
+		}
+		::debug("init", "which ".$shellname." => ");
+		$shellpath = (which($shellname,@{$fakename{$shellname}}))[0];
+		::debug("init", "shell path $shellpath\n");
+		$shellpath and last;
+	    }
+	    if($testpid == $parent_of_ref->{$testpid}) {
+		# In Solaris zones, the PPID of the zsched process is itself
+		last;
+	    }
+	    $testpid = $parent_of_ref->{$testpid};
+	}
+	return $shellpath;
+    }
+}
+
+{
+    my %pid_parentpid_cmd;
+
+    sub pid_table() {
+	# Returns:
+	#   %children_of = { pid -> children of pid }
+	#   %parent_of = { pid -> pid of parent }
+	#   %name_of = { pid -> commandname }
+
+	if(not %pid_parentpid_cmd) {
+	    # Filter for SysV-style `ps`
+	    my $sysv = q( ps -ef |).
+		q(perl -ane '1..1 and /^(.*)CO?MM?A?N?D/ and $s=length $1;).
+		q(s/^.{$s}//; print "@F[1,2] $_"' );
+	    # Minix uses cols 2,3 and can have newlines in the command
+	    # so lines not having numbers in cols 2,3 must be ignored
+	    my $minix = q( ps -ef |).
+		q(perl -ane '1..1 and /^(.*)CO?MM?A?N?D/ and $s=length $1;).
+		q(s/^.{$s}// and $F[2]>0 and $F[3]>0 and print "@F[2,3] $_"' );
+	    # BSD-style `ps`
+	    my $bsd = q(ps -o pid,ppid,command -ax);
+	    %pid_parentpid_cmd =
+	    (
+	     'aix' => $sysv,
+	     'android' => $sysv,
+	     'cygwin' => $sysv,
+	     'darwin' => $bsd,
+	     'dec_osf' => $sysv,
+	     'dragonfly' => $bsd,
+	     'freebsd' => $bsd,
+	     'gnu' => $sysv,
+	     'hpux' => $sysv,
+	     'linux' => $sysv,
+	     'mirbsd' => $bsd,
+	     'minix' => $minix,
+	     'msys' => $sysv,
+	     'MSWin32' => $sysv,
+	     'netbsd' => $bsd,
+	     'nto' => $sysv,
+	     'openbsd' => $bsd,
+	     'solaris' => $sysv,
+	     'svr5' => $sysv,
+	     'syllable' => "echo ps not supported",
+	    );
+	}
+	$pid_parentpid_cmd{$^O} or
+	    ::die_bug("pid_parentpid_cmd for $^O missing");
+
+	my (@pidtable,%parent_of,%children_of,%name_of);
+	# Table with pid -> children of pid
+	@pidtable = `$pid_parentpid_cmd{$^O}`;
+	my $p=$$;
+	for (@pidtable) {
+	    # must match: 24436 21224 busybox ash
+	    # must match: 24436 21224 <<empty on MacOSX running cubase>>
+	    # must match: 24436 21224 <<empty on system running Viber>>
+	    #	or: perl -e 'while($0=" "){}'
+	    if(/^\s*(\S+)\s+(\S+)\s+(\S+.*)/
+	       or
+	       /^\s*(\S+)\s+(\S+)\s+()$/) {
+		$parent_of{$1} = $2;
+		push @{$children_of{$2}}, $1;
+		$name_of{$1} = $3;
+	    } else {
+		::die_bug("pidtable format: $_");
+	    }
+	}
+	return(\%children_of, \%parent_of, \%name_of);
+    }
+}
+
+sub now() {
+    # Returns time since epoch as in seconds with 3 decimals
+    # Uses:
+    #	@Global::use
+    # Returns:
+    #	$time = time now with millisecond accuracy
+    if(not $Global::use{"Time::HiRes"}) {
+	if(eval "use Time::HiRes qw ( time );") {
+	    eval "sub TimeHiRestime { return Time::HiRes::time };";
+	} else {
+	    eval "sub TimeHiRestime { return time() };";
+	}
+	$Global::use{"Time::HiRes"} = 1;
+    }
+
+    return (int(TimeHiRestime()*1000))/1000;
+}
+
+sub usleep($) {
+    # Sleep this many milliseconds.
+    # Input:
+    #	$ms = milliseconds to sleep
+    my $ms = shift;
+    ::debug("timing",int($ms),"ms ");
+    select(undef, undef, undef, $ms/1000);
+}
+
+sub make_regexp_ungreedy {
+    my $regexp = shift;
+    my $class_state = 0;
+    my $escape_state = 0;
+    my $found = 0;
+    my $ungreedy = "";
+    my $c;
+
+    for $c (split (//, $regexp)) {
+	if ($found) {
+	    if($c ne "?") { $ungreedy .= "?"; }
+	    $found = 0;
+	}
+	$ungreedy .= $c;
+
+	if ($escape_state) { $escape_state = 0; next; }
+	if ($c eq "\\") { $escape_state = 1; next; }
+	if ($c eq '[') { $class_state  = 1; next; }
+	if ($class_state) {
+	    if($c eq ']') { $class_state = 0; }
+	    next;
+	}
+	# Quantifiers: + * {...}
+	if ($c =~ /[*}+]/) { $found = 1; }
+    }
+    if($found) { $ungreedy .= '?'; }
+    return $ungreedy;
+}
+
+
+sub __KILLER_REAPER__() {}
+
+sub reap_usleep() {
+    # Reap dead children.
+    # If no dead children: Sleep specified amount with exponential backoff
+    # Input:
+    #	$ms = milliseconds to sleep
+    # Returns:
+    #	$ms/2+0.001 if children reaped
+    #	$ms*1.1 if no children reaped
+    my $ms = shift;
+    if(reapers()) {
+	if(not $Global::total_completed % 100) {
+	    if($opt::timeout) {
+		# Force cleaning the timeout queue for every 100 jobs
+		# Fixes potential memleak
+		$Global::timeoutq->process_timeouts();
+	    }
+	}
+	# Sleep exponentially shorter (1/2^n) if a job finished
+	return $ms/2+0.001;
+    } else {
+	if($opt::timeout) {
+	    $Global::timeoutq->process_timeouts();
+	}
+	if($opt::memfree) {
+	    kill_youngster_if_not_enough_mem($opt::memfree*0.5);
+	}
+	if($opt::memsuspend) {
+	    suspend_young_if_not_enough_mem($opt::memsuspend);
+	}
+	if($opt::limit) {
+	    kill_youngest_if_over_limit();
+	}
+	exit_if_disk_full();
+	if($Global::linebuffer) {
+	    my $something_printed = 0;
+	    if($opt::keeporder and not $opt::latestline) {
+		for my $job (values %Global::running) {
+		    $something_printed += $job->print_earlier_jobs();
+		}
+	    } else {
+		for my $job (values %Global::running) {
+		    $something_printed += $job->print();
+		}
+	    }
+	    if($something_printed) { $ms = $ms/2+0.001; }
+	}
+	if($ms > 0.002) {
+	    # When a child dies, wake up from sleep (or select(,,,))
+	    $SIG{CHLD} = sub { kill "ALRM", $$ };
+	    if($opt::delay and not $Global::linebuffer) {
+		# The 0.004s is approximately the time it takes for one round
+		my $next_earliest_start =
+		    $Global::newest_starttime + $opt::delay - 0.004;
+		my $remaining_ms = 1000 * ($next_earliest_start - ::now());
+		# The next job can only start at $next_earliest_start
+		# so sleep until then (but sleep at least $ms)
+		usleep(::max($ms,$remaining_ms));
+	    } else {
+		usleep($ms);
+	    }
+	    # --compress needs $SIG{CHLD} unset
+	    $SIG{CHLD} = 'DEFAULT';
+	}
+	# Sleep exponentially longer (1.1^n) if a job did not finish,
+	# though at most 1000 ms.
+	return (($ms < 1000) ? ($ms * 1.1) : ($ms));
+    }
+}
+
+sub kill_youngest_if_over_limit() {
+    # Check each $sshlogin we are over limit
+    # If over limit: kill off the youngest child
+    # Put the child back in the queue.
+    # Uses:
+    #	%Global::running
+    my %jobs_of;
+    my @sshlogins;
+
+    for my $job (values %Global::running) {
+	if(not $jobs_of{$job->sshlogin()}) {
+	    push @sshlogins, $job->sshlogin();
+	}
+	push @{$jobs_of{$job->sshlogin()}}, $job;
+    }
+    for my $sshlogin (@sshlogins) {
+	for my $job (sort { $b->seq() <=> $a->seq() }
+		     @{$jobs_of{$sshlogin}}) {
+	    if($sshlogin->limit() == 2) {
+		$job->kill();
+		last;
+	    }
+	}
+    }
+}
+
+sub suspend_young_if_not_enough_mem() {
+    # Check each $sshlogin if there is enough mem.
+    # If less than $limit free mem: suspend some of the young children
+    # Else: Resume all jobs
+    # Uses:
+    #	%Global::running
+    my $limit = shift;
+    my %jobs_of;
+    my @sshlogins;
+
+    for my $job (values %Global::running) {
+	if(not $jobs_of{$job->sshlogin()}) {
+	    push @sshlogins, $job->sshlogin();
+	}
+	push @{$jobs_of{$job->sshlogin()}}, $job;
+    }
+    for my $sshlogin (@sshlogins) {
+	my $free = $sshlogin->memfree();
+	if($free < 2*$limit) {
+	    # Suspend all jobs (resume some of them later)
+	    map { $_->suspended() or $_->suspend(); } @{$jobs_of{$sshlogin}};
+	    my @jobs = (sort { $b->seq() <=> $a->seq() }
+			@{$jobs_of{$sshlogin}});
+	    # how many should be running?
+	    # limit*1 => 1;
+	    # limit*1.5 => 2;
+	    # limit*1.75 => 4;
+	    # free < limit*(2-1/2^n);
+	    # =>
+	    # 1/(2-free/limit) < 2^n;
+	    my $run = int(1/(2-$free/$limit));
+	    $run = ::min($run,$#jobs);
+	    # Resume the oldest running
+	    for my $job ((sort { $a->seq() <=> $b->seq() } @jobs)[0..$run]) {
+		::debug("mem","\nResume ",$run+1, " jobs. Seq ",
+			$job->seq(), " resumed ",
+			$sshlogin->memfree()," < ",2*$limit);
+		$job->resume();
+	    }
+	} else {
+	    for my $job (@{$jobs_of{$sshlogin}}) {
+		if($job->suspended()) {
+		    $job->resume();
+		    ::debug("mem","\nResume ",$#{$jobs_of{$sshlogin}}+1,
+			    " jobs. Seq ", $job->seq(), " resumed ",
+			    $sshlogin->memfree()," > ",2*$limit);
+		    last;
+		}
+	    }
+	}
+    }
+}
+
+sub kill_youngster_if_not_enough_mem() {
+    # Check each $sshlogin if there is enough mem.
+    # If less than 50% enough free mem: kill off the youngest child
+    # Put the child back in the queue.
+    # Uses:
+    #	%Global::running
+    my $limit = shift;
+    my %jobs_of;
+    my @sshlogins;
+
+    for my $job (values %Global::running) {
+	if(not $jobs_of{$job->sshlogin()}) {
+	    push @sshlogins, $job->sshlogin();
+	}
+	push @{$jobs_of{$job->sshlogin()}}, $job;
+    }
+    for my $sshlogin (@sshlogins) {
+	for my $job (sort { $b->seq() <=> $a->seq() }
+		     @{$jobs_of{$sshlogin}}) {
+	    if($sshlogin->memfree() < $limit) {
+		::debug("mem","\n",map { $_->seq()." " }
+			(sort { $b->seq() <=> $a->seq() }
+			 @{$jobs_of{$sshlogin}}));
+		::debug("mem","\n", $job->seq(), "killed ",
+			$sshlogin->memfree()," < ",$limit);
+		$job->kill();
+		$sshlogin->memfree_recompute();
+	    } else {
+		last;
+	    }
+	}
+	::debug("mem","Free mem OK? ",
+		$sshlogin->memfree()," > ",$limit);
+    }
+}
+
+
+sub __DEBUGGING__() {}
+
+
+sub debug(@) {
+    # Uses:
+    #	$Global::debug
+    #	%Global::fh
+    # Returns: N/A
+    $Global::debug or return;
+    @_ = grep { defined $_ ? $_ : "" } @_;
+    if($Global::debug eq "all" or $Global::debug eq $_[0]) {
+	if($Global::fh{2}) {
+	    # Original stderr was saved
+	    my $stderr = $Global::fh{2};
+	    print $stderr @_[1..$#_];
+	} else {
+	    print STDERR @_[1..$#_];
+	}
+    }
+}
+
+sub my_memory_usage() {
+    # Returns:
+    #	memory usage if found
+    #	0 otherwise
+    use strict;
+    use FileHandle;
+
+    local $/ = "\n";
+    my $pid = $$;
+    if(-e "/proc/$pid/stat") {
+	my $fh = FileHandle->new("</proc/$pid/stat");
+
+	my $data = <$fh>;
+	chomp $data;
+	$fh->close;
+
+	my @procinfo = split(/\s+/,$data);
+
+	return undef_as_zero($procinfo[22]);
+    } else {
+	return 0;
+    }
+}
+
+sub my_size() {
+    # Returns:
+    #	$size = size of object if Devel::Size is installed
+    #	-1 otherwise
+    my @size_this = (@_);
+    eval "use Devel::Size qw(size total_size)";
+    if ($@) {
+	return -1;
+    } else {
+	return total_size(@_);
+    }
+}
+
+sub my_dump(@) {
+    # Returns:
+    #	ascii expression of object if Data::Dump(er) is installed
+    #	error code otherwise
+    my @dump_this = (@_);
+    eval "use Data::Dump qw(dump);";
+    if ($@) {
+	# Data::Dump not installed
+	eval "use Data::Dumper;";
+	if ($@) {
+	    my $err =  "Neither Data::Dump nor Data::Dumper is installed\n".
+		"Not dumping output\n";
+	    ::status($err);
+	    return $err;
+	} else {
+	    return Dumper(@dump_this);
+	}
+    } else {
+	# Create a dummy Data::Dump:dump as Hans Schou sometimes has
+	# it undefined
+	eval "sub Data::Dump:dump {}";
+	eval "use Data::Dump qw(dump);";
+	return (Data::Dump::dump(@dump_this));
+    }
+}
+
+sub my_croak(@) {
+    eval "use Carp; 1";
+    $Carp::Verbose = 1;
+    croak(@_);
+}
+
+sub my_carp() {
+    eval "use Carp; 1";
+    $Carp::Verbose = 1;
+    carp(@_);
+}
+
+
+sub __OBJECT_ORIENTED_PARTS__() {}
+
+
+package SSHLogin;
+
+sub new($$) {
+    my $class = shift;
+    my $s = shift;
+    my $origs = $s;
+    my %hostgroups;
+    my $ncpus;
+    my $sshcommand;
+    my $user;
+    my $password;
+    my $host;
+    my $port;
+    my $local;
+    my $string;
+    # SSHLogins can have these formats:
+    #	@grp+grp/ncpu//usr/bin/ssh user@server
+    #	ncpu//usr/bin/ssh user@server
+    #	/usr/bin/ssh user@server
+    #	user@server
+    #	ncpu/user@server
+    #	@grp+grp/user@server
+    #	above with: user:password@server
+    #	above with: user@server:port
+    # So:
+    #	[@grp+grp][ncpu/][ssh command ][[user][:password]@][server[:port]]
+
+    #	[@grp+grp]/ncpu//usr/bin/ssh user:pass@server:port
+    if($s =~ s:^\@([^/]+)/?::) {
+	# Look for SSHLogin hostgroups
+	%hostgroups = map { $_ => 1 } split(/\+/, $1);
+    }
+    # An SSHLogin is always in the hostgroup of its "numcpu/host"
+    $hostgroups{$s} = 1;
+
+    #	[ncpu/]/usr/bin/ssh user:pass@server:port
+    if ($s =~ s:^(\d+)/::) { $ncpus = $1; }
+
+    #	[/usr/bin/ssh ]user:pass@server:port
+    if($s =~ s/^(.*) //) { $sshcommand = $1; }
+
+    #	[user:pass@]server:port
+    if($s =~ s/^([^@]+)@//) {
+	my $userpw = $1;
+	# user[:pass]
+	if($userpw =~ s/:(.*)//) {
+	    $password = $1;
+	    if($password eq "") { $password = $ENV{'SSHPASS'} }
+	    if(not ::which("sshpass")) {
+		::error("--sshlogin with password requires sshpass installed");
+		::wait_and_exit(255);
+	    }
+	}
+	$user = $userpw;
+    }
+    #	[server]:port
+    if(not $s =~ /:.*:/
+       and
+       $s =~ s/^([-a-z0-9._]+)//i) {
+	# Not IPv6 (IPv6 has 2 or more ':')
+	$host = $1;
+    } elsif($s =~ s/^(\\[\[\]box0-9a-f.]+)//i) {
+	# RFC2673 allows for:
+	#   \[b11010000011101] \[o64072/14] \[xd074/14] \[208.116.0.0/14]
+	$host = $1;
+    } elsif($s =~ s/^\[([0-9a-f:]+)\]//i
+	    or
+	    $s =~ s/^([0-9a-f:]+)//i) {
+	# RFC5952
+	#   [2001:db8::1]:80
+	#   2001:db8::1.80
+	#   2001:db8::1p80
+	#   2001:db8::1#80
+	#   2001:db8::1:80 - not supported
+	#   2001:db8::1 port 80 - not supported
+	$host = $1;
+    }
+
+    #	[:port]
+    if($s =~ s/^:(\w+)//i) {
+	$port = $1;
+    } elsif($s =~ s/^[p\.\#](\w+)//i) {
+	# RFC5952
+	#   2001:db8::1.80
+	#   2001:db8::1p80
+	#   2001:db8::1#80
+	$port = $1;
+    }
+
+    if($s and $s ne ':') {
+	::die_bug("SSHLogin parser failed on '$origs' => '$s'");
+    }
+
+    $string =
+	# Only include the sshcommand in $string if it is set by user
+	($sshcommand && $sshcommand." ").
+	($user && $user."@").
+	($host && $host).
+	($port && ":$port");
+    if($host eq ':') {
+	$local = 1;
+	$string = ":";
+    } else {
+	$sshcommand ||= $opt::ssh || $ENV{'PARALLEL_SSH'} || "ssh";
+    }
+    # An SSHLogin is always in the hostgroup of its $string-name
+    $hostgroups{$string} = 1;
+    @Global::hostgroups{keys %hostgroups} = values %hostgroups;
+    # Used for file names for loadavg
+    my $no_slash_string = $string;
+    $no_slash_string =~ s/[^-a-z0-9:]/_/gi;
+    return bless {
+	'string' => $string,
+	    'jobs_running' => 0,
+	    'jobs_completed' => 0,
+	    'maxlength' => undef,
+	    'max_jobs_running' => undef,
+	    'orig_max_jobs_running' => undef,
+	    'ncpus' => $ncpus,
+	    'sshcommand' => $sshcommand,
+	    'user' => $user,
+	    'password' => $password,
+	    'host' => $host,
+	    'port' => $port,
+	    'hostgroups' => \%hostgroups,
+	    'local' => $local,
+	    'control_path_dir' => undef,
+	    'control_path' => undef,
+	    'time_to_login' => undef,
+	    'last_login_at' => undef,
+	    'loadavg_file' => $Global::cache_dir . "/tmp/sshlogin/" .
+	    $no_slash_string . "/loadavg",
+	    'loadavg' => undef,
+	    'last_loadavg_update' => 0,
+	    'swap_activity_file' => $Global::cache_dir . "/tmp/sshlogin/" .
+	    $no_slash_string . "/swap_activity",
+	    'swap_activity' => undef,
+    }, ref($class) || $class;
+}
+
+sub DESTROY($) {
+    my $self = shift;
+    # Remove temporary files if they are created.
+    ::rm($self->{'loadavg_file'});
+    ::rm($self->{'swap_activity_file'});
+}
+
+sub string($) {
+    my $self = shift;
+    return $self->{'string'};
+}
+
+sub host($) {
+    my $self = shift;
+    return $self->{'host'};
+}
+
+sub sshcmd($) {
+    # Give the ssh command without hostname
+    # Returns:
+    #	"sshpass -e ssh -p port -l user"
+    my $self = shift;
+    my @local;
+    # [sshpass -e] ssh -p port -l user
+    if($self->{'password'}) { push @local, "sshpass -e"; }
+    # [ssh] -p port -l user
+    push @local, $self->{'sshcommand'};
+    # [-p port] -l user
+    if($self->{'port'}) { push @local, '-p',$self->{'port'}; }
+    # [-l user]
+    if($self->{'user'}) { push @local, '-l',$self->{'user'}; }
+    if($opt::controlmaster) {
+	# Use control_path to make ssh faster
+	my $control_path = $self->control_path_dir()."/ssh-%r@%h:%p";
+	push @local, "-S", $control_path;
+	if(not $self->{'control_path'}{$control_path}++) {
+	    # Master is not running for this control_path
+	    # Start it
+	    my $pid = fork();
+	    if($pid) {
+		$Global::sshmaster{$pid} ||= 1;
+	    } else {
+		$SIG{'TERM'} = undef;
+		# Run a sleep that outputs data, so it will discover
+		# if the ssh connection closes.
+		my $sleep = ::Q('$|=1;while(1){sleep 1;print "foo\n"}');
+		# Ignore the 'foo' being printed
+		open(STDOUT,">","/dev/null");
+		# STDERR >/dev/null to ignore
+		open(STDERR,">","/dev/null");
+		open(STDIN,"<","/dev/null");
+		exec(@local, "-MT", $self->{'host'}, "--",
+		     "perl", "-e", $sleep);
+	    }
+	}
+    }
+
+    return "@local";
+}
+
+sub wrap($@) {
+    # Input:
+    #	@cmd = shell command to run on remote
+    # Returns:
+    #	$sshwrapped = ssh remote @cmd
+    my $self = shift;
+    my @remote = @_;
+    return(join " ",
+	   $self->sshcmd(), $self->{'host'}, "--", "exec", @remote);
+}
+
+sub hexwrap($@) {
+    # Input:
+    #	@cmd = perl expresion to eval
+    # Returns:
+    #	$hexencoded = perl command that decodes hex and evals @cmd
+    my $self = shift;
+    my $cmd = join("",@_);
+
+    # "#" is needed because Perl on MacOS X adds NULs
+    # when running pack q/H10000000/
+    my $hex = unpack "H*", $cmd."#";
+    # csh does not deal well with > 1000 chars in one word
+    # Insert space every 1000 char
+    $hex =~ s/\G.{1000}\K/ /sg;
+    # Explanation:
+    # Write this without special chars: eval pack 'H*', join '',@ARGV
+    # GNU_Parallel_worker = String so people can see this is from GNU Parallel
+    # eval+	     = way to write 'eval ' without space (gives warning)
+    # pack+	     = way to write 'pack ' without space
+    # q/H10000000/,  = almost the same as "H*" but does not use *
+    # join+q//,	     = join '',
+    return('perl -X -e '.
+	   'GNU_Parallel_worker,eval+pack+q/H10000000/,join+q//,@ARGV '.
+	   $hex);
+}
+
+sub jobs_running($) {
+    my $self = shift;
+    return ($self->{'jobs_running'} || "0");
+}
+
+sub inc_jobs_running($) {
+    my $self = shift;
+    $self->{'jobs_running'}++;
+}
+
+sub dec_jobs_running($) {
+    my $self = shift;
+    $self->{'jobs_running'}--;
+}
+
+sub set_maxlength($$) {
+    my $self = shift;
+    $self->{'maxlength'} = shift;
+}
+
+sub maxlength($) {
+    my $self = shift;
+    return $self->{'maxlength'};
+}
+
+sub jobs_completed() {
+    my $self = shift;
+    return $self->{'jobs_completed'};
+}
+
+sub in_hostgroups() {
+    # Input:
+    #	@hostgroups = the hostgroups to look for
+    # Returns:
+    #	true if intersection of @hostgroups and the hostgroups of this
+    #	     SSHLogin is non-empty
+    my $self = shift;
+    return grep { defined $self->{'hostgroups'}{$_} } @_;
+}
+
+sub hostgroups() {
+    my $self = shift;
+    return keys %{$self->{'hostgroups'}};
+}
+
+sub inc_jobs_completed($) {
+    my $self = shift;
+    $self->{'jobs_completed'}++;
+    $Global::total_completed++;
+}
+
+sub set_max_jobs_running($$) {
+    my $self = shift;
+    if(defined $self->{'max_jobs_running'}) {
+	$Global::max_jobs_running -= $self->{'max_jobs_running'};
+    }
+    $self->{'max_jobs_running'} = shift;
+
+    if(defined $self->{'max_jobs_running'}) {
+	# max_jobs_running could be resat if -j is a changed file
+	$Global::max_jobs_running += $self->{'max_jobs_running'};
+    }
+    # Initialize orig to the first non-zero value that comes around
+    $self->{'orig_max_jobs_running'} ||= $self->{'max_jobs_running'};
+}
+
+sub memfree() {
+    # Returns:
+    #	$memfree in bytes
+    my $self = shift;
+    $self->memfree_recompute();
+    # Return 1 if not defined.
+    return (not defined $self->{'memfree'} or $self->{'memfree'})
+}
+
+sub memfree_recompute() {
+    my $self = shift;
+    my $script = memfreescript();
+
+    # TODO add sshlogin and backgrounding
+    # Run the script twice if it gives 0 (typically intermittent error)
+    $self->{'memfree'} = ::qqx($script) || ::qqx($script);
+    if(not $self->{'memfree'}) {
+	::die_bug("Less than 1 byte memory free");
+    }
+    #::debug("mem","New free:",$self->{'memfree'}," ");
+}
+
+{
+    my $script;
+
+    sub memfreescript() {
+	# Returns:
+	#   shellscript for giving available memory in bytes
+	if(not $script) {
+	    my %script_of = (
+		# /proc/meminfo
+		# MemFree:	    7012 kB
+		# Buffers:	   19876 kB
+		# Cached:	  431192 kB
+		# SwapCached:	       0 kB
+		"linux" => (
+		    q{
+			print 1024 * qx{
+			awk '/^((Swap)?Cached|MemFree|Buffers):/
+			{ sum += \$2} END { print sum }'
+			    /proc/meminfo }
+		    }),
+		# Android uses same code as GNU/Linux
+		"android" => (
+		    q{
+			print 1024 * qx{
+			awk '/^((Swap)?Cached|MemFree|Buffers):/
+			{ sum += \$2} END { print sum }'
+			    /proc/meminfo }
+		    }),
+		# $ vmstat 1 1
+		#   procs	  memory	 page			faults	     cpu
+		# r  b	w    avm    free re at	pi po  fr de  sr   in	sy  cs	us sy id
+		# 1  0	0 242793  389737  5  1	 0  0	0  0   0  107  978  60	 1  1 99
+		"hpux" => (
+		    q{
+			print (((reverse `vmstat 1 1`)[0]
+			    =~ /(?:\d+\D+){4}(\d+)/)[0]*1024)
+		    }),
+		# $ vmstat 1 2
+		# kthr	    memory	      page	      disk	    faults	cpu
+		# r b w	  swap	free  re  mf pi po fr de sr s3 s4 -- --	  in   sy   cs us sy id
+		# 0 0 0 6496720 5170320 68 260 8 2  1  0  0 -0	3  0  0	 309 1371  255	1  2 97
+		# 0 0 0 6434088 5072656	 7  15 8 0  0  0  0  0 261 0  0 1889 1899 3222	0  8 92
+		#
+		# The second free value is correct
+		"solaris" => (
+		    q{
+			print (((reverse `vmstat 1 2`)[0]
+				=~ /(?:\d+\D+){4}(\d+)/)[0]*1024)
+		    }),
+		# hw.pagesize: 4096
+		# vm.stats.vm.v_cache_count: 0
+		# vm.stats.vm.v_inactive_count: 79574
+		# vm.stats.vm.v_free_count: 4507
+		"freebsd" => (
+		    q{
+			for(qx{/sbin/sysctl -a}) {
+			    if (/^([^:]+):\s+(.+)\s*$/s) {
+				$sysctl->{$1} = $2;
+			    }
+			}
+			print $sysctl->{"hw.pagesize"} *
+			    ($sysctl->{"vm.stats.vm.v_cache_count"}
+			     + $sysctl->{"vm.stats.vm.v_inactive_count"}
+			     + $sysctl->{"vm.stats.vm.v_free_count"});
+		    }),
+		# Mach Virtual Memory Statistics: (page size of 4096 bytes)
+		# Pages free:			      198061.
+		# Pages active:			      159701.
+		# Pages inactive:		       47378.
+		# Pages speculative:		       29707.
+		# Pages wired down:		       89231.
+		# "Translation faults":		   928901425.
+		# Pages copy-on-write:		   156988239.
+		# Pages zero filled:		   271267894.
+		# Pages reactivated:		       48895.
+		# Pageins:			     1798068.
+		# Pageouts:				 257.
+		# Object cache: 6603 hits of 1713223 lookups (0% hit rate)
+		'darwin' => (
+		    q{
+			$vm = `vm_stat`;
+			print (($vm =~ /page size of (\d+)/)[0] *
+			       (($vm =~ /Pages free:\s+(\d+)/)[0] +
+				($vm =~ /Pages inactive:\s+(\d+)/)[0]));
+		    }),
+		);
+	    my $perlscript = "";
+	    # Make a perl script that detects the OS ($^O) and runs
+	    # the appropriate command
+	    for my $os (keys %script_of) {
+		$perlscript .= 'if($^O eq "'.$os.'") { '.$script_of{$os}.'}';
+	    }
+	    $script = "perl -e " . ::Q(::spacefree(1,$perlscript));
+	}
+	return $script;
+    }
+}
+
+sub limit($) {
+    # Returns:
+    #  0 = Below limit. Start another job.
+    #  1 = Over limit. Start no jobs.
+    #  2 = Kill youngest job
+    my $self = shift;
+
+    if(not defined $self->{'limitscript'}) {
+	my %limitscripts =
+	    ("io" => q!
+	     io() {
+		 limit=$1;
+		 io_file=$2;
+		 # Do the measurement in the background
+		 ((tmp=$(tempfile);
+		 LANG=C iostat -x 1 2 > $tmp;
+		 mv $tmp $io_file) </dev/null >/dev/null & );
+		 perl -e '-e $ARGV[0] or exit(1);
+		   for(reverse <>) {
+		     /Device/ and last;
+		     /(\S+)$/ and $max = $max > $1 ? $max : $1; }
+		   exit ('$limit' < $max)' $io_file;
+	     };
+	     io %s %s
+	     !,
+	     "mem" => q!
+	     mem() {
+		 limit=$1;
+		 awk '/^((Swap)?Cached|MemFree|Buffers):/{ sum += $2}
+		      END {
+			 if (sum*1024 < '$limit'/2) { exit 2; }
+			 else { exit (sum*1024 < '$limit') }
+		      }' /proc/meminfo;
+	     };
+	     mem %s;
+	     !,
+	     "load" => q!
+	     load() {
+		 limit=$1;
+		 ps ax -o state,command |
+		     grep -E '^[DOR].[^[]' |
+		     wc -l |
+		 perl -ne 'exit ('$limit' < $_)';
+	     };
+	     load %s
+	     !,
+	    );
+	my ($cmd,@args) = split /\s+/,$opt::limit;
+	if($limitscripts{$cmd}) {
+	    my $tmpfile = ::tmpname("parlmt");
+	    ++$Global::unlink{$tmpfile};
+	    $self->{'limitscript'} =
+	    ::spacefree(1, sprintf($limitscripts{$cmd},
+				   ::multiply_binary_prefix(@args),$tmpfile));
+	} else {
+	    $self->{'limitscript'} = $opt::limit;
+	}
+    }
+
+    my %env = %ENV;
+    local %ENV = %env;
+    $ENV{'SSHLOGIN'} = $self->string();
+    system($Global::shell,"-c",$self->{'limitscript'});
+    #::qqx($self->{'limitscript'});
+    ::debug("limit","limit `".$self->{'limitscript'}."` result ".($?>>8)."\n");
+    return $?>>8;
+}
+
+
+sub swapping($) {
+    my $self = shift;
+    my $swapping = $self->swap_activity();
+    return (not defined $swapping or $swapping)
+}
+
+sub swap_activity($) {
+    # If the currently known swap activity is too old:
+    #	Recompute a new one in the background
+    # Returns:
+    #	last swap activity computed
+    my $self = shift;
+    # Should we update the swap_activity file?
+    my $update_swap_activity_file = 0;
+    # Test with (on 64 core machine):
+    # seq 100 | parallel --lb -j100 'seq 1000 | parallel  --noswap -j 1 true'
+    if(open(my $swap_fh, "<", $self->{'swap_activity_file'})) {
+	my $swap_out = <$swap_fh>;
+	close $swap_fh;
+	if($swap_out =~ /^(\d+)$/) {
+	    $self->{'swap_activity'} = $1;
+	    ::debug("swap", "New swap_activity: ", $self->{'swap_activity'});
+	}
+	::debug("swap", "Last update: ", $self->{'last_swap_activity_update'});
+	if(time - $self->{'last_swap_activity_update'} > 10) {
+	    # last swap activity update was started 10 seconds ago
+	    ::debug("swap", "Older than 10 sec: ", $self->{'swap_activity_file'});
+	    $update_swap_activity_file = 1;
+	}
+    } else {
+	::debug("swap", "No swap_activity file: ", $self->{'swap_activity_file'});
+	$self->{'swap_activity'} = undef;
+	$update_swap_activity_file = 1;
+    }
+    if($update_swap_activity_file) {
+	::debug("swap", "Updating swap_activity file ", $self->{'swap_activity_file'});
+	$self->{'last_swap_activity_update'} = time;
+	my $dir = ::dirname($self->{'swap_activity_file'});
+	-d $dir or eval { File::Path::mkpath($dir); };
+	my $swap_activity;
+	$swap_activity = swapactivityscript();
+	if(not $self->local()) {
+	    $swap_activity = $self->wrap($swap_activity);
+	}
+	# Run swap_activity measuring.
+	# As the command can take long to run if run remote
+	# save it to a tmp file before moving it to the correct file
+	my $file = $self->{'swap_activity_file'};
+	my ($dummy_fh, $tmpfile) = ::tmpfile(SUFFIX => ".swp");
+	::debug("swap", "\n", $swap_activity, "\n");
+	::qqx("($swap_activity > $tmpfile && mv $tmpfile $file || rm $tmpfile &)");
+    }
+    return $self->{'swap_activity'};
+}
+
+{
+    my $script;
+
+    sub swapactivityscript() {
+	# Returns:
+	#   shellscript for detecting swap activity
+	#
+	# arguments for vmstat are OS dependant
+	# swap_in and swap_out are in different columns depending on OS
+	#
+	if(not $script) {
+	    my %vmstat = (
+		# linux: $7*$8
+		# $ vmstat 1 2
+		# procs -----------memory---------- ---swap-- -----io---- -system-- ----cpu----
+		#  r  b	  swpd	 free	buff  cache   si   so	 bi    bo   in	 cs us sy id wa
+		#  5  0	 51208 1701096 198012 18857888	  0    0    37	 153   28   19 56 11 33	 1
+		#  3  0	 51208 1701288 198012 18857972	  0    0     0	   0 3638 10412 15  3 82  0
+		'linux' => ['vmstat 1 2 | tail -n1', '$7*$8'],
+
+		# solaris: $6*$7
+		# $ vmstat -S 1 2
+		#  kthr	     memory	       page	       disk	     faults	 cpu
+		#  r b w   swap	 free  si  so pi po fr de sr s3 s4 -- --   in	sy   cs us sy id
+		#  0 0 0 4628952 3208408 0  0  3  1  1	0  0 -0	 2  0  0  263  613  246	 1  2 97
+		#  0 0 0 4552504 3166360 0  0  0  0  0	0  0  0	 0  0  0  246  213  240	 1  1 98
+		'solaris' => ['vmstat -S 1 2 | tail -1', '$6*$7'],
+
+		# darwin (macosx): $21*$22
+		# $ vm_stat -c 2 1
+		# Mach Virtual Memory Statistics: (page size of 4096 bytes)
+		#     free   active   specul inactive throttle	  wired	 prgable   faults     copy    0fill reactive   purged file-backed anonymous cmprssed cmprssor  dcomprs	 comprs	 pageins  pageout  swapins swapouts
+		#   346306   829050    74871   606027	     0	 240231	   90367  544858K 62343596  270837K    14178   415070	   570102    939846	 356	  370	   116	    922	 4019813	4	 0	  0
+		#   345740   830383    74875   606031	     0	 239234	   90369     2696      359	553	   0	    0	   570110    941179	 356	  370	     0	      0	       0	0	 0	  0
+		'darwin' => ['vm_stat -c 2 1 | tail -n1', '$21*$22'],
+
+		# ultrix: $12*$13
+		# $ vmstat -S 1 2
+		#  procs      faults	cpu	 memory		     page	      disk
+		#  r b w   in  sy  cs us sy id	avm  fre  si so	 pi  po	 fr  de	 sr s0
+		#  1 0 0    4  23   2  3  0 97 7743 217k   0  0	  0   0	  0   0	  0  0
+		#  1 0 0    6  40   8  0  1 99 7743 217k   0  0	  3   0	  0   0	  0  0
+		'ultrix' => ['vmstat -S 1 2 | tail -1', '$12*$13'],
+
+		# aix: $6*$7
+		# $ vmstat 1 2
+		# System configuration: lcpu=1 mem=2048MB
+		#
+		# kthr	  memory	      page		faults	      cpu
+		# ----- ----------- ------------------------ ------------ -----------
+		#  r  b	  avm	fre  re	 pi  po	 fr   sr  cy  in   sy  cs us sy id wa
+		#  0  0 333933 241803	0   0	0   0	 0   0	10  143	 90  0	0 99  0
+		#  0  0 334125 241569	0   0	0   0	 0   0	37 5368 184  0	9 86  5
+		'aix' => ['vmstat 1 2 | tail -n1', '$6*$7'],
+
+		# freebsd: $8*$9
+		# $ vmstat -H 1 2
+		#  procs      memory	  page			  disks	    faults	   cpu
+		#  r b w     avm    fre	  flt  re  pi  po    fr	 sr ad0 ad1   in   sy	cs us sy id
+		#  1 0 0  596716   19560    32	 0   0	 0    33   8   0   0   11  220	277  0	0 99
+		#  0 0 0  596716   19560     2	 0   0	 0     0   0   0   0   11  144	263  0	1 99
+		'freebsd' => ['vmstat -H 1 2 | tail -n1', '$8*$9'],
+
+		# mirbsd: $8*$9
+		# $ vmstat 1 2
+		#  procs   memory	 page			 disks	   traps	 cpu
+		#  r b w    avm	   fre	 flt  re  pi  po  fr  sr wd0 cd0  int	sys   cs us sy id
+		#  0 0 0  25776 164968	  34   0   0   0   0   0   0   0  230	259   38  4  0 96
+		#  0 0 0  25776 164968	  24   0   0   0   0   0   0   0  237	275   37  0  0 100
+		'mirbsd' => ['vmstat 1 2 | tail -n1', '$8*$9'],
+
+		# netbsd: $7*$8
+		# $ vmstat 1 2
+		#  procs    memory	page			   disks   faults      cpu
+		#  r b	    avm	   fre	flt  re	 pi   po   fr	sr w0 w1   in	sy  cs us sy id
+		#  0 0	 138452	  6012	 54   0	  0    0    1	 2  3  0    4  100  23	0  0 100
+		#  0 0	 138456	  6008	  1   0	  0    0    0	 0  0  0    7	26  19	0 0 100
+		'netbsd' => ['vmstat 1 2 | tail -n1', '$7*$8'],
+
+		# openbsd: $8*$9
+		# $ vmstat 1 2
+		#  procs    memory	 page			 disks	  traps		 cpu
+		#  r b w    avm	    fre	 flt  re  pi  po  fr  sr wd0 wd1  int	sys   cs us sy id
+		#  0 0 0  76596	 109944	  73   0   0   0   0   0   0   1    5	259   22  0  1 99
+		#  0 0 0  76604	 109936	  24   0   0   0   0   0   0   0    7	114   20  0  1 99
+		'openbsd' => ['vmstat 1 2 | tail -n1', '$8*$9'],
+
+		# hpux: $8*$9
+		# $ vmstat 1 2
+		#	   procs	   memory		    page			      faults	   cpu
+		#     r	    b	  w	 avm	free   re   at	  pi   po    fr	  de	sr     in     sy    cs	us sy id
+		#     1	    0	  0   247211  216476	4    1	   0	0     0	   0	 0    102  73005    54	 6 11 83
+		#     1	    0	  0   247211  216421   43    9	   0	0     0	   0	 0    144   1675    96	25269512791222387000 25269512791222387000 105
+		'hpux' => ['vmstat 1 2 | tail -n1', '$8*$9'],
+
+		# dec_osf (tru64): $11*$12
+		# $ vmstat  1 2
+		# Virtual Memory Statistics: (pagesize = 8192)
+		#   procs      memory	     pages			      intr	 cpu
+		#   r	w   u  act free wire fault  cow zero react  pin pout  in  sy  cs us sy id
+		#   3 181  36  51K 1895 8696  348M  59M 122M   259  79M	   0   5 218 302  4  1 94
+		#   3 181  36  51K 1893 8696	 3   15	  21	 0   28	   0   4  81 321  1  1 98
+		'dec_osf' => ['vmstat 1 2 | tail -n1', '$11*$12'],
+
+		# gnu (hurd): $7*$8
+		# $ vmstat -k 1 2
+		# (pagesize: 4, size: 512288, swap size: 894972)
+		#   free   actv	 inact	wired	zeroed	react	 pgins	 pgouts	 pfaults  cowpfs hrat	 caobj	cache swfree
+		# 371940  30844	 89228	20276	298348	    0	 48192	  19016	  756105   99808  98%	   876	20628 894972
+		# 371940  30844	 89228	20276	    +0	   +0	    +0	     +0	     +42      +2  98%	   876	20628 894972
+		'gnu' => ['vmstat -k 1 2 | tail -n1', '$7*$8'],
+
+		# -nto (qnx has no swap)
+		#-irix
+		#-svr5 (scosysv)
+		);
+	    my $perlscript = "";
+	    # Make a perl script that detects the OS ($^O) and runs
+	    # the appropriate vmstat command
+	    for my $os (keys %vmstat) {
+		$vmstat{$os}[1] =~ s/\$/\\\\\\\$/g; # $ => \\\$
+		$perlscript .= 'if($^O eq "'.$os.'") { print `'.$vmstat{$os}[0].' | awk "{print ' .
+		    $vmstat{$os}[1] . '}"` }';
+	    }
+	    $script = "perl -e " . ::Q($perlscript);
+	}
+	return $script;
+    }
+}
+
+sub too_fast_remote_login($) {
+    my $self = shift;
+    if($self->{'last_login_at'} and $self->{'time_to_login'}) {
+	# sshd normally allows 10 simultaneous logins
+	# A login takes time_to_login
+	# So time_to_login/5 should be safe
+	# If now <= last_login + time_to_login/5: Then it is too soon.
+	my $too_fast = (::now() <= $self->{'last_login_at'}
+			+ $self->{'time_to_login'}/5);
+	::debug("run", "Too fast? $too_fast ");
+	return $too_fast;
+    } else {
+	# No logins so far (or time_to_login not computed): it is not too fast
+	return 0;
+    }
+}
+
+sub last_login_at($) {
+    my $self = shift;
+    return $self->{'last_login_at'};
+}
+
+sub set_last_login_at($$) {
+    my $self = shift;
+    $self->{'last_login_at'} = shift;
+}
+
+sub loadavg_too_high($) {
+    my $self = shift;
+    my $loadavg = $self->loadavg();
+    if(defined $loadavg) {
+	::debug("load", "Load $loadavg > ",$self->max_loadavg());
+	return $loadavg >= $self->max_loadavg();
+    } else {
+	# Unknown load: Assume load is too high
+	return 1;
+    }
+}
+
+
+
+sub loadavg($) {
+    # If the currently know loadavg is too old:
+    #	Recompute a new one in the background
+    # The load average is computed as the number of processes waiting
+    # for disk or CPU right now. So it is the server load this instant
+    # and not averaged over several minutes. This is needed so GNU
+    # Parallel will at most start one job that will push the load over
+    # the limit.
+    #
+    # Returns:
+    #	$last_loadavg = last load average computed (undef if none)
+
+    my $self = shift;
+    sub loadavg_cmd() {
+	if(not $Global::loadavg_cmd) {
+	    # aix => "ps -ae -o state,command" # state wrong
+	    # bsd => "ps ax -o state,command"
+	    # sysv => "ps -ef -o s -o comm"
+	    # cygwin => perl -ne 'close STDERR; /Name/ and print"\n"; \
+	    #	 /(Name|Pid|Ppid|State):\s+(\S+)/ and print "$2\t";' /proc/*/status |
+	    #	 awk '{print $2,$1}'
+	    # dec_osf => bsd
+	    # dragonfly => bsd
+	    # freebsd => bsd
+	    # gnu => bsd
+	    # hpux => ps -el|awk '{print $2,$14,$15}'
+	    # irix => ps -ef -o state -o comm
+	    # linux => bsd
+	    # minix => ps el|awk '{print \$1,\$11}'
+	    # mirbsd => bsd
+	    # netbsd => bsd
+	    # openbsd => bsd
+	    # solaris => sysv
+	    # svr5 => sysv
+	    # ultrix => ps -ax | awk '{print $3,$5}'
+	    # unixware => ps -el|awk '{print $2,$14,$15}'
+	    my $ps = ::spacefree(1,q{
+		$sysv="ps -ef -o s -o comm";
+		$sysv2="ps -ef -o state -o comm";
+		$bsd="ps ax -o state,command";
+		# Treat threads as processes
+		$bsd2="ps axH -o state,command";
+		$psel="ps -el|awk '{ print \$2,\$14,\$15 }'";
+		$cygwin=q{ perl -ne 'close STDERR; /Name/ and print"\n";
+		    /(Name|Pid|Ppid|State):\s+(\S+)/ and print "$2\t";' /proc/*/status |
+		    awk '{print $2,$1}' };
+		$dummy="echo S COMMAND;echo R dummy";
+		%ps=(
+		    # TODO Find better code for AIX/Android
+		    'aix' => "uptime",
+		    'android' => "uptime",
+		    'cygwin' => $cygwin,
+		    'darwin' => $bsd,
+		    'dec_osf' => $sysv2,
+		    'dragonfly' => $bsd,
+		    'freebsd' => $bsd2,
+		    'gnu' => $bsd,
+		    'hpux' => $psel,
+		    'irix' => $sysv2,
+		    'linux' => $bsd2,
+		    'minix' => "ps el|awk '{print \$1,\$11}'",
+		    'mirbsd' => $bsd,
+		    'msys' => $cygwin,
+		    'netbsd' => $bsd,
+		    'nto' => $dummy,
+		    'openbsd' => $bsd,
+		    'solaris' => $sysv,
+		    'svr5' => $psel,
+		    'ultrix' => "ps -ax | awk '{print \$3,\$5}'",
+		    'MSWin32' => $sysv,
+		    );
+		print `$ps{$^O}`;
+	    });
+	    # The command is too long for csh, so base64_wrap the command
+	    $Global::loadavg_cmd = $self->hexwrap($ps);
+	}
+	return $Global::loadavg_cmd;
+    }
+    # Should we update the loadavg file?
+    my $update_loadavg_file = 0;
+    if(open(my $load_fh, "<", $self->{'loadavg_file'})) {
+	local $/; # $/ = undef => slurp whole file
+	my $load_out = <$load_fh>;
+	close $load_fh;
+	if($load_out =~ /\S/) {
+	    # Content can be empty if ~/ is on NFS
+	    # due to reading being non-atomic.
+	    #
+	    # Count lines starting with D,O,R but command does not start with [
+	    my $load =()= ($load_out=~/(^\s?[DOR]\S* +(?=[^\[])\S)/gm);
+	    if($load > 0) {
+		# load is overestimated by 1
+		$self->{'loadavg'} = $load - 1;
+		::debug("load", "New loadavg: ", $self->{'loadavg'},"\n");
+	    } elsif ($load_out=~/average: (\d+.\d+)/) {
+		# AIX does not support instant load average
+		# 04:11AM   up 21 days,	 12:55,	 1 user,  load average: 1.85, 1.57, 1.55
+		$self->{'loadavg'} = $1;
+	    } else {
+		::die_bug("loadavg_invalid_content: " .
+			  $self->{'loadavg_file'} . "\n$load_out");
+	    }
+	}
+	$update_loadavg_file = 1;
+    } else {
+	::debug("load", "No loadavg file: ", $self->{'loadavg_file'});
+	$self->{'loadavg'} = undef;
+	$update_loadavg_file = 1;
+    }
+    if($update_loadavg_file) {
+	::debug("load", "Updating loadavg file", $self->{'loadavg_file'}, "\n");
+	$self->{'last_loadavg_update'} = time;
+	my $dir = ::dirname($self->{'swap_activity_file'});
+	-d $dir or eval { File::Path::mkpath($dir); };
+	-w $dir or ::die_bug("Cannot write to $dir");
+	my $cmd = "";
+	if($self->{'string'} ne ":") {
+	    $cmd = $self->wrap(loadavg_cmd());
+	} else {
+	    $cmd .= loadavg_cmd();
+	}
+	# As the command can take long to run if run remote
+	# save it to a tmp file before moving it to the correct file
+	::debug("load", "Update load\n");
+	my $file = $self->{'loadavg_file'};
+	# tmpfile on same filesystem as $file
+	my $tmpfile = $file.$$;
+	$ENV{'SSHPASS'} = $self->{'password'};
+	::qqx("($cmd > $tmpfile && mv $tmpfile $file || rm $tmpfile & )");
+    }
+    return $self->{'loadavg'};
+}
+
+sub max_loadavg($) {
+    my $self = shift;
+    # If --load is a file it might be changed
+    if($Global::max_load_file) {
+	my $mtime = (stat($Global::max_load_file))[9];
+	if($mtime > $Global::max_load_file_last_mod) {
+	    $Global::max_load_file_last_mod = $mtime;
+	    for my $sshlogin (values %Global::host) {
+		$sshlogin->set_max_loadavg(undef);
+	    }
+	}
+    }
+    if(not defined $self->{'max_loadavg'}) {
+	$self->{'max_loadavg'} =
+	    $self->compute_max_loadavg($opt::load);
+    }
+    ::debug("load", "max_loadavg: ", $self->string(), " ", $self->{'max_loadavg'});
+    return $self->{'max_loadavg'};
+}
+
+sub set_max_loadavg($$) {
+    my $self = shift;
+    $self->{'max_loadavg'} = shift;
+}
+
+sub compute_max_loadavg($) {
+    # Parse the max loadaverage that the user asked for using --load
+    # Returns:
+    #	max loadaverage
+    my $self = shift;
+    my $loadspec = shift;
+    my $load;
+    if(defined $loadspec) {
+	if($loadspec =~ /^\+(\d+)$/) {
+	    # E.g. --load +2
+	    my $j = $1;
+	    $load =
+		$self->ncpus() + $j;
+	} elsif ($loadspec =~ /^-(\d+)$/) {
+	    # E.g. --load -2
+	    my $j = $1;
+	    $load =
+		$self->ncpus() - $j;
+	} elsif ($loadspec =~ /^(\d+)\%$/) {
+	    my $j = $1;
+	    $load =
+		$self->ncpus() * $j / 100;
+	} elsif ($loadspec =~ /^(\d+(\.\d+)?)$/) {
+	    $load = $1;
+	} elsif (-f $loadspec) {
+	    $Global::max_load_file = $loadspec;
+	    $Global::max_load_file_last_mod = (stat($Global::max_load_file))[9];
+	    if(open(my $in_fh, "<", $Global::max_load_file)) {
+		my $opt_load_file = join("",<$in_fh>);
+		close $in_fh;
+		$load = $self->compute_max_loadavg($opt_load_file);
+	    } else {
+		::error("Cannot open $loadspec.");
+		::wait_and_exit(255);
+	    }
+	} else {
+	    ::error("Parsing of --load failed.");
+	    ::die_usage();
+	}
+	if($load < 0.01) {
+	    $load = 0.01;
+	}
+    }
+    return $load;
+}
+
+sub time_to_login($) {
+    my $self = shift;
+    return $self->{'time_to_login'};
+}
+
+sub set_time_to_login($$) {
+    my $self = shift;
+    $self->{'time_to_login'} = shift;
+}
+
+sub max_jobs_running($) {
+    my $self = shift;
+    if(not defined $self->{'max_jobs_running'}) {
+	my $nproc = $self->compute_number_of_processes($opt::jobs);
+	$self->set_max_jobs_running($nproc);
+    }
+    return $self->{'max_jobs_running'};
+}
+
+sub orig_max_jobs_running($) {
+    my $self = shift;
+    return $self->{'orig_max_jobs_running'};
+}
+
+sub compute_number_of_processes($) {
+    # Number of processes wanted and limited by system resources
+    # Returns:
+    #	Number of processes
+    my $self = shift;
+    my $opt_P = shift;
+    my $wanted_processes = $self->user_requested_processes($opt_P);
+    if(not defined $wanted_processes) {
+	$wanted_processes = $Global::default_simultaneous_sshlogins;
+    }
+    ::debug("load", "Wanted procs: $wanted_processes\n");
+    my $system_limit =
+	$self->processes_available_by_system_limit($wanted_processes);
+    ::debug("load", "Limited to procs: $system_limit\n");
+    return $system_limit;
+}
+
+{
+    my @children;
+    my $max_system_proc_reached;
+    my $more_filehandles;
+    my %fh;
+    my $tmpfhname;
+    my $count_jobs_already_read;
+    my @jobs;
+    my $job;
+    my @args;
+    my $arg;
+
+    sub reserve_filehandles($) {
+	# Reserves filehandle
+	my $n = shift;
+	for (1..$n) {
+	    $more_filehandles &&= open($fh{$tmpfhname++}, "<", "/dev/null");
+	}
+    }
+
+    sub reserve_process() {
+	# Spawn a dummy process
+	my $child;
+	if($child = fork()) {
+	    push @children, $child;
+	    $Global::unkilled_children{$child} = 1;
+	} elsif(defined $child) {
+	    # This is the child
+	    # The child takes one process slot
+	    # It will be killed later
+	    $SIG{'TERM'} = $Global::original_sig{'TERM'};
+	    if($^O eq "cygwin" or $^O eq "msys" or $^O eq "nto") {
+		# The exec does not work on Cygwin and QNX
+		sleep 10101010;
+	    } else {
+		# 'exec sleep' takes less RAM than sleeping in perl
+		exec 'sleep', 10101;
+	    }
+	    exit(0);
+	} else {
+	    # Failed to spawn
+	    $max_system_proc_reached = 1;
+	}
+    }
+
+    sub get_args_or_jobs() {
+	# Get an arg or a job (depending on mode)
+	if($Global::semaphore or ($opt::pipe and not $opt::tee)) {
+	    # Skip: No need to get args
+	    return 1;
+	} elsif(defined $opt::retries and $count_jobs_already_read) {
+	    # For retries we may need to run all jobs on this sshlogin
+	    # so include the already read jobs for this sshlogin
+	    $count_jobs_already_read--;
+	    return 1;
+	} else {
+	    if($opt::X or $opt::m) {
+		# The arguments may have to be re-spread over several jobslots
+		# So pessimistically only read one arg per jobslot
+		# instead of a full commandline
+		if($Global::JobQueue->{'commandlinequeue'}->{'arg_queue'}->empty()) {
+		    if($Global::JobQueue->empty()) {
+			return 0;
+		    } else {
+			$job = $Global::JobQueue->get();
+			push(@jobs, $job);
+			return 1;
+		    }
+		} else {
+		    $arg = $Global::JobQueue->{'commandlinequeue'}->{'arg_queue'}->get();
+		    push(@args, $arg);
+		    return 1;
+		}
+	    } else {
+		# If there are no more command lines, then we have a process
+		# per command line, so no need to go further
+		if($Global::JobQueue->empty()) {
+		    return 0;
+		} else {
+		    $job = $Global::JobQueue->get();
+		    # Replacement must happen here due to seq()
+		    $job and $job->replaced();
+		    push(@jobs, $job);
+		    return 1;
+		}
+	    }
+	}
+    }
+
+    sub cleanup() {
+	# Cleanup: Close the files
+	for (values %fh) { close $_ }
+	# Cleanup: Kill the children
+	for my $pid (@children) {
+	    kill 9, $pid;
+	    waitpid($pid,0);
+	    delete $Global::unkilled_children{$pid};
+	}
+	# Cleanup: Unget the command_lines or the @args
+	$Global::JobQueue->{'commandlinequeue'}{'arg_queue'}->unget(@args);
+	@args = ();
+	$Global::JobQueue->unget(@jobs);
+	@jobs = ();
+    }
+
+    sub processes_available_by_system_limit($) {
+	# If the wanted number of processes is bigger than the system limits:
+	# Limit them to the system limits
+	# Limits are: File handles, number of input lines, processes,
+	# and taking > 1 second to spawn 10 extra processes
+	# Returns:
+	#   Number of processes
+	my $self = shift;
+	my $wanted_processes = shift;
+	my $system_limit = 0;
+	my $slow_spawning_warning_printed = 0;
+	my $time = time;
+	$more_filehandles = 1;
+	$tmpfhname = "TmpFhNamE";
+
+	# perl uses 7 filehandles for something?
+	# parallel uses 1 for memory_usage
+	# parallel uses 4 for ?
+	reserve_filehandles(12);
+	# Two processes for load avg and ?
+	reserve_process();
+	reserve_process();
+
+	# For --retries count also jobs already run
+	$count_jobs_already_read = $Global::JobQueue->next_seq();
+	my $wait_time_for_getting_args = 0;
+	my $start_time = time;
+	if($wanted_processes < $Global::infinity) {
+	    $Global::dummy_jobs = 1;
+	}
+	while(1) {
+	    $system_limit >= $wanted_processes and last;
+	    not $more_filehandles and last;
+	    $max_system_proc_reached and last;
+
+	    my $before_getting_arg = time;
+	    if(!$Global::dummy_jobs) {
+		get_args_or_jobs() or last;
+	    }
+	    $wait_time_for_getting_args += time - $before_getting_arg;
+	    $system_limit++;
+
+	    # Every simultaneous process uses 2 filehandles to write to
+	    # and 2 filehandles to read from
+	    reserve_filehandles(4);
+
+	    # System process limit
+	    reserve_process();
+
+	    my $forktime = time - $time - $wait_time_for_getting_args;
+	    ::debug("run", "Time to fork $system_limit procs: ".
+		    $wait_time_for_getting_args, " ", $forktime,
+		    " (processes so far: ", $system_limit,")\n");
+	    if($system_limit > 10 and
+	       $forktime > 1 and
+	       $forktime > $system_limit * 0.01) {
+		# It took more than 0.01 second to fork a processes on avg.
+		# Give the user a warning. He can press Ctrl-C if this
+		# sucks.
+		::warning_once(
+		      "Starting $system_limit processes took > $forktime sec.",
+		      "Consider adjusting -j. Press CTRL-C to stop.");
+	    }
+	}
+	cleanup();
+
+	if($system_limit < $wanted_processes) {
+	    # The system_limit is less than the wanted_processes
+	    if($system_limit < 1 and not $Global::JobQueue->empty()) {
+		::warning("Cannot spawn any jobs.",
+			  "Try increasing 'ulimit -u' (try: ulimit -u `ulimit -Hu`)",
+			  "or increasing 'nproc' in /etc/security/limits.conf",
+			  "or increasing /proc/sys/kernel/pid_max");
+		::wait_and_exit(255);
+	    }
+	    if(not $more_filehandles) {
+		::warning("Only enough file handles to run ".
+			  $system_limit. " jobs in parallel.",
+			  "Try running 'parallel -j0 -N $system_limit --pipe parallel -j0'",
+			  "or increasing 'ulimit -n' (try: ulimit -n `ulimit -Hn`)",
+			  "or increasing 'nofile' in /etc/security/limits.conf",
+			  "or increasing /proc/sys/fs/file-max");
+	    }
+	    if($max_system_proc_reached) {
+		::warning("Only enough available processes to run ".
+			  $system_limit. " jobs in parallel.",
+			  "Try increasing 'ulimit -u' (try: ulimit -u `ulimit -Hu`)",
+			  "or increasing 'nproc' in /etc/security/limits.conf",
+			  "or increasing /proc/sys/kernel/pid_max");
+	    }
+	}
+	if($] == 5.008008 and $system_limit > 1000) {
+	    # https://savannah.gnu.org/bugs/?36942
+	    $system_limit = 1000;
+	}
+	if($Global::JobQueue->empty()) {
+	    $system_limit ||= 1;
+	}
+	if($self->string() ne ":" and
+	   $system_limit > $Global::default_simultaneous_sshlogins) {
+	    $system_limit =
+		$self->simultaneous_sshlogin_limit($system_limit);
+	}
+	return $system_limit;
+    }
+}
+
+sub simultaneous_sshlogin_limit($) {
+    # Test by logging in wanted number of times simultaneously
+    # Returns:
+    #	min($wanted_processes,$working_simultaneous_ssh_logins-1)
+    my $self = shift;
+    my $wanted_processes = shift;
+    if($self->{'time_to_login'}) {
+	return $wanted_processes;
+    }
+
+    # Try twice because it guesses wrong sometimes
+    # Choose the minimal
+    my $ssh_limit =
+	::min($self->simultaneous_sshlogin($wanted_processes),
+	      $self->simultaneous_sshlogin($wanted_processes));
+    if($ssh_limit < $wanted_processes) {
+	my $serverlogin = $self->string();
+	::warning("ssh to $serverlogin only allows ".
+		  "for $ssh_limit simultaneous logins.",
+		  "You may raise this by changing",
+		  "/etc/ssh/sshd_config:MaxStartups and MaxSessions on $serverlogin.",
+		  "You can also try --sshdelay 0.1",
+		  "Using only ".($ssh_limit-1)." connections ".
+		  "to avoid race conditions.");
+	# Race condition can cause problem if using all sshs.
+	if($ssh_limit > 1) { $ssh_limit -= 1; }
+    }
+    return $ssh_limit;
+}
+
+sub simultaneous_sshlogin($) {
+    # Using $sshlogin try to see if we can do $wanted_processes
+    # simultaneous logins
+    # (ssh host echo simul-login & ssh host echo simul-login & ...) |
+    #	grep simul|wc -l
+    # Input:
+    #	$wanted_processes = Try for this many logins in parallel
+    # Returns:
+    #	$ssh_limit = Number of succesful parallel logins
+    local $/ = "\n";
+    my $self = shift;
+    my $wanted_processes = shift;
+    my $sshdelay = $opt::sshdelay ? "sleep $opt::sshdelay;" : "";
+    # TODO sh -c wrapper to work for csh
+    my $cmd = ($sshdelay.$self->wrap("echo simultaneouslogin").
+	       "</dev/null 2>&1 &")x$wanted_processes;
+    ::debug("init","Trying $wanted_processes logins at ".$self->string()."\n");
+    open (my $simul_fh, "-|", "($cmd)|grep simultaneouslogin | wc -l") or
+	::die_bug("simultaneouslogin");
+    my $ssh_limit = <$simul_fh>;
+    close $simul_fh;
+    chomp $ssh_limit;
+    return $ssh_limit;
+}
+
+sub set_ncpus($$) {
+    my $self = shift;
+    $self->{'ncpus'} = shift;
+}
+
+sub user_requested_processes($) {
+    # Parse the number of processes that the user asked for using -j
+    # Input:
+    #	$opt_P = string formatted as for -P
+    # Returns:
+    #	$processes = the number of processes to run on this sshlogin
+    my $self = shift;
+    my $opt_P = shift;
+    my $processes;
+    if(defined $opt_P) {
+	if($opt_P =~ /^\+(\d+)$/) {
+	    # E.g. -P +2
+	    my $j = $1;
+	    $processes =
+		$self->ncpus() + $j;
+	} elsif ($opt_P =~ /^-(\d+)$/) {
+	    # E.g. -P -2
+	    my $j = $1;
+	    $processes =
+		$self->ncpus() - $j;
+	} elsif ($opt_P =~ /^(\d+(\.\d+)?)\%$/) {
+	    # E.g. -P 10.5%
+	    my $j = $1;
+	    $processes =
+		$self->ncpus() * $j / 100;
+	} elsif ($opt_P =~ /^(\d+)$/) {
+	    $processes = $1;
+	    if($processes == 0) {
+		# -P 0 = infinity (or at least close)
+		$processes = $Global::infinity;
+	    }
+	} elsif (-f $opt_P) {
+	    $Global::max_procs_file = $opt_P;
+	    if(open(my $in_fh, "<", $Global::max_procs_file)) {
+		my $opt_P_file = join("",<$in_fh>);
+		close $in_fh;
+		$processes = $self->user_requested_processes($opt_P_file);
+	    } else {
+		::error("Cannot open $opt_P.");
+		::wait_and_exit(255);
+	    }
+	} else {
+	    ::error("Parsing of --jobs/-j/--max-procs/-P failed.");
+	    ::die_usage();
+	}
+	$processes = ::ceil($processes);
+    }
+    return $processes;
+}
+
+sub ncpus($) {
+    # Number of CPU threads
+    # --use_sockets_instead_of_threads = count socket instead
+    # --use_cores_instead_of_threads = count physical cores instead
+    # Returns:
+    #	$ncpus = number of cpu (threads) on this sshlogin
+    local $/ = "\n";
+    my $self = shift;
+    if(not defined $self->{'ncpus'}) {
+	if($self->local()) {
+	    if($opt::use_sockets_instead_of_threads) {
+		$self->{'ncpus'} = socket_core_thread()->{'sockets'};
+	    } elsif($opt::use_cores_instead_of_threads) {
+		$self->{'ncpus'} = socket_core_thread()->{'cores'};
+	    } else {
+		$self->{'ncpus'} = socket_core_thread()->{'threads'};
+	    }
+	} else {
+	    my $ncpu;
+	    $ENV{'SSHPASS'} = $self->{'password'};
+	    ::debug("init",("echo | ".$self->wrap("parallel --number-of-sockets")));
+	    if($opt::use_sockets_instead_of_threads
+	       or
+		$opt::use_cpus_instead_of_cores) {
+		$ncpu = ::qqx("echo | ".$self->wrap("parallel --number-of-sockets"));
+	    } elsif($opt::use_cores_instead_of_threads) {
+		$ncpu = ::qqx("echo | ".$self->wrap("parallel --number-of-cores"));
+	    } else {
+		$ncpu = ::qqx("echo | ".$self->wrap("parallel --number-of-threads"));
+	    }
+	    chomp $ncpu;
+	    if($ncpu =~ /^\s*[0-9]+\s*$/s) {
+		$self->{'ncpus'} = $ncpu;
+	    } else {
+		::warning("Could not figure out ".
+			  "number of cpus on ".$self->string." ($ncpu). Using 1.");
+		$self->{'ncpus'} = 1;
+	    }
+	}
+    }
+    return $self->{'ncpus'};
+}
+
+
+sub nproc() {
+    # Returns:
+    #	Number of threads using `nproc`
+    my $no_of_threads = ::qqx("nproc");
+    chomp $no_of_threads;
+    return $no_of_threads;
+}
+
+sub no_of_sockets() {
+    return socket_core_thread()->{'sockets'};
+}
+
+sub no_of_cores() {
+    return socket_core_thread()->{'cores'};
+}
+
+sub no_of_threads() {
+    return socket_core_thread()->{'threads'};
+}
+
+sub socket_core_thread() {
+    # Returns:
+    #	{
+    #	  'sockets' => #sockets = number of socket with CPU present
+    #	  'cores' => #cores = number of physical cores
+    #	  'threads' => #threads = number of compute cores (hyperthreading)
+    #	  'active' => #taskset_threads = number of taskset limited cores
+    #	}
+    my $cpu;
+    if ($^O eq 'linux') {
+	$cpu = sct_gnu_linux($cpu);
+    } elsif ($^O eq 'android') {
+	$cpu = sct_android($cpu);
+    } elsif ($^O eq 'freebsd') {
+	$cpu = sct_freebsd($cpu);
+    } elsif ($^O eq 'netbsd') {
+	$cpu = sct_netbsd($cpu);
+    } elsif ($^O eq 'openbsd') {
+	$cpu = sct_openbsd($cpu);
+    } elsif ($^O eq 'gnu') {
+	$cpu = sct_hurd($cpu);
+    } elsif ($^O eq 'darwin') {
+	$cpu = sct_darwin($cpu);
+    } elsif ($^O eq 'solaris') {
+	$cpu = sct_solaris($cpu);
+    } elsif ($^O eq 'aix') {
+	$cpu = sct_aix($cpu);
+    } elsif ($^O eq 'hpux') {
+	$cpu = sct_hpux($cpu);
+    } elsif ($^O eq 'nto') {
+	$cpu = sct_qnx($cpu);
+    } elsif ($^O eq 'svr5') {
+	$cpu = sct_openserver($cpu);
+    } elsif ($^O eq 'irix') {
+	$cpu = sct_irix($cpu);
+    } elsif ($^O eq 'dec_osf') {
+	$cpu = sct_tru64($cpu);
+    } else {
+	# Try all methods until we find something that works
+	$cpu = (sct_gnu_linux($cpu)
+		|| sct_android($cpu)
+		|| sct_freebsd($cpu)
+		|| sct_netbsd($cpu)
+		|| sct_openbsd($cpu)
+		|| sct_hurd($cpu)
+		|| sct_darwin($cpu)
+		|| sct_solaris($cpu)
+		|| sct_aix($cpu)
+		|| sct_hpux($cpu)
+		|| sct_qnx($cpu)
+		|| sct_openserver($cpu)
+		|| sct_irix($cpu)
+		|| sct_tru64($cpu)
+	    );
+    }
+    if(not $cpu) {
+	# Fall back: Set all to nproc
+	my $nproc = nproc();
+	if($nproc) {
+	    $cpu->{'sockets'} =
+		$cpu->{'cores'} =
+		$cpu->{'threads'} =
+		$cpu->{'active'} =
+		$nproc;
+	}
+    }
+    if(not $cpu) {
+	::warning("Cannot figure out number of cpus. Using 1.");
+	$cpu->{'sockets'} =
+	    $cpu->{'cores'} =
+	    $cpu->{'threads'} =
+	    $cpu->{'active'} =
+	    1
+    }
+    $cpu->{'sockets'} ||= 1;
+    $cpu->{'threads'} ||= $cpu->{'cores'};
+    $cpu->{'active'} ||= $cpu->{'threads'};
+    chomp($cpu->{'sockets'},
+	  $cpu->{'cores'},
+	  $cpu->{'threads'},
+	  $cpu->{'active'});
+    # Choose minimum of active and actual
+    my $mincpu;
+    $mincpu->{'sockets'} = ::min($cpu->{'sockets'},$cpu->{'active'});
+    $mincpu->{'cores'} = ::min($cpu->{'cores'},$cpu->{'active'});
+    $mincpu->{'threads'} = ::min($cpu->{'threads'},$cpu->{'active'});
+    return $mincpu;
+}
+
+sub sct_gnu_linux($) {
+    # Returns:
+    #	{ 'sockets' => #sockets
+    #	  'cores' => #cores
+    #	  'threads' => #threads
+    #	  'active' => #taskset_threads }
+    my $cpu = shift;
+
+    sub read_topology($) {
+	my $prefix = shift;
+	my %sibiling;
+	my %socket;
+	my $thread;
+	for($thread = 0;
+	    -r "$prefix/cpu$thread/topology/physical_package_id";
+	    $thread++) {
+	    open(my $fh,"<",
+		 "$prefix/cpu$thread/topology/physical_package_id")
+		|| die;
+	    $socket{<$fh>}++;
+	    close $fh;
+	}
+	for($thread = 0;
+	    -r "$prefix/cpu$thread/topology/thread_siblings";
+	    $thread++) {
+	    open(my $fh,"<",
+		 "$prefix/cpu$thread/topology/thread_siblings")
+		|| die;
+	    $sibiling{<$fh>}++;
+	    close $fh;
+	}
+	$cpu->{'sockets'} = keys %socket;
+	$cpu->{'cores'} = keys %sibiling;
+	$cpu->{'threads'} = $thread;
+    }
+
+    sub read_cpuinfo(@) {
+	my @cpuinfo = @_;
+	$cpu->{'sockets'} = 0;
+	$cpu->{'cores'} = 0;
+	$cpu->{'threads'} = 0;
+	my %seen;
+	my %phy_seen;
+	my $physicalid;
+	for(@cpuinfo) {
+	    # physical id : 0
+	    if(/^physical id.*[:](.*)/) {
+		$physicalid = $1;
+		if(not $phy_seen{$1}++) {
+		    $cpu->{'sockets'}++;
+		}
+	    }
+	    # core id : 3
+	    if(/^core id.*[:](.*)/ and not $seen{$physicalid,$1}++) {
+		$cpu->{'cores'}++;
+	    }
+	    # processor : 2
+	    /^processor.*[:]\s*\d/i and $cpu->{'threads'}++;
+	}
+	$cpu->{'cores'} ||= $cpu->{'threads'};
+	$cpu->{'cpus'} ||= $cpu->{'threads'};
+	$cpu->{'sockets'} ||= 1;
+    }
+
+    sub read_lscpu(@) {
+	my @lscpu = @_;
+	my $threads_per_core;
+	my $cores_per_socket;
+	for(@lscpu) {
+	    /^CPU.s.:\s*(\d+)/ and $cpu->{'threads'} = $1;
+	    /^Thread.s. per core:\s*(\d+)/ and $threads_per_core = $1;
+	    /^Core.s. per socket:\s*(\d+)/ and $cores_per_socket = $1;
+	    /^(CPU )?Socket.s.:\s*(\d+)/i and $cpu->{'sockets'} = $2;
+	}
+	if($threads_per_core and $cpu->{'threads'}) {
+	    $cpu->{'cores'} =  $cpu->{'threads'} / $threads_per_core;
+	}
+	$cpu->{'cpus'} ||= $cpu->{'threads'};
+    }
+
+    local $/ = "\n"; # If delimiter is set, then $/ will be wrong
+    my @cpuinfo;
+    my @lscpu;
+    if($ENV{'PARALLEL_CPUINFO'}) {
+	# Use CPUINFO from environment - used for testing only
+	read_cpuinfo(split/(?<=\n)/,$ENV{'PARALLEL_CPUINFO'});
+    } elsif($ENV{'PARALLEL_LSCPU'}) {
+	# Use LSCPU from environment - used for testing only
+	read_lscpu(split/(?<=\n)/,$ENV{'PARALLEL_LSCPU'});
+    } elsif(-r "$ENV{'PARALLEL_CPUPREFIX'}/cpu0/topology/thread_siblings") {
+	# Use CPUPREFIX from environment - used for testing only
+	read_topology($ENV{'PARALLEL_CPUPREFIX'});
+    } elsif($cpu->{'sockets'} and $cpu->{'cores'} and $cpu->{'threads'}) {
+	# Skip /proc/cpuinfo - already set
+    } else {
+	# Not debugging: Look at this computer
+	if(!($cpu->{'sockets'} and $cpu->{'cores'} and $cpu->{'threads'})
+	   and
+	   open(my $in_fh, "-|", "lscpu")) {
+	    # Parse output from lscpu
+	    read_lscpu(<$in_fh>);
+	    close $in_fh;
+	}
+	if(!($cpu->{'sockets'} and $cpu->{'cores'} and $cpu->{'threads'})
+	   and
+	   -r "/sys/devices/system/cpu/cpu0/topology/thread_siblings") {
+	    read_topology("/sys/devices/system/cpu");
+	}
+	if(!($cpu->{'sockets'} and $cpu->{'cores'} and $cpu->{'threads'})
+	   and
+	   open(my $in_fh, "<", "/proc/cpuinfo")) {
+	    # Read /proc/cpuinfo
+	    read_cpuinfo(<$in_fh>);
+	    close $in_fh;
+	}
+    }
+    if(-e "/proc/self/status" and not $ENV{'PARALLEL_CPUINFO'}) {
+	# if 'taskset' is used to limit number of threads
+	if(open(my $in_fh, "<", "/proc/self/status")) {
+	    while(<$in_fh>) {
+		if(/^Cpus_allowed:\s*(\S+)/) {
+		    my $a = $1;
+		    $a =~ tr/,//d;
+		    $cpu->{'active'} = unpack ("%32b*", pack ("H*",$a));
+		}
+	    }
+	    close $in_fh;
+	}
+    }
+    return $cpu;
+}
+
+sub sct_android($) {
+    # Returns:
+    #	{ 'sockets' => #sockets
+    #	  'cores' => #cores
+    #	  'threads' => #threads
+    #	  'active' => #taskset_threads }
+    # Use GNU/Linux
+    return sct_gnu_linux($_[0]);
+}
+
+sub sct_freebsd($) {
+    # Returns:
+    #	{ 'sockets' => #sockets
+    #	  'cores' => #cores
+    #	  'threads' => #threads
+    #	  'active' => #taskset_threads }
+    local $/ = "\n";
+    my $cpu = shift;
+    $cpu->{'cores'} ||=
+	(::qqx(qq{ sysctl -a dev.cpu | grep \%parent | awk '{ print \$2 }' | uniq | wc -l | awk '{ print \$1 }' })
+	 or
+	 ::qqx(qq{ sysctl hw.ncpu | awk '{ print \$2 }' }));
+    $cpu->{'threads'} ||=
+	(::qqx(qq{ sysctl hw.ncpu | awk '{ print \$2 }' })
+	 or
+	 ::qqx(qq{ sysctl -a dev.cpu | grep \%parent | awk '{ print \$2 }' | uniq | wc -l | awk '{ print \$1 }' }));
+    return $cpu;
+}
+
+sub sct_netbsd($) {
+    # Returns:
+    #	{ 'sockets' => #sockets
+    #	  'cores' => #cores
+    #	  'threads' => #threads
+    #	  'active' => #taskset_threads }
+    local $/ = "\n";
+    my $cpu = shift;
+    $cpu->{'cores'} ||= ::qqx("sysctl -n hw.ncpu");
+    return $cpu;
+}
+
+sub sct_openbsd($) {
+    # Returns:
+    #	{ 'sockets' => #sockets
+    #	  'cores' => #cores
+    #	  'threads' => #threads
+    #	  'active' => #taskset_threads }
+    local $/ = "\n";
+    my $cpu = shift;
+    $cpu->{'cores'} ||= ::qqx('sysctl -n hw.ncpu');
+    return $cpu;
+}
+
+sub sct_hurd($) {
+    # Returns:
+    #	{ 'sockets' => #sockets
+    #	  'cores' => #cores
+    #	  'threads' => #threads
+    #	  'active' => #taskset_threads }
+    local $/ = "\n";
+    my $cpu = shift;
+    $cpu->{'cores'} ||= ::qqx("nproc");
+    return $cpu;
+}
+
+sub sct_darwin($) {
+    # Returns:
+    #	{ 'sockets' => #sockets
+    #	  'cores' => #cores
+    #	  'threads' => #threads
+    #	  'active' => #taskset_threads }
+    local $/ = "\n";
+    my $cpu = shift;
+    $cpu->{'cores'} ||=
+	(::qqx('sysctl -n hw.physicalcpu')
+	 or
+	 ::qqx(qq{ sysctl -a hw | grep [^a-z]physicalcpu[^a-z] | awk '{ print \$2 }' }));
+    $cpu->{'threads'} ||=
+	(::qqx('sysctl -n hw.logicalcpu')
+	 or
+	 ::qqx(qq{ sysctl -a hw | grep [^a-z]logicalcpu[^a-z] | awk '{ print \$2 }' }));
+    return $cpu;
+}
+
+sub sct_solaris($) {
+    # Returns:
+    #	{ 'sockets' => #sockets
+    #	  'cores' => #cores
+    #	  'threads' => #threads
+    #	  'active' => #taskset_threads }
+    local $/ = "\n";
+    my $cpu = shift;
+    if(not $cpu->{'cores'}) {
+	if(-x "/usr/bin/kstat") {
+	    my @chip_id = ::qqx("/usr/bin/kstat cpu_info|grep chip_id");
+	    if($#chip_id >= 0) {
+		$cpu->{'sockets'} ||= $#chip_id +1;
+	    }
+	    my @core_id = ::qqx("/usr/bin/kstat -m cpu_info|grep -w core_id|uniq");
+	    if($#core_id >= 0) {
+		$cpu->{'cores'} ||= $#core_id +1;
+	    }
+	}
+	if(-x "/usr/sbin/psrinfo") {
+	    my @psrinfo = ::qqx("/usr/sbin/psrinfo -p");
+	    if($#psrinfo >= 0) {
+		$cpu->{'sockets'} ||= $psrinfo[0];
+	    }
+	}
+	if(-x "/usr/sbin/prtconf") {
+	    my @prtconf = ::qqx("/usr/sbin/prtconf | grep cpu..instance");
+	    if($#prtconf >= 0) {
+		$cpu->{'cores'} ||= $#prtconf +1;
+	    }
+	}
+    }
+    return $cpu;
+}
+
+sub sct_aix($) {
+    # Returns:
+    #	{ 'sockets' => #sockets
+    #	  'cores' => #cores
+    #	  'threads' => #threads
+    #	  'active' => #taskset_threads }
+    local $/ = "\n";
+    my $cpu = shift;
+    if(not $cpu->{'cores'}) {
+	if(-x "/usr/sbin/lscfg") {
+	    if(open(my $in_fh, "-|",
+		    "/usr/sbin/lscfg -vs |grep proc | wc -l|tr -d ' '")) {
+		$cpu->{'cores'} = <$in_fh>;
+		close $in_fh;
+	    }
+	}
+    }
+    if(not $cpu->{'threads'}) {
+	if(-x "/usr/bin/vmstat") {
+	    if(open(my $in_fh, "-|", "/usr/bin/vmstat 1 1")) {
+		while(<$in_fh>) {
+		    /lcpu=([0-9]*) / and $cpu->{'threads'} = $1;
+		}
+		close $in_fh;
+	    }
+	}
+    }
+    return $cpu;
+}
+
+sub sct_hpux($) {
+    # Returns:
+    #	{ 'sockets' => #sockets
+    #	  'cores' => #cores
+    #	  'threads' => #threads
+    #	  'active' => #taskset_threads }
+    local $/ = "\n";
+    my $cpu = shift;
+    $cpu->{'cores'} ||=
+	::qqx(qq{ /usr/bin/mpsched -s 2>&1 | grep 'Locality Domain Count' | awk '{ print \$4 }'});
+    $cpu->{'threads'} ||=
+	::qqx(qq{ /usr/bin/mpsched -s 2>&1 | perl -ne '/Processor Count\\D+(\\d+)/ and print "\$1"'});
+    return $cpu;
+}
+
+sub sct_qnx($) {
+    # Returns:
+    #	{ 'sockets' => #sockets
+    #	  'cores' => #cores
+    #	  'threads' => #threads
+    #	  'active' => #taskset_threads }
+    local $/ = "\n";
+    my $cpu = shift;
+    # BUG: It is not known how to calculate this.
+
+    return $cpu;
+}
+
+sub sct_openserver($) {
+    # Returns:
+    #	{ 'sockets' => #sockets
+    #	  'cores' => #cores
+    #	  'threads' => #threads
+    #	  'active' => #taskset_threads }
+    local $/ = "\n";
+    my $cpu = shift;
+    if(not $cpu->{'cores'}) {
+	if(-x "/usr/sbin/psrinfo") {
+	    my @psrinfo = ::qqx("/usr/sbin/psrinfo");
+	    if($#psrinfo >= 0) {
+		$cpu->{'cores'} = $#psrinfo +1;
+	    }
+	}
+    }
+    $cpu->{'sockets'} ||= $cpu->{'cores'};
+    return $cpu;
+}
+
+sub sct_irix($) {
+    # Returns:
+    #	{ 'sockets' => #sockets
+    #	  'cores' => #cores
+    #	  'threads' => #threads
+    #	  'active' => #taskset_threads }
+    local $/ = "\n";
+    my $cpu = shift;
+    $cpu->{'cores'} ||=
+	::qqx(qq{ hinv | grep HZ | grep Processor | awk '{print \$1}' });
+    return $cpu;
+}
+
+sub sct_tru64($) {
+    # Returns:
+    #	{ 'sockets' => #sockets
+    #	  'cores' => #cores
+    #	  'threads' => #threads
+    #	  'active' => #taskset_threads }
+    local $/ = "\n";
+    my $cpu = shift;
+    $cpu->{'cores'} ||= ::qqx("sizer -pr");
+    $cpu->{'sockets'} ||= $cpu->{'cores'};
+    $cpu->{'threads'} ||= $cpu->{'cores'};
+
+    return $cpu;
+}
+
+sub sshcommand($) {
+    # Returns:
+    #	$sshcommand = the command (incl options) to run when using ssh
+    my $self = shift;
+    if (not defined $self->{'sshcommand'}) {
+	::die_bug("sshcommand not set");
+    }
+    return $self->{'sshcommand'};
+}
+
+sub local($) {
+    my $self = shift;
+    return $self->{'local'};
+}
+
+sub control_path_dir($) {
+    # Returns:
+    #	$control_path_dir = dir of control path (for -M)
+    my $self = shift;
+    if(not defined $self->{'control_path_dir'}) {
+	$self->{'control_path_dir'} =
+	    # Use $ENV{'TMPDIR'} as that is typically not
+	    # NFS mounted
+	    File::Temp::tempdir($ENV{'TMPDIR'}
+				. "/control_path_dir-XXXX",
+				CLEANUP => 1);
+    }
+    return $self->{'control_path_dir'};
+}
+
+sub rsync_transfer_cmd($) {
+    # Command to run to transfer a file
+    # Input:
+    #	$file = filename of file to transfer
+    #	$workdir = destination dir
+    # Returns:
+    #	$cmd = rsync command to run to transfer $file ("" if unreadable)
+    my $self = shift;
+    my $file = shift;
+    my $workdir = shift;
+    if(not -r $file) {
+	::warning($file. " is not readable and will not be transferred.");
+	return "true";
+    }
+    my $rsync_destdir;
+    my $relpath = ($file !~ m:^/:) || ($file =~ m:/\./:); # Is the path relative or /./?
+    if($relpath) {
+	$rsync_destdir = ::shell_quote_file($workdir);
+    } else {
+	# rsync /foo/bar /
+	$rsync_destdir = "/";
+    }
+    $file = ::shell_quote_file($file);
+    # Make dir if it does not exist
+    return($self->wrap("mkdir -p $rsync_destdir") . " && " .
+	   $self->rsync()." $file ".$self->{'host'}.":$rsync_destdir");
+}
+
+{
+    my $rsync_protocol;
+
+    sub rsync($) {
+	sub rsync_protocol {
+	    # rsync 3.1.x uses protocol 31 which is unsupported by 2.5.7.
+	    # If the version >= 3.1.0: downgrade to protocol 30
+	    # Returns:
+	    #   $rsync = "rsync" or "rsync --protocol 30"
+	    if(not $rsync_protocol) {
+		my @out = `rsync --version`;
+		if(not @out) {
+		    if(::which("rsync")) {
+			::die_bug("'rsync --version' gave no output.");
+		    } else {
+			::error("'rsync' is not in \$PATH.");
+			::wait_and_exit(255);
+		    }
+		}
+		for (@out) {
+		    # rsync	 version 3.1.3	protocol version 31
+		    # rsync	 version v3.2.3	 protocol version 31
+		    if(/version v?(\d+.\d+)(.\d+)?/) {
+			if($1 >= 3.1) {
+			    # Version 3.1.0 or later: Downgrade to protocol 30
+			    $rsync_protocol = "rsync --protocol 30";
+			} else {
+			    $rsync_protocol = "rsync";
+			}
+		    }
+		}
+		$rsync_protocol or
+		    ::die_bug("Cannot figure out version of rsync: @out");
+	    }
+	    return $rsync_protocol;
+	}
+	my $self = shift;
+
+	return rsync_protocol()." ".$ENV{'PARALLEL_RSYNC_OPTS'}.
+	    " -e".::Q($self->sshcmd());
+    }
+}
+
+sub cleanup_cmd($$$) {
+    # Command to run to remove the remote file
+    # Input:
+    #	$file = filename to remove
+    #	$workdir = destination dir
+    # Returns:
+    #	$cmd = ssh command to run to remove $file and empty parent dirs
+    my $self = shift;
+    my $file = shift;
+    my $workdir = shift;
+    my $f = $file;
+    if($f =~ m:/\./:) {
+	# foo/bar/./baz/quux => workdir/baz/quux
+	# /foo/bar/./baz/quux => workdir/baz/quux
+	$f =~ s:.*/\./:$workdir/:;
+    } elsif($f =~ m:^[^/]:) {
+	# foo/bar => workdir/foo/bar
+	$f = $workdir."/".$f;
+    }
+    my @subdirs = split m:/:, ::dirname($f);
+    my @rmdir;
+    my $dir = "";
+    for(@subdirs) {
+	$dir .= $_."/";
+	unshift @rmdir, ::shell_quote_file($dir);
+    }
+    my $rmdir = @rmdir ? "rmdir @rmdir 2>/dev/null;" : "";
+    if(defined $opt::workdir and $opt::workdir eq "...") {
+	$rmdir .= "rm -rf " . ::shell_quote_file($workdir).';';
+    }
+    my $rmf = "sh -c ".
+	::Q("rm -f ".::shell_quote_file($f)." 2>/dev/null;".$rmdir);
+    return $self->wrap(::Q($rmf));
+}
+
+package JobQueue;
+
+sub new($) {
+    my $class = shift;
+    my $commandref = shift;
+    my $read_from = shift;
+    my $context_replace = shift;
+    my $max_number_of_args = shift;
+    my $transfer_files = shift;
+    my $return_files = shift;
+    my $template_names = shift;
+    my $template_contents = shift;
+    my $commandlinequeue = CommandLineQueue->new
+	($commandref, $read_from, $context_replace, $max_number_of_args,
+	 $transfer_files, $return_files, $template_names, $template_contents);
+    my @unget = ();
+    return bless {
+	'unget' => \@unget,
+	'commandlinequeue' => $commandlinequeue,
+	'this_job_no' => 0,
+	'total_jobs' => undef,
+    }, ref($class) || $class;
+}
+
+sub get($) {
+    my $self = shift;
+
+    $self->{'this_job_no'}++;
+    if(@{$self->{'unget'}}) {
+	my $job = shift @{$self->{'unget'}};
+	# {%} may have changed, so flush computed values
+	$job && $job->flush_cache();
+	return $job;
+    } else {
+	my $commandline = $self->{'commandlinequeue'}->get();
+	if(defined $commandline) {
+	    return Job->new($commandline);
+	} else {
+	    $self->{'this_job_no'}--;
+	    return undef;
+	}
+    }
+}
+
+sub unget($) {
+    my $self = shift;
+    unshift @{$self->{'unget'}}, @_;
+    $self->{'this_job_no'} -= @_;
+}
+
+sub empty($) {
+    my $self = shift;
+    my $empty = (not @{$self->{'unget'}}) &&
+	$self->{'commandlinequeue'}->empty();
+    ::debug("run", "JobQueue->empty $empty ");
+    return $empty;
+}
+
+sub total_jobs($) {
+    my $self = shift;
+    if(not defined $self->{'total_jobs'}) {
+	if($opt::pipe and not $opt::tee) {
+	    ::error("--pipe is incompatible with --eta/--bar/--shuf");
+	    ::wait_and_exit(255);
+	}
+	if($opt::totaljobs) {
+	    $self->{'total_jobs'} = $opt::totaljobs;
+	} elsif($opt::sqlworker) {
+	    $self->{'total_jobs'} = $Global::sql->total_jobs();
+	} else {
+	    my $record;
+	    my @arg_records;
+	    my $record_queue = $self->{'commandlinequeue'}{'arg_queue'};
+	    my $start = time;
+	    while($record = $record_queue->get()) {
+		push @arg_records, $record;
+		if(time - $start > 10) {
+		    ::warning("Reading ".scalar(@arg_records).
+			      " arguments took longer than 10 seconds.");
+		    $opt::eta && ::warning("Consider removing --eta.");
+		    $opt::bar && ::warning("Consider removing --bar.");
+		    $opt::shuf && ::warning("Consider removing --shuf.");
+		    last;
+		}
+	    }
+	    while($record = $record_queue->get()) {
+		push @arg_records, $record;
+	    }
+	    if($opt::shuf and @arg_records) {
+		my $i = @arg_records;
+		while (--$i) {
+		    my $j = int rand($i+1);
+		    @arg_records[$i,$j] = @arg_records[$j,$i];
+		}
+	    }
+	    $record_queue->unget(@arg_records);
+	    # $#arg_records = number of args - 1
+	    # We have read one @arg_record for this job (so add 1 more)
+	    my $num_args = $#arg_records + 2;
+	    # This jobs is not started so -1
+	    my $started_jobs = $self->{'this_job_no'} - 1;
+	    my $max_args = ::max($Global::max_number_of_args,1);
+	    $self->{'total_jobs'} = ::ceil($num_args / $max_args)
+		+ $started_jobs;
+	    ::debug("init","Total jobs: ".$self->{'total_jobs'}.
+		    " ($num_args/$max_args + $started_jobs)\n");
+	}
+    }
+    return $self->{'total_jobs'};
+}
+
+sub flush_total_jobs($) {
+    # Unset total_jobs to force recomputing
+    my $self = shift;
+    ::debug("init","flush Total jobs: ");
+    $self->{'total_jobs'} = undef;
+}
+
+sub next_seq($) {
+    my $self = shift;
+
+    return $self->{'commandlinequeue'}->seq();
+}
+
+sub quote_args($) {
+    my $self = shift;
+    return $self->{'commandlinequeue'}->quote_args();
+}
+
+
+package Job;
+
+sub new($) {
+    my $class = shift;
+    my $commandlineref = shift;
+    return bless {
+	'commandline' => $commandlineref, # CommandLine object
+	'workdir' => undef, # --workdir
+	# filehandle for stdin (used for --pipe)
+	# filename for writing stdout to (used for --files)
+	# remaining data not sent to stdin (used for --pipe)
+	# tmpfiles to cleanup when job is done
+	'unlink' => [],
+	# amount of data sent via stdin (used for --pipe)
+	'transfersize' => 0, # size of files using --transfer
+	'returnsize' => 0, # size of files using --return
+	'pid' => undef,
+	# hash of { SSHLogins => number of times the command failed there }
+	'failed' => undef,
+	'sshlogin' => undef,
+	# The commandline wrapped with rsync and ssh
+	'sshlogin_wrap' => undef,
+	'exitstatus' => undef,
+	'exitsignal' => undef,
+	# Timestamp for timeout if any
+	'timeout' => undef,
+	'virgin' => 1,
+	# Output used for SQL and CSV-output
+	'output' => { 1 => [], 2 => [] },
+	'halfline' => { 1 => [], 2 => [] },
+    }, ref($class) || $class;
+}
+
+sub flush_cache($) {
+    my $self = shift;
+    $self->{'commandline'}->flush_cache();
+}
+
+sub replaced($) {
+    my $self = shift;
+    $self->{'commandline'} or ::die_bug("commandline empty");
+    return $self->{'commandline'}->replaced();
+}
+
+{
+    my $next_available_row;
+
+    sub row($) {
+	my $self = shift;
+	if(not defined $self->{'row'}) {
+	    if($opt::keeporder) {
+		$self->{'row'} = $self->seq();
+	    } else {
+		$self->{'row'} = ++$next_available_row;
+	    }
+	}
+	return $self->{'row'};
+    }
+}
+
+sub seq($) {
+    my $self = shift;
+    return $self->{'commandline'}->seq();
+}
+
+sub set_seq($$) {
+    my $self = shift;
+    return $self->{'commandline'}->set_seq(shift);
+}
+
+sub slot($) {
+    my $self = shift;
+    return $self->{'commandline'}->slot();
+}
+
+sub free_slot($) {
+    my $self = shift;
+    push @Global::slots, $self->slot();
+}
+
+{
+    my($cattail);
+
+    sub cattail() {
+	# Returns:
+	#   $cattail = perl program for:
+	#     cattail "decomp-prg" wpid [file_stdin] [file_to_unlink]
+	#     decomp-prg     = decompress program
+	#     wpid	     = pid of writer program
+	#     file_stdin     = file_to_decompress
+	#     file_to_unlink = unlink this file
+	if(not $cattail) {
+	    $cattail = q{
+		# cat followed by tail (possibly with rm as soon at the file is opened)
+		# If $writerpid dead: finish after this round
+		use Fcntl;
+		$|=1;
+
+		my ($comfile, $cmd, $writerpid, $read_file, $unlink_file) = @ARGV;
+		if($read_file) {
+		    open(IN,"<",$read_file) || die("cattail: Cannot open $read_file");
+		} else {
+		    *IN = *STDIN;
+		}
+		while(! -s $comfile) {
+		    # Writer has not opened the buffer file, so we cannot remove it yet
+		    $sleep = ($sleep < 30) ? ($sleep * 1.001 + 0.01) : ($sleep);
+		    usleep($sleep);
+		}
+		# The writer and we have both opened the file, so it is safe to unlink it
+		unlink $unlink_file;
+		unlink $comfile;
+
+		my $first_round = 1;
+		my $flags;
+		fcntl(IN, F_GETFL, $flags) || die $!; # Get the current flags on the filehandle
+		$flags |= O_NONBLOCK; # Add non-blocking to the flags
+		fcntl(IN, F_SETFL, $flags) || die $!; # Set the flags on the filehandle
+
+		while(1) {
+		    # clear EOF
+		    seek(IN,0,1);
+		    my $writer_running = kill 0, $writerpid;
+		    $read = sysread(IN,$buf,131072);
+		    if($read) {
+			if($first_round) {
+			    # Only start the command if there any input to process
+			    $first_round = 0;
+			    open(OUT,"|-",$cmd) || die("cattail: Cannot run $cmd");
+			}
+
+			# Blocking print
+			while($buf) {
+			    my $bytes_written = syswrite(OUT,$buf);
+			    # syswrite may be interrupted by SIGHUP
+			    substr($buf,0,$bytes_written) = "";
+			}
+			# Something printed: Wait less next time
+			$sleep /= 2;
+		    } else {
+			if(eof(IN) and not $writer_running) {
+			    # Writer dead: There will never be sent more to the decompressor
+			    close OUT;
+			    exit;
+			}
+			# TODO This could probably be done more efficiently using select(2)
+			# Nothing read: Wait longer before next read
+			# Up to 100 milliseconds
+			$sleep = ($sleep < 100) ? ($sleep * 1.001 + 0.01) : ($sleep);
+			usleep($sleep);
+		    }
+		}
+
+		sub usleep {
+		    # Sleep this many milliseconds.
+		    my $secs = shift;
+		    select(undef, undef, undef, $secs/1000);
+		}
+	    };
+	    $cattail =~ s/#.*//mg;
+	    $cattail =~ s/\s+/ /g;
+	}
+	return $cattail;
+    }
+}
+
+sub openoutputfiles($) {
+    # Open files for STDOUT and STDERR
+    # Set file handles in $self->fh
+    my $self = shift;
+    my ($outfhw, $errfhw, $outname, $errname);
+
+    if($opt::latestline) {
+	# Do not save to files: Use non-blocking pipe
+	my ($outfhr, $errfhr);
+	pipe($outfhr, $outfhw) || die;
+	$self->set_fh(1,'w',$outfhw);
+	$self->set_fh(2,'w',$outfhw);
+	$self->set_fh(1,'r',$outfhr);
+	$self->set_fh(2,'r',$outfhr);
+	# Make it possible to read non-blocking from the pipe
+	for my $fdno (1,2) {
+	    ::set_fh_non_blocking($self->fh($fdno,'r'));
+	}
+	# Return immediately because we do not need setting filenames
+	return;
+    } elsif($Global::linebuffer and not
+       ($opt::keeporder or $opt::files or $opt::results or
+	$opt::compress or $opt::compress_program or
+	$opt::decompress_program)) {
+	# Do not save to files: Use non-blocking pipe
+	my ($outfhr, $errfhr);
+	pipe($outfhr, $outfhw) || die;
+	pipe($errfhr, $errfhw) || die;
+	$self->set_fh(1,'w',$outfhw);
+	$self->set_fh(2,'w',$errfhw);
+	$self->set_fh(1,'r',$outfhr);
+	$self->set_fh(2,'r',$errfhr);
+	# Make it possible to read non-blocking from the pipe
+	for my $fdno (1,2) {
+	    ::set_fh_non_blocking($self->fh($fdno,'r'));
+	}
+	# Return immediately because we do not need setting filenames
+	return;
+    } elsif($opt::results and not $Global::csvsep and not $Global::jsonout) {
+	# If --results, but not --results *.csv/*.tsv
+	my $out = $self->{'commandline'}->results_out();
+	my $seqname;
+	if($out eq $opt::results or $out =~ m:/$:) {
+	    # $opt::results = simple string or ending in /
+	    # => $out is a dir/
+	    # prefix/name1/val1/name2/val2/seq
+	    $seqname = $out."seq";
+	    # prefix/name1/val1/name2/val2/stdout
+	    $outname = $out."stdout";
+	    # prefix/name1/val1/name2/val2/stderr
+	    $errname = $out."stderr";
+	} else {
+	    # $opt::results = replacement string not ending in /
+	    # => $out is a file
+	    $outname = $out;
+	    $errname = "$out.err";
+	    $seqname = "$out.seq";
+	}
+	my $seqfhw;
+	if(not open($seqfhw, "+>", $seqname)) {
+	    ::error("Cannot write to `$seqname'.");
+	    ::wait_and_exit(255);
+	}
+	print $seqfhw $self->seq();
+	close $seqfhw;
+	if(not open($outfhw, "+>", $outname)) {
+	    ::error("Cannot write to `$outname'.");
+	    ::wait_and_exit(255);
+	}
+	if(not open($errfhw, "+>", $errname)) {
+	    ::error("Cannot write to `$errname'.");
+	    ::wait_and_exit(255);
+	}
+	$self->set_fh(1,"unlink","");
+	$self->set_fh(2,"unlink","");
+	if($opt::sqlworker) {
+	    # Save the filenames in SQL table
+	    $Global::sql->update("SET Stdout = ?, Stderr = ? ".
+				 "WHERE Seq = ". $self->seq(),
+				 $outname, $errname);
+	}
+    } elsif(not $opt::ungroup) {
+	# To group we create temporary files for STDOUT and STDERR
+	# To avoid the cleanup unlink the files immediately (but keep them open)
+	if($opt::files) {
+	    ($outfhw, $outname) = ::tmpfile(SUFFIX => ".par");
+	    ($errfhw, $errname) = ::tmpfile(SUFFIX => ".par");
+	    # --files => only remove stderr
+	    $self->set_fh(1,"unlink","");
+	    $self->set_fh(2,"unlink",$errname);
+	} else {
+	    ($outfhw, $outname) = ::tmpfile(SUFFIX => ".par");
+	    ($errfhw, $errname) = ::tmpfile(SUFFIX => ".par");
+	    $self->set_fh(1,"unlink",$outname);
+	    $self->set_fh(2,"unlink",$errname);
+	}
+    } else {
+	# --ungroup
+	open($outfhw,">&",$Global::fh{1}) || die;
+	open($errfhw,">&",$Global::fh{2}) || die;
+	# File name must be empty as it will otherwise be printed
+	$outname = "";
+	$errname = "";
+	$self->set_fh(1,"unlink",$outname);
+	$self->set_fh(2,"unlink",$errname);
+    }
+    # Set writing FD
+    $self->set_fh(1,'w',$outfhw);
+    $self->set_fh(2,'w',$errfhw);
+    $self->set_fh(1,'name',$outname);
+    $self->set_fh(2,'name',$errname);
+    if($opt::compress) {
+	$self->filter_through_compress();
+    } elsif(not $opt::ungroup) {
+	$self->grouped();
+    }
+    if($Global::linebuffer) {
+	# Make it possible to read non-blocking from
+	# the buffer files
+	# Used for --linebuffer with -k, --files, --res, --compress*
+	for my $fdno (1,2) {
+	    ::set_fh_non_blocking($self->fh($fdno,'r'));
+	}
+    }
+}
+
+sub print_verbose_dryrun($) {
+    # If -v set: print command to stdout (possibly buffered)
+    # This must be done before starting the command
+    my $self = shift;
+    if($Global::verbose or $opt::dryrun) {
+	my $fh = $self->fh(1,"w");
+	if($Global::verbose <= 1) {
+	    print $fh $self->replaced(),"\n";
+	} else {
+	    # Verbose level > 1: Print the rsync and stuff
+	    print $fh $self->wrapped(),"\n";
+	}
+    }
+    if($opt::sqlworker) {
+	$Global::sql->update("SET Command = ? WHERE Seq = ".$self->seq(),
+			     $self->replaced());
+    }
+}
+
+sub add_rm($) {
+    # Files to remove when job is done
+    my $self = shift;
+    push @{$self->{'unlink'}}, @_;
+}
+
+sub get_rm($) {
+    # Files to remove when job is done
+    my $self = shift;
+    return @{$self->{'unlink'}};
+}
+
+sub cleanup($) {
+    # Remove files when job is done
+    my $self = shift;
+    unlink $self->get_rm();
+    delete @Global::unlink{$self->get_rm()};
+}
+
+sub grouped($) {
+    my $self = shift;
+    # Set reading FD if using --group (--ungroup does not need)
+    for my $fdno (1,2) {
+	# Re-open the file for reading
+	# so fdw can be closed seperately
+	# and fdr can be seeked seperately (for --line-buffer)
+	open(my $fdr,"<", $self->fh($fdno,'name')) ||
+	    ::die_bug("fdr: Cannot open ".$self->fh($fdno,'name'));
+	$self->set_fh($fdno,'r',$fdr);
+	# Unlink if not debugging
+	$Global::debug or ::rm($self->fh($fdno,"unlink"));
+    }
+}
+
+sub empty_input_wrapper($) {
+    # If no input: exit(0)
+    # If some input: Pass input as input to command on STDIN
+    # This avoids starting the command if there is no input.
+    # Input:
+    #	$command = command to pipe data to
+    # Returns:
+    #	$wrapped_command = the wrapped command
+    my $command = shift;
+    # The optimal block size differs
+    # It has been measured on:
+    # AMD 6376: 59000
+    # <big ppar --pipe --block 100M --test $1 -j1 'cat >/dev/null';
+    my $script =
+	::spacefree(0,q{
+	    if(sysread(STDIN, $buf, 1)) {
+		open($fh, "|-", @ARGV) || die;
+		syswrite($fh, $buf);
+		while($read = sysread(STDIN, $buf, 59000)) {
+		    syswrite($fh, $buf);
+		}
+		close $fh;
+		exit ($?&127 ? 128+($?&127) : 1+$?>>8)
+	    }
+		  });
+    ::debug("run",'Empty wrap: perl -e '.::Q($script)."\n");
+    if($Global::cshell
+       and
+       length $command > 499) {
+	# csh does not like words longer than 1000 (499 quoted)
+	# $command = "perl -e '".base64_zip_eval()."' ".
+	# join" ",string_zip_base64(
+	#	  'exec "'.::perl_quote_scalar($command).'"');
+	return 'perl -e '.::Q($script)." ".
+	    base64_wrap("exec \"$Global::shell\",'-c',\"".
+				   ::perl_quote_scalar($command).'"');
+    } else {
+	return 'perl -e '.::Q($script)." ".
+	    $Global::shell." -c ".::Q($command);
+    }
+}
+
+sub filter_through_compress($) {
+    my $self = shift;
+    # Send stdout to stdin for $opt::compress_program(1)
+    # Send stderr to stdin for $opt::compress_program(2)
+    # cattail get pid:	$pid = $self->fh($fdno,'rpid');
+    my $cattail = cattail();
+
+    for my $fdno (1,2) {
+	# Make a communication file.
+	my ($fh, $comfile) = ::tmpfile(SUFFIX => ".pac");
+	close $fh;
+	# Compressor: (echo > $comfile; compress pipe) > output
+	# When the echo is written to $comfile,
+	# it is known that output file is opened,
+	# thus output file can then be removed by the decompressor.
+	# empty_input_wrapper is needed for plzip
+	my $wpid = open(my $fdw,"|-", "(echo > $comfile; ".
+			empty_input_wrapper($opt::compress_program).") >".
+			::Q($self->fh($fdno,'name'))) || die $?;
+	$self->set_fh($fdno,'w',$fdw);
+	$self->set_fh($fdno,'wpid',$wpid);
+	# Decompressor: open output; -s $comfile > 0: rm $comfile output;
+	#		decompress output > stdout
+	my $rpid = open(my $fdr, "-|", "perl", "-e", $cattail, $comfile,
+			$opt::decompress_program, $wpid,
+			$self->fh($fdno,'name'),$self->fh($fdno,'unlink'))
+	    || die $?;
+	$self->set_fh($fdno,'r',$fdr);
+	$self->set_fh($fdno,'rpid',$rpid);
+    }
+}
+
+sub set_fh($$$$) {
+    # Set file handle
+    my ($self, $fd_no, $key, $fh) = @_;
+    $self->{'fd'}{$fd_no,$key} = $fh;
+}
+
+sub fh($) {
+    # Get file handle
+    my ($self, $fd_no, $key) = @_;
+    return $self->{'fd'}{$fd_no,$key};
+}
+
+sub write_block($) {
+    my $self = shift;
+    my $stdin_fh = $self->fh(0,"w");
+    if(fork()) {
+	# Close in parent
+	close $stdin_fh;
+    } else {
+	# If writing is to a closed pipe:
+	#   Do not call signal handler, but let nothing be written
+	local $SIG{PIPE} = undef;
+
+	for my $part (
+	    grep { defined $_ }
+	    $self->{'header'},$self->{'block'}) {
+	    # syswrite may not write all in one go,
+	    # so make sure everything is written.
+	    my $written;
+	    while($written = syswrite($stdin_fh,$$part)) {
+		substr($$part,0,$written) = "";
+	    }
+	}
+	close $stdin_fh;
+	exit(0);
+    }
+}
+
+sub write($) {
+    my $self = shift;
+    my $remaining_ref = shift;
+    my $stdin_fh = $self->fh(0,"w");
+
+    my $len = length $$remaining_ref;
+    # syswrite may not write all in one go,
+    # so make sure everything is written.
+    my $written;
+
+    # If writing is to a closed pipe:
+    #	Do not call signal handler, but let nothing be written
+    local $SIG{PIPE} = undef;
+    while($written = syswrite($stdin_fh,$$remaining_ref)){
+	substr($$remaining_ref,0,$written) = "";
+    }
+}
+
+sub set_block($$$$$$) {
+    # Copy stdin buffer from $block_ref up to $endpos
+    # Prepend with $header_ref if virgin (i.e. not --roundrobin)
+    # Remove $recstart and $recend if needed
+    # Input:
+    #	$header_ref = ref to $header to prepend
+    #	$buffer_ref = ref to $buffer containing the block
+    #	$endpos = length of $block to pass on
+    #	$recstart = --recstart regexp
+    #	$recend = --recend regexp
+    # Returns:
+    #	N/A
+    my $self = shift;
+    my ($header_ref,$buffer_ref,$endpos,$recstart,$recend) = @_;
+    $self->{'header'} = $header_ref;
+    if($opt::roundrobin or $opt::remove_rec_sep or defined $opt::retries) {
+	my $a = "";
+	if(($opt::roundrobin or defined $opt::retries) and $self->virgin()) {
+	    $a .= $$header_ref;
+	}
+	# Job is no longer virgin
+	$self->set_virgin(0);
+	# Make a full copy because $buffer will change
+	$a .= substr($$buffer_ref,0,$endpos);
+	$self->{'block'} = \$a;
+	if($opt::remove_rec_sep) {
+	    remove_rec_sep($self->{'block'},$recstart,$recend);
+	}
+	$self->{'block_length'} = length ${$self->{'block'}};
+    } else {
+	$self->set_virgin(0);
+	for(substr($$buffer_ref,0,$endpos)) {
+	    $self->{'block'} = \$_;
+	}
+	$self->{'block_length'} = $endpos + length ${$self->{'header'}};
+    }
+    $self->{'block_pos'} = 0;
+    $self->add_transfersize($self->{'block_length'});
+}
+
+sub block_ref($) {
+    my $self = shift;
+    return $self->{'block'};
+}
+
+sub block_length($) {
+    my $self = shift;
+    return $self->{'block_length'};
+}
+
+sub remove_rec_sep($) {
+    # Remove --recstart and --recend from $block
+    # Input:
+    #	$block_ref = reference to $block to be modified
+    #	$recstart = --recstart
+    #	$recend = --recend
+    # Uses:
+    #	$opt::regexp = Are --recstart/--recend regexp?
+    # Returns:
+    #	N/A
+    my ($block_ref,$recstart,$recend) = @_;
+    # Remove record separator
+    if($opt::regexp) {
+	$$block_ref =~ s/$recend$recstart//gom;
+	$$block_ref =~ s/^$recstart//os;
+	$$block_ref =~ s/$recend$//os;
+    } else {
+	$$block_ref =~ s/\Q$recend$recstart\E//gom;
+	$$block_ref =~ s/^\Q$recstart\E//os;
+	$$block_ref =~ s/\Q$recend\E$//os;
+    }
+}
+
+sub non_blocking_write($) {
+    my $self = shift;
+    my $something_written = 0;
+
+    my $in = $self->fh(0,"w");
+    my $rv = syswrite($in,
+		      substr(${$self->{'block'}},$self->{'block_pos'}));
+    if (!defined($rv) && $! == ::EAGAIN()) {
+	# would block - but would have written
+	$something_written = 0;
+	# avoid triggering auto expanding block size
+	$Global::no_autoexpand_block ||= 1;
+    } elsif ($self->{'block_pos'}+$rv != $self->{'block_length'}) {
+	# incomplete write
+	# Remove the written part
+	$self->{'block_pos'} += $rv;
+	$something_written = $rv;
+    } else {
+	# successfully wrote everything
+	# Empty block to free memory
+	my $a = "";
+	$self->set_block(\$a,\$a,0,"","");
+	$something_written = $rv;
+    }
+    ::debug("pipe", "Non-block: ", $something_written);
+    return $something_written;
+}
+
+
+sub virgin($) {
+    my $self = shift;
+    return $self->{'virgin'};
+}
+
+sub set_virgin($$) {
+    my $self = shift;
+    $self->{'virgin'} = shift;
+}
+
+sub pid($) {
+    my $self = shift;
+    return $self->{'pid'};
+}
+
+sub set_pid($$) {
+    my $self = shift;
+    $self->{'pid'} = shift;
+}
+
+sub starttime($) {
+    # Returns:
+    #	UNIX-timestamp this job started
+    my $self = shift;
+    return sprintf("%.3f",$self->{'starttime'});
+}
+
+sub set_starttime($@) {
+    my $self = shift;
+    my $starttime = shift || ::now();
+    $self->{'starttime'} = $starttime;
+    $opt::sqlworker and
+	$Global::sql->update("SET Starttime = ? WHERE Seq = ".$self->seq(),
+			     $starttime);
+}
+
+sub runtime($) {
+    # Returns:
+    #	Run time in seconds with 3 decimals
+    my $self = shift;
+    return sprintf("%.3f",
+		   int(($self->endtime() - $self->starttime())*1000)/1000);
+}
+
+sub endtime($) {
+    # Returns:
+    #	UNIX-timestamp this job ended
+    #	0 if not ended yet
+    my $self = shift;
+    return ($self->{'endtime'} || 0);
+}
+
+sub set_endtime($$) {
+    my $self = shift;
+    my $endtime = shift;
+    $self->{'endtime'} = $endtime;
+    $opt::sqlworker and
+	$Global::sql->update("SET JobRuntime = ? WHERE Seq = ".$self->seq(),
+			     $self->runtime());
+}
+
+sub is_timedout($) {
+    # Is the job timedout?
+    # Input:
+    #	$delta_time = time that the job may run
+    # Returns:
+    #	True or false
+    my $self = shift;
+    my $delta_time = shift;
+    return time > $self->{'starttime'} + $delta_time;
+}
+
+sub kill($) {
+    my $self = shift;
+    $self->set_exitstatus(-1);
+    ::kill_sleep_seq($self->pid());
+}
+
+sub suspend($) {
+    my $self = shift;
+    my @pgrps = map { -$_ } $self->pid();
+    kill "STOP", @pgrps;
+    $self->set_suspended(1);
+}
+
+sub set_suspended($$) {
+    my $self = shift;
+    $self->{'suspended'} = shift;
+}
+
+sub suspended($) {
+    my $self = shift;
+    return $self->{'suspended'};
+}
+
+sub resume($) {
+    my $self = shift;
+    my @pgrps = map { -$_ } $self->pid();
+    kill "CONT", @pgrps;
+    $self->set_suspended(0);
+}
+
+sub failed($) {
+    # return number of times failed for this $sshlogin
+    # Input:
+    #	$sshlogin
+    # Returns:
+    #	Number of times failed for $sshlogin
+    my $self = shift;
+    my $sshlogin = shift;
+    return $self->{'failed'}{$sshlogin};
+}
+
+sub failed_here($) {
+    # return number of times failed for the current $sshlogin
+    # Returns:
+    #	Number of times failed for this sshlogin
+    my $self = shift;
+    return $self->{'failed'}{$self->sshlogin()};
+}
+
+sub add_failed($) {
+    # increase the number of times failed for this $sshlogin
+    my $self = shift;
+    my $sshlogin = shift;
+    $self->{'failed'}{$sshlogin}++;
+}
+
+sub add_failed_here($) {
+    # increase the number of times failed for the current $sshlogin
+    my $self = shift;
+    $self->{'failed'}{$self->sshlogin()}++;
+}
+
+sub reset_failed($) {
+    # increase the number of times failed for this $sshlogin
+    my $self = shift;
+    my $sshlogin = shift;
+    delete $self->{'failed'}{$sshlogin};
+}
+
+sub reset_failed_here($) {
+    # increase the number of times failed for this $sshlogin
+    my $self = shift;
+    delete $self->{'failed'}{$self->sshlogin()};
+}
+
+sub min_failed($) {
+    # Returns:
+    #	the number of sshlogins this command has failed on
+    #	the minimal number of times this command has failed
+    my $self = shift;
+    my $min_failures =
+	::min(map { $self->{'failed'}{$_} } keys %{$self->{'failed'}});
+    my $number_of_sshlogins_failed_on = scalar keys %{$self->{'failed'}};
+    return ($number_of_sshlogins_failed_on,$min_failures);
+}
+
+sub total_failed($) {
+    # Returns:
+    #	$total_failures = the number of times this command has failed
+    my $self = shift;
+    my $total_failures = 0;
+    for (values %{$self->{'failed'}}) {
+	$total_failures += $_;
+    }
+    return $total_failures;
+}
+
+{
+    my $script;
+
+    sub postpone_exit_and_cleanup {
+	# Command to remove files and dirs (given as args) without
+	# affecting the exit value in $?/$status.
+	if(not $script) {
+	    $script = "perl -e '".
+		::spacefree(0,q{
+		    $bash=shift;
+		    $csh=shift;
+		    for(@ARGV){
+			unlink;
+			rmdir;
+		    }
+		    if($bash=~s/(\d+)h/$1/) {
+			exit $bash;
+		    }
+		    exit $csh;
+			    }).
+		# `echo \$?h` is needed to make fish not complain
+		"' ".'"`echo \\\\\\\\\$?h`" "$status" ';
+	}
+	return $script
+    }
+}
+
+{
+    my $script;
+
+    sub fifo_wrap() {
+	# Script to create a fifo, run a command on the fifo
+	# while copying STDIN to the fifo, and finally
+	# remove the fifo and return the exit code of the command.
+	if(not $script) {
+	    # {} == $PARALLEL_TMP for --fifo
+	    # To make it csh compatible a wrapper needs to:
+	    # * mkfifo
+	    # * spawn $command &
+	    # * cat > fifo
+	    # * waitpid to get the exit code from $command
+	    # * be less than 1000 chars long
+
+	    # The optimal block size differs
+	    # It has been measured on:
+	    # AMD 6376: 4095
+	    # ppar -a big --pipepart --block -1 --test $1 --fifo 'cat {} >/dev/null';
+	    $script = "perl -e '".
+		(::spacefree
+		 (0, q{
+		     ($s,$c,$f) = @ARGV;
+		     # mkfifo $PARALLEL_TMP
+		     system "mkfifo", $f;
+		     # spawn $shell -c $command &
+		     $pid = fork || exec $s, "-c", $c;
+		     open($o,">",$f) || die $!;
+		     # cat > $PARALLEL_TMP
+		     while(sysread(STDIN,$buf,4095)){
+			 syswrite $o, $buf;
+		     }
+		     close $o;
+		     # waitpid to get the exit code from $command
+		     waitpid $pid,0;
+		     # Cleanup
+		     unlink $f;
+		     exit $?/256;
+		  }))."'";
+	}
+	return $script;
+    }
+}
+
+sub wrapped($) {
+    # Wrap command with:
+    # * --shellquote
+    # * --nice
+    # * --cat
+    # * --fifo
+    # * --sshlogin
+    # * --pipepart (@Global::cat_prepends)
+    # * --tee (@Global::cat_prepends)
+    # * --pipe
+    # * --tmux
+    # The ordering of the wrapping is important:
+    # * --nice/--cat/--fifo should be done on the remote machine
+    # * --pipepart/--pipe should be done on the local machine inside --tmux
+    # Uses:
+    #	@opt::shellquote
+    #	$opt::nice
+    #	$Global::shell
+    #	$opt::cat
+    #	$opt::fifo
+    #	@Global::cat_prepends
+    #	$opt::pipe
+    #	$opt::tmux
+    # Returns:
+    #	$self->{'wrapped'} = the command wrapped with the above
+    my $self = shift;
+    if(not defined $self->{'wrapped'}) {
+	my $command = $self->replaced();
+	# Bug in Bash and Ksh when running multiline aliases
+	# This will force them to run correctly, but will fail in
+	# tcsh so we do not do it.
+	# $command .= "\n\n";
+	if(@opt::shellquote) {
+	    # Quote one time for each --shellquote
+	    my $c = $command;
+	    for(@opt::shellquote) {
+		$c = ::Q($c);
+	    }
+	    # Prepend "echo" (it is written in perl because
+	    # quoting '-e' causes problem in some versions and
+	    # csh's version does something wrong)
+	    $command = q(perl -e '$,=" "; print "@ARGV\n";' -- ) . ::Q($c);
+	}
+	if($Global::parallel_env) {
+	    # If $PARALLEL_ENV set, put that in front of the command
+	    # Used for env_parallel.*
+	    if($Global::shell =~ /zsh/) {
+		# The extra 'eval' will make aliases work, too
+		$command = $Global::parallel_env."\n".
+		    "eval ".::Q($command);
+	    } else {
+		$command = $Global::parallel_env."\n".$command;
+	    }
+	}
+	if($opt::cat) {
+	    # In '--cat' and '--fifo' {} == $PARALLEL_TMP.
+	    # This is to make it possible to compute $PARALLEL_TMP on
+	    # the fly when running remotely.
+	    # $ENV{PARALLEL_TMP} is set in the remote wrapper before
+	    # the command is run.
+	    #
+	    # Prepend 'cat > $PARALLEL_TMP;'
+	    # Append 'unlink $PARALLEL_TMP without affecting $?'
+	    $command =
+		'cat > $PARALLEL_TMP;'.
+		$command.";". postpone_exit_and_cleanup().
+					 '$PARALLEL_TMP';
+	} elsif($opt::fifo) {
+	    # Prepend fifo-wrapper. In essence:
+	    #	mkfifo {}
+	    #	( $command ) &
+	    #	# $command must read {}, otherwise this 'cat' will block
+	    #	cat > {};
+	    #	wait; rm {}
+	    # without affecting $?
+	    $command = fifo_wrap(). " ".
+		$Global::shell. " ". ::Q($command). ' $PARALLEL_TMP'. ';';
+	}
+	# Wrap with ssh + tranferring of files
+	$command = $self->sshlogin_wrap($command);
+	if(@Global::cat_prepends) {
+	    # --pipepart: prepend:
+	    # < /tmp/foo perl -e 'while(@ARGV) {
+	    #	sysseek(STDIN,shift,0) || die; $left = shift;
+	    #	while($read = sysread(STDIN,$buf, ($left > 60800 ? 60800 : $left))){
+	    #	  $left -= $read; syswrite(STDOUT,$buf);
+	    #	}
+	    # }'  0 0 0 11 |
+	    #
+	    # --pipepart --tee: prepend:
+	    #	< dash-a-file
+	    #
+	    # --pipe --tee: wrap:
+	    #	(rm fifo; ... ) < fifo
+	    #
+	    # --pipe --shard X:
+	    #	(rm fifo; ... ) < fifo
+	    $command = (shift @Global::cat_prepends). "($command)".
+		(shift @Global::cat_appends);
+	} elsif($opt::pipe and not $opt::roundrobin) {
+	    # Wrap with EOF-detector to avoid starting $command if EOF.
+	    $command = empty_input_wrapper($command);
+	}
+	if($opt::tmux) {
+	    # Wrap command with 'tmux'
+	    $command = $self->tmux_wrap($command);
+	}
+	if($Global::cshell
+	   and
+	   length $command > 499) {
+	    # csh does not like words longer than 1000 (499 quoted)
+	    # $command = "perl -e '".base64_zip_eval()."' ".
+	    # join" ",string_zip_base64(
+	    #	      'exec "'.::perl_quote_scalar($command).'"');
+	    $command = base64_wrap("exec \"$Global::shell\",'-c',\"".
+				   ::perl_quote_scalar($command).'"');
+	}
+	$self->{'wrapped'} = $command;
+    }
+    return $self->{'wrapped'};
+}
+
+sub set_sshlogin($$) {
+    my $self = shift;
+    my $sshlogin = shift;
+    $self->{'sshlogin'} = $sshlogin;
+    delete $self->{'sshlogin_wrap'}; # If sshlogin is changed the wrap is wrong
+    delete $self->{'wrapped'};
+
+    if($opt::sqlworker) {
+	# Identify worker as --sqlworker often runs on different machines
+	# If local: Use hostname
+	my $host = $sshlogin->local() ? ::hostname() : $sshlogin->host();
+	$Global::sql->update("SET Host = ? WHERE Seq = ".$self->seq(), $host);
+    }
+}
+
+sub sshlogin($) {
+    my $self = shift;
+    return $self->{'sshlogin'};
+}
+
+sub string_base64($) {
+    # Base64 encode strings into 1000 byte blocks.
+    # 1000 bytes is the largest word size csh supports
+    # Input:
+    #	@strings = to be encoded
+    # Returns:
+    #	@base64 = 1000 byte block
+    $Global::use{"MIME::Base64"} ||= eval "use MIME::Base64; 1;";
+    my @base64 = unpack("(A1000)*",encode_base64((join"",@_),""));
+    return @base64;
+}
+
+sub string_zip_base64($) {
+    # Pipe string through 'bzip2 -9' and base64 encode it into 1000
+    # byte blocks.
+    # 1000 bytes is the largest word size csh supports
+    # Zipping will make exporting big environments work, too
+    # Input:
+    #	@strings = to be encoded
+    # Returns:
+    #	@base64 = 1000 byte block
+    my($zipin_fh, $zipout_fh,@base64);
+    ::open3($zipin_fh,$zipout_fh,">&STDERR","bzip2 -9");
+    if(fork) {
+	close $zipin_fh;
+	$Global::use{"MIME::Base64"} ||= eval "use MIME::Base64; 1;";
+	# Split base64 encoded into 1000 byte blocks
+	@base64 = unpack("(A1000)*",encode_base64((join"",<$zipout_fh>),""));
+	close $zipout_fh;
+    } else {
+	close $zipout_fh;
+	print $zipin_fh @_;
+	close $zipin_fh;
+	exit;
+    }
+    ::debug("base64","Orig:@_\nAs bzip2 base64:@base64\n");
+    return @base64;
+}
+
+sub base64_zip_eval() {
+    # Script that:
+    #	* reads base64 strings from @ARGV
+    #	* decodes them
+    #	* pipes through 'bzip2 -dc'
+    #	* evals the result
+    # Reverse of string_zip_base64 + eval
+    # Will be wrapped in ' so single quote is forbidden
+    # Returns:
+    #	$script = 1-liner for perl -e
+    my $script = ::spacefree(0,q{
+	@GNU_Parallel = split /_/, "use_IPC::Open3;_use_MIME::Base64";
+	eval"@GNU_Parallel";
+	$chld = $SIG{CHLD};
+	$SIG{CHLD} = "IGNORE";
+	# Search for bzip2. Not found => use default path
+	my $zip = (grep { -x $_ } "/usr/local/bin/bzip2")[0] || "bzip2";
+	# $in = stdin on $zip, $out = stdout from $zip
+	# Forget my() to save chars for csh
+	# my($in, $out,$eval);
+	open3($in,$out,">&STDERR",$zip,"-dc");
+	if(my $perlpid = fork) {
+	    close $in;
+	    $eval = join "", <$out>;
+	    close $out;
+	} else {
+	    close $out;
+	    # Pipe decoded base64 into 'bzip2 -dc'
+	    print $in (decode_base64(join"",@ARGV));
+	    close $in;
+	    exit;
+	}
+	wait;
+	$SIG{CHLD} = $chld;
+	eval $eval;
+			     });
+    ::debug("base64",$script,"\n");
+    return $script;
+}
+
+sub base64_wrap($) {
+    # base64 encode Perl code
+    # Split it into chunks of < 1000 bytes
+    # Prepend it with a decoder that eval's it
+    # Input:
+    #	$eval_string = Perl code to run
+    # Returns:
+    #	$shell_command = shell command that runs $eval_string
+    my $eval_string = shift;
+    return
+	"perl -e ".
+	::Q(base64_zip_eval())." ".
+	join" ",::shell_quote(string_zip_base64($eval_string));
+}
+
+sub base64_eval($) {
+    # Script that:
+    #	* reads base64 strings from @ARGV
+    #	* decodes them
+    #	* evals the result
+    # Reverse of string_base64 + eval
+    # Will be wrapped in ' so single quote is forbidden.
+    # Spaces are stripped so spaces cannot be significant.
+    # The funny 'use IPC::Open3'-syntax is to avoid spaces and
+    # to make it clear that this is a GNU  Parallel command
+    # when looking at the process table.
+    # Returns:
+    #	$script = 1-liner for perl -e
+    my $script = ::spacefree(0,q{
+	@GNU_Parallel=("use","IPC::Open3;","use","MIME::Base64");
+	eval "@GNU_Parallel";
+	my $eval = decode_base64(join"",@ARGV);
+	eval $eval;
+			     });
+    ::debug("base64",$script,"\n");
+    return $script;
+}
+
+sub sshlogin_wrap($) {
+    # Wrap the command with the commands needed to run remotely
+    # Input:
+    #	$command = command to run
+    # Returns:
+    #	$self->{'sshlogin_wrap'} = command wrapped with ssh+transfer commands
+    sub monitor_parent_sshd_script {
+	# This script is to solve the problem of
+	# * not mixing STDERR and STDOUT
+	# * terminating with ctrl-c
+	# If its parent is ssh: all good
+	# If its parent is init(1): ssh died, so kill children
+	my $monitor_parent_sshd_script;
+
+	if(not $monitor_parent_sshd_script) {
+	    $monitor_parent_sshd_script =
+		# This will be packed in ', so only use "
+		::spacefree
+		(0,'$shell = "'.($ENV{'PARALLEL_SHELL'} || '$ENV{SHELL}').'";'.
+			    '$tmpdir = $ENV{"TMPDIR"} || "'.
+			    ::perl_quote_scalar($ENV{'PARALLEL_REMOTE_TMPDIR'}).'";'.
+			    '$nice = '.$opt::nice.';'.
+			    '$termseq = "'.$opt::termseq.'";'.
+			    # }
+			    q{
+		# Check that $tmpdir is writable
+		-w $tmpdir ||
+		    die("$tmpdir\040is\040not\040writable.".
+			"\040Set\040PARALLEL_REMOTE_TMPDIR");
+		# Set $PARALLEL_TMP to a non-existent file name in $TMPDIR
+		do {
+		    $ENV{PARALLEL_TMP} = $tmpdir."/par".
+			join"", map { (0..9,"a".."z","A".."Z")[rand(62)] } (1..5);
+		} while(-e $ENV{PARALLEL_TMP});
+		# Set $script to a non-existent file name in $TMPDIR
+		do {
+		    $script = $tmpdir."/par-job-$ENV{PARALLEL_SEQ}_".
+			join"", map { (0..9,"a".."z","A".."Z")[rand(62)] } (1..5);
+		} while(-e $script);
+		# Create a script from the hex code
+		# that removes itself and runs the commands
+		open($fh,">",$script) || die;
+		# \040 = space - but we remove spaces in the script
+		# ' needed due to rc-shell
+		print($fh("rm\040\'$script\'\n",$bashfunc.$cmd));
+		close $fh;
+		my $parent = getppid;
+		my $done = 0;
+		$SIG{CHLD} = sub { $done = 1; };
+		$pid = fork;
+		unless($pid) {
+		    # Make own process group to be able to kill HUP it later
+		    eval { setpgrp };
+		    # Set nice value
+		    eval { setpriority(0,0,$nice) };
+		    # Run the script
+		    exec($shell,$script);
+		    die("exec\040failed: $!");
+		}
+		while((not $done) and (getppid == $parent)) {
+		    # Parent pid is not changed, so sshd is alive
+		    # Exponential sleep up to 1 sec
+		    $s = $s < 1 ? 0.001 + $s * 1.03 : $s;
+		    select(undef, undef, undef, $s);
+		}
+		if(not $done) {
+		    # sshd is dead: User pressed Ctrl-C
+		    # Kill as per --termseq
+		    my @term_seq = split/,/,$termseq;
+		    if(not @term_seq) {
+			@term_seq = ("TERM",200,"TERM",100,"TERM",50,"KILL",25);
+		    }
+		    while(@term_seq && kill(0,-$pid)) {
+			kill(shift @term_seq, -$pid);
+			select(undef, undef, undef, (shift @term_seq)/1000);
+		    }
+		}
+		wait;
+		exit ($?&127 ? 128+($?&127) : 1+$?>>8)
+	    });
+	}
+	return $monitor_parent_sshd_script;
+    }
+
+    sub vars_to_export {
+	# Uses:
+	#   @opt::env
+	my @vars = ("parallel_bash_environment");
+	for my $varstring (@opt::env) {
+	    # Split up --env VAR1,VAR2
+	    push @vars, split /,/, $varstring;
+	}
+	for (@vars) {
+	    if(-r $_ and not -d) {
+		# Read as environment definition bug #44041
+		# TODO parse this
+		my $fh = ::open_or_exit($_);
+		$Global::envdef = join("",<$fh>);
+		close $fh;
+	    }
+	}
+	if(grep { /^_$/ } @vars) {
+	    local $/ = "\n";
+	    # --env _
+	    # Include all vars that are not in a clean environment
+	    if(open(my $vars_fh, "<", $Global::config_dir . "/ignored_vars")) {
+		my @ignore = <$vars_fh>;
+		chomp @ignore;
+		my %ignore;
+		@ignore{@ignore} = @ignore;
+		close $vars_fh;
+		push @vars, grep { not defined $ignore{$_} } keys %ENV;
+		@vars = grep { not /^_$/ } @vars;
+	    } else {
+		::error("Run '$Global::progname --record-env' ".
+			"in a clean environment first.");
+		::wait_and_exit(255);
+	    }
+	}
+	# Duplicate vars as BASH functions to include post-shellshock functions (v1+v2)
+	# So --env myfunc should look for BASH_FUNC_myfunc() and BASH_FUNC_myfunc%%
+
+	push(@vars, "PARALLEL_PID", "PARALLEL_SEQ",
+	     "PARALLEL_SSHLOGIN", "PARALLEL_SSHHOST",
+	     "PARALLEL_HOSTGROUPS", "PARALLEL_ARGHOSTGROUPS",
+	     "PARALLEL_JOBSLOT", $opt::process_slot_var,
+	     map { ("BASH_FUNC_$_()", "BASH_FUNC_$_%%") } @vars);
+	# Keep only defined variables
+	return grep { defined($ENV{$_}) } @vars;
+    }
+
+    sub env_as_eval {
+	# Returns:
+	#   $eval = '$ENV{"..."}=...; ...'
+	my @vars = vars_to_export();
+	my $csh_friendly = not grep { /\n/ } @ENV{@vars};
+	my @bash_functions = grep { substr($ENV{$_},0,4) eq "() {" } @vars;
+	my @non_functions = (grep { !/PARALLEL_ENV/ }
+			     grep { substr($ENV{$_},0,4) ne "() {" } @vars);
+
+	# eval of @envset will set %ENV
+	my $envset = join"", map {
+	    '$ENV{"'.::perl_quote_scalar($_).'"}="'.
+		::perl_quote_scalar($ENV{$_}).'";'; } @non_functions;
+
+	# running @bashfunc on the command line, will set the functions
+	my @bashfunc = map {
+	    my $v=$_;
+	    s/BASH_FUNC_(.*)(\(\)|%%)/$1/;
+	    "$_$ENV{$v};\nexport -f $_ 2> /dev/null;\n" } @bash_functions;
+	# eval $bashfuncset will set $bashfunc
+	my $bashfuncset;
+	if(@bashfunc) {
+	    # Functions are not supported for all shells
+	    if($Global::shell !~ m:(^|/)(ash|bash|rbash|zsh|rzsh|dash|ksh):) {
+		::warning("Shell functions may not be supported in $Global::shell.");
+	    }
+	    $bashfuncset =
+		'@bash_functions=qw('."@bash_functions".");".
+		::spacefree(1,'$shell="'.($ENV{'PARALLEL_SHELL'} || '$ENV{SHELL}').'";'.q{
+		    if($shell=~/csh/) {
+			print STDERR "CSH/TCSH DO NOT SUPPORT newlines IN VARIABLES/FUNCTIONS. Unset @bash_functions\n";
+			exec "false";
+		    }
+			    }).
+				"\n".'$bashfunc = "'.::perl_quote_scalar("@bashfunc").'";';
+	} else {
+	    $bashfuncset = '$bashfunc = "";'
+	}
+	if($ENV{'parallel_bash_environment'}) {
+	    $bashfuncset .= '$bashfunc .= "eval\ \"\$parallel_bash_environment\"\;";';
+	}
+	::debug("base64",$envset,$bashfuncset,"\n");
+	return $csh_friendly,$envset,$bashfuncset;
+    }
+
+    my $self = shift;
+    my $command = shift;
+    # TODO test that *sh -c 'parallel --env' use *sh
+    if(not defined $self->{'sshlogin_wrap'}{$command}) {
+	my $sshlogin = $self->sshlogin();
+	$ENV{'PARALLEL_SEQ'} = $self->seq();
+	$ENV{$opt::process_slot_var} = -1 +
+	    ($ENV{'PARALLEL_JOBSLOT'} = $self->slot());
+	$ENV{'PARALLEL_SSHLOGIN'} = $sshlogin->string();
+	$ENV{'PARALLEL_SSHHOST'} = $sshlogin->host();
+	if ($opt::hostgroups) {
+	    $ENV{'PARALLEL_HOSTGROUPS'} = join '+', $sshlogin->hostgroups();
+	    $ENV{'PARALLEL_ARGHOSTGROUPS'} = join '+', $self->hostgroups();
+	}
+	$ENV{'PARALLEL_PID'} = $$;
+	if($sshlogin->local()) {
+	    if($opt::workdir) {
+		# Create workdir if needed. Then cd to it.
+		my $wd = $self->workdir();
+		if($opt::workdir eq "." or $opt::workdir eq "...") {
+		    # If $wd does not start with '/': Prepend $HOME
+		    $wd =~ s:^([^/]):$ENV{'HOME'}/$1:;
+		}
+		::mkdir_or_die($wd);
+		my $post = "";
+		if($opt::workdir eq "...") {
+		    $post = ";".exitstatuswrapper("rm -rf ".::Q($wd).";");
+
+		}
+		$command = "cd ".::Q($wd)." || exit 255; " .
+		    $command . $post;;
+	    }
+	    if(@opt::env) {
+		# Prepend with environment setter, which sets functions in zsh
+		my ($csh_friendly,$envset,$bashfuncset) = env_as_eval();
+		my $perl_code = $envset.$bashfuncset.
+		    '@ARGV="'.::perl_quote_scalar($command).'";'.
+		    "exec\"$Global::shell\",\"-c\",\(\$bashfunc.\"\@ARGV\"\)\;die\"exec:\$\!\\n\"\;";
+		if(length $perl_code > 999
+		   or
+		   not $csh_friendly
+		   or
+		   $command =~ /\n/) {
+		    # csh does not deal well with > 1000 chars in one word
+		    # csh does not deal well with $ENV with \n
+		    $self->{'sshlogin_wrap'}{$command} = base64_wrap($perl_code);
+		} else {
+		    $self->{'sshlogin_wrap'}{$command} = "perl -e ".::Q($perl_code);
+		}
+	    } else {
+		$self->{'sshlogin_wrap'}{$command} = $command;
+	    }
+	} else {
+	    my $pwd = "";
+	    if($opt::workdir) {
+		# Create remote workdir if needed. Then cd to it.
+		my $wd = ::pQ($self->workdir());
+		$pwd = qq{system("mkdir","-p","--","$wd"); chdir "$wd" ||}.
+		    qq{print(STDERR "parallel: Cannot chdir to $wd\\n") &&}.
+		    qq{exit 255;};
+	    }
+	    my ($csh_friendly,$envset,$bashfuncset) = env_as_eval();
+	    my $cmd = $command;
+	    # q// does not quote \, so we must do that
+	    $cmd =~ s/\\/\\\\/g;
+
+	    my $remote_command = $sshlogin->hexwrap
+		($pwd.$envset.$bashfuncset.'$cmd='."q\0".$cmd."\0;".
+		 monitor_parent_sshd_script());
+	    my ($pre,$post,$cleanup)=("","","");
+	    # --transfer
+	    $pre .= $self->sshtransfer();
+	    # --return
+	    $post .= $self->sshreturn();
+	    # --cleanup
+	    $post .= $self->sshcleanup();
+	    if($post) {
+		# We need to save the exit status of the job
+		$post = exitstatuswrapper($post);
+	    }
+	    $self->{'sshlogin_wrap'}{$command} =
+		($pre
+		 . $sshlogin->wrap($remote_command)
+		 . ";"
+		 . $post);
+	}
+    }
+    return $self->{'sshlogin_wrap'}{$command};
+}
+
+sub fill_templates($) {
+    # Replace replacement strings in template(s)
+    # Returns:
+    #	@templates - File names of replaced templates
+    my $self = shift;
+
+    if(%opt::template) {
+	my @template_name =
+	    map { $self->{'commandline'}->replace_placeholders([$_],0,0) }
+	@{$self->{'commandline'}{'template_names'}};
+	::debug("tmpl","Names: @template_name\n");
+	for(my $i = 0; $i <= $#template_name; $i++) {
+	    open(my $fh, ">", $template_name[$i]) || die;
+	    print $fh $self->{'commandline'}->
+		replace_placeholders([$self->{'commandline'}
+				      {'template_contents'}[$i]],0,0);
+	    close $fh;
+	}
+	if($opt::cleanup) {
+	    $self->add_rm(@template_name);
+	}
+    }
+}
+
+sub filter($) {
+    # Replace replacement strings in filter(s) and evaluate them
+    # Returns:
+    #	$run - 1=yes, undef=no
+    my $self = shift;
+    my $run = 1;
+    if(@opt::filter) {
+	for my $eval ($self->{'commandline'}->
+		      replace_placeholders(\@opt::filter,0,0)) {
+	    $run &&= eval $eval;
+	}
+	$self->{'commandline'}{'skip'} ||= not $run;
+    }
+    return $run;
+}
+
+sub transfer($) {
+    # Files to transfer
+    # Non-quoted and with {...} substituted
+    # Returns:
+    #	@transfer - File names of files to transfer
+    my $self = shift;
+
+    my $transfersize = 0;
+    my @transfer = $self->{'commandline'}->
+	replace_placeholders($self->{'commandline'}{'transfer_files'},0,0);
+    for(@transfer) {
+	# filesize
+	if(-e $_) {
+	    $transfersize += (stat($_))[7];
+	}
+    }
+    $self->add_transfersize($transfersize);
+    return @transfer;
+}
+
+sub transfersize($) {
+    my $self = shift;
+    return $self->{'transfersize'};
+}
+
+sub add_transfersize($) {
+    my $self = shift;
+    my $transfersize = shift;
+    $self->{'transfersize'} += $transfersize;
+    $opt::sqlworker and
+	$Global::sql->update("SET Send = ? WHERE Seq = ".$self->seq(),
+			     $self->{'transfersize'});
+}
+
+sub sshtransfer($) {
+    # Returns for each transfer file:
+    #	rsync $file remote:$workdir
+    my $self = shift;
+    my @pre;
+    my $sshlogin = $self->sshlogin();
+    my $workdir = $self->workdir();
+    for my $file ($self->transfer()) {
+	push @pre, $sshlogin->rsync_transfer_cmd($file,$workdir).";";
+    }
+    return join("",@pre);
+}
+
+sub return($) {
+    # Files to return
+    # Non-quoted and with {...} substituted
+    # Returns:
+    #	@non_quoted_filenames
+    my $self = shift;
+    return $self->{'commandline'}->
+	replace_placeholders($self->{'commandline'}{'return_files'},0,0);
+}
+
+sub returnsize($) {
+    # This is called after the job has finished
+    # Returns:
+    #	$number_of_bytes transferred in return
+    my $self = shift;
+    for my $file ($self->return()) {
+	if(-e $file) {
+	    $self->{'returnsize'} += (stat($file))[7];
+	}
+    }
+    return $self->{'returnsize'};
+}
+
+sub add_returnsize($) {
+    my $self = shift;
+    my $returnsize = shift;
+    $self->{'returnsize'} += $returnsize;
+    $opt::sqlworker and
+	$Global::sql->update("SET Receive = ? WHERE Seq = ".$self->seq(),
+			     $self->{'returnsize'});
+}
+
+sub sshreturn($) {
+    # Returns for each return-file:
+    #	rsync remote:$workdir/$file .
+    my $self = shift;
+    my $sshlogin = $self->sshlogin();
+    my $pre = "";
+    for my $file ($self->return()) {
+	$file =~ s:^\./::g; # Remove ./ if any
+	my $relpath = ($file !~ m:^/:) ||
+	    ($file =~ m:/\./:); # Is the path relative or /./?
+	my $cd = "";
+	my $wd = "";
+	if($relpath) {
+	    #	rsync -avR /foo/./bar/baz.c remote:/tmp/
+	    # == (on old systems)
+	    #	rsync -avR --rsync-path="cd /foo; rsync" remote:bar/baz.c /tmp/
+	    $wd = ::shell_quote_file($self->workdir()."/");
+	}
+	# Only load File::Basename if actually needed
+	$Global::use{"File::Basename"} ||= eval "use File::Basename; 1;";
+	# dir/./file means relative to dir, so remove dir on remote
+	$file =~ m:(.*)/\./:;
+	my $basedir = $1 ? ::shell_quote_file($1."/") : "";
+	my $nobasedir = $file;
+	$nobasedir =~ s:.*/\./::;
+	$cd = ::shell_quote_file(::dirname($nobasedir));
+	my $rsync_cd = '--rsync-path='.::Q("cd $wd$cd; rsync");
+	my $basename = ::Q(::shell_quote_file(::basename($file)));
+	# --return
+	#   mkdir -p /home/tange/dir/subdir/;
+	#   rsync (--protocol 30) -rlDzR
+	#     --rsync-path="cd /home/tange/dir/subdir/; rsync"
+	#     server:file.gz /home/tange/dir/subdir/
+	$pre .= "mkdir -p $basedir$cd" . " && " .
+	    $sshlogin->rsync(). " $rsync_cd -- ".$sshlogin->host().':'.
+	    $basename . " ".$basedir.$cd.";";
+    }
+    return $pre;
+}
+
+sub sshcleanup($) {
+    # Return the sshcommand needed to remove the file
+    # Returns:
+    #	ssh command needed to remove files from sshlogin
+    my $self = shift;
+    my $sshlogin = $self->sshlogin();
+    my $workdir = $self->workdir();
+    my $cleancmd = "";
+
+    for my $file ($self->remote_cleanup()) {
+	my @subworkdirs = parentdirs_of($file);
+	$cleancmd .= $sshlogin->cleanup_cmd($file,$workdir).";";
+    }
+    if(defined $opt::workdir and $opt::workdir eq "...") {
+	$cleancmd .= $sshlogin->wrap("rm -rf " . ::Q($workdir).';');
+    }
+    return $cleancmd;
+}
+
+sub remote_cleanup($) {
+    # Returns:
+    #	Files to remove at cleanup
+    my $self = shift;
+    if($opt::cleanup) {
+	my @transfer = $self->transfer();
+	my @return = $self->return();
+	return (@transfer,@return);
+    } else {
+	return ();
+    }
+}
+
+sub exitstatuswrapper(@) {
+    # Input:
+    #	@shellcode = shell code to execute
+    # Returns:
+    #	shell script that returns current status after executing @shellcode
+    if($Global::cshell) {
+	return ('set _EXIT_status=$status; ' .
+		join(" ",@_).
+		'exit $_EXIT_status;');
+    } else {
+	return ('_EXIT_status=$?; ' .
+		join(" ",@_).
+		'exit $_EXIT_status;');
+    }
+}
+
+sub workdir($) {
+    # Returns:
+    #	the workdir on a remote machine
+    my $self = shift;
+    if(not defined $self->{'workdir'}) {
+	my $workdir;
+	if(defined $opt::workdir) {
+	    if($opt::workdir eq ".") {
+		# . means current dir
+		my $home = $ENV{'HOME'};
+		eval 'use Cwd';
+		my $cwd = cwd();
+		$workdir = $cwd;
+		if($home) {
+		    # If homedir exists: remove the homedir from
+		    # workdir if cwd starts with homedir
+		    # E.g. /home/foo/my/dir => my/dir
+		    # E.g. /tmp/my/dir => /tmp/my/dir
+		    my ($home_dev, $home_ino) = (stat($home))[0,1];
+		    my $parent = "";
+		    my @dir_parts = split(m:/:,$cwd);
+		    my $part;
+		    while(defined ($part = shift @dir_parts)) {
+			$part eq "" and next;
+			$parent .= "/".$part;
+			my ($parent_dev, $parent_ino) = (stat($parent))[0,1];
+			if($parent_dev == $home_dev and $parent_ino == $home_ino) {
+			    # dev and ino is the same: We found the homedir.
+			    $workdir = join("/",@dir_parts);
+			    last;
+			}
+		    }
+		}
+		if($workdir eq "") {
+		    $workdir = ".";
+		}
+	    } elsif($opt::workdir eq "...") {
+		$workdir = ".parallel/tmp/" . ::hostname() . "-" . $$
+		    . "-" . $self->seq();
+	    } else {
+		$workdir = $self->{'commandline'}->
+		    replace_placeholders([$opt::workdir],0,0);
+		#$workdir = $opt::workdir;
+		# Rsync treats /./ special. We dont want that
+		$workdir =~ s:/\./:/:g; # Remove /./
+		$workdir =~ s:(.)/+$:$1:; # Remove ending / if any
+		$workdir =~ s:^\./::g; # Remove starting ./ if any
+	    }
+	} else {
+	    $workdir = ".";
+	}
+	$self->{'workdir'} = $workdir;
+    }
+    return $self->{'workdir'};
+}
+
+sub parentdirs_of($) {
+    # Return:
+    #	all parentdirs except . of this dir or file - sorted desc by length
+    my $d = shift;
+    my @parents = ();
+    while($d =~ s:/[^/]+$::) {
+	if($d ne ".") {
+	    push @parents, $d;
+	}
+    }
+    return @parents;
+}
+
+sub start($) {
+    # Setup STDOUT and STDERR for a job and start it.
+    # Returns:
+    #	job-object or undef if job not to run
+
+    sub open3_setpgrp_internal {
+	# Run open3+setpgrp followed by the command
+	# Input:
+	#   $stdin_fh = Filehandle to use as STDIN
+	#   $stdout_fh = Filehandle to use as STDOUT
+	#   $stderr_fh = Filehandle to use as STDERR
+	#   $command = Command to run
+	# Returns:
+	#   $pid = Process group of job started
+	my ($stdin_fh,$stdout_fh,$stderr_fh,$command) = @_;
+	my $pid;
+	local (*OUT,*ERR);
+	open OUT, '>&', $stdout_fh or ::die_bug("Can't dup STDOUT: $!");
+	open ERR, '>&', $stderr_fh or ::die_bug("Can't dup STDERR: $!");
+	# The eval is needed to catch exception from open3
+	eval {
+	    if(not $pid = ::open3($stdin_fh, ">&OUT", ">&ERR", "-")) {
+		# Each child gets its own process group to make it safe to killall
+		eval{ setpgrp(0,0) };
+		eval{ setpriority(0,0,$opt::nice) };
+		exec($Global::shell,"-c",$command)
+		    || ::die_bug("open3-$stdin_fh ".substr($command,0,200));
+	    }
+	};
+	return $pid;
+    }
+
+    sub open3_setpgrp_external {
+	# Run open3 on $command wrapped with a perl script doing setpgrp
+	# Works on systems that do not support open3(,,,"-")
+	# Input:
+	#   $stdin_fh = Filehandle to use as STDIN
+	#   $stdout_fh = Filehandle to use as STDOUT
+	#   $stderr_fh = Filehandle to use as STDERR
+	#   $command = Command to run
+	# Returns:
+	#   $pid = Process group of job started
+	my ($stdin_fh,$stdout_fh,$stderr_fh,$command) = @_;
+	local (*OUT,*ERR);
+	open OUT, '>&', $stdout_fh or ::die_bug("Can't dup STDOUT: $!");
+	open ERR, '>&', $stderr_fh or ::die_bug("Can't dup STDERR: $!");
+
+	my $pid;
+	my @setpgrp_wrap =
+	    ('perl','-e',
+	     "eval\{setpgrp\}\;eval\{setpriority\(0,0,$opt::nice\)\}\;".
+	     "exec '$Global::shell', '-c', \@ARGV");
+	# The eval is needed to catch exception from open3
+	eval {
+	    $pid = ::open3($stdin_fh, ">&OUT", ">&ERR", @setpgrp_wrap, $command)
+		|| ::die_bug("open3-$stdin_fh");
+	    1;
+	};
+	return $pid;
+    }
+
+    sub redefine_open3_setpgrp {
+	my $setgprp_cache = shift;
+	# Select and run open3_setpgrp_internal/open3_setpgrp_external
+	no warnings 'redefine';
+	my ($outfh,$name) = ::tmpfile(SUFFIX => ".tst");
+	# Test to see if open3(x,x,x,"-") is fully supported
+	# Can an exported bash function be called via open3?
+	my $script = 'if($pid=::open3($i,$o,$e,"-")) { wait; } '.
+	    'else { exec("bash","-c","testfun && true"); }';
+	my $bash =
+	    ::shell_quote_scalar_default(
+	    "testfun() { rm $name; }; export -f testfun; ".
+	    "perl -MIPC::Open3 -e ".
+	    ::shell_quote_scalar_default($script)
+	    );
+	my $redefine_eval;
+	# Redirect STDERR temporarily,
+	# so errors on MacOS X are ignored.
+	open my $saveerr, ">&STDERR";
+	open STDERR, '>', "/dev/null";
+	# Run the test
+	::debug("init",qq{bash -c $bash 2>/dev/null});
+	qx{ bash -c $bash 2>/dev/null };
+	open STDERR, ">&", $saveerr;
+
+	if(-e $name) {
+	    # Does not support open3(x,x,x,"-")
+	    # or does not have bash:
+	    # Use (slow) external version
+	    unlink($name);
+	    $redefine_eval = '*open3_setpgrp = \&open3_setpgrp_external';
+	    ::debug("init","open3_setpgrp_external chosen\n");
+	} else {
+	    # Supports open3(x,x,x,"-")
+	    # This is 0.5 ms faster to run
+	    $redefine_eval = '*open3_setpgrp = \&open3_setpgrp_internal';
+	    ::debug("init","open3_setpgrp_internal chosen\n");
+	}
+	if(open(my $fh, ">", $setgprp_cache)) {
+	    print $fh $redefine_eval;
+	    close $fh;
+	} else {
+	    ::debug("init","Cannot write to $setgprp_cache");
+	}
+	eval $redefine_eval;
+    }
+
+    sub open3_setpgrp {
+	my $setgprp_cache = $Global::cache_dir . "/tmp/sshlogin/" .
+	    ::hostname() . "/setpgrp_func";
+	sub read_cache() {
+	    -e $setgprp_cache || return 0;
+	    local $/ = undef;
+	    open(my $fh, "<", $setgprp_cache) || return 0;
+	    eval <$fh> || return 0;
+	    close $fh;
+	    return 1;
+	}
+	if(not read_cache()) {
+	    redefine_open3_setpgrp($setgprp_cache);
+	}
+	# The sub is now redefined. Call it
+	return open3_setpgrp(@_);
+    }
+
+    my $job = shift;
+    # Get the shell command to be executed (possibly with ssh infront).
+    my $command = $job->wrapped();
+    my $pid;
+
+    if($Global::interactive or $Global::stderr_verbose) {
+	$job->interactive_start();
+    }
+    # Must be run after $job->interactive_start():
+    # $job->interactive_start() may call $job->skip()
+    if($job->{'commandline'}{'skip'}
+       or
+       not $job->filter()) {
+	# $job->skip() was called or job filtered
+	$command = "true";
+    }
+    $job->openoutputfiles();
+    $job->print_verbose_dryrun();
+    my($stdout_fh,$stderr_fh) = ($job->fh(1,"w"),$job->fh(2,"w"));
+    if($opt::dryrun or $opt::sqlmaster) { $command = "true"; }
+    $ENV{'PARALLEL_SEQ'} = $job->seq();
+    $ENV{'PARALLEL_PID'} = $$;
+    $ENV{$opt::process_slot_var} = -1 +
+	($ENV{'PARALLEL_JOBSLOT'} = $job->slot());
+    $ENV{'PARALLEL_TMP'} = ::tmpname("par");
+    $job->add_rm($ENV{'PARALLEL_TMP'});
+    $job->fill_templates();
+    $ENV{'SSHPASS'} = $job->{'sshlogin'}->{'password'};
+    ::debug("run", $Global::total_running, " processes . Starting (",
+	    $job->seq(), "): $command\n");
+    if($opt::pipe) {
+	my ($stdin_fh) = ::gensym();
+	$pid = open3_setpgrp($stdin_fh,$stdout_fh,$stderr_fh,$command);
+	if($opt::roundrobin and not $opt::keeporder) {
+	    # --keep-order will make sure the order will be reproducible
+	    ::set_fh_non_blocking($stdin_fh);
+	}
+	$job->set_fh(0,"w",$stdin_fh);
+	if($opt::tee or $opt::shard or $opt::bin) { $job->set_virgin(0); }
+    } elsif(($opt::tty or $opt::open_tty) and -c "/dev/tty" and
+	    open(my $devtty_fh, "<", "/dev/tty")) {
+	# Give /dev/tty to the command if no one else is using it
+	# The eval is needed to catch exception from open3
+	local (*IN,*OUT,*ERR);
+	open OUT, '>&', $stdout_fh or ::die_bug("Can't dup STDOUT: $!");
+	open ERR, '>&', $stderr_fh or ::die_bug("Can't dup STDERR: $!");
+	*IN = $devtty_fh;
+	# The eval is needed to catch exception from open3
+	my @wrap = ('perl','-e',
+			    "eval\{setpriority\(0,0,$opt::nice\)\}\;".
+			    "exec '$Global::shell', '-c', \@ARGV");
+	eval {
+	    $pid = ::open3("<&IN", ">&OUT", ">&ERR", @wrap, $command)
+		|| ::die_bug("open3-/dev/tty");
+	    1;
+	};
+	close $devtty_fh;
+	$job->set_virgin(0);
+    } elsif($Global::semaphore) {
+	# Allow sem to read from stdin
+	$pid = open3_setpgrp("<&STDIN",$stdout_fh,$stderr_fh,$command);
+	$job->set_virgin(0);
+    } else {
+	$pid = open3_setpgrp(::gensym(),$stdout_fh,$stderr_fh,$command);
+	$job->set_virgin(0);
+    }
+    if($pid) {
+	# A job was started
+	$Global::total_running++;
+	$Global::total_started++;
+	$job->set_pid($pid);
+	$job->set_starttime();
+	$Global::running{$job->pid()} = $job;
+	if($opt::timeout) {
+	    $Global::timeoutq->insert($job);
+	}
+	$Global::newest_job = $job;
+	$Global::newest_starttime = ::now();
+	return $job;
+    } else {
+	# No more processes
+	::debug("run", "Cannot spawn more jobs.\n");
+	return undef;
+    }
+}
+
+sub interactive_start($) {
+    my $self = shift;
+    my $command = $self->wrapped();
+    if($Global::interactive) {
+	my $answer;
+	::status_no_nl("$command ?...");
+	do{
+	    open(my $tty_fh, "<", "/dev/tty") || ::die_bug("interactive-tty");
+	    $answer = <$tty_fh>;
+	    close $tty_fh;
+	    # Sometime we get an empty string (not even \n)
+	    # Do not know why, so let us just ignore it and try again
+	} while(length $answer < 1);
+	if (not ($answer =~ /^\s*y/i)) {
+	    $self->{'commandline'}->skip();
+	}
+    } else {
+	print $Global::original_stderr "$command\n";
+    }
+}
+
+{
+    my $tmuxsocket;
+
+    sub tmux_wrap($) {
+	# Wrap command with tmux for session pPID
+	# Input:
+	#   $actual_command = the actual command being run (incl ssh wrap)
+	my $self = shift;
+	my $actual_command = shift;
+	# Temporary file name. Used for fifo to communicate exit val
+	my $tmpfifo = ::tmpname("tmx");
+	$self->add_rm($tmpfifo);
+
+	if(length($tmpfifo) >=100) {
+	    ::error("tmux does not support sockets with path > 100.");
+	    ::wait_and_exit(255);
+	}
+	if($opt::tmuxpane) {
+	    # Move the command into a pane in window 0
+	    $actual_command = $ENV{'PARALLEL_TMUX'}.' joinp -t :0 ; '.
+		$ENV{'PARALLEL_TMUX'}.' select-layout -t :0 tiled ; '.
+		$actual_command;
+	}
+	my $visual_command = $self->replaced();
+	my $title = $visual_command;
+	if($visual_command =~ /\0/) {
+	    ::error("Command line contains NUL. tmux is confused by NUL.");
+	    ::wait_and_exit(255);
+	}
+	# ; causes problems
+	# ascii 194-245 annoys tmux
+	$title =~ tr/[\011-\016;\302-\365]/ /s;
+	$title = ::Q($title);
+
+	my $l_act = length($actual_command);
+	my $l_tit = length($title);
+	my $l_fifo = length($tmpfifo);
+	# The line to run contains a 118 chars extra code + the title 2x
+	my $l_tot = 2 * $l_tit + $l_act + $l_fifo;
+
+	my $quoted_space75 = ::Q(" ")x75;
+	while($l_tit < 1000 and
+	      (
+	       (890 < $l_tot and $l_tot < 1350)
+	       or
+	       (9250 < $l_tot and $l_tot < 9800)
+	      )) {
+	    # tmux blocks for certain lengths:
+	    # 900 < title + command < 1200
+	    # 9250 < title + command < 9800
+	    # but only if title < 1000, so expand the title with 75 spaces
+	    # The measured lengths are:
+	    # 996 < (title + whole command) < 1127
+	    # 9331 < (title + whole command) < 9636
+	    $title .= $quoted_space75;
+	    $l_tit = length($title);
+	    $l_tot = 2 * $l_tit + $l_act + $l_fifo;
+	}
+
+	my $tmux;
+	$ENV{'PARALLEL_TMUX'} ||= "tmux";
+	if(not $tmuxsocket) {
+	    $tmuxsocket = ::tmpname("tms");
+	    ::debug("tmux", "Start: $ENV{'PARALLEL_TMUX'} -S $tmuxsocket attach");
+	    if($opt::fg) {
+		if(not fork) {
+		    # Run tmux in the foreground
+		    # Wait for the socket to appear
+		    while (not -e $tmuxsocket) { }
+		    `$ENV{'PARALLEL_TMUX'} -S $tmuxsocket attach`;
+		    exit;
+		}
+	    }
+	    ::status("See output with: $ENV{'PARALLEL_TMUX'} -S $tmuxsocket attach");
+	}
+	$tmux = "sh -c '".
+	    $ENV{'PARALLEL_TMUX'}.
+	    " -S $tmuxsocket new-session -s p$$ -d \"sleep .2\" >/dev/null 2>&1';" .
+	    $ENV{'PARALLEL_TMUX'}.
+	    " -S $tmuxsocket new-window -t p$$ -n $title";
+
+	::debug("tmux", "title len:", $l_tit, " act ", $l_act, " max ",
+		$Limits::Command::line_max_len, " tot ",
+		$l_tot, "\n");
+
+	return "mkfifo $tmpfifo && $tmux ".
+	    # Run in tmux
+	    ::Q
+	    (
+	     "(".$actual_command.');'.
+	     # The triple print is needed - otherwise the testsuite fails
+	     q[ perl -e 'while($t++<3){ print $ARGV[0],"\n" }' $?h/$status >> ].
+	     $tmpfifo."&".
+	     "echo $title; echo \007Job finished at: `date`;sleep 10"
+	    ).
+	    # Run outside tmux
+	    # Read a / separated line: 0h/2 for csh, 2/0 for bash.
+	    # If csh the first will be 0h, so use the second as exit value.
+	    # Otherwise just use the first value as exit value.
+	    q{; exec perl -e '$/="/";$_=<>;$c=<>;unlink $ARGV; }.
+	    q{/(\d+)h/ and exit($1);exit$c' }.$tmpfifo;
+    }
+}
+
+sub is_already_in_results($) {
+    # Do we already have results for this job?
+    # Returns:
+    #	$job_already_run = bool whether there is output for this or not
+    my $job = $_[0];
+    if($Global::csvsep) {
+	if($opt::joblog) {
+	    # OK: You can look for job run in joblog
+	    return 0
+	} else {
+	    ::warning_once(
+		  "--resume --results .csv/.tsv/.json is not supported yet\n");
+	    # TODO read and parse the file
+	    return 0
+	}
+    }
+    my $out = $job->{'commandline'}->results_out();
+    ::debug("run", "Test ${out}stdout", -e "${out}stdout", "\n");
+    return(-e $out."stdout" or -f $out);
+}
+
+sub is_already_in_joblog($) {
+    my $job = shift;
+    return vec($Global::job_already_run,$job->seq(),1);
+}
+
+sub set_job_in_joblog($) {
+    my $job = shift;
+    vec($Global::job_already_run,$job->seq(),1) = 1;
+}
+
+sub should_be_retried($) {
+    # Should this job be retried?
+    # Returns
+    #	0 - do not retry
+    #	1 - job queued for retry
+    my $self = shift;
+    if (not defined $opt::retries) { return 0; }
+    if(not $self->exitstatus() and not $self->exitsignal()) {
+	# Completed with success. If there is a recorded failure: forget it
+	$self->reset_failed_here();
+	return 0;
+    } else {
+	# The job failed. Should it be retried?
+	$self->add_failed_here();
+	my $retries = $self->{'commandline'}->
+	    replace_placeholders([$opt::retries],0,0);
+	# 0 = Inf
+	if($retries == 0) { $retries = 2**31; }
+	# Ignore files already unlinked to avoid memory leak
+	$self->{'unlink'} = [ grep { -e $_ } @{$self->{'unlink'}} ];
+	map { -e $_ or delete $Global::unlink{$_} } keys %Global::unlink;
+	if($self->total_failed() == $retries) {
+	    # This has been retried enough
+	    return 0;
+	} else {
+	    # This command should be retried
+	    $self->set_endtime(undef);
+	    $self->reset_exitstatus();
+	    $Global::JobQueue->unget($self);
+	    ::debug("run", "Retry ", $self->seq(), "\n");
+	    return 1;
+	}
+    }
+}
+
+{
+    my (%print_later,$job_seq_to_print);
+
+    sub print_earlier_jobs($) {
+	# Print jobs whose output is postponed due to --keep-order
+	# Returns: N/A
+	my $job = shift;
+	$print_later{$job->seq()} = $job;
+	$job_seq_to_print ||= 1;
+	my $returnsize = 0;
+	::debug("run", "Looking for: $job_seq_to_print ",
+		"This: ", $job->seq(), "\n");
+	for(;vec($Global::job_already_run,$job_seq_to_print,1);
+	    $job_seq_to_print++) {}
+	while(my $j = $print_later{$job_seq_to_print}) {
+	    $returnsize += $j->print();
+	    if($j->endtime()) {
+		# Job finished - look at the next
+		delete $print_later{$job_seq_to_print};
+		$job_seq_to_print++;
+		next;
+	    } else {
+		# Job not finished yet - look at it again next round
+		last;
+	    }
+	}
+	return $returnsize;
+    }
+}
+
+sub print($) {
+    # Print the output of the jobs
+    # Returns: N/A
+    my $self = shift;
+
+    ::debug("print", ">>joboutput ", $self->replaced(), "\n");
+    if($opt::dryrun) {
+	# Nothing was printed to this job:
+	# cleanup tmp files if --files was set
+	::rm($self->fh(1,"name"));
+    }
+    if($opt::pipe and $self->virgin() and not $opt::tee) {
+	# Skip --joblog, --dryrun, --verbose
+    } else {
+	if($opt::ungroup) {
+	    # NULL returnsize = 0 returnsize
+	    $self->returnsize() or $self->add_returnsize(0);
+	    if($Global::joblog and defined $self->{'exitstatus'}) {
+		# Add to joblog when finished
+		$self->print_joblog();
+		# Printing is only relevant for grouped/--line-buffer output.
+		$opt::ungroup and return;
+	    }
+	}
+	# Check for disk full
+	::exit_if_disk_full();
+    }
+
+    my $returnsize = $self->returnsize();
+    my @fdno;
+    if($opt::latestline) {
+	@fdno = (1);
+    } else {
+	@fdno = (sort { $a <=> $b } keys %Global::fh);
+    }
+    for my $fdno (@fdno) {
+	# Sort by file descriptor numerically: 1,2,3,..,9,10,11
+	$fdno == 0 and next;
+	my $out_fh = $Global::fh{$fdno};
+	my $in_fh = $self->fh($fdno,"r");
+	if(not $in_fh) {
+	    if(not $Job::file_descriptor_warning_printed{$fdno}++) {
+		# ::warning("File descriptor $fdno not defined\n");
+	    }
+	    next;
+	}
+	::debug("print", "File descriptor $fdno (", $self->fh($fdno,"name"), "):\n");
+	if($Global::linebuffer) {
+	    # Line buffered print out
+	    $self->print_linebuffer($fdno,$in_fh,$out_fh);
+	} elsif($opt::files) {
+	    $self->print_files($fdno,$in_fh,$out_fh);
+	} elsif($opt::results) {
+	    $self->print_results($fdno,$in_fh,$out_fh);
+	} else {
+	    $self->print_normal($fdno,$in_fh,$out_fh);
+	}
+	flush $out_fh;
+    }
+    ::debug("print", "<<joboutput\n");
+    if(defined $self->{'exitstatus'}
+       and not ($self->virgin() and $opt::pipe)) {
+	if($Global::joblog and not $opt::sqlworker) {
+	    # Add to joblog when finished
+	    $self->print_joblog();
+	}
+	if($opt::sqlworker and not $opt::results) {
+	    $Global::sql->output($self);
+	}
+	if($Global::csvsep) {
+	    # Add output to CSV when finished
+	    $self->print_csv();
+	}
+	if($Global::jsonout) {
+	    $self->print_json();
+	}
+    }
+    return $returnsize - $self->returnsize();
+}
+
+{
+    my %jsonmap;
+
+    sub print_json($) {
+	my $self = shift;
+	sub jsonquote($) {
+	    my $a = shift;
+	    if(not $jsonmap{"\001"}) {
+		map { $jsonmap{sprintf("%c",$_)} =
+			  sprintf '\u%04x', $_ } 0..31;
+	    }
+	    $a =~ s/\\/\\\\/g;
+	    $a =~ s/\"/\\"/g;
+	    $a =~ s/([\000-\037])/$jsonmap{$1}/g;
+	    return $a;
+	}
+
+	my $cmd;
+	if($Global::verbose <= 1) {
+	    $cmd = jsonquote($self->replaced());
+	} else {
+	    # Verbose level > 1: Print the rsync and stuff
+	    $cmd = jsonquote(join " ", @{$self->{'commandline'}});
+	}
+	my $record_ref = $self->{'commandline'}{'arg_list_flat_orig'};
+
+	# Memory optimization: Overwrite with the joined output
+	$self->{'output'}{1} = join("", @{$self->{'output'}{1}});
+	$self->{'output'}{2} = join("", @{$self->{'output'}{2}});
+	# {
+	#   "Seq": 12,
+	#   "Host": "/usr/bin/ssh foo@lo",
+	#   "Starttime": 1608344711.743,
+	#   "JobRuntime": 0.01,
+	#   "Send": 0,
+	#   "Receive": 10,
+	#   "Exitval": 0,
+	#   "Signal": 0,
+	#   "Command": "echo 1",
+	#   "V": [
+	#     "1"
+	#   ],
+	#   "Stdout": "1\n",
+	#   "Stderr": ""
+	# }
+	#
+	printf($Global::csv_fh
+	       q({ "Seq": %s, "Host": "%s", "Starttime": %s, "JobRuntime": %s, ).
+	       q("Send": %s, "Receive": %s, "Exitval": %s, "Signal": %s, ).
+	       q("Command": "%s", "V": [ %s ], "Stdout": "%s", "Stderr": "%s" }).
+	       "\n",
+	       $self->seq(),
+	       jsonquote($self->sshlogin()->string()),
+	       $self->starttime(), sprintf("%0.3f",$self->runtime()),
+	       $self->transfersize(), $self->returnsize(),
+	       $self->exitstatus(), $self->exitsignal(), $cmd,
+	       (join ",",
+		map { '"'.jsonquote($_).'"' } @$record_ref[1..$#$record_ref],
+	       ),
+	       jsonquote($self->{'output'}{1}),
+	       jsonquote($self->{'output'}{2})
+	    );
+    }
+}
+
+{
+    my $header_printed;
+
+    sub print_csv($) {
+	my $self = shift;
+	my $cmd;
+	if($Global::verbose <= 1) {
+	    $cmd = $self->replaced();
+	} else {
+	    # Verbose level > 1: Print the rsync and stuff
+	    $cmd = join " ", @{$self->{'commandline'}};
+	}
+	my $record_ref = $self->{'commandline'}{'arg_list_flat_orig'};
+
+	if(not $header_printed) {
+	    # Variable headers
+	    # Normal => V1..Vn
+	    # --header : => first value from column
+	    my @V;
+	    if($opt::header) {
+		my $i = 1;
+		@V = (map { $Global::input_source_header{$i++} }
+		      @$record_ref[1..$#$record_ref]);
+	    } else {
+		my $V = "V1";
+		@V = (map { $V++ } @$record_ref[1..$#$record_ref]);
+	    }
+	    print $Global::csv_fh
+		(map { $$_ }
+		 combine_ref("Seq", "Host", "Starttime", "JobRuntime",
+			     "Send", "Receive", "Exitval", "Signal", "Command",
+			     @V,
+			     "Stdout","Stderr"
+		 )),"\n";
+	    $header_printed++;
+	}
+	# Memory optimization: Overwrite with the joined output
+	$self->{'output'}{1} = join("", @{$self->{'output'}{1}});
+	$self->{'output'}{2} = join("", @{$self->{'output'}{2}});
+	print $Global::csv_fh
+	    (map { $$_ }
+	     combine_ref
+	     ($self->seq(),
+	      $self->sshlogin()->string(),
+	      $self->starttime(), sprintf("%0.3f",$self->runtime()),
+	      $self->transfersize(), $self->returnsize(),
+	      $self->exitstatus(), $self->exitsignal(), \$cmd,
+	      \@$record_ref[1..$#$record_ref],
+	      \$self->{'output'}{1},
+	      \$self->{'output'}{2})),"\n";
+    }
+}
+
+sub combine_ref($) {
+    # Inspired by Text::CSV_PP::_combine (by Makamaka Hannyaharamitu)
+    my @part = @_;
+    my $sep = $Global::csvsep;
+    my $quot = '"';
+    my @out = ();
+
+    my $must_be_quoted;
+    for my $column (@part) {
+	# Memory optimization: Content transferred as reference
+	if(ref $column ne "SCALAR") {
+	    # Convert all columns to scalar references
+	    my $v = $column;
+	    $column = \$v;
+	}
+	if(not defined $$column) {
+	    $$column = '';
+	    next;
+	}
+
+	$must_be_quoted = 0;
+
+	if($$column =~ s/$quot/$quot$quot/go){
+	    # Replace " => ""
+	    $must_be_quoted ||=1;
+	}
+	if($$column =~ /[\s\Q$sep\E]/o){
+	    # Put quotes around if the column contains ,
+	    $must_be_quoted ||=1;
+	}
+
+	$Global::use{"bytes"} ||= eval "use bytes; 1;";
+	if ($$column =~ /\0/) {
+	    # Contains \0 => put quotes around
+	    $must_be_quoted ||=1;
+	}
+	if($must_be_quoted){
+	    push @out, \$sep, \$quot, $column, \$quot;
+	} else {
+	    push @out, \$sep, $column;
+	}
+    }
+    # Remove the first $sep: ,val,"val" => val,"val"
+    shift @out;
+    return @out;
+}
+
+sub print_files($) {
+    # Print the name of the file containing stdout on stdout
+    # Uses:
+    #	$opt::pipe
+    #	$opt::group = Print when job is done
+    #	$opt::linebuffer = Print ASAP
+    # Returns: N/A
+    my $self = shift;
+    my ($fdno,$in_fh,$out_fh) = @_;
+
+    # If the job is dead: close printing fh. Needed for --compress
+    close $self->fh($fdno,"w");
+    if($? and $opt::compress) {
+	::error($opt::compress_program." failed.");
+	$self->set_exitstatus(255);
+    }
+    if($opt::compress) {
+	# Kill the decompressor which will not be needed
+	CORE::kill "TERM", $self->fh($fdno,"rpid");
+    }
+    close $in_fh;
+
+    if($opt::pipe and $self->virgin()) {
+	# Nothing was printed to this job:
+	# cleanup unused tmp files because --files was set
+	for my $fdno (1,2) {
+	    ::rm($self->fh($fdno,"name"));
+	    ::rm($self->fh($fdno,"unlink"));
+	}
+    } elsif($fdno == 1 and $self->fh($fdno,"name")) {
+	print $out_fh $self->tag(),$self->fh($fdno,"name"),"\n";
+	if($Global::membuffer) {
+	    push @{$self->{'output'}{$fdno}},
+		$self->tag(), $self->fh($fdno,"name");
+	}
+	$self->add_returnsize(-s $self->fh($fdno,"name"));
+	# Mark as printed - do not print again
+	$self->set_fh($fdno,"name",undef);
+    }
+}
+
+
+# Different print types
+# (--ll | --ll --bar | --lb | --group | --parset | --sql-worker)
+# (--files | --results (.json|.csv|.tsv) )
+# --color-failed
+# --color
+# --keep-order
+# --tag
+# --bar
+{
+    my ($up,$currow,$maxrow);
+    my ($minvisible,%print_later,%notvisible);
+    my (%binmodeset,%tab);
+
+    sub latestline_init() {
+	# cursor_up cuu1 = up one line
+	$up = `sh -c "tput cuu1 </dev/tty" 2>/dev/null`;
+	chomp($up);
+	$currow = 1;
+	$maxrow = 1;
+	$minvisible = 1;
+	for(0..8) {
+	    $tab{$_} = " "x(8-($_%8));
+	}
+    }
+
+    sub print_latest_line($) {
+	my $self = shift;
+	my $out_fh = shift;
+	my $row = $self->row();
+	# Is row visible?
+	if(not ($minvisible <= $row
+		and
+		$row < $minvisible + ::terminal_rows() - 1)) {
+	    return;
+	}
+	if(not $binmodeset{$out_fh}++) {
+	    # Enable utf8 if possible
+	    eval q{ binmode $out_fh, "encoding(utf8)"; };
+	}
+	my ($color,$reset_color) = $self->color();
+	# Strings with TABs give the wrong length. Untabify strings
+	my $termcol = ::terminal_columns();
+	my $untabify_tag = ::decode_utf8($self->untabtag());
+	my $taglen = length $untabify_tag;
+	my $truncated_tag = "";
+	my $strlen = $termcol - $taglen;
+	my $untabify_str = ::decode_utf8($self->{$out_fh,'latestline'});
+	$untabify_str =~ s/\t/$tab{$-[0]%8}/g;
+	my $strspc = $strlen - length $untabify_str;
+	$strlen--;
+	if($strlen < 0) { $strlen = 0;}
+	# Line is shorter than terminal width: add " "
+	# Line is longer than terminal width: add ">"
+	my $truncated = ($strspc > 0) ? " " : ">";
+	if($taglen > $termcol) {
+	    # Tag is longer than terminal width: add ">" to tag
+	    # Remove $truncated (it will not be shown at all)
+	    $taglen = $termcol - 1;
+	    $truncated_tag = ">";
+	    $truncated = "";
+	}
+
+	$maxrow = $row > $maxrow ? $row : $maxrow;
+	printf($out_fh
+	       ("%s%s%s". # up down \r
+		"%.${taglen}s%s". # tag
+		"%s%.${strlen}s%s%s". # color + line
+		"%s" # down
+	       ),
+	       "$up"x($currow - $row),
+	       "\n"x($row - $currow),
+	       "\r", $untabify_tag,$truncated_tag,
+	       $color, $untabify_str, $truncated, $reset_color,
+	       "\n"x($maxrow - $row + 1));
+	$currow = $maxrow + 1;
+    }
+
+    sub print_linebuffer($) {
+	my $self = shift;
+	my ($fdno,$in_fh,$out_fh) = @_;
+	if(defined $self->{'exitstatus'}) {
+	    # If the job is dead: close printing fh. Needed for --compress
+	    close $self->fh($fdno,"w");
+	    if($opt::compress) {
+		if($?) {
+		    ::error($opt::compress_program." failed.");
+		    $self->set_exitstatus(255);
+		}
+		# Blocked reading in final round
+		for my $fdno (1,2) { ::set_fh_blocking($self->fh($fdno,'r')); }
+	    }
+	    if($opt::latestline) { $print_later{$self->row()} = $self; }
+	}
+	if(not $self->virgin()) {
+	    if($opt::files or ($opt::results and not $Global::csvsep)) {
+		# Print filename
+		if($fdno == 1 and not $self->fh($fdno,"printed")) {
+		    print $out_fh $self->tag(),$self->fh($fdno,"name"),"\n";
+		    if($Global::membuffer) {
+			push(@{$self->{'output'}{$fdno}}, $self->tag(),
+			     $self->fh($fdno,"name"));
+		    }
+		    $self->set_fh($fdno,"printed",1);
+		}
+		# No need for reading $in_fh, as it is from "cat >/dev/null"
+	    } else {
+		# Read halflines and print full lines
+		my $outputlength = 0;
+		my $halfline_ref = $self->{'halfline'}{$fdno};
+		my ($buf,$i,$rv);
+		# 1310720 gives 1.2 GB/s
+		# 131072  gives 0.9 GB/s
+		# The optimal block size differs
+		# It has been measured on:
+		# AMD 6376: 60800 (>70k is also reasonable)
+		# Intel i7-3632QM: 52-59k, 170-175k
+		# seq 64 | ppar --_test $1 --lb \
+		#   'yes {} `seq 1000`|head -c 10000000' >/dev/null
+		while($rv = sysread($in_fh, $buf, 60800)) {
+		    $outputlength += $rv;
+		    # TODO --recend
+		    # Treat both \n and \r as line end
+		    # Only test for \r if there is no \n
+		    # Test:
+		    #   perl -e '$a="x"x1000000;
+		    #	     $b="$a\r$a\n$a\r$a\n";
+		    #	     map { print $b,$_ } 1..10'
+		    $i = ((rindex($buf,"\n")+1) || (rindex($buf,"\r")+1));
+		    if($i) {
+			if($opt::latestline) {
+			    # Keep the latest full line
+			    my $l = join('', @$halfline_ref,
+					 substr($buf,0,$i-1));
+			    my $j = ((rindex($l,"\n")+1) ||
+				     (rindex($l,"\r")+1));
+			    $self->{$out_fh,'latestline'} = substr($l,$j);
+			    # Remove the processed part
+			    # by keeping the unprocessed part
+			    @$halfline_ref = (substr($buf,$i));
+			} else {
+			    # One or more complete lines were found
+			    if($Global::color) {
+				my $print = join("",@$halfline_ref,
+						 substr($buf,0,$i));
+				chomp($print);
+				my ($color,$reset_color) = $self->color();
+				my $colortag = $color.$self->tag();
+				# \n => reset \n color tag
+				$print =~ s{([\n\r])(?=.|$)}
+				{$reset_color$1$colortag}gs;
+				print($out_fh $colortag, $print,
+				      $reset_color, "\n");
+			    } elsif($opt::tag or defined $opt::tagstring) {
+				# Replace ^ with $tag within the full line
+				if($Global::cache_replacement_eval) {
+				    # Replace with the same value for tag
+				    my $tag = $self->tag();
+				    unshift @$halfline_ref, $tag;
+				    # TODO --recend that can be partially in
+				    # @$halfline_ref
+				    substr($buf,0,$i-1) =~
+					s/([\n\r])(?=.|$)/$1$tag/gs;
+				} else {
+				    # Replace with freshly computed tag-value
+				    unshift @$halfline_ref, $self->tag();
+				    substr($buf,0,$i-1) =~
+					s/([\n\r])(?=.|$)/$1.$self->tag()/gse;
+				}
+				# The length changed,
+				# so find the new ending pos
+				$i = ::max((rindex($buf,"\n")+1),
+					   (rindex($buf,"\r")+1));
+				# Print the partial line (halfline)
+				# and the last half
+				print $out_fh @$halfline_ref, substr($buf,0,$i);
+			    } else {
+				# Print the partial line (halfline)
+				# and the last half
+				print $out_fh @$halfline_ref, substr($buf,0,$i);
+			    }
+			    # Buffer in memory for SQL and CSV-output
+			    if($Global::membuffer) {
+				push(@{$self->{'output'}{$fdno}},
+				     @$halfline_ref, substr($buf,0,$i));
+			    }
+			    # Remove the printed part by keeping the unprinted
+			    @$halfline_ref = (substr($buf,$i));
+			}
+		    } else {
+			# No newline, so append to the halfline
+			push @$halfline_ref, $buf;
+		    }
+		}
+		$self->add_returnsize($outputlength);
+		if($opt::latestline) { $self->print_latest_line($out_fh); }
+	    }
+	    if(defined $self->{'exitstatus'}) {
+		if($opt::latestline) {
+		    # Force re-computing color if --colorfailed
+		    if($opt::colorfailed) { delete $self->{'color'}; }
+		    $self->print_latest_line($out_fh);
+		    # Print latest line from jobs that are already done
+		    while($print_later{$minvisible}) {
+			$print_later{$minvisible}->print_latest_line($out_fh);
+			delete $print_later{$minvisible};
+			$minvisible++;
+		    }
+		    # Print latest line from jobs that are on screen now
+		    for(my $row = $minvisible;
+			$row < $minvisible -1 + ::terminal_rows();
+			$row++) {
+			$print_later{$row} and
+			$print_later{$row}->print_latest_line($out_fh);
+		    }
+		}
+		if($opt::files or ($opt::results and not $Global::csvsep)) {
+		    $self->add_returnsize(-s $self->fh($fdno,"name"));
+		} else {
+		    # If the job is dead: print the remaining partial line
+		    # read remaining
+		    my $halfline_ref = $self->{'halfline'}{$fdno};
+		    if(grep /./, @$halfline_ref) {
+			my $returnsize = 0;
+			for(@{$self->{'halfline'}{$fdno}}) {
+			    $returnsize += length $_;
+			}
+			$self->add_returnsize($returnsize);
+			if($opt::tag or defined $opt::tagstring) {
+			    # Prepend $tag the the remaining half line
+			    unshift @$halfline_ref, $self->tag();
+			}
+			# Print the partial line (halfline)
+			print $out_fh @{$self->{'halfline'}{$fdno}};
+			# Buffer in memory for SQL and CSV-output
+			if($Global::membuffer) {
+			    push(@{$self->{'output'}{$fdno}}, @$halfline_ref);
+			}
+			@$halfline_ref = ();
+		    }
+		}
+		if($self->fh($fdno,"rpid") and
+		   CORE::kill 0, $self->fh($fdno,"rpid")) {
+		    # decompress still running
+		} else {
+		    # decompress done: close fh
+		    close $in_fh;
+		    if($? and $opt::compress) {
+			::error($opt::decompress_program." failed.");
+			$self->set_exitstatus(255);
+		    }
+		}
+	    }
+	}
+    }
+}
+
+sub free_ressources() {
+    my $self = shift;
+    if(not $opt::ungroup) {
+	my $fh;
+	for my $fdno (sort { $a <=> $b } keys %Global::fh) {
+	    $fh = $self->fh($fdno,"w");
+	    $fh and close $fh;
+	    $fh = $self->fh($fdno,"r");
+	    $fh and close $fh;
+	}
+    }
+}
+
+sub print_parset($) {
+    # Wrap output with shell script code to set as variables
+    my $self = shift;
+    my ($fdno,$in_fh,$out_fh) = @_;
+    my $outputlength = 0;
+
+    ::debug("parset","print $Global::parset");
+    if($Global::parset eq "assoc") {
+	# Start: (done in parse_parset())
+	#   eval "`echo 'declare -A myassoc; myassoc=(
+	# Each: (done here)
+	#   [$'a\tb']=$'a\tb\tc	 ddd'
+	# End: (done in wait_and_exit())
+	#   )'`"
+	print '[',::Q($self->{'commandline'}->
+		      replace_placeholders(["\257<\257>"],0,0)),']=';
+    } elsif($Global::parset eq "array") {
+	# Start: (done in parse_parset())
+	#   eval "`echo 'myassoc=(
+	# Each: (done here)
+	#   $'a\tb\tc  ddd'
+	# End: (done in wait_and_exit())
+	#   )'`"
+    } elsif($Global::parset eq "var") {
+	# Start: (done in parse_parset())
+	#   <empty>
+	# Each: (done here)
+	#   var=$'a\tb\tc  ddd'
+	# End: (done in wait_and_exit())
+	#   <empty>
+	if(not @Global::parset_vars) {
+	    ::error("Too few named destination variables");
+	    ::wait_and_exit(255);
+	}
+	print shift @Global::parset_vars,"=";
+    }
+    local $/ = "\n";
+    my $tag = $self->tag();
+    my @out;
+    while(<$in_fh>) {
+	$outputlength += length $_;
+	# Tag lines with \r, too
+	$_ =~ s/(?<=[\r])(?=.|$)/$tag/gs;
+	push @out, $tag,$_;
+    }
+    # Remove last newline
+    # This often makes it easier to use the output in shell
+    @out and ${out[$#out]} =~ s/\n$//s;
+    print ::Q(join("",@out)),"\n";
+    return $outputlength;
+}
+
+sub print_normal($) {
+    my $self = shift;
+    my ($fdno,$in_fh,$out_fh) = @_;
+    my $buf;
+    close $self->fh($fdno,"w");
+    if($? and $opt::compress) {
+	::error($opt::compress_program." failed.");
+	$self->set_exitstatus(255);
+    }
+    if(not $self->virgin()) {
+	seek $in_fh, 0, 0;
+	# $in_fh is now ready for reading at position 0
+	my $outputlength = 0;
+	my @output;
+
+	if($Global::parset and $fdno == 1) {
+	    $outputlength += $self->print_parset($fdno,$in_fh,$out_fh);
+	} elsif(defined $opt::tag or defined $opt::tagstring
+		or $Global::color or $opt::colorfailed) {
+	    if($Global::color or $opt::colorfailed) {
+		my ($color,$reset_color) = $self->color();
+		my $colortag = $color.$self->tag();
+		# Read line by line
+		local $/ = "\n";
+		while(<$in_fh>) {
+		    $outputlength += length $_;
+		    # Tag lines with \r, too
+		    chomp;
+		    s{([\n\r])(?=.|$)}{$reset_color$1$colortag}gs;
+		    print $out_fh $colortag,$_,$reset_color,"\n";
+		}
+	    } else {
+		my $tag = $self->tag();
+		my $pretag = 1;
+		my $s;
+		while(sysread($in_fh,$buf,32767)) {
+		    $outputlength += length $buf;
+		    $buf =~ s/(?<=[\r\n])(?=.)/$tag/gs;
+		    print $out_fh ($pretag ? $tag : ""),$buf;
+		    if($Global::membuffer) {
+			push @{$self->{'output'}{$fdno}},
+			    ($pretag ? $tag : ""),$buf;
+		    }
+		    # Should next print start with a tag?
+		    $s = substr($buf, -1);
+		    # This is faster than ($s eq "\n") || ($s eq "\r")
+		    $pretag = ($s eq "\n") ? 1 : ($s eq "\r");
+		}
+	    }
+	} else {
+	    # Most efficient way of copying data from $in_fh to $out_fh
+	    # Intel i7-3632QM: 25k-
+	    while(sysread($in_fh,$buf,32767)) {
+		print $out_fh $buf;
+		$outputlength += length $buf;
+		if($Global::membuffer) {
+		    push @{$self->{'output'}{$fdno}}, $buf;
+		}
+	    }
+	}
+	if($fdno == 1) {
+	    $self->add_returnsize($outputlength);
+	}
+	close $in_fh;
+	if($? and $opt::compress) {
+	    ::error($opt::decompress_program." failed.");
+	    $self->set_exitstatus(255);
+	}
+    }
+}
+
+sub print_results($) {
+    my $self = shift;
+    my ($fdno,$in_fh,$out_fh) = @_;
+    my $buf;
+    close $self->fh($fdno,"w");
+    if($? and $opt::compress) {
+	::error($opt::compress_program." failed.");
+	$self->set_exitstatus(255);
+    }
+    if(not $self->virgin()) {
+	seek $in_fh, 0, 0;
+	# $in_fh is now ready for reading at position 0
+	my $outputlength = 0;
+	my @output;
+
+	if($Global::membuffer) {
+	    # Read data into membuffer
+	    if($opt::tag or $opt::tagstring) {
+		# Read line by line
+		local $/ = "\n";
+		my $tag = $self->tag();
+		while(<$in_fh>) {
+		    $outputlength += length $_;
+		    # Tag lines with \r, too
+		    $_ =~ s/(?<=[\r])(?=.|$)/$tag/gs;
+		    push @{$self->{'output'}{$fdno}}, $tag, $_;
+		}
+	    } else {
+		# Most efficient way of copying data from $in_fh to $out_fh
+		while(sysread($in_fh,$buf,60000)) {
+		    $outputlength += length $buf;
+		    push @{$self->{'output'}{$fdno}}, $buf;
+		}
+	    }
+	} else {
+	    # Not membuffer: No need to read the file
+	    if($opt::compress) {
+		$outputlength = -1;
+	    } else {
+		# Determine $outputlength = file length
+		seek($in_fh, 0, 2) || ::die_bug("cannot seek result");
+		$outputlength = tell($in_fh);
+	    }
+	}
+	if($fdno == 1) { $self->add_returnsize($outputlength); }
+	close $in_fh;
+	if($? and $opt::compress) {
+	    ::error($opt::decompress_program." failed.");
+	    $self->set_exitstatus(255);
+	}
+    }
+}
+
+sub print_joblog($) {
+    my $self = shift;
+    my $cmd;
+    if($Global::verbose <= 1) {
+	$cmd = $self->replaced();
+    } else {
+	# Verbose level > 1: Print the rsync and stuff
+	$cmd = $self->wrapped();
+    }
+    # Newlines make it hard to parse the joblog
+    $cmd =~ s/\n/\0/g;
+    print $Global::joblog
+	join("\t", $self->seq(), $self->sshlogin()->string(),
+	     $self->starttime(), sprintf("%10.3f",$self->runtime()),
+	     $self->transfersize(), $self->returnsize(),
+	     $self->exitstatus(), $self->exitsignal(), $cmd
+	). "\n";
+    flush $Global::joblog;
+    $self->set_job_in_joblog();
+}
+
+sub tag($) {
+    my $self = shift;
+    if(not defined $self->{'tag'} or not $Global::cache_replacement_eval) {
+	if(defined $opt::tag or defined $opt::tagstring) {
+	    $self->{'tag'} =
+		($self->{'commandline'}->
+		 replace_placeholders([$opt::tagstring],0,0)).
+		"\t";
+	} else {
+	    # No tag
+	    $self->{'tag'} = "";
+	}
+    }
+    return $self->{'tag'};
+}
+
+sub untabtag($) {
+    # tag with \t replaced with spaces
+    my $self = shift;
+    my $tag = $self->tag();
+    if(not defined $self->{'untab'}{$tag}) {
+	my $t = $tag;
+	$t =~ s/\t/" "x(8-($-[0]%8))/eg;
+	$self->{'untab'}{$tag} = $t;
+    }
+    return $self->{'untab'}{$tag};
+}
+
+{
+    my (@color,$eol,$reset_color,$init);
+
+    sub init_color() {
+	if(not $init) {
+	    $init = 1;
+	    # color combinations that are readable: black/white text
+	    # on colored background, but not white on yellow
+	    my @color_combinations =
+		# Force each color code to have the same length in chars
+		# This will make \t work as expected
+		((map { [sprintf("%03d",$_),"000"] }
+		  6..7,9..11,13..15,40..51,75..87,113..123,147..159,
+		  171..182,185..231,249..254),
+		 (map { [sprintf("%03d",$_),231] }
+		  1..9,12..13,16..45,52..81,88..114,124..149,
+		  160..178,180,182..184,196..214,232..250));
+	    # reorder list so adjacent colors are dissimilar
+	    # %23 and %7 were found experimentally
+	    @color_combinations = @color_combinations[
+		sort { ($a%23 <=> $b%23) or ($b%7 <=> $a%7) }
+		0..$#color_combinations
+		];
+	    @color = map {
+		# TODO Can this be done with `tput` codes?
+		"\033[48;5;".$_->[0].";38;5;".$_->[1]."m"
+	    } @color_combinations;
+
+	    # clr_eol el = clear to end of line
+	    $eol = `sh -c "tput el </dev/tty" 2>/dev/null`;
+	    chomp($eol);
+	    if($eol eq "") { $eol = "\033[K"; }
+	    # exit_attribute_mode sgr0 = turn off all attributes
+	    $reset_color = `sh -c "tput sgr0 </dev/tty" 2>/dev/null`;
+	    chomp($reset_color);
+	    if($reset_color eq "") { $reset_color = "\033[m"; }
+	}
+    }
+
+    sub color($) {
+	my $self = shift;
+	if(not defined $self->{'color'}) {
+	    if($Global::color) {
+		# Choose a value based on the seq
+		$self->{'color'} = $color[$self->seq() % ($#color+1)].$eol;
+		$self->{'reset_color'} = $reset_color;
+	    } else {
+		$self->{'color'} = "";
+		$self->{'reset_color'} = "";
+	    }
+	    if($opt::colorfailed) {
+		if($self->exitstatus()) {
+		    # White on Red
+		    # Can this be done more generally?
+		    $self->{'color'} =
+			"\033[48;5;"."196".";38;5;"."231"."m".$eol;
+		    $self->{'reset_color'} = $reset_color;
+		}
+	    }
+	}
+	return ($self->{'color'},$self->{'reset_color'});
+    }
+}
+
+sub hostgroups($) {
+    my $self = shift;
+    if(not defined $self->{'hostgroups'}) {
+	$self->{'hostgroups'} =
+	    $self->{'commandline'}->{'arg_list'}[0][0]->{'hostgroups'};
+    }
+    return @{$self->{'hostgroups'}};
+}
+
+sub exitstatus($) {
+    my $self = shift;
+    return $self->{'exitstatus'};
+}
+
+sub set_exitstatus($$) {
+    my $self = shift;
+    my $exitstatus = shift;
+    if($exitstatus) {
+	# Overwrite status if non-zero
+	$self->{'exitstatus'} = $exitstatus;
+    } else {
+	# Set status but do not overwrite
+	# Status may have been set by --timeout
+	$self->{'exitstatus'} ||= $exitstatus;
+    }
+    $opt::sqlworker and
+	$Global::sql->update("SET Exitval = ? WHERE Seq = ".$self->seq(),
+			     $exitstatus);
+}
+
+sub reset_exitstatus($) {
+    my $self = shift;
+    undef $self->{'exitstatus'};
+}
+
+sub exitsignal($) {
+    my $self = shift;
+    return $self->{'exitsignal'};
+}
+
+sub set_exitsignal($$) {
+    my $self = shift;
+    my $exitsignal = shift;
+    $self->{'exitsignal'} = $exitsignal;
+    $opt::sqlworker and
+	$Global::sql->update("SET _Signal = ? WHERE Seq = ".$self->seq(),
+			     $exitsignal);
+}
+
+{
+    my $total_jobs;
+
+    sub should_we_halt {
+	# Should we halt? Immediately? Gracefully?
+	# Returns: N/A
+	my $job = shift;
+	my $limit;
+	if($Global::semaphore) {
+	    # Emulate Bash's +128 if there is a signal
+	    $Global::halt_exitstatus =
+		($job->exitstatus()
+		 or
+		 $job->exitsignal() ? $job->exitsignal() + 128 : 0);
+	}
+	if($job->exitstatus() or $job->exitsignal()) {
+	    # Job failed
+	    $Global::exitstatus++;
+	    $Global::total_failed++;
+	    if($Global::halt_fail) {
+		::status("$Global::progname: This job failed:",
+			 $job->replaced());
+		$limit = $Global::total_failed;
+	    }
+	} elsif($Global::halt_success) {
+	    ::status("$Global::progname: This job succeeded:",
+		     $job->replaced());
+	    $limit = $Global::total_completed - $Global::total_failed;
+	}
+	if($Global::halt_done) {
+	    ::status("$Global::progname: This job finished:",
+		     $job->replaced());
+	    $limit = $Global::total_completed;
+	}
+	if(not defined $limit) {
+	    return ""
+	}
+	#  --halt # => 1..100 (number of jobs failed, 101 means > 100)
+	#  --halt % => 1..100 (pct of jobs failed)
+	if($Global::halt_pct and not $Global::halt_count) {
+	    $total_jobs ||= $Global::JobQueue->total_jobs();
+	    # From the pct compute the number of jobs that must fail/succeed
+	    $Global::halt_count = $total_jobs * $Global::halt_pct;
+	}
+	if($limit >= $Global::halt_count) {
+	    # At least N jobs have failed/succeded/completed
+	    # or at least N% have failed/succeded/completed
+	    # So we should prepare for exit
+	    if($Global::halt_fail or $Global::halt_done) {
+		# Set exit status
+		if(not defined $Global::halt_exitstatus) {
+		    if($Global::halt_pct) {
+			# --halt now,fail=X% or soon,fail=X%
+			# --halt now,done=X% or soon,done=X%
+			$Global::halt_exitstatus =
+			    ::ceil($Global::total_failed / $total_jobs * 100);
+		    } elsif($Global::halt_count) {
+			# --halt now,fail=X or soon,fail=X
+			# --halt now,done=X or soon,done=X
+			$Global::halt_exitstatus =
+			    ::min($Global::total_failed,101);
+		    }
+		    if($Global::halt_count and $Global::halt_count == 1) {
+			# --halt now,fail=1 or soon,fail=1
+			# --halt now,done=1 or soon,done=1
+			# Emulate Bash's +128 if there is a signal
+			$Global::halt_exitstatus =
+			    ($job->exitstatus()
+			     or
+			     $job->exitsignal() ? $job->exitsignal() + 128 : 0);
+		    }
+		}
+		::debug("halt","Pct: ",$Global::halt_pct,
+			" count: ",$Global::halt_count,
+			" status: ",$Global::halt_exitstatus,"\n");
+	    } elsif($Global::halt_success) {
+		$Global::halt_exitstatus = 0;
+	    }
+	    if($Global::halt_when eq "soon") {
+		$Global::start_no_new_jobs ||= 1;
+		if(scalar(keys %Global::running) > 0) {
+		    # Only warn if there are more jobs running
+		    ::status
+			("$Global::progname: Starting no more jobs. ".
+			 "Waiting for ". (keys %Global::running).
+			 " jobs to finish.");
+		}
+	    }
+	    return($Global::halt_when);
+	}
+	return "";
+    }
+}
+
+
+package CommandLine;
+
+sub new($) {
+    my $class = shift;
+    my $seq = shift;
+    my $commandref = shift;
+    $commandref || die;
+    my $arg_queue = shift;
+    my $context_replace = shift;
+    my $max_number_of_args = shift; # for -N and normal (-n1)
+    my $transfer_files = shift;
+    my $return_files = shift;
+    my $template_names = shift;
+    my $template_contents = shift;
+    my $replacecount_ref = shift;
+    my $len_ref = shift;
+    my %replacecount = %$replacecount_ref;
+    my %len = %$len_ref;
+    for (keys %$replacecount_ref) {
+	# Total length of this replacement string {} replaced with all args
+	$len{$_} = 0;
+    }
+    return bless {
+	'command' => $commandref,
+	'seq' => $seq,
+	'len' => \%len,
+	'arg_list' => [],
+	'arg_list_flat' => [],
+	'arg_list_flat_orig' => [undef],
+	'arg_queue' => $arg_queue,
+	'max_number_of_args' => $max_number_of_args,
+	'replacecount' => \%replacecount,
+	'context_replace' => $context_replace,
+	'transfer_files' => $transfer_files,
+	'return_files' => $return_files,
+	'template_names' => $template_names,
+	'template_contents' => $template_contents,
+	'replaced' => undef,
+    }, ref($class) || $class;
+}
+
+sub flush_cache() {
+    my $self = shift;
+    for my $arglist (@{$self->{'arg_list'}}) {
+	for my $arg (@$arglist) {
+	    $arg->flush_cache();
+	}
+    }
+    $self->{'arg_queue'}->flush_cache();
+    $self->{'replaced'} = undef;
+}
+
+sub seq($) {
+    my $self = shift;
+    return $self->{'seq'};
+}
+
+sub set_seq($$) {
+    my $self = shift;
+    $self->{'seq'} = shift;
+}
+
+sub slot($) {
+    # Find the number of a free job slot and return it
+    # Uses:
+    #	@Global::slots - list with free jobslots
+    # Returns:
+    #	$jobslot = number of jobslot
+    my $self = shift;
+    if(not $self->{'slot'}) {
+	if(not @Global::slots) {
+	    # $max_slot_number will typically be $Global::max_jobs_running
+	    push @Global::slots, ++$Global::max_slot_number;
+	}
+	$self->{'slot'} = shift @Global::slots;
+    }
+    return $self->{'slot'};
+}
+
+{
+    my $already_spread;
+    my $darwin_max_len;
+
+    sub populate($) {
+	# Add arguments from arg_queue until the number of arguments or
+	# max line length is reached
+	# Uses:
+	#   $Global::usable_command_line_length
+	#   $opt::cat
+	#   $opt::fifo
+	#   $Global::JobQueue
+	#   $opt::m
+	#   $opt::X
+	#   $Global::max_jobs_running
+	# Returns: N/A
+	my $self = shift;
+	my $next_arg;
+	my $max_len = $Global::usable_command_line_length || die;
+	if($^O eq "darwin") {
+	    # Darwin's limit is affected by:
+	    # * number of environment names (variables+functions)
+	    # * size of environment
+	    # * the length of arguments:
+	    #	a one-char argument lowers the limit by 5
+	    #	To be safe assume all arguments are one-char
+	    # The max_len is cached between runs, but if the size of
+	    # the environment is different we need to recompute the
+	    # usable max length for this run of GNU Parallel
+	    # See https://unix.stackexchange.com/a/604943/2972
+	    if(not $darwin_max_len) {
+		my $envc = (keys %ENV);
+		my $envn = length join"",(keys %ENV);
+		my $envv = length join"",(values %ENV);
+		$darwin_max_len = -146+($max_len - $envn - $envv) - $envc*10;
+		::debug("init",
+			"length: $darwin_max_len ".
+			"3+($max_len - $envn - $envv)/5 - $envc*2");
+	    }
+	    $max_len = $darwin_max_len;
+	}
+	if($opt::cat or $opt::fifo) {
+	    # Get the empty arg added by --pipepart (if any)
+	    $Global::JobQueue->{'commandlinequeue'}->{'arg_queue'}->get();
+	    # $PARALLEL_TMP will point to a tempfile that will be used as {}
+	    $Global::JobQueue->{'commandlinequeue'}->{'arg_queue'}->
+		unget([Arg->new('$PARALLEL_TMP')]);
+	}
+	while (not $self->{'arg_queue'}->empty()) {
+	    $next_arg = $self->{'arg_queue'}->get();
+	    if(not defined $next_arg) {
+		next;
+	    }
+	    $self->push($next_arg);
+	    if($self->len() >= $max_len) {
+		# Command length is now > max_length
+		# If there are arguments: remove the last
+		# If there are no arguments: Error
+		# TODO stuff about -x opt_x
+		if($self->number_of_args() > 1) {
+		    # There is something to work on
+		    $self->{'arg_queue'}->unget($self->pop());
+		    last;
+		} else {
+		    my $args = join(" ", map { $_->orig() } @$next_arg);
+		    ::error("Command line too long (".
+			    $self->len(). " >= ".
+			    $max_len.
+			    ") at input ".
+			    $self->{'arg_queue'}->arg_number().
+			    ": ".
+			    ((length $args > 50) ?
+			     (substr($args,0,50))."..." :
+			     $args));
+		    $self->{'arg_queue'}->unget($self->pop());
+		    ::wait_and_exit(255);
+		}
+	    }
+
+	    if(defined $self->{'max_number_of_args'}) {
+		if($self->number_of_args() >= $self->{'max_number_of_args'}) {
+		    last;
+		}
+	    }
+	}
+	if(($opt::m or $opt::X) and not $already_spread
+	   and $self->{'arg_queue'}->empty() and $Global::max_jobs_running) {
+	    # -m or -X and EOF => Spread the arguments over all jobslots
+	    # (unless they are already spread)
+	    $already_spread ||= 1;
+	    if($self->number_of_args() > 1) {
+		$self->{'max_number_of_args'} =
+		    ::ceil($self->number_of_args()/$Global::max_jobs_running);
+		$Global::JobQueue->{'commandlinequeue'}->{'max_number_of_args'} =
+		    $self->{'max_number_of_args'};
+		$self->{'arg_queue'}->unget($self->pop_all());
+		while($self->number_of_args() < $self->{'max_number_of_args'}) {
+		    $self->push($self->{'arg_queue'}->get());
+		}
+	    }
+	    $Global::JobQueue->flush_total_jobs();
+	}
+
+	if($opt::sqlmaster) {
+	    # Insert the V1..Vn for this $seq in SQL table
+	    # instead of generating one
+	    $Global::sql->insert_records($self->seq(), $self->{'command'},
+					 $self->{'arg_list_flat_orig'});
+	}
+    }
+}
+
+sub push($) {
+    # Add one or more records as arguments
+    # Returns: N/A
+    my $self = shift;
+    my $record = shift;
+    push @{$self->{'arg_list_flat_orig'}}, map { $_->orig() } @$record;
+    push @{$self->{'arg_list_flat'}}, @$record;
+    push @{$self->{'arg_list'}}, $record;
+    # Make @arg available for {= =}
+    *Arg::arg = $self->{'arg_list_flat_orig'};
+
+    my $quote_arg = ($Global::quote_replace and not $Global::quoting);
+    my $col;
+    for my $perlexpr (keys %{$self->{'replacecount'}}) {
+	if($perlexpr =~ /^(-?\d+)(?:\D.*|)$/) {
+	    # Positional replacement string
+	    # Deal with negative positional replacement string
+	    $col = ($1 < 0) ? $1 : $1-1;
+	    if(defined($record->[$col])) {
+		$self->{'len'}{$perlexpr} +=
+		    length $record->[$col]->replace($perlexpr,$quote_arg,$self);
+	    }
+	} else {
+	    for my $arg (@$record) {
+		if(defined $arg) {
+		    $self->{'len'}{$perlexpr} +=
+			length $arg->replace($perlexpr,$quote_arg,$self);
+		}
+	    }
+	}
+    }
+}
+
+sub pop($) {
+    # Remove last argument
+    # Returns:
+    #	the last record
+    my $self = shift;
+    my $record = pop @{$self->{'arg_list'}};
+    # pop off arguments from @$record
+    splice @{$self->{'arg_list_flat_orig'}}, -($#$record+1), $#$record+1;
+    splice @{$self->{'arg_list_flat'}}, -($#$record+1), $#$record+1;
+    my $quote_arg = ($Global::quote_replace and not $Global::quoting);
+    for my $perlexpr (keys %{$self->{'replacecount'}}) {
+	if($perlexpr =~ /^(\d+) /) {
+	    # Positional
+	    defined($record->[$1-1]) or next;
+	    $self->{'len'}{$perlexpr} -=
+		length $record->[$1-1]->replace($perlexpr,$quote_arg,$self);
+	} else {
+	    for my $arg (@$record) {
+		if(defined $arg) {
+		    $self->{'len'}{$perlexpr} -=
+			length $arg->replace($perlexpr,$quote_arg,$self);
+		}
+	    }
+	}
+    }
+    return $record;
+}
+
+sub pop_all($) {
+    # Remove all arguments and zeros the length of replacement perlexpr
+    # Returns:
+    #	all records
+    my $self = shift;
+    my @popped = @{$self->{'arg_list'}};
+    for my $perlexpr (keys %{$self->{'replacecount'}}) {
+	$self->{'len'}{$perlexpr} = 0;
+    }
+    $self->{'arg_list'} = [];
+    $self->{'arg_list_flat_orig'} = [undef];
+    $self->{'arg_list_flat'} = [];
+    return @popped;
+}
+
+sub number_of_args($) {
+    # The number of records
+    # Returns:
+    #	number of records
+    my $self = shift;
+    # This is really the number of records
+    return $#{$self->{'arg_list'}}+1;
+}
+
+sub number_of_recargs($) {
+    # The number of args in records
+    # Returns:
+    #	number of args records
+    my $self = shift;
+    my $sum = 0;
+    my $nrec = scalar @{$self->{'arg_list'}};
+    if($nrec) {
+	$sum = $nrec * (scalar @{$self->{'arg_list'}[0]});
+    }
+    return $sum;
+}
+
+sub args_as_string($) {
+    # Returns:
+    #  all unmodified arguments joined with ' ' (similar to {})
+    my $self = shift;
+    return (join " ", map { $_->orig() }
+	    map { @$_ } @{$self->{'arg_list'}});
+}
+
+sub results_out($) {
+    sub max_file_name_length {
+	# Figure out the max length of a subdir
+	# TODO and the max total length
+	# Ext4 = 255,130816
+	# Uses:
+	#   $Global::max_file_length is set
+	# Returns:
+	#   $Global::max_file_length
+	my $testdir = shift;
+
+	my $upper = 100_000_000;
+	# Dir length of 8 chars is supported everywhere
+	my $len = 8;
+	my $dir = "d"x$len;
+	do {
+	    rmdir($testdir."/".$dir);
+	    $len *= 16;
+	    $dir = "d"x$len;
+	} while ($len < $upper and mkdir $testdir."/".$dir);
+	# Then search for the actual max length between $len/16 and $len
+	my $min = $len/16;
+	my $max = $len;
+	while($max-$min > 5) {
+	    # If we are within 5 chars of the exact value:
+	    # it is not worth the extra time to find the exact value
+	    my $test = int(($min+$max)/2);
+	    $dir = "d"x$test;
+	    if(mkdir $testdir."/".$dir) {
+		rmdir($testdir."/".$dir);
+		$min = $test;
+	    } else {
+		$max = $test;
+	    }
+	}
+	$Global::max_file_length = $min;
+	return $min;
+    }
+
+    my $self = shift;
+    my $out = $self->replace_placeholders([$opt::results],0,0);
+    if($out eq $opt::results) {
+	# $opt::results simple string: Append args_as_dirname
+	my $args_as_dirname = $self->args_as_dirname();
+	# Output in: prefix/name1/val1/name2/val2/stdout
+	$out = $opt::results."/".$args_as_dirname;
+	if(-d $out or eval{ File::Path::mkpath($out); }) {
+	    # OK
+	} else {
+	    # mkpath failed: Argument probably too long.
+	    # Set $Global::max_file_length, which will keep the individual
+	    # dir names shorter than the max length
+	    max_file_name_length($opt::results);
+	    $args_as_dirname = $self->args_as_dirname();
+	    # prefix/name1/val1/name2/val2/
+	    $out = $opt::results."/".$args_as_dirname;
+	    File::Path::mkpath($out);
+	}
+	$out .="/";
+    } else {
+	if($out =~ m:/$:) {
+	    # / = dir
+	    if(-d $out or eval{ File::Path::mkpath($out); }) {
+		# OK
+	    } else {
+		::error("Cannot make dir '$out'.");
+		::wait_and_exit(255);
+	    }
+	} else {
+	    $out =~ m:(.*)/:;
+	    File::Path::mkpath($1);
+	}
+    }
+    return $out;
+}
+
+sub args_as_dirname($) {
+    # Returns:
+    #  all unmodified arguments joined with '/' (similar to {})
+    #  \t \0 \\ and / are quoted as: \t \0 \\ \_
+    # If $Global::max_file_length: Keep subdirs < $Global::max_file_length
+    my $self = shift;
+    my @res = ();
+
+    for my $rec_ref (@{$self->{'arg_list'}}) {
+	# If headers are used, sort by them.
+	# Otherwise keep the order from the command line.
+	my @header_indexes_sorted = header_indexes_sorted($#$rec_ref+1);
+	for my $n (@header_indexes_sorted) {
+	    CORE::push(@res,
+		 $Global::input_source_header{$n},
+		 map { my $s = $_;
+		       #  \t \0 \\ and / are quoted as: \t \0 \\ \_
+		       $s =~ s/\\/\\\\/g;
+		       $s =~ s/\t/\\t/g;
+		       $s =~ s/\0/\\0/g;
+		       $s =~ s:/:\\_:g;
+		       if($Global::max_file_length) {
+			   # Keep each subdir shorter than the longest
+			   # allowed file name
+			   $s = substr($s,0,$Global::max_file_length);
+		       }
+		       $s; }
+		 $rec_ref->[$n-1]->orig());
+	}
+    }
+    return join "/", @res;
+}
+
+sub header_indexes_sorted($) {
+    # Sort headers first by number then by name.
+    # E.g.: 1a 1b 11a 11b
+    # Returns:
+    #  Indexes of %Global::input_source_header sorted
+    my $max_col = shift;
+
+    no warnings 'numeric';
+    for my $col (1 .. $max_col) {
+	# Make sure the header is defined. If it is not: use column number
+	if(not defined $Global::input_source_header{$col}) {
+	    $Global::input_source_header{$col} = $col;
+	}
+    }
+    my @header_indexes_sorted = sort {
+	# Sort headers numerically then asciibetically
+	$Global::input_source_header{$a} <=> $Global::input_source_header{$b}
+	or
+	    $Global::input_source_header{$a} cmp $Global::input_source_header{$b}
+    } 1 .. $max_col;
+    return @header_indexes_sorted;
+}
+
+sub len($) {
+    # Uses:
+    #	@opt::shellquote
+    # The length of the command line with args substituted
+    my $self = shift;
+    my $len = 0;
+    # Add length of the original command with no args
+    # Length of command w/ all replacement args removed
+    $len += $self->{'len'}{'noncontext'} + @{$self->{'command'}} -1;
+    ::debug("length", "noncontext + command: $len\n");
+    # MacOS has an overhead of 8 bytes per argument
+    my $darwin = ($^O eq "darwin") ? 8 : 0;
+    my $recargs = $self->number_of_recargs();
+    if($self->{'context_replace'}) {
+	# Context is duplicated for each arg
+	$len += $recargs * $self->{'len'}{'context'};
+	for my $replstring (keys %{$self->{'replacecount'}}) {
+	    # If the replacements string is more than once: mulitply its length
+	    $len += $self->{'len'}{$replstring} *
+		$self->{'replacecount'}{$replstring};
+	    ::debug("length", $replstring, " ", $self->{'len'}{$replstring}, "*",
+		    $self->{'replacecount'}{$replstring}, "\n");
+	}
+	# echo 11 22 33 44 55 66 77 88 99 1010
+	# echo 1 2 3 4 5 6 7 8 9 10 1 2 3 4 5 6 7 8 9 10
+	# 5 +  ctxgrp*arg
+	::debug("length", "Ctxgrp: ", $self->{'len'}{'contextgroups'},
+		" Groups: ", $self->{'len'}{'noncontextgroups'}, "\n");
+	# Add space between context groups
+	$len += ($recargs-1) * ($self->{'len'}{'contextgroups'});
+	if($darwin) {
+	    $len += $recargs * $self->{'len'}{'contextgroups'} * $darwin;
+	}
+    } else {
+	# Each replacement string may occur several times
+	# Add the length for each time
+	$len += 1*$self->{'len'}{'context'};
+	::debug("length", "context+noncontext + command: $len\n");
+	for my $replstring (keys %{$self->{'replacecount'}}) {
+	    # (space between recargs + length of replacement)
+	    # * number this replacement is used
+	    $len += ($recargs -1 + $self->{'len'}{$replstring}) *
+		$self->{'replacecount'}{$replstring};
+	    if($darwin) {
+		$len += ($recargs * $self->{'replacecount'}{$replstring}
+			 * $darwin);
+	    }
+	}
+    }
+    if(defined $Global::parallel_env) {
+	# If we are using --env, add the prefix for that, too.
+	$len += length $Global::parallel_env;
+    }
+    if($Global::quoting) {
+	# Pessimistic length if -q is set
+	# Worse than worst case: ' => "'" + " => '"'
+	# TODO can we count the number of expanding chars?
+	#   and count them in arguments, too?
+	$len *= 3;
+    }
+    if(@opt::shellquote) {
+	# Pessimistic length if --shellquote is set
+	# Worse than worst case: ' => "'"
+	for(@opt::shellquote) {
+	    $len *= 3;
+	}
+	$len *= 5;
+    }
+    if(@opt::sshlogin) {
+	# Pessimistic length if remote
+	# Worst case is BASE64 encoding 3 bytes -> 4 bytes
+	$len = int($len*4/3);
+    }
+    return $len;
+}
+
+sub replaced($) {
+    # Uses:
+    #	$Global::quote_replace
+    #	$Global::quoting
+    # Returns:
+    #	$replaced = command with place holders replaced and prepended
+    my $self = shift;
+    if(not defined $self->{'replaced'}) {
+	# Don't quote arguments if the input is the full command line
+	my $quote_arg = ($Global::quote_replace and not $Global::quoting);
+	# or if ($opt::cat or $opt::pipe) as they use $PARALLEL_TMP
+	$quote_arg = ($opt::cat || $opt::fifo) ? 0 : $quote_arg;
+	$self->{'replaced'} = $self->
+	    replace_placeholders($self->{'command'},$Global::quoting,
+				 $quote_arg);
+	my $len = length $self->{'replaced'};
+	if ($len != $self->len()) {
+	    ::debug("length", $len, " != ", $self->len(),
+		    " ", $self->{'replaced'}, "\n");
+	} else {
+	    ::debug("length", $len, " == ", $self->len(),
+		    " ", $self->{'replaced'}, "\n");
+	}
+    }
+    return $self->{'replaced'};
+}
+
+sub replace_placeholders($$$$) {
+    # Replace foo{}bar with fooargbar
+    # Input:
+    #	$targetref = command as shell words
+    #	$quote = should everything be quoted?
+    #	$quote_arg = should replaced arguments be quoted?
+    # Uses:
+    #	@Arg::arg = arguments as strings to be use in {= =}
+    # Returns:
+    #	@target with placeholders replaced
+    my $self = shift;
+    my $targetref = shift;
+    my $quote = shift;
+    my $quote_arg = shift;
+    my %replace;
+
+    # Token description:
+    #	\0spc = unquoted space
+    #	\0end = last token element
+    #	\0ign = dummy token to be ignored
+    #	\257<...\257> = replacement expression
+    #	" " = quoted space, that splits -X group
+    #	text = normal text - possibly part of -X group
+    my $spacer = 0;
+    my @tokens = grep { length $_ > 0 } map {
+	if(/^\257<|^ $/) {
+	    # \257<...\257> or space
+	    $_
+	} else {
+	    # Split each space/tab into a token
+	    split /(?=\s)|(?<=\s)/
+	}
+    }
+    # Split \257< ... \257> into own token
+    map { split /(?=\257<)|(?<=\257>)/ }
+    # Insert "\0spc" between every element
+    # This space should never be quoted
+    map { $spacer++ ? ("\0spc",$_) : $_ }
+    map { $_ eq "" ? "\0empty" : $_ }
+    @$targetref;
+
+    if(not @tokens) {
+	# @tokens is empty: Return empty array
+	return @tokens;
+    }
+    ::debug("replace", "Tokens ".join":",@tokens,"\n");
+    # Make it possible to use $arg[2] in {= =}
+    *Arg::arg = $self->{'arg_list_flat_orig'};
+    # Flat list:
+    # $self->{'arg_list'} = [ [Arg11, Arg12], [Arg21, Arg22], [Arg31, Arg32] ]
+    # $self->{'arg_list_flat'} = [ Arg11, Arg12, Arg21, Arg22, Arg31, Arg32 ]
+    if(not @{$self->{'arg_list_flat'}}) {
+	@{$self->{'arg_list_flat'}} = Arg->new("");
+    }
+    my $argref = $self->{'arg_list_flat'};
+    # Number of arguments - used for positional arguments
+    my $n = $#$argref+1;
+
+    # $self is actually a CommandLine-object,
+    # but it looks nice to be able to say {= $job->slot() =}
+    my $job = $self;
+    # @replaced = tokens with \257< \257> replaced
+    my @replaced;
+    if($self->{'context_replace'}) {
+	my @ctxgroup;
+	for my $t (@tokens,"\0end") {
+	    # \0end = last token was end of tokens.
+	    if($t eq "\t" or $t eq " " or $t eq "\0end" or $t eq "\0spc") {
+		# Context group complete: Replace in it
+		if(grep { /^\257</ } @ctxgroup) {
+		    # Context group contains a replacement string:
+		    # Copy once per arg
+		    my $space = "\0ign";
+		    for my $arg (@$argref) {
+			my $normal_replace;
+			# Push output
+			# Put unquoted space before each context group
+			# except the first
+			CORE::push @replaced, $space, map {
+			    $a = $_;
+			    if($a =~
+				s{\257<(-?\d+)?(.*)\257>}
+			    {
+				if($1) {
+				    # Positional replace
+				    # Find the relevant arg and replace it
+				    ($argref->[$1 > 0 ? $1-1 : $n+$1] ? # If defined: replace
+				     $argref->[$1 > 0 ? $1-1 : $n+$1]->
+				     replace($2,$quote_arg,$self)
+				     : "");
+				} else {
+				    # Normal replace
+				    $normal_replace ||= 1;
+				    ($arg ? $arg->replace($2,$quote_arg,$self) : "");
+				}
+			    }sgxe) {
+				# Token is \257<..\257>
+			    } else {
+				if($Global::escape_string_present) {
+				    # Command line contains \257:
+				    # Unescape it \257\256 => \257
+				    $a =~ s/\257\256/\257/g;
+				}
+			    }
+			    $a
+			} @ctxgroup;
+			$normal_replace or last;
+			$space = "\0spc";
+		    }
+		} else {
+		    # Context group has no a replacement string: Copy it once
+		    CORE::push @replaced, map {
+			$Global::escape_string_present and s/\257\256/\257/g; $_;
+		    } @ctxgroup;
+		}
+		# New context group
+		@ctxgroup=();
+	    }
+	    if($t eq "\0spc" or $t eq " ") {
+		CORE::push @replaced,$t;
+	    } else {
+		CORE::push @ctxgroup,$t;
+	    }
+	}
+    } else {
+	# @group = @token
+	# Replace in group
+	# Push output
+	# repquote = no if {} first on line, no if $quote, yes otherwise
+	for my $t (@tokens) {
+	    if($t =~ /^\257</) {
+		my $space = "\0ign";
+		for my $arg (@$argref) {
+		    my $normal_replace;
+		    $a = $t;
+		    $a =~
+			s{\257<(-?\d+)?(.*)\257>}
+		    {
+			if($1) {
+			    # Positional replace
+			    # Find the relevant arg and replace it
+			    ($argref->[$1 > 0 ? $1-1 : $n+$1] ?
+			     # If defined: replace
+			     $argref->[$1 > 0 ? $1-1 : $n+$1]->
+			     replace($2,$quote_arg,$self)
+			     : "");
+			} else {
+			    # Normal replace
+			    $normal_replace ||= 1;
+			    ($arg ? $arg->replace($2,$quote_arg,$self) : "");
+			}
+		    }sgxe;
+		    CORE::push @replaced, $space, $a;
+		    $normal_replace or last;
+		    $space = "\0spc";
+		}
+	    } else {
+		# No replacement
+		CORE::push @replaced, map {
+		    $Global::escape_string_present and s/\257\256/\257/g; $_;
+		} $t;
+	    }
+	}
+    }
+    *Arg::arg = [];
+    ::debug("replace","Replaced: ".join":",@replaced,"\n");
+
+    # Put tokens into groups that may be quoted.
+    my @quotegroup;
+    my @quoted;
+    for (map { $_ eq "\0empty" ? "" : $_ }
+	 grep { $_ ne "\0ign" and $_ ne "\0noarg" and $_ ne "'\0noarg'" }
+	 @replaced, "\0end") {
+	if($_ eq "\0spc" or $_ eq "\0end") {
+	    # \0spc splits quotable groups
+	    if($quote) {
+		if(@quotegroup) {
+		    CORE::push @quoted, ::Q(join"",@quotegroup);;
+		}
+	    } else {
+		CORE::push @quoted, join"",@quotegroup;
+	    }
+	    @quotegroup = ();
+	} else {
+	    CORE::push @quotegroup, $_;
+	}
+    }
+    ::debug("replace","Quoted: ".join":",@quoted,"\n");
+    return wantarray ? @quoted : "@quoted";
+}
+
+sub skip($) {
+    # Skip this job
+    my $self = shift;
+    $self->{'skip'} = 1;
+}
+
+
+package CommandLineQueue;
+
+sub new($) {
+    my $class = shift;
+    my $commandref = shift;
+    my $read_from = shift;
+    my $context_replace = shift || 0;
+    my $max_number_of_args = shift;
+    my $transfer_files = shift;
+    my $return_files = shift;
+    my $template_names = shift;
+    my $template_contents = shift;
+    my @unget = ();
+    my $posrpl;
+    my ($replacecount_ref, $len_ref);
+    my @command = @$commandref;
+    my $seq = 1;
+    # Replace replacement strings with {= perl expr =}
+    # '{=' 'perlexpr' '=}'  => '{= perlexpr =}'
+    @command = merge_rpl_parts(@command);
+
+    # Protect matching inside {= perl expr =}
+    # by replacing {= and =} with \257< and \257>
+    # in options that can contain replacement strings:
+    # @command, --transferfile, --return,
+    # --tagstring, --workdir, --results
+    for(@command, @$transfer_files, @$return_files,
+	@$template_names, @$template_contents,
+	$opt::tagstring, $opt::workdir, $opt::results, $opt::retries,
+	@opt::filter) {
+	# Skip if undefined
+	defined($_) or next;
+	# Escape \257 => \257\256
+	$Global::escape_string_present += s/\257/\257\256/g;
+	# Needs to match rightmost left parens (Perl defaults to leftmost)
+	# to deal with: {={==} and {={==}=}
+	# Replace {= -> \257<  and  =} -> \257>
+	#
+	# Complex way to do:
+	#   s/{=(.*)=}/\257<$1\257>/g
+	# which would not work
+	s[\Q$Global::parensleft\E # Match {=
+	  # Match . unless the next string is {= or =}
+	  #   needed to force matching the shortest {= =}
+	  ((?:(?! \Q$Global::parensleft\E|\Q$Global::parensright\E ).)*?)
+	  \Q$Global::parensright\E ] # Match =}
+	{\257<$1\257>}gxs;
+	for my $rpl (sort { length $b <=> length $a } keys %Global::rpl) {
+	    # Replace long --rpl's before short ones, as a short may be a
+	    # substring of a long:
+	    #	--rpl '% s/a/b/' --rpl '%% s/b/a/'
+	    #
+	    # Replace the shorthand string (--rpl)
+	    # with the {= perl expr =}
+	    #
+	    # Avoid searching for shorthand strings inside existing {= perl expr =}
+	    #
+	    # Replace $$1 in {= perl expr =} with groupings in shorthand string
+	    #
+	    #	--rpl '{/(\.\S+)/(\.\S+)} s/$$1/$$2/g;'
+	    #	  echo {/.tar/.gz} ::: UU.tar.gz
+	    my ($prefix,$grp_regexp,$postfix) =
+		$rpl =~ /^( [^(]*  )	# Prefix - e.g. {%%
+			  ( \(.*\) )?	# Group capture regexp - e.g (.*)
+			  ( [^)]*  )$	# Postfix - e.g }
+			/xs;
+	    $grp_regexp ||= '';
+	    my $rplval = $Global::rpl{$rpl};
+	    while(s{( (?: ^|\257> ) (?: [^\257]*|[\257][^<>] )*? )
+		      # Don't replace after \257 unless \257>
+		    \Q$prefix\E $grp_regexp \Q$postfix\E}
+		  {
+		      # The start remains the same
+		      my $unchanged = $1;
+		      # Dummy entry to start at 1.
+		      my @grp = (1);
+		      # $2 = first ()-group in $grp_regexp
+		      # Put $2 in $grp[1], Put $3 in $grp[2]
+		      # so first ()-group in $grp_regexp is $grp[1];
+		      for(my $i = 2; defined $grp[$#grp]; $i++) {
+			  push @grp, eval '$'.$i;
+		      }
+		      my $rv = $rplval;
+		      # replace $$1 with $_pAr_gRp1, $$2 with $_pAr_gRp2
+		      # in the code to be executed
+		      $rv =~ s/\$\$ (\d+)/\$_pAr_gRp$1/gx;
+		      # prepend with $_pAr_gRp1 = perlquote($1),
+		      my $set_args = "";
+		      for(my $i = 1;defined $grp[$i]; $i++) {
+			  $set_args .= "\$_pAr_gRp$i = \"" .
+			      ::perl_quote_scalar($grp[$i]) . "\";";
+		      }
+		      $unchanged . "\257<" . $set_args . $rv . "\257>"
+		  }gxes) {
+	    }
+	    # Do the same for the positional replacement strings
+	    $posrpl = $rpl;
+	    if($posrpl =~ s/^\{//) {
+		# Only do this if the shorthand start with {
+		$prefix=~s/^\{//;
+		# Don't replace after \257 unless \257>
+		while(s{( (?: ^|\257> ) (?: [^\257]*|[\257][^<>] )*? )
+		  \{(-?\d+) \s* \Q$prefix\E $grp_regexp \Q$postfix\E}
+		      {
+		      # The start remains the same
+		      my $unchanged = $1;
+		      my $position = $2;
+		      # Dummy entry to start at 1.
+		      my @grp = (1);
+		      # $3 = first ()-group in $grp_regexp
+		      # Put $3 in $grp[1], Put $4 in $grp[2]
+		      # so first ()-group in $grp_regexp is $grp[1];
+		      for(my $i = 3; defined $grp[$#grp]; $i++) {
+			  push @grp, eval '$'.$i;
+		      }
+		      my $rv = $rplval;
+		      # replace $$1 with $_pAr_gRp1, $$2 with $_pAr_gRp2
+		      # in the code to be executed
+		      $rv =~ s/\$\$ (\d+)/\$_pAr_gRp$1/gx;
+		      # prepend with $_pAr_gRp1 = perlquote($1),
+		      my $set_args = "";
+		      for(my $i = 1;defined $grp[$i]; $i++) {
+			  $set_args .= "\$_pAr_gRp$i = \"" .
+			      ::perl_quote_scalar($grp[$i]) . "\";";
+		      }
+		      $unchanged . "\257<" . $position . $set_args . $rv . "\257>"
+		  }gxes) {
+		}
+	    }
+	}
+    }
+    # Add {} if no replacement strings in @command
+    ($replacecount_ref, $len_ref, @command) =
+	replacement_counts_and_lengths($transfer_files, $return_files,
+				       $template_names, $template_contents,
+				       @command);
+    if("@command" =~ /^[^ \t\n=]*\257</) {
+	# Replacement string is (part of) the command (and not just
+	# argument or variable definition V1={})
+	# E.g. parallel {}, parallel my_{= s/_//=}, parallel {2}
+	# Do no quote (Otherwise it will fail if the input contains spaces)
+	$Global::quote_replace = 0;
+    }
+
+    if($opt::sqlmaster and $Global::sql->append()) {
+	$seq = $Global::sql->max_seq() + 1;
+    }
+
+    return bless {
+	('unget' => \@unget,
+	 'command' => \@command,
+	 'replacecount' => $replacecount_ref,
+	 'arg_queue' => RecordQueue->new($read_from,$opt::colsep),
+	 'context_replace' => $context_replace,
+	 'len' => $len_ref,
+	 'max_number_of_args' => $max_number_of_args,
+	 'size' => undef,
+	 'transfer_files' => $transfer_files,
+	 'return_files' => $return_files,
+	 'template_names' => $template_names,
+	 'template_contents' => $template_contents,
+	 'seq' => $seq,
+	 )
+    }, ref($class) || $class;
+}
+
+sub merge_rpl_parts($) {
+    # '{=' 'perlexpr' '=}'  => '{= perlexpr =}'
+    # Input:
+    #	@in = the @command as given by the user
+    # Uses:
+    #	$Global::parensleft
+    #	$Global::parensright
+    # Returns:
+    #	@command with parts merged to keep {= and =} as one
+    my @in = @_;
+    my @out;
+    my $l = quotemeta($Global::parensleft);
+    my $r = quotemeta($Global::parensright);
+
+    while(@in) {
+	my $s = shift @in;
+	$_ = $s;
+	# Remove matching (right most) parens
+	while(s/(.*)$l.*?$r/$1/os) {}
+	if(/$l/o) {
+	    # Missing right parens
+	    while(@in) {
+		$s .= " ".shift @in;
+		$_ = $s;
+		while(s/(.*)$l.*?$r/$1/os) {}
+		if(not /$l/o) {
+		    last;
+		}
+	    }
+	}
+	push @out, $s;
+    }
+    return @out;
+}
+
+sub replacement_counts_and_lengths($$@) {
+    # Count the number of different replacement strings.
+    # Find the lengths of context for context groups and non-context
+    # groups.
+    # If no {} found in @command: add it to @command
+    #
+    # Input:
+    #	\@transfer_files = array of filenames to transfer
+    #	\@return_files = array of filenames to return
+    #	\@template_names = array of names to copy to
+    #	\@template_contents = array of contents to write
+    #	@command = command template
+    # Output:
+    #	\%replacecount, \%len, @command
+    my $transfer_files = shift;
+    my $return_files = shift;
+    my $template_names = shift;
+    my $template_contents = shift;
+    my @command = @_;
+    my (%replacecount,%len);
+    my $sum = 0;
+    while($sum == 0) {
+	# Count how many times each replacement string is used
+	my @cmd = @command;
+	my $contextlen = 0;
+	my $noncontextlen = 0;
+	my $contextgroups = 0;
+	for my $c (@cmd) {
+	    while($c =~ s/ \257<( (?: [^\257]*|[\257][^<>] )*?)\257> /\000/xs) {
+		# %replacecount = { "perlexpr" => number of times seen }
+		# e.g { "s/a/b/" => 2 }
+		$replacecount{$1}++;
+		$sum++;
+	    }
+	    # Measure the length of the context around the {= perl expr =}
+	    # Use that {=...=} has been replaced with \000 above
+	    # So there is no need to deal with \257<
+	    while($c =~ s/ (\S*\000\S*) //xs) {
+		my $w = $1;
+		$w =~ tr/\000//d; # Remove all \000's
+		$contextlen += length($w);
+		$contextgroups++;
+	    }
+	    # All {= perl expr =} have been removed: The rest is non-context
+	    $noncontextlen += length $c;
+	}
+	for(@$transfer_files, @$return_files,
+	    @$template_names, @$template_contents,
+	    @opt::filter,
+	    $opt::tagstring, $opt::workdir, $opt::results, $opt::retries) {
+	    # Options that can contain replacement strings
+	    defined($_) or next;
+	    my $t = $_;
+	    while($t =~ s/ \257<( (?: [^\257]*|[\257][^<>] )* )\257> //xs) {
+		# %replacecount = { "perlexpr" => number of times seen }
+		# e.g { "$_++" => 2 }
+		# But for tagstring we just need to mark it as seen
+		$replacecount{$1} ||= 1;
+	    }
+	}
+	if($opt::bar) {
+	    # If the command does not contain {} force it to be computed
+	    # as it is being used by --bar
+	    $replacecount{""} ||= 1;
+	}
+
+	$len{'context'} = 0+$contextlen;
+	$len{'noncontext'} = $noncontextlen;
+	$len{'contextgroups'} = $contextgroups;
+	$len{'noncontextgroups'} = @cmd-$contextgroups;
+	::debug("length", "@command Context: ", $len{'context'},
+		" Non: ", $len{'noncontext'}, " Ctxgrp: ", $len{'contextgroups'},
+		" NonCtxGrp: ", $len{'noncontextgroups'}, "\n");
+	if($sum == 0) {
+	    if(not @command) {
+		# Default command = {}
+		@command = ("\257<\257>");
+	    } elsif(($opt::pipe or $opt::pipepart)
+		    and not $opt::fifo and not $opt::cat) {
+		# With --pipe / --pipe-part you can have no replacement
+		last;
+	    } else {
+		# Append {} to the command if there are no {...}'s and no {=...=}
+		push @command, ("\257<\257>");
+	    }
+	}
+    }
+    return(\%replacecount,\%len,@command);
+}
+
+sub get($) {
+    my $self = shift;
+    if(@{$self->{'unget'}}) {
+	my $cmd_line = shift @{$self->{'unget'}};
+	return ($cmd_line);
+    } else {
+	if($opt::sqlworker) {
+	    # Get the sequence number from the SQL table
+	    $self->set_seq($SQL::next_seq);
+	    # Get the command from the SQL table
+	    $self->{'command'} = $SQL::command_ref;
+	    my @command;
+	    # Recompute replace counts based on the read command
+	    ($self->{'replacecount'},
+	     $self->{'len'}, @command) =
+		replacement_counts_and_lengths($self->{'transfer_files'},
+					       $self->{'return_files'},
+					       $self->{'template_name'},
+					       $self->{'template_contents'},
+					       @$SQL::command_ref);
+	    if("@command" =~ /^[^ \t\n=]*\257</) {
+		# Replacement string is (part of) the command (and not just
+		# argument or variable definition V1={})
+		# E.g. parallel {}, parallel my_{= s/_//=}, parallel {2}
+		# Do no quote (Otherwise it will fail if the input contains spaces)
+		$Global::quote_replace = 0;
+	    }
+	}
+
+	my $cmd_line = CommandLine->new($self->seq(),
+					$self->{'command'},
+					$self->{'arg_queue'},
+					$self->{'context_replace'},
+					$self->{'max_number_of_args'},
+					$self->{'transfer_files'},
+					$self->{'return_files'},
+					$self->{'template_names'},
+					$self->{'template_contents'},
+					$self->{'replacecount'},
+					$self->{'len'},
+	    );
+	$cmd_line->populate();
+	::debug("run","cmd_line->number_of_args ",
+		$cmd_line->number_of_args(), "\n");
+	if(not $Global::no_more_input and ($opt::pipe or $opt::pipepart)) {
+	    if($cmd_line->replaced() eq "") {
+		# Empty command - pipe requires a command
+		::error("--pipe/--pipepart must have a command to pipe into ".
+			"(e.g. 'cat').");
+		::wait_and_exit(255);
+	    }
+	} elsif($cmd_line->number_of_args() == 0) {
+	    # We did not get more args - maybe at EOF string?
+	    return undef;
+	}
+	$self->set_seq($self->seq()+1);
+	return $cmd_line;
+    }
+}
+
+sub unget($) {
+    my $self = shift;
+    unshift @{$self->{'unget'}}, @_;
+}
+
+sub empty($) {
+    my $self = shift;
+    my $empty = (not @{$self->{'unget'}}) &&
+	$self->{'arg_queue'}->empty();
+    ::debug("run", "CommandLineQueue->empty $empty");
+    return $empty;
+}
+
+sub seq($) {
+    my $self = shift;
+    return $self->{'seq'};
+}
+
+sub set_seq($$) {
+    my $self = shift;
+    $self->{'seq'} = shift;
+}
+
+sub quote_args($) {
+    my $self = shift;
+    # If there is not command emulate |bash
+    return $self->{'command'};
+}
+
+
+package Limits::Command;
+
+# Maximal command line length (for -m and -X)
+sub max_length($) {
+    # Find the max_length of a command line and cache it
+    # Returns:
+    #	number of chars on the longest command line allowed
+    if(not $Limits::Command::line_max_len) {
+	# Disk cache of max command line length
+	my $len_cache = $Global::cache_dir . "/tmp/sshlogin/" . ::hostname() .
+	    "/linelen";
+	my $cached_limit;
+	local $/ = undef;
+	if(open(my $fh, "<", $len_cache)) {
+	    $cached_limit = <$fh>;
+	    $cached_limit || ::die_bug("Cannot read $len_cache");
+	    close $fh;
+	}
+	if(not $cached_limit) {
+	    $cached_limit = real_max_length();
+	    # If $HOME is write protected: Do not fail
+	    my $dir = ::dirname($len_cache);
+	    -d $dir or eval { File::Path::mkpath($dir); };
+	    open(my $fh, ">", $len_cache.$$);
+	    print $fh $cached_limit;
+	    close $fh;
+	    rename $len_cache.$$, $len_cache || ::die_bug("rename cache file");
+	}
+	$Limits::Command::line_max_len = tmux_length($cached_limit);
+    }
+    return int($Limits::Command::line_max_len);
+}
+
+sub real_max_length() {
+    # Find the max_length of a command line
+    # Returns:
+    #	The maximal command line length with 1 byte arguments
+    # return find_max(" c");
+    return find_max("c");
+}
+
+sub find_max($) {
+    my $string = shift;
+    # This is slow on Cygwin, so give Cygwin users a warning
+    if($^O eq "cygwin" or $^O eq "msys") {
+	::warning("Finding the maximal command line length. ".
+		  "This may take up to 1 minute.")
+    }
+    # Use an upper bound of 100 MB if the shell allows for infinite
+    # long lengths
+    my $upper = 100_000_000;
+    my $lower;
+    # 1000 is supported everywhere, so the search can start anywhere 1..999
+    # 324 makes the search much faster on Cygwin, so let us use that
+    my $len = 324;
+    do {
+	if($len > $upper) { return $len };
+	$lower = $len;
+	$len *= 16;
+	::debug("init", "Maxlen: $lower<$len<$upper(".($upper-$lower)."): ");
+    } while (is_acceptable_command_line_length($len,$string));
+    # Then search for the actual max length between
+    # last successful length ($len/16) and upper bound
+    return binary_find_max(int($len/16),$len,$string);
+}
+
+
+# Prototype forwarding
+sub binary_find_max($$$);
+sub binary_find_max($$$) {
+    # Given a lower and upper bound find the max (length or args) of a
+    # command line
+    # Returns:
+    #   number of chars on the longest command line allowed
+    my ($lower, $upper, $string) = (@_);
+    if($lower == $upper
+       or $lower == $upper-1
+       or $lower/$upper > 0.99) {
+        # $lower is +- 1 or within 1%: Don't search more
+        return $lower;
+    }
+    # Unevenly split binary search which is faster for Microsoft Windows.
+    # Guessing too high is cheap. Guessing too low is expensive.
+    my $split = ($^O eq "cygwin" or $^O eq "msys") ? 0.93 : 0.5;
+    my $middle = int (($upper-$lower)*$split + $lower);
+    ::debug("init", "Maxlen: $lower<$middle<$upper(".($upper-$lower)."): ");
+    if (is_acceptable_command_line_length($middle,$string)) {
+        return binary_find_max($middle,$upper,$string);
+    } else {
+        return binary_find_max($lower,$middle,$string);
+    }
+}
+
+{
+    my $prg;
+
+    sub is_acceptable_command_line_length($$) {
+	# Test if a command line of this length can run
+	# in the current environment
+	# If the string is " x" it tests how many args are allowed
+	# Returns:
+	#   0 if the command line length is too long
+	#   1 otherwise
+	my $len = shift;
+	my $string = shift;
+	if($Global::parallel_env) {
+	    $len += length $Global::parallel_env;
+	}
+	# Force using non-built-in command
+	$prg ||= ::which("echo");
+	::qqx("$prg ".${string}x(($len-1-length $prg)/length $string));
+	::debug("init", "$len=$?\n");
+	return not $?;
+    }
+}
+
+sub tmux_length($) {
+    # If $opt::tmux set, find the limit for tmux
+    # tmux 1.8 has a 2kB limit
+    # tmux 1.9 has a 16kB limit
+    # tmux 2.0 has a 16kB limit
+    # tmux 2.1 has a 16kB limit
+    # tmux 2.2 has a 16kB limit
+    # Input:
+    #	$len = maximal command line length
+    # Returns:
+    #	$tmux_len = maximal length runable in tmux
+    local $/ = "\n";
+    my $len = shift;
+    if($opt::tmux) {
+	$ENV{'PARALLEL_TMUX'} ||= "tmux";
+	if(not ::which($ENV{'PARALLEL_TMUX'})) {
+	    ::error($ENV{'PARALLEL_TMUX'}." not found in \$PATH.");
+	    ::wait_and_exit(255);
+	}
+	my @out;
+	for my $l (1, 2020, 16320, 30000, $len) {
+	    my $tmpfile = ::tmpname("tms");
+	    my $tmuxcmd = $ENV{'PARALLEL_TMUX'}.
+		" -S $tmpfile new-session -d -n echo $l".
+		("t"x$l). " && echo $l; rm -f $tmpfile";
+	    push @out, ::qqx($tmuxcmd);
+	    ::rm($tmpfile);
+	}
+	::debug("tmux","tmux-out ",@out);
+	chomp @out;
+	# The arguments is given 3 times on the command line
+	# and the tmux wrapping is around 30 chars
+	# (29 for tmux1.9, 33 for tmux1.8)
+	my $tmux_len = ::max(@out);
+	$len = ::min($len,int($tmux_len/4-33));
+	::debug("tmux","tmux-length ",$len);
+    }
+    return $len;
+}
+
+
+package RecordQueue;
+
+sub new($) {
+    my $class = shift;
+    my $fhs = shift;
+    my $colsep = shift;
+    my @unget = ();
+    my $arg_sub_queue;
+    if($opt::sqlworker) {
+	# Open SQL table
+	$arg_sub_queue = SQLRecordQueue->new();
+    } elsif(defined $colsep) {
+	# Open one file with colsep or CSV
+	$arg_sub_queue = RecordColQueue->new($fhs);
+    } else {
+	# Open one or more files if multiple -a
+	$arg_sub_queue = MultifileQueue->new($fhs);
+    }
+    return bless {
+	'unget' => \@unget,
+	'arg_number' => 0,
+	'arg_sub_queue' => $arg_sub_queue,
+    }, ref($class) || $class;
+}
+
+sub get($) {
+    # Returns:
+    #	reference to array of Arg-objects
+    my $self = shift;
+    if(@{$self->{'unget'}}) {
+	$self->{'arg_number'}++;
+	# Flush cached computed replacements in Arg-objects
+	# To fix: parallel --bar echo {%} ::: a b c ::: d e f
+	my $ret = shift @{$self->{'unget'}};
+	if($ret) {
+	    map { $_->flush_cache() } @$ret;
+	}
+	return $ret;
+    }
+    my $ret = $self->{'arg_sub_queue'}->get();
+    if($ret) {
+	if(grep { index($_->orig(),"\0") > 0 } @$ret) {
+	    # Allow for \0 in position 0 because GNU  Parallel uses "\0noarg"
+	    # to mean no-string
+	    ::warning("A NUL character in the input was replaced with \\0.",
+		      "NUL cannot be passed through in the argument list.",
+		      "Did you mean to use the --null option?");
+	    for(grep { index($_->orig(),"\0") > 0 } @$ret) {
+		# Replace \0 with \\0
+		my $a = $_->orig();
+		$a =~ s/\0/\\0/g;
+		$_->set_orig($a);
+	    }
+	}
+	if(defined $Global::max_number_of_args
+	   and $Global::max_number_of_args == 0) {
+	    ::debug("run", "Read 1 but return 0 args\n");
+	    # \0noarg => nothing (not the empty string)
+	    map { $_->set_orig("\0noarg"); } @$ret;
+	}
+	# Flush cached computed replacements in Arg-objects
+	# To fix: parallel --bar echo {%} ::: a b c ::: d e f
+	map { $_->flush_cache() } @$ret;
+    }
+    return $ret;
+}
+
+sub unget($) {
+    my $self = shift;
+    ::debug("run", "RecordQueue-unget\n");
+    $self->{'arg_number'} -= @_;
+    unshift @{$self->{'unget'}}, @_;
+}
+
+sub empty($) {
+    my $self = shift;
+    my $empty = (not @{$self->{'unget'}}) &&
+	$self->{'arg_sub_queue'}->empty();
+    ::debug("run", "RecordQueue->empty $empty");
+    return $empty;
+}
+
+sub flush_cache($) {
+    my $self = shift;
+    for my $record (@{$self->{'unget'}}) {
+	for my $arg (@$record) {
+	    $arg->flush_cache();
+	}
+    }
+    $self->{'arg_sub_queue'}->flush_cache();
+}
+
+sub arg_number($) {
+    my $self = shift;
+    return $self->{'arg_number'};
+}
+
+
+package RecordColQueue;
+
+sub new($) {
+    my $class = shift;
+    my $fhs = shift;
+    my @unget = ();
+    my $arg_sub_queue = MultifileQueue->new($fhs);
+    return bless {
+	'unget' => \@unget,
+	'arg_sub_queue' => $arg_sub_queue,
+    }, ref($class) || $class;
+}
+
+sub get($) {
+    # Returns:
+    #	reference to array of Arg-objects
+    my $self = shift;
+    if(@{$self->{'unget'}}) {
+	return shift @{$self->{'unget'}};
+    }
+    if($self->{'arg_sub_queue'}->empty()) {
+	return undef;
+    }
+    my $in_record = $self->{'arg_sub_queue'}->get();
+    if(defined $in_record) {
+	my @out_record = ();
+	for my $arg (@$in_record) {
+	    ::debug("run", "RecordColQueue::arg $arg\n");
+	    my $line = $arg->orig();
+	    ::debug("run", "line='$line'\n");
+	    if($line ne "") {
+		if($opt::csv) {
+		    # Parse CSV and put it into a record
+		    chomp $line;
+		    if(not $Global::csv->parse($line)) {
+			die "CSV has unexpected format: ^$line^";
+		    }
+		    for($Global::csv->fields()) {
+			push @out_record, Arg->new($_);
+		    }
+		} else {
+		    # Split --colsep into record
+		    for my $s (split /$opt::colsep/o, $line, -1) {
+			push @out_record, Arg->new($s);
+		    }
+		}
+	    } else {
+		push @out_record, Arg->new("");
+	    }
+	}
+	return \@out_record;
+    } else {
+	return undef;
+    }
+}
+
+sub unget($) {
+    my $self = shift;
+    ::debug("run", "RecordColQueue-unget '@_'\n");
+    unshift @{$self->{'unget'}}, @_;
+}
+
+sub empty($) {
+    my $self = shift;
+    my $empty = (not @{$self->{'unget'}}) &&
+	$self->{'arg_sub_queue'}->empty();
+    ::debug("run", "RecordColQueue->empty $empty");
+    return $empty;
+}
+
+sub flush_cache($) {
+    my $self = shift;
+    for my $arg (@{$self->{'unget'}}) {
+	$arg->flush_cache();
+    }
+    $self->{'arg_sub_queue'}->flush_cache();
+}
+
+
+package SQLRecordQueue;
+
+sub new($) {
+    my $class = shift;
+    my @unget = ();
+    return bless {
+	'unget' => \@unget,
+    }, ref($class) || $class;
+}
+
+sub get($) {
+    # Returns:
+    #	reference to array of Arg-objects
+    my $self = shift;
+    if(@{$self->{'unget'}}) {
+	return shift @{$self->{'unget'}};
+    }
+    return $Global::sql->get_record();
+}
+
+sub unget($) {
+    my $self = shift;
+    ::debug("run", "SQLRecordQueue-unget '@_'\n");
+    unshift @{$self->{'unget'}}, @_;
+}
+
+sub empty($) {
+    my $self = shift;
+    if(@{$self->{'unget'}}) { return 0; }
+    my $get = $self->get();
+    if(defined $get) {
+	$self->unget($get);
+    }
+    my $empty = not $get;
+    ::debug("run", "SQLRecordQueue->empty $empty");
+    return $empty;
+}
+
+sub flush_cache($) {
+    my $self = shift;
+    for my $record (@{$self->{'unget'}}) {
+	for my $arg (@$record) {
+	    $arg->flush_cache();
+	}
+    }
+}
+
+
+package MultifileQueue;
+
+@Global::unget_argv=();
+
+sub new($$) {
+    my $class = shift;
+    my $fhs = shift;
+    for my $fh (@$fhs) {
+	if(-t $fh and -t ($Global::status_fd || *STDERR)) {
+	    ::warning(
+		  "Input is read from the terminal. You are either an expert",
+		  "(in which case: YOU ARE AWESOME!) or maybe you forgot",
+		  "::: or :::: or -a or to pipe data into parallel. If so",
+		  "consider going through the tutorial: man parallel_tutorial",
+		  "Press CTRL-D to exit.");
+	}
+    }
+    return bless {
+	'unget' => \@Global::unget_argv,
+	'fhs' => $fhs,
+	'arg_matrix' => undef,
+    }, ref($class) || $class;
+}
+
+sub get($) {
+    my $self = shift;
+    if($opt::link) {
+	return $self->link_get();
+    } else {
+	return $self->nest_get();
+    }
+}
+
+sub unget($) {
+    my $self = shift;
+    ::debug("run", "MultifileQueue-unget '@_'\n");
+    unshift @{$self->{'unget'}}, @_;
+}
+
+sub empty($) {
+    my $self = shift;
+    my $empty = (not @Global::unget_argv) &&
+	not @{$self->{'unget'}};
+    for my $fh (@{$self->{'fhs'}}) {
+	$empty &&= eof($fh);
+    }
+    ::debug("run", "MultifileQueue->empty $empty ");
+    return $empty;
+}
+
+sub flush_cache($) {
+    my $self = shift;
+    for my $record (@{$self->{'unget'}}, @{$self->{'arg_matrix'}}) {
+	for my $arg (@$record) {
+	    $arg->flush_cache();
+	}
+    }
+}
+
+sub link_get($) {
+    my $self = shift;
+    if(@{$self->{'unget'}}) {
+	return shift @{$self->{'unget'}};
+    }
+    my @record = ();
+    my $prepend;
+    my $empty = 1;
+    for my $i (0..$#{$self->{'fhs'}}) {
+	my $fh = $self->{'fhs'}[$i];
+	my $arg = read_arg_from_fh($fh);
+	if(defined $arg) {
+	    # Record $arg for recycling at end of file
+	    push @{$self->{'arg_matrix'}[$i]}, $arg;
+	    push @record, $arg;
+	    $empty = 0;
+	} else {
+	    ::debug("run", "EOA ");
+	    # End of file: Recycle arguments
+	    push @{$self->{'arg_matrix'}[$i]}, shift @{$self->{'arg_matrix'}[$i]};
+	    # return last @{$args->{'args'}{$fh}};
+	    push @record, @{$self->{'arg_matrix'}[$i]}[-1];
+	}
+    }
+    if($empty) {
+	return undef;
+    } else {
+	return \@record;
+    }
+}
+
+sub nest_get($) {
+    my $self = shift;
+    if(@{$self->{'unget'}}) {
+	return shift @{$self->{'unget'}};
+    }
+    my @record = ();
+    my $prepend;
+    my $empty = 1;
+    my $no_of_inputsources = $#{$self->{'fhs'}} + 1;
+    if(not $self->{'arg_matrix'}) {
+	# Initialize @arg_matrix with one arg from each file
+	# read one line from each file
+	my @first_arg_set;
+	my $all_empty = 1;
+	for (my $fhno = 0; $fhno < $no_of_inputsources ; $fhno++) {
+	    my $arg = read_arg_from_fh($self->{'fhs'}[$fhno]);
+	    if(defined $arg) {
+		$all_empty = 0;
+	    }
+	    $self->{'arg_matrix'}[$fhno][0] = $arg || Arg->new("");
+	    push @first_arg_set, $self->{'arg_matrix'}[$fhno][0];
+	}
+	if($all_empty) {
+	    # All filehandles were at eof or eof-string
+	    return undef;
+	}
+	return [@first_arg_set];
+    }
+
+    # Treat the case with one input source special.  For multiple
+    # input sources we need to remember all previously read values to
+    # generate all combinations. But for one input source we can
+    # forget the value after first use.
+    if($no_of_inputsources == 1) {
+	my $arg = read_arg_from_fh($self->{'fhs'}[0]);
+	if(defined($arg)) {
+	    return [$arg];
+	}
+	return undef;
+    }
+    for (my $fhno = $no_of_inputsources - 1; $fhno >= 0; $fhno--) {
+	if(eof($self->{'fhs'}[$fhno])) {
+	    next;
+	} else {
+	    # read one
+	    my $arg = read_arg_from_fh($self->{'fhs'}[$fhno]);
+	    defined($arg) || next; # If we just read an EOF string: Treat this as EOF
+	    my $len = $#{$self->{'arg_matrix'}[$fhno]} + 1;
+	    $self->{'arg_matrix'}[$fhno][$len] = $arg;
+	    # make all new combinations
+	    my @combarg = ();
+	    for (my $fhn = 0; $fhn < $no_of_inputsources; $fhn++) {
+		push(@combarg, [0, $#{$self->{'arg_matrix'}[$fhn]}],
+		     # Is input source --link'ed to the next?
+		     $opt::linkinputsource[$fhn+1]);
+	    }
+	    # Find only combinations with this new entry
+	    $combarg[2*$fhno] = [$len,$len];
+	    # map combinations
+	    # [ 1, 3, 7 ], [ 2, 4, 1 ]
+	    # =>
+	    # [ m[0][1], m[1][3], m[2][7] ], [ m[0][2], m[1][4], m[2][1] ]
+	    my @mapped;
+	    for my $c (expand_combinations(@combarg)) {
+		my @a;
+		for my $n (0 .. $no_of_inputsources - 1 ) {
+		    push @a,  $self->{'arg_matrix'}[$n][$$c[$n]];
+		}
+		push @mapped, \@a;
+	    }
+	    # append the mapped to the ungotten arguments
+	    push @{$self->{'unget'}}, @mapped;
+	    # get the first
+	    if(@mapped) {
+		return shift @{$self->{'unget'}};
+	    }
+	}
+    }
+    # all are eof or at EOF string; return from the unget queue
+    return shift @{$self->{'unget'}};
+}
+
+{
+    my $cr_count = 0;
+    my $nl_count = 0;
+    my $dos_crnl_determined;
+    sub read_arg_from_fh($) {
+	# Read one Arg from filehandle
+	# Returns:
+	#   Arg-object with one read line
+	#   undef if end of file
+	my $fh = shift;
+	my $prepend;
+	my $arg;
+	my $half_record = 0;
+	do {{
+	    # This makes 10% faster
+	    if(not defined ($arg = <$fh>)) {
+		if(defined $prepend) {
+		    return Arg->new($prepend);
+		} else {
+		    return undef;
+		}
+	    }
+	    if(not $dos_crnl_determined and not defined $opt::d) {
+		# Warn if input has CR-NL and -d is not set
+		if($arg =~ /\r$/) {
+		    $cr_count++;
+		} else {
+		    $nl_count++;
+		}
+		if($cr_count == 3 or $nl_count == 3) {
+		    $dos_crnl_determined = 1;
+		    if($nl_count == 0 and $cr_count == 3) {
+			::warning('The first three values end in CR-NL. '.
+				  'Consider using -d "\r\n"');
+		    }
+		}
+	    }
+	    if($opt::csv) {
+		# We need to read a full CSV line.
+		if(($arg =~ y/"/"/) % 2 ) {
+		    # The number of " on the line is uneven:
+		    # If we were in a half_record => we have a full record now
+		    # If we were outside a half_record =>
+		    #	 we are in a half record now
+		    $half_record = not $half_record;
+		}
+		if($half_record) {
+		    # CSV half-record with quoting:
+		    #	col1,"col2 2""x3"" board newline  <-this one
+		    #	cont",col3
+		    $prepend .= $arg;
+		    redo;
+		} else {
+		    # Now we have a full CSV record
+		}
+	    }
+	    # Remove delimiter
+	    chomp $arg;
+	    if($Global::end_of_file_string and
+	       $arg eq $Global::end_of_file_string) {
+		# Ignore the rest of input file
+		close $fh;
+		::debug("run", "EOF-string ($arg) met\n");
+		if(defined $prepend) {
+		    return Arg->new($prepend);
+		} else {
+		    return undef;
+		}
+	    }
+	    if(defined $prepend) {
+		$arg = $prepend.$arg; # For line continuation
+		undef $prepend;
+	    }
+	    if($Global::ignore_empty) {
+		if($arg =~ /^\s*$/) {
+		    redo; # Try the next line
+		}
+	    }
+	    if($Global::max_lines) {
+		if($arg =~ /\s$/) {
+		    # Trailing space => continued on next line
+		    $prepend = $arg;
+		    redo;
+		}
+	    }
+	    }} while (1 == 0); # Dummy loop {{}} for redo
+	if(defined $arg) {
+	    return Arg->new($arg);
+	} else {
+	    ::die_bug("multiread arg undefined");
+	}
+    }
+}
+
+# Prototype forwarding
+sub expand_combinations(@);
+sub expand_combinations(@) {
+    # Input:
+    #	([xmin,xmax], [ymin,ymax], ...)
+    # Returns: ([x,y,...],[x,y,...])
+    # where xmin <= x <= xmax and ymin <= y <= ymax
+    my $minmax_ref = shift;
+    my $link = shift; # This is linked to the next input source
+    my $xmin = $$minmax_ref[0];
+    my $xmax = $$minmax_ref[1];
+    my @p;
+    if(@_) {
+	my @rest = expand_combinations(@_);
+	if($link) {
+	    # Linked to next col with --link/:::+/::::+
+	    # TODO BUG does not wrap values if not same number of vals
+	    push(@p, map { [$$_[0], @$_] }
+		 grep { $xmin <= $$_[0] and $$_[0] <= $xmax } @rest);
+	} else {
+	    # If there are more columns: Compute those recursively
+	    for(my $x = $xmin; $x <= $xmax; $x++) {
+		push @p, map { [$x, @$_] } @rest;
+	    }
+	}
+    } else {
+	for(my $x = $xmin; $x <= $xmax; $x++) {
+	    push @p, [$x];
+	}
+    }
+    return @p;
+}
+
+
+package Arg;
+
+sub new($) {
+    my $class = shift;
+    my $orig = shift;
+    my @hostgroups;
+    if($opt::hostgroups) {
+	if($orig =~ s:@(.+)::) {
+	    # We found hostgroups on the arg
+	    @hostgroups = split(/\+/, $1);
+	    if(not grep { defined $Global::hostgroups{$_} } @hostgroups) {
+		# This hostgroup is not defined using -S
+		# Add it
+		::warning("Adding hostgroups: @hostgroups");
+		# Add sshlogin
+		for(grep { not defined $Global::hostgroups{$_} } @hostgroups) {
+		    my $sshlogin = SSHLogin->new($_);
+		    my $sshlogin_string = $sshlogin->string();
+		    $Global::host{$sshlogin_string} = $sshlogin;
+		    $Global::hostgroups{$sshlogin_string} = 1;
+		}
+	    }
+	} else {
+	    # No hostgroup on the arg => any hostgroup
+	    @hostgroups = (keys %Global::hostgroups);
+	}
+    }
+    return bless {
+	'orig' => $orig,
+	'hostgroups' => \@hostgroups,
+    }, ref($class) || $class;
+}
+
+sub Q($) {
+    # Q alias for ::shell_quote_scalar
+    my $ret = ::Q($_[0]);
+    no warnings 'redefine';
+    *Q = \&::Q;
+    return $ret;
+}
+
+sub pQ($) {
+    # pQ alias for ::perl_quote_scalar
+    my $ret = ::pQ($_[0]);
+    no warnings 'redefine';
+    *pQ = \&::pQ;
+    return $ret;
+}
+
+sub hash($) {
+    $Global::use{"DBI"} ||= eval "use B; 1;";
+    B::hash(@_);
+}
+
+sub total_jobs() {
+    return $Global::JobQueue->total_jobs();
+}
+
+{
+    my %perleval;
+    my $job;
+    sub skip() {
+	# shorthand for $job->skip();
+	$job->skip();
+    }
+    sub slot() {
+	# shorthand for $job->slot();
+	$job->slot();
+    }
+    sub seq() {
+	# shorthand for $job->seq();
+	$job->seq();
+    }
+    sub uq() {
+	# Do not quote this arg
+	$Global::unquote_arg = 1;
+    }
+    sub yyyy_mm_dd_hh_mm_ss() {
+	# ISO8601 2038-01-19T03:14:08
+	::strftime("%Y-%m-%dT%H:%M:%S", localtime(time()));
+    }
+    sub yyyy_mm_dd_hh_mm() {
+	# ISO8601 2038-01-19T03:14
+	::strftime("%Y-%m-%dT%H:%M", localtime(time()));
+    }
+    sub yyyy_mm_dd() {
+	# ISO8601 2038-01-19
+	::strftime("%Y-%m-%d", localtime(time()));
+    }
+    sub hh_mm_ss() {
+	# ISO8601 03:14:08
+	::strftime("%H:%M:%S", localtime(time()));
+    }
+    sub hh_mm() {
+	# ISO8601 03:14
+	::strftime("%H:%M", localtime(time()));
+    }
+    sub yyyymmddhhmmss() {
+	# ISO8601 20380119 + ISO8601 031408
+	::strftime("%Y%m%d%H%M%S", localtime(time()));
+    }
+    sub yyyymmddhhmm() {
+	# ISO8601 20380119 + ISO8601 0314
+	::strftime("%Y%m%d%H%M", localtime(time()));
+    }
+    sub yyyymmdd() {
+	# ISO8601 20380119
+	::strftime("%Y%m%d", localtime(time()));
+    }
+    sub hhmmss() {
+	# ISO8601 031408
+	::strftime("%H%M%S", localtime(time()));
+    }
+    sub hhmm() {
+	# ISO8601 0314
+	::strftime("%H%M", localtime(time()));
+    }
+
+    sub replace($$$$) {
+	# Calculates the corresponding value for a given perl expression
+	# Returns:
+	#   The calculated string (quoted if asked for)
+	my $self = shift;
+	my $perlexpr = shift; # E.g. $_=$_ or s/.gz//
+	my $quote = shift; # should the string be quoted?
+	# This is actually a CommandLine-object,
+	# but it looks nice to be able to say {= $job->slot() =}
+	$job = shift;
+	# Positional replace treated as normal replace
+	$perlexpr =~ s/^(-?\d+)? *//;
+	if(not $Global::cache_replacement_eval
+	   or
+	   not $self->{'cache'}{$perlexpr}) {
+	    # Only compute the value once
+	    # Use $_ as the variable to change
+	    local $_;
+	    if($Global::trim eq "n") {
+		$_ = $self->{'orig'};
+	    } else {
+		# Trim the input
+		$_ = trim_of($self->{'orig'});
+	    }
+	    ::debug("replace", "eval ", $perlexpr, " ", $_, "\n");
+	    if(not $perleval{$perlexpr}) {
+		# Make an anonymous function of the $perlexpr
+		# And more importantly: Compile it only once
+		if($perleval{$perlexpr} =
+		   eval('sub { no strict; no warnings; my $job = shift; '.
+			$perlexpr.' }')) {
+		    # All is good
+		} else {
+		    # The eval failed. Maybe $perlexpr is invalid perl?
+		    ::error("Cannot use $perlexpr: $@");
+		    ::wait_and_exit(255);
+		}
+	    }
+	    # Execute the function
+	    $perleval{$perlexpr}->($job);
+	    $self->{'cache'}{$perlexpr} = $_;
+	    if($Global::unquote_arg) {
+		# uq() was called in perlexpr
+		$self->{'cache'}{'unquote'}{$perlexpr} = 1;
+		# Reset for next perlexpr
+		$Global::unquote_arg = 0;
+	    }
+	}
+	# Return the value quoted if needed
+	if($self->{'cache'}{'unquote'}{$perlexpr}) {
+	    return($self->{'cache'}{$perlexpr});
+	} else {
+	    return($quote ? Q($self->{'cache'}{$perlexpr})
+		   : $self->{'cache'}{$perlexpr});
+	}
+    }
+}
+
+sub flush_cache($) {
+    # Flush cache of computed values
+    my $self = shift;
+    $self->{'cache'} = undef;
+}
+
+sub orig($) {
+    my $self = shift;
+    return $self->{'orig'};
+}
+
+sub set_orig($$) {
+    my $self = shift;
+    $self->{'orig'} = shift;
+}
+
+sub trim_of($) {
+    # Removes white space as specifed by --trim:
+    # n = nothing
+    # l = start
+    # r = end
+    # lr|rl = both
+    # Returns:
+    #	string with white space removed as needed
+    my @strings = map { defined $_ ? $_ : "" } (@_);
+    my $arg;
+    if($Global::trim eq "n") {
+	# skip
+    } elsif($Global::trim eq "l") {
+	for my $arg (@strings) { $arg =~ s/^\s+//; }
+    } elsif($Global::trim eq "r") {
+	for my $arg (@strings) { $arg =~ s/\s+$//; }
+    } elsif($Global::trim eq "rl" or $Global::trim eq "lr") {
+	for my $arg (@strings) { $arg =~ s/^\s+//; $arg =~ s/\s+$//; }
+    } else {
+	::error("--trim must be one of: r l rl lr.");
+	::wait_and_exit(255);
+    }
+    return wantarray ? @strings : "@strings";
+}
+
+
+package TimeoutQueue;
+
+sub new($) {
+    my $class = shift;
+    my $delta_time = shift;
+    my ($pct);
+    if($delta_time =~ /(\d+(\.\d+)?)%/) {
+	# Timeout in percent
+	$pct = $1/100;
+	$delta_time = 1_000_000;
+    }
+    $delta_time = ::multiply_time_units($delta_time);
+
+    return bless {
+	'queue' => [],
+	'delta_time' => $delta_time,
+	'pct' => $pct,
+	'remedian_idx' => 0,
+	'remedian_arr' => [],
+	'remedian' => undef,
+    }, ref($class) || $class;
+}
+
+sub delta_time($) {
+    my $self = shift;
+    return $self->{'delta_time'};
+}
+
+sub set_delta_time($$) {
+    my $self = shift;
+    $self->{'delta_time'} = shift;
+}
+
+sub remedian($) {
+    my $self = shift;
+    return $self->{'remedian'};
+}
+
+sub set_remedian($$) {
+    # Set median of the last 999^3 (=997002999) values using Remedian
+    #
+    # Rousseeuw, Peter J., and Gilbert W. Bassett Jr. "The remedian: A
+    # robust averaging method for large data sets." Journal of the
+    # American Statistical Association 85.409 (1990): 97-104.
+    my $self = shift;
+    my $val = shift;
+    my $i = $self->{'remedian_idx'}++;
+    my $rref = $self->{'remedian_arr'};
+    $rref->[0][$i%999] = $val;
+    $rref->[1][$i/999%999] = (sort @{$rref->[0]})[$#{$rref->[0]}/2];
+    $rref->[2][$i/999/999%999] = (sort @{$rref->[1]})[$#{$rref->[1]}/2];
+    $self->{'remedian'} = (sort @{$rref->[2]})[$#{$rref->[2]}/2];
+}
+
+sub update_median_runtime($) {
+    # Update delta_time based on runtime of finished job if timeout is
+    # a percentage
+    my $self = shift;
+    my $runtime = shift;
+    if($self->{'pct'}) {
+	$self->set_remedian($runtime);
+	$self->{'delta_time'} = $self->{'pct'} * $self->remedian();
+	::debug("run", "Timeout: $self->{'delta_time'}s ");
+    }
+}
+
+sub process_timeouts($) {
+    # Check if there was a timeout
+    my $self = shift;
+    # $self->{'queue'} is sorted by start time
+    while (@{$self->{'queue'}}) {
+	my $job = $self->{'queue'}[0];
+	if($job->endtime()) {
+	    # Job already finished. No need to timeout the job
+	    # This could be because of --keep-order
+	    shift @{$self->{'queue'}};
+	} elsif($job->is_timedout($self->{'delta_time'})) {
+	    # Need to shift off queue before kill
+	    # because kill calls usleep that calls process_timeouts
+	    shift @{$self->{'queue'}};
+	    ::warning("This job was killed because it timed out:",
+		      $job->replaced());
+	    $job->kill();
+	} else {
+	    # Because they are sorted by start time the rest are later
+	    last;
+	}
+    }
+}
+
+sub insert($) {
+    my $self = shift;
+    my $in = shift;
+    push @{$self->{'queue'}}, $in;
+}
+
+
+package SQL;
+
+sub new($) {
+    my $class = shift;
+    my $dburl = shift;
+    $Global::use{"DBI"} ||= eval "use DBI; 1;";
+    # +DBURL = append to this DBURL
+    my $append = $dburl=~s/^\+//;
+    my %options = parse_dburl(get_alias($dburl));
+    my %driveralias = ("sqlite" => "SQLite",
+		       "sqlite3" => "SQLite",
+		       "pg" => "Pg",
+		       "postgres" => "Pg",
+		       "postgresql" => "Pg",
+		       "csv" => "CSV",
+		       "oracle" => "Oracle",
+		       "ora" => "Oracle");
+    my $driver = $driveralias{$options{'databasedriver'}} ||
+	$options{'databasedriver'};
+    my $database = $options{'database'};
+    my $host = $options{'host'} ? ";host=".$options{'host'} : "";
+    my $port = $options{'port'} ? ";port=".$options{'port'} : "";
+    my $dsn = "DBI:$driver:dbname=$database$host$port";
+    my $userid = $options{'user'};
+    my $password = $options{'password'};;
+    if(not grep /$driver/, DBI->available_drivers) {
+	::error("$driver not supported. Are you missing a perl DBD::$driver module?");
+	::wait_and_exit(255);
+    }
+    my $dbh;
+    if($driver eq "CSV") {
+	# CSV does not use normal dsn
+	if(-d $database) {
+	    $dbh = DBI->connect("dbi:CSV:", "", "", { f_dir => "$database", })
+		or die $DBI::errstr;
+	} else {
+	    ::error("$database is not a directory.");
+	    ::wait_and_exit(255);
+	}
+    } else {
+	$dbh = DBI->connect($dsn, $userid, $password,
+			   { RaiseError => 1, AutoInactiveDestroy => 1 })
+	or die $DBI::errstr;
+    }
+    $dbh->{'PrintWarn'} = $Global::debug || 0;
+    $dbh->{'PrintError'} = $Global::debug || 0;
+    $dbh->{'RaiseError'} = 1;
+    $dbh->{'ShowErrorStatement'} = 1;
+    $dbh->{'HandleError'} = sub {};
+    if(not defined $options{'table'}) {
+	::error("The DBURL ($dburl) must contain a table.");
+	::wait_and_exit(255);
+    }
+
+    return bless {
+	'dbh' => $dbh,
+	'driver' => $driver,
+	'max_number_of_args' => undef,
+	'table' => $options{'table'},
+	'append' => $append,
+    }, ref($class) || $class;
+}
+
+# Prototype forwarding
+sub get_alias($);
+sub get_alias($) {
+    my $alias = shift;
+    $alias =~ s/^(sql:)*//; # Accept aliases prepended with sql:
+    if ($alias !~ /^:/) {
+	return $alias;
+    }
+
+    # Find the alias
+    my $path;
+    if (-l $0) {
+	($path) = readlink($0) =~ m|^(.*)/|;
+    } else {
+	($path) = $0 =~ m|^(.*)/|;
+    }
+
+    my @deprecated = ("$ENV{HOME}/.dburl.aliases",
+		      "$path/dburl.aliases", "$path/dburl.aliases.dist");
+    for (@deprecated) {
+	if(-r $_) {
+	    ::warning("$_ is deprecated. ".
+		      "Use .sql/aliases instead (read man sql).");
+	}
+    }
+    my @urlalias=();
+    check_permissions("$ENV{HOME}/.sql/aliases");
+    check_permissions("$ENV{HOME}/.dburl.aliases");
+    my @search = ("$ENV{HOME}/.sql/aliases",
+		  "$ENV{HOME}/.dburl.aliases", "/etc/sql/aliases",
+		  "$path/dburl.aliases", "$path/dburl.aliases.dist");
+    for my $alias_file (@search) {
+	# local $/ needed if -0 set
+	local $/ = "\n";
+	if(-r $alias_file) {
+	    open(my $in, "<", $alias_file) || die;
+	    push @urlalias, <$in>;
+	    close $in;
+	}
+    }
+    my ($alias_part,$rest) = $alias=~/(:\w*)(.*)/;
+    # If we saw this before: we have an alias loop
+    if(grep {$_ eq $alias_part } @Private::seen_aliases) {
+	::error("$alias_part is a cyclic alias.");
+	exit -1;
+    } else {
+	push @Private::seen_aliases, $alias_part;
+    }
+
+    my $dburl;
+    for (@urlalias) {
+	/^$alias_part\s+(\S+.*)/ and do { $dburl = $1; last; }
+    }
+
+    if($dburl) {
+	return get_alias($dburl.$rest);
+    } else {
+	::error("$alias is not defined in @search");
+	exit(-1);
+    }
+}
+
+sub check_permissions($) {
+    my $file = shift;
+
+    if(-e $file) {
+	if(not -o $file) {
+	    my $username = (getpwuid($<))[0];
+	    ::warning("$file should be owned by $username: ".
+		      "chown $username $file");
+	}
+	my ($dev,$ino,$mode,$nlink,$uid,$gid,$rdev,$size,
+	    $atime,$mtime,$ctime,$blksize,$blocks) = stat($file);
+	if($mode & 077) {
+	    my $username = (getpwuid($<))[0];
+	    ::warning("$file should be only be readable by $username: ".
+		      "chmod 600 $file");
+	}
+    }
+}
+
+sub parse_dburl($) {
+    my $url = shift;
+    my %options = ();
+    # sql:mysql://[[user][:password]@][host][:port]/[database[/table][?query]]
+
+    if($url=~m!^(?:sql:)? # You can prefix with 'sql:'
+	       ((?:oracle|ora|mysql|pg|postgres|postgresql)(?:s|ssl|)|
+		 (?:sqlite|sqlite2|sqlite3|csv)):// # Databasedriver ($1)
+	       (?:
+		([^:@/][^:@]*|) # Username ($2)
+		(?:
+		 :([^@]*) # Password ($3)
+		)?
+	       @)?
+	       ([^:/]*)? # Hostname ($4)
+	       (?:
+		:
+		([^/]*)? # Port ($5)
+	       )?
+	       (?:
+		/
+		([^/?]*)? # Database ($6)
+	       )?
+	       (?:
+		/
+		([^?]*)? # Table ($7)
+	       )?
+	       (?:
+		\?
+		(.*)? # Query ($8)
+	       )?
+	      $!ix) {
+	$options{databasedriver} = ::undef_if_empty(lc(uri_unescape($1)));
+	$options{user} = ::undef_if_empty(uri_unescape($2));
+	$options{password} = ::undef_if_empty(uri_unescape($3));
+	$options{host} = ::undef_if_empty(uri_unescape($4));
+	$options{port} = ::undef_if_empty(uri_unescape($5));
+	$options{database} = ::undef_if_empty(uri_unescape($6));
+	$options{table} = ::undef_if_empty(uri_unescape($7));
+	$options{query} = ::undef_if_empty(uri_unescape($8));
+	::debug("sql", "dburl $url\n");
+	::debug("sql", "databasedriver ", $options{databasedriver},
+		" user ", $options{user},
+		" password ", $options{password}, " host ", $options{host},
+		" port ", $options{port}, " database ", $options{database},
+		" table ", $options{table}, " query ", $options{query}, "\n");
+    } else {
+	::error("$url is not a valid DBURL");
+	exit 255;
+    }
+    return %options;
+}
+
+sub uri_unescape($) {
+    # Copied from http://cpansearch.perl.org/src/GAAS/URI-1.55/URI/Escape.pm
+    # to avoid depending on URI::Escape
+    # This section is (C) Gisle Aas.
+    # Note from RFC1630:  "Sequences which start with a percent sign
+    # but are not followed by two hexadecimal characters are reserved
+    # for future extension"
+    my $str = shift;
+    if (@_ && wantarray) {
+	# not executed for the common case of a single argument
+	my @str = ($str, @_);  # need to copy
+	foreach (@str) {
+	    s/%([0-9A-Fa-f]{2})/chr(hex($1))/eg;
+	}
+	return @str;
+    }
+    $str =~ s/%([0-9A-Fa-f]{2})/chr(hex($1))/eg if defined $str;
+    $str;
+}
+
+sub run($) {
+    my $self = shift;
+    my $stmt = shift;
+    if($self->{'driver'} eq "CSV") {
+	$stmt=~ s/;$//;
+	if($stmt eq "BEGIN" or
+	   $stmt eq "COMMIT") {
+	    return undef;
+	}
+    }
+    my @retval;
+    my $dbh = $self->{'dbh'};
+    ::debug("sql","$opt::sqlmaster$opt::sqlworker run $stmt\n");
+    # Execute with the rest of the args - if any
+    my $rv;
+    my $sth;
+    my $lockretry = 0;
+    while($lockretry < 10) {
+	$sth = $dbh->prepare($stmt);
+	if($sth
+	   and
+	   eval { $rv = $sth->execute(@_) }) {
+	    last;
+	} else {
+	    if($@ =~ /no such table|Table .* doesn.t exist|relation ".*" does not exist/
+	       or
+	       $DBI::errstr =~ /no such table|Table .* doesn.t exist|relation ".*" does not exist/) {
+		# This is fine:
+		# It is just a worker that reported back too late -
+		# another worker had finished the job first
+		# and the table was then dropped
+		$rv = $sth = 0;
+		last;
+	    }
+	    if($DBI::errstr =~ /locked/) {
+		::debug("sql", "Lock retry: $lockretry");
+		$lockretry++;
+		::usleep(rand()*300);
+	    } elsif(not $sth) {
+		# Try again
+		$lockretry++;
+	    } else {
+		::error($DBI::errstr);
+		::wait_and_exit(255);
+	    }
+	}
+    }
+    if($lockretry >= 10) {
+	::die_bug("retry > 10: $DBI::errstr");
+    }
+    if($rv < 0 and $DBI::errstr){
+	::error($DBI::errstr);
+	::wait_and_exit(255);
+    }
+    return $sth;
+}
+
+sub get($) {
+    my $self = shift;
+    my $sth = $self->run(@_);
+    my @retval;
+    # If $sth = 0 it means the table was dropped by another process
+    while($sth) {
+	my @row = $sth->fetchrow_array();
+	@row or last;
+	push @retval, \@row;
+    }
+    return \@retval;
+}
+
+sub table($) {
+    my $self = shift;
+    return $self->{'table'};
+}
+
+sub append($) {
+    my $self = shift;
+    return $self->{'append'};
+}
+
+sub update($) {
+    my $self = shift;
+    my $stmt = shift;
+    my $table = $self->table();
+    $self->run("UPDATE $table $stmt",@_);
+}
+
+sub output($) {
+    my $self = shift;
+    my $commandline = shift;
+
+    $self->update("SET Stdout = ?, Stderr = ? WHERE Seq = ".
+		  $commandline->seq(),
+		  join("",@{$commandline->{'output'}{1}}),
+		  join("",@{$commandline->{'output'}{2}}));
+}
+
+sub max_number_of_args($) {
+    # Maximal number of args for this table
+    my $self = shift;
+    if(not $self->{'max_number_of_args'}) {
+	# Read the number of args from the SQL table
+	my $table = $self->table();
+	my $v = $self->get("SELECT * FROM $table LIMIT 1;");
+	my @reserved_columns = qw(Seq Host Starttime JobRuntime Send
+	    Receive Exitval _Signal Command Stdout Stderr);
+	if(not $v) {
+	    ::error("$table contains no records");
+	}
+	# Count the number of Vx columns
+	$self->{'max_number_of_args'} = $#{$v->[0]} - $#reserved_columns;
+    }
+    return $self->{'max_number_of_args'};
+}
+
+sub set_max_number_of_args($$) {
+    my $self = shift;
+    $self->{'max_number_of_args'} = shift;
+}
+
+sub create_table($) {
+    my $self = shift;
+    if($self->append()) { return; }
+    my $max_number_of_args = shift;
+    $self->set_max_number_of_args($max_number_of_args);
+    my $table = $self->table();
+    $self->run(qq(DROP TABLE IF EXISTS $table;));
+    # BIGINT and TEXT are not supported in these databases or are too small
+    my %vartype = (
+	"Oracle" => { "BIGINT" => "NUMBER(19,0)",
+		      "TEXT" => "CLOB", },
+	"mysql" => { "TEXT" => "BLOB", },
+	"CSV" => { "BIGINT" => "INT",
+		   "FLOAT" => "REAL", },
+	);
+    my $BIGINT = $vartype{$self->{'driver'}}{"BIGINT"} || "BIGINT";
+    my $TEXT = $vartype{$self->{'driver'}}{"TEXT"} || "TEXT";
+    my $FLOAT = $vartype{$self->{'driver'}}{"FLOAT"} || "FLOAT(44)";
+    my $v_def = join "", map { "V$_ $TEXT," } (1..$self->max_number_of_args());
+    $self->run(qq{CREATE TABLE $table
+		(Seq $BIGINT,
+		 Host $TEXT,
+		 Starttime $FLOAT,
+		 JobRuntime $FLOAT,
+		 Send $BIGINT,
+		 Receive $BIGINT,
+		 Exitval $BIGINT,
+		 _Signal $BIGINT,
+		 Command $TEXT,}.
+	       $v_def.
+	       qq{Stdout $TEXT,
+		 Stderr $TEXT);});
+}
+
+sub insert_records($) {
+    my $self = shift;
+    my $seq = shift;
+    my $command_ref = shift;
+    my $record_ref = shift;
+    my $table = $self->table();
+    # For SQL encode the command with \257 space as split points
+    my $command = join("\257 ",@$command_ref);
+    my @v_cols = map { ", V$_" } (1..$self->max_number_of_args());
+    # Two extra value due to $seq, Exitval, Send
+    my $v_vals = join ",", map { "?" } (1..$self->max_number_of_args()+4);
+    $self->run("INSERT INTO $table (Seq,Command,Exitval,Send @v_cols) ".
+	       "VALUES ($v_vals);", $seq, $command, -1000,
+	       0, @$record_ref[1..$#$record_ref]);
+}
+
+
+sub get_record($) {
+    my $self = shift;
+    my @retval;
+    my $table = $self->table();
+    my @v_cols = map { ", V$_" } (1..$self->max_number_of_args());
+    my $rand = "Reserved-".$$.rand();
+    my $v;
+    my $more_pending;
+
+    do {
+	if($self->{'driver'} eq "CSV") {
+	    # Sub SELECT is not supported in CSV
+	    # So to minimize the race condition below select a job at random
+	    my $r = $self->get("SELECT Seq, Command @v_cols FROM $table ".
+			       "WHERE Exitval = -1000 LIMIT 100;");
+	    $v = [ sort { rand() > 0.5 } @$r ];
+	} else {
+	    # Avoid race condition where multiple workers get the same job
+	    # by setting Stdout to a unique string
+	    # (SELECT * FROM (...) AS dummy) is needed due to sillyness in MySQL
+	    $self->update("SET Stdout = ?,Exitval = ? ".
+			  "WHERE Seq = (".
+			  "  SELECT * FROM (".
+			  "    SELECT min(Seq) FROM $table WHERE Exitval = -1000".
+			  "  ) AS dummy".
+			  ") AND Exitval = -1000;", $rand, -1210);
+	    # If a parallel worker overwrote the unique string this will get nothing
+	    $v = $self->get("SELECT Seq, Command @v_cols FROM $table ".
+			    "WHERE Stdout = ?;", $rand);
+	}
+	if($v->[0]) {
+	    my $val_ref = $v->[0];
+	    # Mark record as taken
+	    my $seq = shift @$val_ref;
+	    # Save the sequence number to use when running the job
+	    $SQL::next_seq = $seq;
+	    $self->update("SET Exitval = ? WHERE Seq = ".$seq, -1220);
+	    # Command is encoded with '\257 space' as splitting char
+	    my @command = split /\257 /, shift @$val_ref;
+	    $SQL::command_ref = \@command;
+	    for (@$val_ref) {
+		push @retval, Arg->new($_);
+	    }
+	} else {
+	    # If the record was updated by another job in parallel,
+	    # then we may not be done, so see if there are more jobs pending
+	    $more_pending =
+		$self->get("SELECT Seq FROM $table WHERE Exitval = ?;", -1210);
+	}
+    } while (not $v->[0] and $more_pending->[0]);
+
+    if(@retval) {
+	return \@retval;
+    } else {
+	return undef;
+    }
+}
+
+sub total_jobs($) {
+    my $self = shift;
+    my $table = $self->table();
+    my $v = $self->get("SELECT count(*) FROM $table;");
+    if($v->[0]) {
+	return $v->[0]->[0];
+    } else {
+	::die_bug("SQL::total_jobs");
+    }
+}
+
+sub max_seq($) {
+    my $self = shift;
+    my $table = $self->table();
+    my $v = $self->get("SELECT max(Seq) FROM $table;");
+    if($v->[0]) {
+	return $v->[0]->[0];
+    } else {
+	::die_bug("SQL::max_seq");
+    }
+}
+
+sub finished($) {
+    # Check if there are any jobs left in the SQL table that do not
+    # have a "real" exitval
+    my $self = shift;
+    if($opt::wait or $Global::start_sqlworker) {
+	my $table = $self->table();
+	my $rv = $self->get("select Seq,Exitval from $table ".
+			    "where Exitval <= -1000 limit 1");
+	return not $rv->[0];
+    } else {
+	return 1;
+    }
+}
+
+package Semaphore;
+
+# This package provides a counting semaphore
+#
+# If a process dies without releasing the semaphore the next process
+# that needs that entry will clean up dead semaphores
+#
+# The semaphores are stored in $PARALLEL_HOME/semaphores/id-<name> Each
+# file in $PARALLEL_HOME/semaphores/id-<name>/ is the process ID of the
+# process holding the entry. If the process dies, the entry can be
+# taken by another process.
+
+sub new($) {
+    my $class = shift;
+    my $id = shift;
+    my $count = shift;
+    $id =~ s/([^-_a-z0-9])/unpack("H*",$1)/ige; # Convert non-word chars to hex
+    $id = "id-".$id; # To distinguish it from a process id
+    my $parallel_locks = $Global::cache_dir . "/semaphores";
+    -d $parallel_locks or ::mkdir_or_die($parallel_locks);
+    my $lockdir = "$parallel_locks/$id";
+    my $lockfile = $lockdir.".lock";
+    if(-d $parallel_locks and -w $parallel_locks
+       and -r $parallel_locks and -x $parallel_locks) {
+	# skip
+    } else {
+	::error("Semaphoredir must be writable: '$parallel_locks'");
+	::wait_and_exit(255);
+    }
+
+    if($count < 1) { ::die_bug("semaphore-count: $count"); }
+    return bless {
+	'lockfile' => $lockfile,
+	'lockfh' => Symbol::gensym(),
+	'lockdir' => $lockdir,
+	'id' => $id,
+	'idfile' => $lockdir."/".$id,
+	'pid' => $$,
+	'pidfile' => $lockdir."/".$$.'@'.::hostname(),
+	'count' => $count + 1 # nlinks returns a link for the 'id-' as well
+    }, ref($class) || $class;
+}
+
+sub remove_dead_locks($) {
+    my $self = shift;
+    my $lockdir = $self->{'lockdir'};
+
+    for my $d (glob "$lockdir/*") {
+	$d =~ m:$lockdir/([0-9]+)\@([-\._a-z0-9]+)$:o or next;
+	my ($pid, $host) = ($1, $2);
+	if($host eq ::hostname()) {
+	    if(kill 0, $pid) {
+		::debug("sem", "Alive: $pid $d\n");
+	    } else {
+		::debug("sem", "Dead: $d\n");
+		::rm($d);
+	    }
+	}
+    }
+}
+
+sub acquire($) {
+    my $self = shift;
+    my $sleep = 1; # 1 ms
+    my $start_time = time;
+    while(1) {
+	# Can we get a lock?
+	$self->atomic_link_if_count_less_than() and last;
+	$self->remove_dead_locks();
+	# Retry slower and slower up to 1 second
+	$sleep = ($sleep < 1000) ? ($sleep * 1.1) : ($sleep);
+	# Random to avoid every sleeping job waking up at the same time
+	::usleep(rand()*$sleep);
+	if($opt::semaphoretimeout) {
+	    if($opt::semaphoretimeout > 0
+	       and
+	       time - $start_time > $opt::semaphoretimeout) {
+		# Timeout: Take the semaphore anyway
+		::warning("Semaphore timed out. Stealing the semaphore.");
+		if(not -e $self->{'idfile'}) {
+		    open (my $fh, ">", $self->{'idfile'}) or
+			::die_bug("timeout_write_idfile: $self->{'idfile'}");
+		    close $fh;
+		}
+		link $self->{'idfile'}, $self->{'pidfile'};
+		last;
+	    }
+	    if($opt::semaphoretimeout < 0
+	       and
+	       time - $start_time > -$opt::semaphoretimeout) {
+		# Timeout: Exit
+		::warning("Semaphore timed out. Exiting.");
+		exit(1);
+		last;
+	    }
+	}
+    }
+    ::debug("sem", "acquired $self->{'pid'}\n");
+}
+
+sub release($) {
+    my $self = shift;
+    ::rm($self->{'pidfile'});
+    if($self->nlinks() == 1) {
+	# This is the last link, so atomic cleanup
+	$self->lock();
+	if($self->nlinks() == 1) {
+	    ::rm($self->{'idfile'});
+	    rmdir $self->{'lockdir'};
+	}
+	$self->unlock();
+    }
+    ::debug("run", "released $self->{'pid'}\n");
+}
+
+sub pid_change($) {
+    # This should do what release()+acquire() would do without having
+    # to re-acquire the semaphore
+    my $self = shift;
+
+    my $old_pidfile =  $self->{'pidfile'};
+    $self->{'pid'} = $$;
+    $self->{'pidfile'} = $self->{'lockdir'}."/".$$.'@'.::hostname();
+    my $retval = link $self->{'idfile'}, $self->{'pidfile'};
+    ::debug("sem","link($self->{'idfile'},$self->{'pidfile'})=$retval\n");
+    ::rm($old_pidfile);
+}
+
+sub atomic_link_if_count_less_than($) {
+    # Link $file1 to $file2 if nlinks to $file1 < $count
+    my $self = shift;
+    my $retval = 0;
+    $self->lock();
+    my $nlinks = $self->nlinks();
+    ::debug("sem","$nlinks<$self->{'count'} ");
+    if($nlinks < $self->{'count'}) {
+	-d $self->{'lockdir'} or ::mkdir_or_die($self->{'lockdir'});
+	if(not -e $self->{'idfile'}) {
+	    open (my $fh, ">", $self->{'idfile'}) or
+		::die_bug("write_idfile: $self->{'idfile'}");
+	    close $fh;
+	}
+	$retval = link $self->{'idfile'}, $self->{'pidfile'};
+	::debug("sem","link($self->{'idfile'},$self->{'pidfile'})=$retval\n");
+    }
+    $self->unlock();
+    ::debug("sem", "atomic $retval");
+    return $retval;
+}
+
+sub nlinks($) {
+    my $self = shift;
+    if(-e $self->{'idfile'}) {
+	return (stat(_))[3];
+    } else {
+	return 0;
+    }
+}
+
+sub lock($) {
+    my $self = shift;
+    my $sleep = 100; # 100 ms
+    my $total_sleep = 0;
+    $Global::use{"Fcntl"} ||= eval "use Fcntl qw(:DEFAULT :flock); 1;";
+    my $locked = 0;
+    while(not $locked) {
+	if(tell($self->{'lockfh'}) == -1) {
+	    # File not open
+	    open($self->{'lockfh'}, ">", $self->{'lockfile'})
+		or ::debug("run", "Cannot open $self->{'lockfile'}");
+	}
+	if($self->{'lockfh'}) {
+	    # File is open
+	    chmod 0666, $self->{'lockfile'}; # assuming you want it a+rw
+	    if(flock($self->{'lockfh'}, LOCK_EX()|LOCK_NB())) {
+		# The file is locked: No need to retry
+		$locked = 1;
+		last;
+	    } else {
+		if ($! =~ m/Function not implemented/) {
+		    ::warning("flock: $!",
+			      "Will wait for a random while.");
+		    ::usleep(rand(5000));
+		    # File cannot be locked: No need to retry
+		    $locked = 2;
+		    last;
+		}
+	    }
+	}
+	# Locking failed in first round
+	# Sleep and try again
+	$sleep = ($sleep < 1000) ? ($sleep * 1.1) : ($sleep);
+	# Random to avoid every sleeping job waking up at the same time
+	::usleep(rand()*$sleep);
+	$total_sleep += $sleep;
+	if($opt::semaphoretimeout) {
+	    if($opt::semaphoretimeout > 0
+	       and
+	       $total_sleep/1000 > $opt::semaphoretimeout) {
+		# Timeout: Take the semaphore anyway
+		::warning("Semaphore timed out. Taking the semaphore.");
+		$locked = 3;
+		last;
+	    }
+	    if($opt::semaphoretimeout < 0
+	       and
+	       $total_sleep/1000 > -$opt::semaphoretimeout) {
+		# Timeout: Exit
+		::warning("Semaphore timed out. Exiting.");
+		$locked = 4;
+		last;
+	    }
+	} else {
+	    if($total_sleep/1000 > 30) {
+		::warning("Semaphore stuck for 30 seconds. ".
+			  "Consider using --semaphoretimeout.");
+	    }
+	}
+    }
+    ::debug("run", "locked $self->{'lockfile'}");
+}
+
+sub unlock($) {
+    my $self = shift;
+    ::rm($self->{'lockfile'});
+    close $self->{'lockfh'};
+    ::debug("run", "unlocked\n");
+}
+
+# Keep perl -w happy
+
+$opt::x = $Semaphore::timeout = $Semaphore::wait =
+$Job::file_descriptor_warning_printed = $Global::envdef = @Arg::arg =
+$Global::max_slot_number = $opt::session;
+
+package main;
+
+sub main() {
+    save_stdin_stdout_stderr();
+    save_original_signal_handler();
+    parse_options();
+    ::debug("init", "Open file descriptors: ", join(" ",keys %Global::fh), "\n");
+    my $number_of_args;
+    if($Global::max_number_of_args) {
+	$number_of_args = $Global::max_number_of_args;
+    } elsif ($opt::X or $opt::m or $opt::xargs) {
+	$number_of_args = undef;
+    } else {
+	$number_of_args = 1;
+    }
+
+    my @command = @ARGV;
+    my @input_source_fh;
+    if($opt::pipepart) {
+	if($opt::tee) {
+	    @input_source_fh = map { open_or_exit($_) } @opt::a;
+	    # Remove the first: It will be the file piped.
+	    shift @input_source_fh;
+	    if(not @input_source_fh and not $opt::pipe) {
+		@input_source_fh = (*STDIN);
+	    }
+	} else {
+	    # -a is used for data - not for command line args
+	    @input_source_fh = map { open_or_exit($_) } "/dev/null";
+	}
+    } else {
+	@input_source_fh = map { open_or_exit($_) } @opt::a;
+	if(not @input_source_fh and not $opt::pipe) {
+	    @input_source_fh = (*STDIN);
+	}
+    }
+
+    if($opt::skip_first_line) {
+	# Skip the first line for the first file handle
+	my $fh = $input_source_fh[0];
+	<$fh>;
+    }
+
+    set_input_source_header(\@command,\@input_source_fh);
+    if($opt::filter_hosts and (@opt::sshlogin or @opt::sshloginfile)) {
+	# Parallel check all hosts are up. Remove hosts that are down
+	filter_hosts();
+    }
+
+
+    if($opt::sqlmaster and $opt::sqlworker) {
+	# Start a real --sqlworker in the background later
+	$Global::start_sqlworker = 1;
+	$opt::sqlworker = undef;
+    }
+
+    if($opt::nonall or $opt::onall) {
+	onall(\@input_source_fh,@command);
+	wait_and_exit(min(undef_as_zero($Global::exitstatus),254));
+    }
+
+    $Global::JobQueue = JobQueue->new(
+	\@command, \@input_source_fh, $Global::ContextReplace,
+	$number_of_args, \@Global::transfer_files, \@Global::ret_files,
+	\@Global::template_names, \@Global::template_contents
+	);
+
+    if($opt::sqlmaster) {
+	# Create SQL table to hold joblog + output
+	# Figure out how many arguments are in a job
+	# (It is affected by --colsep, -N, $number_source_fh)
+	my $record_queue = $Global::JobQueue->{'commandlinequeue'}{'arg_queue'};
+	my $record = $record_queue->get();
+	my $no_of_values = $number_of_args * (1+$#{$record});
+	$record_queue->unget($record);
+	$Global::sql->create_table($no_of_values);
+	if($opt::sqlworker) {
+	    # Start a real --sqlworker in the background later
+	    $Global::start_sqlworker = 1;
+	    $opt::sqlworker = undef;
+	}
+    }
+
+    if($opt::pipepart) {
+	pipepart_setup();
+    } elsif($opt::pipe) {
+	if($opt::tee) {
+	    pipe_tee_setup();
+	} elsif($opt::shard or $opt::bin) {
+	    pipe_shard_setup();
+	} elsif($opt::groupby) {
+	    pipe_group_by_setup();
+	}
+    }
+
+    if($opt::eta or $opt::bar or $opt::shuf or $Global::halt_pct) {
+	# Count the number of jobs or shuffle all jobs
+	# before starting any.
+	# Must be done after ungetting any --pipepart jobs.
+	$Global::JobQueue->total_jobs();
+    }
+    # Compute $Global::max_jobs_running
+    # Must be done after ungetting any --pipepart jobs.
+    max_jobs_running();
+
+    init_run_jobs();
+    my $sem;
+    if($Global::semaphore) {
+	$sem = acquire_semaphore();
+    }
+    $SIG{TERM} = $Global::original_sig{TERM};
+    $SIG{HUP} = \&start_no_new_jobs;
+
+    if($opt::tee or $opt::shard or $opt::bin) {
+	# All jobs must be running in parallel for --tee/--shard/--bin
+	while(start_more_jobs()) {}
+	$Global::start_no_new_jobs = 1;
+	if(not $Global::JobQueue->empty()) {
+	    if($opt::tee) {
+		::error("--tee requires --jobs to be higher. Try --jobs 0.");
+	    } elsif($opt::bin) {
+		::error("--bin requires --jobs to be higher than the number of",
+			"arguments. Increase --jobs.");
+	    } elsif($opt::shard) {
+		::error("--shard requires --jobs to be higher than the number of",
+			"arguments. Increase --jobs.");
+	    } else {
+		::die_bug("--bin/--shard/--tee should not get here");
+	    }
+	    ::wait_and_exit(255);
+	}
+    } elsif($opt::pipe and not $opt::pipepart and not $opt::semaphore) {
+	# Fill all jobslots
+	while(start_more_jobs()) {}
+	spreadstdin();
+    } else {
+	# Reap the finished jobs and start more
+	while(reapers() + start_more_jobs()) {}
+    }
+    ::debug("init", "Start draining\n");
+    drain_job_queue(@command);
+    ::debug("init", "Done draining\n");
+    reapers();
+    ::debug("init", "Done reaping\n");
+    if($Global::semaphore) { $sem->release(); }
+    cleanup();
+    ::debug("init", "Halt\n");
+    halt();
+}
+
+main();
diff --git a/src/parallel.pod b/src/parallel.pod
new file mode 100644
index 0000000..4101e6a
--- /dev/null
+++ b/src/parallel.pod
@@ -0,0 +1,4520 @@
+#!/usr/bin/perl -w
+
+# SPDX-FileCopyrightText: 2021-2022 Ole Tange, http://ole.tange.dk and Free Software and Foundation, Inc.
+# SPDX-License-Identifier: GFDL-1.3-or-later
+# SPDX-License-Identifier: CC-BY-SA-4.0
+
+=encoding utf8
+
+=head1 NAME
+
+parallel - build and execute shell command lines from standard input
+in parallel
+
+
+=head1 SYNOPSIS
+
+B<parallel> [options] [I<command> [arguments]] < list_of_arguments
+
+B<parallel> [options] [I<command> [arguments]] ( B<:::> arguments |
+B<:::+> arguments | B<::::> argfile(s) | B<::::+> argfile(s) ) ...
+
+B<parallel> --semaphore [options] I<command>
+
+B<#!/usr/bin/parallel> --shebang [options] [I<command> [arguments]]
+
+B<#!/usr/bin/parallel> --shebang-wrap [options] [I<command>
+[arguments]]
+
+
+=head1 DESCRIPTION
+
+STOP!
+
+Read the B<Reader's guide> below if you are new to GNU B<parallel>.
+
+GNU B<parallel> is a shell tool for executing jobs in parallel using
+one or more computers. A job can be a single command or a small script
+that has to be run for each of the lines in the input. The typical
+input is a list of files, a list of hosts, a list of users, a list of
+URLs, or a list of tables. A job can also be a command that reads from
+a pipe. GNU B<parallel> can then split the input into blocks and pipe
+a block into each command in parallel.
+
+If you use xargs and tee today you will find GNU B<parallel> very easy
+to use as GNU B<parallel> is written to have the same options as
+xargs. If you write loops in shell, you will find GNU B<parallel> may
+be able to replace most of the loops and make them run faster by
+running several jobs in parallel.
+
+GNU B<parallel> makes sure output from the commands is the same output
+as you would get had you run the commands sequentially. This makes it
+possible to use output from GNU B<parallel> as input for other
+programs.
+
+For each line of input GNU B<parallel> will execute I<command> with
+the line as arguments. If no I<command> is given, the line of input is
+executed. Several lines will be run in parallel. GNU B<parallel> can
+often be used as a substitute for B<xargs> or B<cat | bash>.
+
+
+=head2 Reader's guide
+
+GNU B<parallel> includes the 4 types of documentation: Tutorial,
+how-to, reference and explanation.
+
+
+=head3 Tutorial
+
+If you prefer reading a book buy B<GNU Parallel 2018> at
+https://www.lulu.com/shop/ole-tange/gnu-parallel-2018/paperback/product-23558902.html
+or download it at: https://doi.org/10.5281/zenodo.1146014 Read at
+least chapter 1+2. It should take you less than 20 minutes.
+
+Otherwise start by watching the intro videos for a quick introduction:
+https://youtube.com/playlist?list=PL284C9FF2488BC6D1
+
+If you want to dive deeper: spend a couple of hours walking through
+the tutorial (B<man parallel_tutorial>). Your command line will love
+you for it.
+
+
+=head3 How-to
+
+You can find a lot of examples of use in B<man
+parallel_examples>. They will give you an idea of what GNU B<parallel>
+is capable of, and you may find a solution you can simply adapt to
+your situation.
+
+
+=head3 Reference
+
+If you need a one page printable cheat sheet you can find it on:
+https://www.gnu.org/software/parallel/parallel_cheat.pdf
+
+The man page is the reference for all options.
+
+
+=head3 Design discussion
+
+If you want to know the design decisions behind GNU B<parallel>, try:
+B<man parallel_design>. This is also a good intro if you intend to
+change GNU B<parallel>.
+
+
+
+=head1 OPTIONS
+
+=over 4
+
+=item I<command>
+
+Command to execute.
+
+If I<command> or the following arguments contain
+replacement strings (such as B<{}>) every instance will be substituted
+with the input.
+
+If I<command> is given, GNU B<parallel> solve the same tasks as
+B<xargs>. If I<command> is not given GNU B<parallel> will behave
+similar to B<cat | sh>.
+
+The I<command> must be an executable, a script, a composed command, an
+alias, or a function.
+
+B<Bash functions>: B<export -f> the function first or use B<env_parallel>.
+
+B<Bash, Csh, or Tcsh aliases>: Use B<env_parallel>.
+
+B<Zsh, Fish, Ksh, and Pdksh functions and aliases>: Use B<env_parallel>.
+
+=item B<{}>
+
+Input line.
+
+This replacement string will be replaced by a full line read from the
+input source. The input source is normally stdin (standard input), but
+can also be given with B<--arg-file>, B<:::>, or B<::::>.
+
+The replacement string B<{}> can be changed with B<-I>.
+
+If the command line contains no replacement strings then B<{}> will be
+appended to the command line.
+
+Replacement strings are normally quoted, so special characters are not
+parsed by the shell. The exception is if the command starts with a
+replacement string; then the string is not quoted.
+
+See also: B<--plus> B<{.}> B<{/}> B<{//}> B<{/.}> B<{#}> B<{%}>
+B<{>I<n>B<}> B<{=>I<perl expression>B<=}>
+
+
+=item B<{.}>
+
+Input line without extension.
+
+This replacement string will be replaced by the input with the
+extension removed. If the input line contains B<.> after the last
+B</>, the last B<.> until the end of the string will be removed and
+B<{.}> will be replaced with the remaining. E.g. I<foo.jpg> becomes
+I<foo>, I<subdir/foo.jpg> becomes I<subdir/foo>,
+I<sub.dir/foo.jpg> becomes I<sub.dir/foo>, I<sub.dir/bar> remains
+I<sub.dir/bar>. If the input line does not contain B<.> it will remain
+unchanged.
+
+The replacement string B<{.}> can be changed with B<--extensionreplace>
+
+See also: B<{}> B<--extensionreplace>
+
+
+=item B<{/}>
+
+Basename of input line.
+
+This replacement string will be replaced by the input with the
+directory part removed.
+
+See also: B<{}> B<--basenamereplace>
+
+
+=item B<{//}>
+
+Dirname of input line.
+
+This replacement string will be replaced by the dir of the input
+line. See B<dirname>(1).
+
+See also: B<{}> B<--dirnamereplace>
+
+
+=item B<{/.}>
+
+Basename of input line without extension.
+
+This replacement string will be replaced by the input with the
+directory and extension part removed.  B<{/.}> is a combination of
+B<{/}> and B<{.}>.
+
+See also: B<{}> B<--basenameextensionreplace>
+
+
+=item B<{#}>
+
+Sequence number of the job to run.
+
+This replacement string will be replaced by the sequence number of the
+job being run. It contains the same number as $PARALLEL_SEQ.
+
+See also: B<{}> B<--seqreplace>
+
+
+=item B<{%}>
+
+Job slot number.
+
+This replacement string will be replaced by the job's slot number
+between 1 and number of jobs to run in parallel. There will never be 2
+jobs running at the same time with the same job slot number.
+
+If the job needs to be retried (e.g using B<--retries> or
+B<--retry-failed>) the job slot is not automatically updated. You
+should then instead use B<$PARALLEL_JOBSLOT>:
+
+  $ do_test() {
+      id="$3 {%}=$1 PARALLEL_JOBSLOT=$2"
+      echo run "$id";
+      sleep 1
+      # fail if {%} is odd
+      return `echo $1%2 | bc`
+    }
+  $ export -f do_test
+  $ parallel -j3 --jl mylog do_test {%} \$PARALLEL_JOBSLOT {} ::: A B C D
+  run A {%}=1 PARALLEL_JOBSLOT=1
+  run B {%}=2 PARALLEL_JOBSLOT=2
+  run C {%}=3 PARALLEL_JOBSLOT=3
+  run D {%}=1 PARALLEL_JOBSLOT=1
+  $ parallel --retry-failed -j3 --jl mylog do_test {%} \$PARALLEL_JOBSLOT {} ::: A B C D
+  run A {%}=1 PARALLEL_JOBSLOT=1
+  run C {%}=3 PARALLEL_JOBSLOT=2
+  run D {%}=1 PARALLEL_JOBSLOT=3
+
+Notice how {%} and $PARALLEL_JOBSLOT differ in the retry run of C and D.
+
+See also: B<{}> B<--jobs> B<--slotreplace>
+
+
+=item B<{>I<n>B<}>
+
+Argument from input source I<n> or the I<n>'th argument.
+
+This positional replacement string will be replaced by the input from
+input source I<n> (when used with B<--arg-file> or B<::::>) or with the
+I<n>'th argument (when used with B<-N>). If I<n> is negative it refers
+to the I<n>'th last argument.
+
+See also: B<{}> B<{>I<n>.B<}> B<{>I<n>/B<}> B<{>I<n>//B<}>
+B<{>I<n>/.B<}>
+
+
+=item B<{>I<n>.B<}>
+
+Argument from input source I<n> or the I<n>'th argument without
+extension.
+
+B<{>I<n>.B<}> is a combination of B<{>I<n>B<}> and B<{.}>.
+
+This positional replacement string will be replaced by the input from
+input source I<n> (when used with B<--arg-file> or B<::::>) or with the
+I<n>'th argument (when used with B<-N>). The input will have the
+extension removed.
+
+See also: B<{>I<n>B<}> B<{.}>
+
+
+=item B<{>I<n>/B<}>
+
+Basename of argument from input source I<n> or the I<n>'th argument.
+
+B<{>I<n>/B<}> is a combination of B<{>I<n>B<}> and B<{/}>.
+
+This positional replacement string will be replaced by the input from
+input source I<n> (when used with B<--arg-file> or B<::::>) or with the
+I<n>'th argument (when used with B<-N>). The input will have the
+directory (if any) removed.
+
+See also: B<{>I<n>B<}> B<{/}>
+
+
+=item B<{>I<n>//B<}>
+
+Dirname of argument from input source I<n> or the I<n>'th argument.
+
+B<{>I<n>//B<}> is a combination of B<{>I<n>B<}> and B<{//}>.
+
+This positional replacement string will be replaced by the dir of the
+input from input source I<n> (when used with B<--arg-file> or B<::::>) or with
+the I<n>'th argument (when used with B<-N>). See B<dirname>(1).
+
+See also: B<{>I<n>B<}> B<{//}>
+
+
+=item B<{>I<n>/.B<}>
+
+Basename of argument from input source I<n> or the I<n>'th argument
+without extension.
+
+B<{>I<n>/.B<}> is a combination of B<{>I<n>B<}>, B<{/}>, and
+B<{.}>.
+
+This positional replacement string will be replaced by the input from
+input source I<n> (when used with B<--arg-file> or B<::::>) or with the
+I<n>'th argument (when used with B<-N>). The input will have the
+directory (if any) and extension removed.
+
+See also: B<{>I<n>B<}> B<{/.}>
+
+
+=item B<{=>I<perl expression>B<=}>
+
+Replace with calculated I<perl expression>.
+
+B<$_> will contain the same as B<{}>. After evaluating I<perl
+expression> B<$_> will be used as the value. It is recommended to only
+change $_ but you have full access to all of GNU B<parallel>'s
+internal functions and data structures.
+
+The expression must give the same result if evaluated twice -
+otherwise the behaviour is undefined. E.g. this will not work as expected:
+
+    parallel echo '{= $_= ++$wrong_counter =}' ::: a b c
+
+A few convenience functions and data structures have been made:
+
+=over 15
+
+=item Z<> B<Q(>I<string>B<)>
+
+shell quote a string
+
+=item Z<> B<pQ(>I<string>B<)>
+
+perl quote a string
+
+=item Z<> B<uq()> (or B<uq>)
+
+do not quote current replacement string
+
+=item Z<> B<hash(val)>
+
+compute B::hash(val)
+
+=item Z<> B<total_jobs()>
+
+number of jobs in total
+
+=item Z<> B<slot()>
+
+slot number of job
+
+=item Z<> B<seq()>
+
+sequence number of job
+
+=item Z<> B<@arg>
+
+the arguments
+
+=item Z<> B<skip()>
+
+skip this job (see also B<--filter>)
+
+=item Z<> B<yyyy_mm_dd_hh_mm_ss()>
+
+=item Z<> B<yyyy_mm_dd_hh_mm()>
+
+=item Z<> B<yyyy_mm_dd()>
+
+=item Z<> B<hh_mm_ss()>
+
+=item Z<> B<hh_mm()>
+
+=item Z<> B<yyyymmddhhmmss()>
+
+=item Z<> B<yyyymmddhhmm()>
+
+=item Z<> B<yyyymmdd()>
+
+=item Z<> B<hhmmss()>
+
+=item Z<> B<hhmm()>
+
+time functions
+
+=back
+
+Example:
+
+  seq 10 | parallel echo {} + 1 is {= '$_++' =}
+  parallel csh -c {= '$_="mkdir ".Q($_)' =} ::: '12" dir'
+  seq 50 | parallel echo job {#} of {= '$_=total_jobs()' =}
+
+See also: B<--rpl> B<--parens> B<{}> B<{=>I<n> I<perl expression>B<=}>
+
+
+=item B<{=>I<n> I<perl expression>B<=}>
+
+Positional equivalent to B<{=>I<perl expression>B<=}>.
+
+To understand positional replacement strings see B<{>I<n>B<}>.
+
+See also: B<{=>I<perl expression>B<=}> B<{>I<n>B<}>
+
+
+=item B<:::> I<arguments>
+
+Use arguments on the command line as input source.
+
+Unlike other options for GNU B<parallel> B<:::> is placed after the
+I<command> and before the arguments.
+
+The following are equivalent:
+
+  (echo file1; echo file2) | parallel gzip
+  parallel gzip ::: file1 file2
+  parallel gzip {} ::: file1 file2
+  parallel --arg-sep ,, gzip {} ,, file1 file2
+  parallel --arg-sep ,, gzip ,, file1 file2
+  parallel ::: "gzip file1" "gzip file2"
+
+To avoid treating B<:::> as special use B<--arg-sep> to set the
+argument separator to something else.
+
+If multiple B<:::> are given, each group will be treated as an input
+source, and all combinations of input sources will be
+generated. E.g. ::: 1 2 ::: a b c will result in the combinations
+(1,a) (1,b) (1,c) (2,a) (2,b) (2,c). This is useful for replacing
+nested for-loops.
+
+B<:::>, B<::::>, and B<--arg-file> can be mixed. So these are equivalent:
+
+  parallel echo {1} {2} {3} ::: 6 7 ::: 4 5 ::: 1 2 3
+  parallel echo {1} {2} {3} :::: <(seq 6 7) <(seq 4 5) \
+    :::: <(seq 1 3)
+  parallel -a <(seq 6 7) echo {1} {2} {3} :::: <(seq 4 5) \
+    :::: <(seq 1 3)
+  parallel -a <(seq 6 7) -a <(seq 4 5) echo {1} {2} {3} \
+    ::: 1 2 3
+  seq 6 7 | parallel -a - -a <(seq 4 5) echo {1} {2} {3} \
+    ::: 1 2 3
+  seq 4 5 | parallel echo {1} {2} {3} :::: <(seq 6 7) - \
+    ::: 1 2 3
+
+See also: B<--arg-sep> B<--arg-file> B<::::> B<:::+> B<::::+> B<--link>
+
+
+=item B<:::+> I<arguments>
+
+Like B<:::> but linked like B<--link> to the previous input source.
+
+Contrary to B<--link>, values do not wrap: The shortest input source
+determines the length.
+
+Example:
+
+  parallel echo ::: a b c :::+ 1 2 3 ::: X Y :::+ 11 22
+
+See also: B<::::+> B<--link>
+
+
+=item B<::::> I<argfiles>
+
+Another way to write B<--arg-file> I<argfile1> B<--arg-file> I<argfile2> ...
+
+B<:::> and B<::::> can be mixed.
+
+See also: B<--arg-file> B<:::> B<::::+> B<--link>
+
+
+=item B<::::+> I<argfiles>
+
+Like B<::::> but linked like B<--link> to the previous input source.
+
+Contrary to B<--link>, values do not wrap: The shortest input source
+determines the length.
+
+See also: B<--arg-file> B<:::+> B<--link>
+
+
+=item B<--null>
+
+=item B<-0>
+
+Use NUL as delimiter.
+
+Normally input lines will end in \n (newline). If they end in \0
+(NUL), then use this option. It is useful for processing arguments
+that may contain \n (newline).
+
+Shorthand for B<--delimiter '\0'>.
+
+See also: B<--delimiter>
+
+
+=item B<--arg-file> I<input-file>
+
+=item B<-a> I<input-file>
+
+Use I<input-file> as input source.
+
+If you use this option, stdin (standard input) is given to the first
+process run.  Otherwise, stdin (standard input) is redirected from
+/dev/null.
+
+If multiple B<--arg-file> are given, each I<input-file> will be treated as an
+input source, and all combinations of input sources will be
+generated. E.g. The file B<foo> contains B<1 2>, the file
+B<bar> contains B<a b c>.  B<-a foo> B<-a bar> will result in the combinations
+(1,a) (1,b) (1,c) (2,a) (2,b) (2,c). This is useful for replacing
+nested for-loops.
+
+See also: B<--link> B<{>I<n>B<}> B<::::> B<::::+> B<:::>
+
+
+=item B<--arg-file-sep> I<sep-str>
+
+Use I<sep-str> instead of B<::::> as separator string between command
+and argument files.
+
+Useful if B<::::> is used for something else by the command.
+
+See also: B<::::>
+
+
+=item B<--arg-sep> I<sep-str>
+
+Use I<sep-str> instead of B<:::> as separator string.
+
+Useful if B<:::> is used for something else by the command.
+
+Also useful if you command uses B<:::> but you still want to read
+arguments from stdin (standard input): Simply change B<--arg-sep> to a
+string that is not in the command line.
+
+See also: B<:::>
+
+
+=item B<--bar> (alpha testing)
+
+Show progress as a progress bar.
+
+In the bar is shown: % of jobs completed, estimated seconds left, and
+number of jobs started.
+
+It is compatible with B<zenity>:
+
+  seq 1000 | parallel -j30 --bar '(echo {};sleep 0.1)' \
+    2> >(perl -pe 'BEGIN{$/="\r";$|=1};s/\r/\n/g' |
+         zenity --progress --auto-kill) | wc
+
+See also: B<--eta> B<--progress> B<--total-jobs>
+
+
+=item B<--basefile> I<file>
+
+=item B<--bf> I<file>
+
+I<file> will be transferred to each sshlogin before first job is
+started.
+
+It will be removed if B<--cleanup> is active. The file may be a script
+to run or some common base data needed for the job.  Multiple
+B<--bf> can be specified to transfer more basefiles. The I<file> will be
+transferred the same way as B<--transferfile>.
+
+See also: B<--sshlogin> B<--transfer> B<--return> B<--cleanup>
+B<--workdir>
+
+=item B<--basenamereplace> I<replace-str>
+
+=item B<--bnr> I<replace-str>
+
+Use the replacement string I<replace-str> instead of B<{/}> for
+basename of input line.
+
+See also: B<{/}>
+
+
+=item B<--basenameextensionreplace> I<replace-str>
+
+=item B<--bner> I<replace-str>
+
+Use the replacement string I<replace-str> instead of B<{/.}> for basename of input line without extension.
+
+See also: B<{/.}>
+
+
+=item B<--bin> I<binexpr>
+
+Use I<binexpr> as binning key and bin input to the jobs.
+
+I<binexpr> is [column number|column name] [perlexpression] e.g.:
+
+  3
+  Address
+  3 $_%=100
+  Address s/\D//g
+
+Each input line is split using B<--colsep>. The value of the column is
+put into $_, the perl expression is executed, the resulting value is
+is the job slot that will be given the line. If the value is bigger
+than the number of jobslots the value will be modulo number of jobslots.
+
+This is similar to B<--shard> but the hashing algorithm is a simple
+modulo, which makes it predictible which jobslot will receive which
+value.
+
+The performance is in the order of 100K rows per second. Faster if the
+I<bincol> is small (<10), slower if it is big (>100).
+
+B<--bin> requires B<--pipe> and a fixed numeric value for B<--jobs>.
+
+See also: SPREADING BLOCKS OF DATA B<--group-by> B<--round-robin>
+B<--shard>
+
+
+=item B<--bg>
+
+Run command in background.
+
+GNU B<parallel> will normally wait for the completion of a job. With
+B<--bg> GNU B<parallel> will not wait for completion of the command
+before exiting.
+
+This is the default if B<--semaphore> is set.
+
+Implies B<--semaphore>.
+
+See also: B<--fg> B<man sem>
+
+
+=cut
+
+# You accept to be added to a public hall of shame by
+# removing this section.
+=item B<--bibtex>
+
+=item B<--citation>
+
+Print the citation notice and BibTeX entry for GNU B<parallel>,
+silence citation notice for all future runs, and exit. It will not run
+any commands.
+
+If it is impossible for you to run B<--citation> you can instead use
+B<--will-cite>, which will run commands, but which will only silence
+the citation notice for this single run.
+
+If you use B<--will-cite> in scripts to be run by others you are
+making it harder for others to see the citation notice.  The
+development of GNU B<parallel> is indirectly financed through
+citations, so if your users do not know they should cite then you are
+making it harder to finance development. However, if you pay 10000
+EUR, you have done your part to finance future development and should
+feel free to use B<--will-cite> in scripts.
+
+If you do not want to help financing future development by letting
+other users see the citation notice or by paying, then please consider
+using another tool instead of GNU B<parallel>. You can find some of
+the alternatives in B<man parallel_alternatives>.
+
+
+=item B<--block> I<size>
+
+=item B<--block-size> I<size>
+
+Size of block in bytes to read at a time.
+
+The I<size> can be postfixed with K, M, G, T, P, k, m, g, t, or p.
+
+GNU B<parallel> tries to meet the block size but can be off by the
+length of one record. For performance reasons I<size> should be bigger
+than a two records. GNU B<parallel> will warn you and automatically
+increase the size if you choose a I<size> that is too small.
+
+If you use B<-N>, B<--block> should be bigger than N+1 records.
+
+I<size> defaults to 1M.
+
+When using B<--pipe-part> a negative block size is not interpreted as a
+blocksize but as the number of blocks each jobslot should have. So
+this will run 10*5 = 50 jobs in total:
+
+  parallel --pipe-part -a myfile --block -10 -j5 wc
+
+This is an efficient alternative to B<--round-robin> because data is
+never read by GNU B<parallel>, but you can still have very few
+jobslots process large amounts of data.
+
+See also: UNIT PREFIX B<-N> B<--pipe> B<--pipe-part> B<--round-robin>
+B<--block-timeout>
+
+=item B<--block-timeout> I<duration>
+
+=item B<--bt> I<duration>
+
+Timeout for reading block when using B<--pipe>.
+
+If it takes longer than I<duration> to read a full block, use the
+partial block read so far.
+
+I<duration> is in seconds, but can be postfixed with s, m, h, or d.
+
+See also: TIME POSTFIXES B<--pipe> B<--block>
+
+
+=item B<--cat>
+
+Create a temporary file with content.
+
+Normally B<--pipe>/B<--pipe-part> will give data to the program on
+stdin (standard input). With B<--cat> GNU B<parallel> will create a
+temporary file with the name in B<{}>, so you can do: B<parallel
+--pipe --cat wc {}>.
+
+Implies B<--pipe> unless B<--pipe-part> is used.
+
+See also: B<--pipe> B<--pipe-part> B<--fifo>
+
+
+=item B<--cleanup>
+
+Remove transferred files.
+
+B<--cleanup> will remove the transferred files on the remote computer
+after processing is done.
+
+  find log -name '*gz' | parallel \
+    --sshlogin server.example.com --transferfile {} \
+    --return {.}.bz2 --cleanup "zcat {} | bzip -9 >{.}.bz2"
+
+With B<--transferfile {}> the file transferred to the remote computer
+will be removed on the remote computer. Directories on the remote
+computer containing the file will be removed if they are empty.
+
+With B<--return> the file transferred from the remote computer will be
+removed on the remote computer. Directories on the remote
+computer containing the file will be removed if they are empty.
+
+B<--cleanup> is ignored when not used with B<--basefile>,
+B<--transfer>, B<--transferfile> or B<--return>.
+
+See also: B<--basefile> B<--transfer> B<--transferfile> B<--sshlogin>
+B<--return>
+
+
+=item B<--color> (beta testing)
+
+Colour output.
+
+Colour the output. Each job gets its own colour combination
+(background+foreground).
+
+B<--color> is ignored when using B<-u>.
+
+See also: B<--color-failed>
+
+
+=item B<--color-failed> (beta testing)
+
+=item B<--cf> (beta testing)
+
+Colour the output from failing jobs white on red.
+
+Useful if you have a lot of jobs and want to focus on the failing
+jobs.
+
+B<--color-failed> is ignored when using B<-u>, B<--line-buffer> and
+unreliable when using B<--latest-line>.
+
+See also: B<--color>
+
+
+=item B<--colsep> I<regexp>
+
+=item B<-C> I<regexp>
+
+Column separator.
+
+The input will be treated as a table with I<regexp> separating the
+columns. The n'th column can be accessed using B<{>I<n>B<}> or
+B<{>I<n>.B<}>. E.g. B<{3}> is the 3rd column.
+
+If there are more input sources, each input source will be separated,
+but the columns from each input source will be linked.
+
+  parallel --colsep '-' echo {4} {3} {2} {1} \
+    ::: A-B C-D ::: e-f g-h
+
+B<--colsep> implies B<--trim rl>, which can be overridden with
+B<--trim n>.
+
+I<regexp> is a Perl Regular Expression:
+https://perldoc.perl.org/perlre.html
+
+See also: B<--csv> B<{>I<n>B<}> B<--trim> B<--link>
+
+
+=item B<--compress>
+
+Compress temporary files.
+
+If the output is big and very compressible this will take up less disk
+space in $TMPDIR and possibly be faster due to less disk I/O.
+
+GNU B<parallel> will try B<pzstd>, B<lbzip2>, B<pbzip2>, B<zstd>,
+B<pigz>, B<lz4>, B<lzop>, B<plzip>, B<lzip>, B<lrz>, B<gzip>, B<pxz>,
+B<lzma>, B<bzip2>, B<xz>, B<clzip>, in that order, and use the first
+available.
+
+GNU B<parallel> will use up to 8 processes per job waiting to be
+printed. See B<man parallel_design> for details.
+
+See also: B<--compress-program>
+
+
+=item B<--compress-program> I<prg>
+
+=item B<--decompress-program> I<prg>
+
+Use I<prg> for (de)compressing temporary files.
+
+It is assumed that I<prg -dc> will decompress stdin (standard input)
+to stdout (standard output) unless B<--decompress-program> is given.
+
+See also: B<--compress>
+
+
+=item B<--csv> (alpha testing)
+
+Treat input as CSV-format.
+
+B<--colsep> sets the field delimiter. It works very much like
+B<--colsep> except it deals correctly with quoting. Compare:
+
+   echo '"1 big, 2 small","2""x4"" plank",12.34' |
+     parallel --csv echo {1} of {2} at {3}
+
+   echo '"1 big, 2 small","2""x4"" plank",12.34' |
+     parallel --colsep ',' echo {1} of {2} at {3}
+
+Even quoted newlines are parsed correctly:
+
+   (echo '"Start of field 1 with newline'
+    echo 'Line 2 in field 1";value 2') |
+     parallel --csv --colsep ';' echo Field 1: {1} Field 2: {2}
+
+When used with B<--pipe> only pass full CSV-records.
+
+See also: B<--pipe> B<--link> B<{>I<n>B<}> B<--colsep> B<--header>
+
+
+=item B<--ctag> (obsolete: use B<--color> B<--tag>)
+
+Color tag.
+
+If the values look very similar looking at the output it can be hard
+to tell when a new value is used. B<--ctag> gives each value a random
+color.
+
+See also: B<--color> B<--tag>
+
+
+=item B<--ctagstring> I<str> (obsolete: use B<--color> B<--tagstring>)
+
+Color tagstring.
+
+See also: B<--color> B<--ctag> B<--tagstring>
+
+
+=item B<--delay> I<duration>
+
+Delay starting next job by I<duration>.
+
+GNU B<parallel> will not start another job for the next I<duration>.
+
+I<duration> is in seconds, but can be postfixed with s, m, h, or d.
+
+If you append 'auto' to I<duration> (e.g. 13m3sauto) GNU B<parallel>
+will automatically try to find the optimal value: If a job fails,
+I<duration> is increased by 30%. If a job succeeds, I<duration> is
+decreased by 10%.
+
+See also: TIME POSTFIXES B<--retries> B<--ssh-delay>
+
+
+=item B<--delimiter> I<delim>
+
+=item B<-d> I<delim>
+
+Input items are terminated by I<delim>.
+
+The specified delimiter may be characters, C-style character escapes
+such as \n, or octal or hexadecimal escape codes.  Octal and
+hexadecimal escape codes are understood as for the printf command.
+
+See also: B<--colsep>
+
+
+=item B<--dirnamereplace> I<replace-str>
+
+=item B<--dnr> I<replace-str>
+
+Use the replacement string I<replace-str> instead of B<{//}> for
+dirname of input line.
+
+See also: B<{//}>
+
+
+=item B<--dry-run>
+
+Print the job to run on stdout (standard output), but do not run the
+job.
+
+Use B<-v -v> to include the wrapping that GNU B<parallel> generates
+(for remote jobs, B<--tmux>, B<--nice>, B<--pipe>, B<--pipe-part>,
+B<--fifo> and B<--cat>). Do not count on this literally, though, as
+the job may be scheduled on another computer or the local computer if
+: is in the list.
+
+See also: B<-v>
+
+
+=item B<-E> I<eof-str>
+
+Set the end of file string to I<eof-str>.
+
+If the end of file string occurs as a line of input, the rest of the
+input is not read.  If neither B<-E> nor B<-e> is used, no end of file
+string is used.
+
+
+=item B<--eof>[=I<eof-str>]
+
+=item B<-e>[I<eof-str>]
+
+This option is a synonym for the B<-E> option.
+
+Use B<-E> instead, because it is POSIX compliant for B<xargs> while
+this option is not.  If I<eof-str> is omitted, there is no end of file
+string.  If neither B<-E> nor B<-e> is used, no end of file string is
+used.
+
+
+=item B<--embed>
+
+Embed GNU B<parallel> in a shell script.
+
+If you need to distribute your script to someone who does not want to
+install GNU B<parallel> you can embed GNU B<parallel> in your own
+shell script:
+
+  parallel --embed > new_script
+
+After which you add your code at the end of B<new_script>. This is tested
+on B<ash>, B<bash>, B<dash>, B<ksh>, B<sh>, and B<zsh>.
+
+
+=item B<--env> I<var>
+
+Copy exported environment variable I<var>.
+
+This will copy I<var> to the environment that the command is run
+in. This is especially useful for remote execution.
+
+In Bash I<var> can also be a Bash function - just remember to B<export
+-f> the function.
+
+The variable '_' is special. It will copy all exported environment
+variables except for the ones mentioned in ~/.parallel/ignored_vars.
+
+To copy the full environment (both exported and not exported
+variables, arrays, and functions) use B<env_parallel>.
+
+See also: B<--record-env> B<--session> B<--sshlogin> I<command>
+B<env_parallel>
+
+
+=item B<--eta>
+
+Show the estimated number of seconds before finishing.
+
+This forces GNU B<parallel> to read all jobs before starting to find
+the number of jobs (unless you use B<--total-jobs>). GNU B<parallel>
+normally only reads the next job to run.
+
+The estimate is based on the runtime of finished jobs, so the first
+estimate will only be shown when the first job has finished.
+
+Implies B<--progress>.
+
+See also: B<--bar> B<--progress> B<--total-jobs>
+
+
+=item B<--fg>
+
+Run command in foreground.
+
+With B<--tmux> and B<--tmuxpane> GNU B<parallel> will start B<tmux> in
+the foreground.
+
+With B<--semaphore> GNU B<parallel> will run the command in the
+foreground (opposite B<--bg>), and wait for completion of the command
+before exiting. Exit code will be that of the command.
+
+See also: B<--bg> B<man sem>
+
+
+=item B<--fifo>
+
+Create a temporary fifo with content.
+
+Normally B<--pipe> and B<--pipe-part> will give data to the program on
+stdin (standard input). With B<--fifo> GNU B<parallel> will create a
+temporary fifo with the name in B<{}>, so you can do:
+
+  parallel --pipe --fifo wc {}
+
+Beware: If the fifo is never opened for reading, the job will block forever:
+
+  seq 1000000 | parallel --fifo echo This will block
+  seq 1000000 | parallel --fifo 'echo This will not block < {}'
+
+By using B<--fifo> instead of B<--cat> you may save I/O as B<--cat>
+will write to a temporary file, whereas B<--fifo> will not.
+
+Implies B<--pipe> unless B<--pipe-part> is used.
+
+See also: B<--cat> B<--pipe> B<--pipe-part>
+
+
+=item B<--filter> I<filter>
+
+Only run jobs where I<filter> is true.
+
+I<filter> can contain replacement strings and Perl code. Example:
+
+   parallel --filter '{1} < {2}+1' echo ::: {1..3} ::: {1..3}
+
+Outputs: 1,1 1,2 1,3 2,2 2,3 3,3
+
+See also: B<skip()> B<--no-run-if-empty>
+
+
+=item B<--filter-hosts> (alpha testing)
+
+Remove down hosts.
+
+For each remote host: check that login through ssh works. If not: do
+not use this host.
+
+For performance reasons, this check is performed only at the start and
+every time B<--sshloginfile> is changed. If an host goes down after
+the first check, it will go undetected until B<--sshloginfile> is
+changed; B<--retries> can be used to mitigate this.
+
+Currently you can I<not> put B<--filter-hosts> in a profile,
+$PARALLEL, /etc/parallel/config or similar. This is because GNU
+B<parallel> uses GNU B<parallel> to compute this, so you will get an
+infinite loop. This will likely be fixed in a later release.
+
+See also: B<--sshloginfile> B<--sshlogin> B<--retries>
+
+
+=item B<--gnu>
+
+Behave like GNU B<parallel>.
+
+This option historically took precedence over B<--tollef>. The
+B<--tollef> option is now retired, and therefore may not be
+used. B<--gnu> is kept for compatibility.
+
+
+=item B<--group>
+
+Group output.
+
+Output from each job is grouped together and is only printed when the
+command is finished. Stdout (standard output) first followed by stderr
+(standard error).
+
+This takes in the order of 0.5ms CPU time per job and depends on the
+speed of your disk for larger output. It can be disabled with B<-u>,
+but this means output from different commands can get mixed.
+
+B<--group> is the default. Can be reversed with B<-u>.
+
+See also: B<--line-buffer> B<--ungroup> B<--tag>
+
+
+=item B<--group-by> I<val>
+
+Group input by value.
+
+Combined with B<--pipe>/B<--pipe-part> B<--group-by> groups lines with
+the same value into a record.
+
+The value can be computed from the full line or from a single column.
+
+I<val> can be:
+
+=over 15
+
+=item Z<> column number
+
+Use the value in the column numbered.
+
+=item Z<> column name
+
+Treat the first line as a header and use the value in the column
+named.
+
+(Not supported with B<--pipe-part>).
+
+=item Z<> perl expression
+
+Run the perl expression and use $_ as the value.
+
+=item Z<> column number perl expression
+
+Put the value of the column put in $_, run the perl expression, and use $_ as the value.
+
+=item Z<> column name perl expression
+
+Put the value of the column put in $_, run the perl expression, and use $_ as the value.
+
+(Not supported with B<--pipe-part>).
+
+=back
+
+Example:
+
+  UserID, Consumption
+  123,    1
+  123,    2
+  12-3,   1
+  221,    3
+  221,    1
+  2/21,   5
+
+If you want to group 123, 12-3, 221, and 2/21 into 4 records and pass
+one record at a time to B<wc>:
+
+  tail -n +2 table.csv | \
+    parallel --pipe --colsep , --group-by 1 -kN1 wc
+
+Make GNU B<parallel> treat the first line as a header:
+
+  cat table.csv | \
+    parallel --pipe --colsep , --header : --group-by 1 -kN1 wc
+
+Address column by column name:
+
+  cat table.csv | \
+    parallel --pipe --colsep , --header : --group-by UserID -kN1 wc
+
+If 12-3 and 123 are really the same UserID, remove non-digits in
+UserID when grouping:
+
+  cat table.csv | parallel --pipe --colsep , --header : \
+    --group-by 'UserID s/\D//g' -kN1 wc
+
+See also: SPREADING BLOCKS OF DATA B<--pipe> B<--pipe-part> B<--bin>
+B<--shard> B<--round-robin>
+
+
+=item B<--help>
+
+=item B<-h>
+
+Print a summary of the options to GNU B<parallel> and exit.
+
+
+=item B<--halt-on-error> I<val>
+
+=item B<--halt> I<val>
+
+When should GNU B<parallel> terminate?
+
+In some situations it makes no sense to run all jobs. GNU
+B<parallel> should simply stop as soon as a condition is met.
+
+I<val> defaults to B<never>, which runs all jobs no matter what.
+
+I<val> can also take on the form of I<when>,I<why>.
+
+I<when> can be 'now' which means kill all running jobs and halt
+immediately, or it can be 'soon' which means wait for all running jobs
+to complete, but start no new jobs.
+
+I<why> can be 'fail=X', 'fail=Y%', 'success=X', 'success=Y%',
+'done=X', or 'done=Y%' where X is the number of jobs that has to fail,
+succeed, or be done before halting, and Y is the percentage of jobs
+that has to fail, succeed, or be done before halting.
+
+Example:
+
+=over 23
+
+=item Z<> --halt now,fail=1
+
+exit when a job has failed. Kill running jobs.
+
+=item Z<> --halt soon,fail=3
+
+exit when 3 jobs have failed, but wait for running jobs to complete.
+
+=item Z<> --halt soon,fail=3%
+
+exit when 3% of the jobs have failed, but wait for running jobs to complete.
+
+=item Z<> --halt now,success=1
+
+exit when a job has succeeded. Kill running jobs.
+
+=item Z<> --halt soon,success=3
+
+exit when 3 jobs have succeeded, but wait for running jobs to complete.
+
+=item Z<> --halt now,success=3%
+
+exit when 3% of the jobs have succeeded. Kill running jobs.
+
+=item Z<> --halt now,done=1
+
+exit when a job has finished. Kill running jobs.
+
+=item Z<> --halt soon,done=3
+
+exit when 3 jobs have finished, but wait for running jobs to complete.
+
+=item Z<> --halt now,done=3%
+
+exit when 3% of the jobs have finished. Kill running jobs.
+
+=back
+
+For backwards compatibility these also work:
+
+=over 12
+
+=item Z<>0
+
+never
+
+=item Z<>1
+
+soon,fail=1
+
+=item Z<>2
+
+now,fail=1
+
+=item Z<>-1
+
+soon,success=1
+
+=item Z<>-2
+
+now,success=1
+
+=item Z<>1-99%
+
+soon,fail=1-99%
+
+=back
+
+
+=item B<--header> I<regexp>
+
+Use regexp as header.
+
+For normal usage the matched header (typically the first line:
+B<--header '.*\n'>) will be split using B<--colsep> (which will
+default to '\t') and column names can be used as replacement
+variables: B<{column name}>, B<{column name/}>, B<{column name//}>,
+B<{column name/.}>, B<{column name.}>, B<{=column name perl expression
+=}>, ..
+
+For B<--pipe> the matched header will be prepended to each output.
+
+B<--header :> is an alias for B<--header '.*\n'>.
+
+If I<regexp> is a number, it is a fixed number of lines.
+
+B<--header 0> is special: It will make replacement strings for files
+given with B<--arg-file> or B<::::>. It will make B<{foo/bar}> for the
+file B<foo/bar>.
+
+See also: B<--colsep> B<--pipe> B<--pipe-part> B<--arg-file>
+
+
+=item B<--hostgroups>
+
+=item B<--hgrp>
+
+Enable hostgroups on arguments.
+
+If an argument contains '@' the string after '@' will be removed and
+treated as a list of hostgroups on which this job is allowed to
+run. If there is no B<--sshlogin> with a corresponding group, the job
+will run on any hostgroup.
+
+Example:
+
+  parallel --hostgroups \
+    --sshlogin @grp1/myserver1 -S @grp1+grp2/myserver2 \
+    --sshlogin @grp3/myserver3 \
+    echo ::: my_grp1_arg@grp1 arg_for_grp2@grp2 third@grp1+grp3
+
+B<my_grp1_arg> may be run on either B<myserver1> or B<myserver2>,
+B<third> may be run on either B<myserver1> or B<myserver3>,
+but B<arg_for_grp2> will only be run on B<myserver2>.
+
+See also: B<--sshlogin> B<$PARALLEL_HOSTGROUPS> B<$PARALLEL_ARGHOSTGROUPS>
+
+
+=item B<-I> I<replace-str>
+
+Use the replacement string I<replace-str> instead of B<{}>.
+
+See also: B<{}>
+
+
+=item B<--replace> [I<replace-str>]
+
+=item B<-i> [I<replace-str>]
+
+This option is deprecated; use B<-I> instead.
+
+This option is a synonym for B<-I>I<replace-str> if I<replace-str> is
+specified, and for B<-I {}> otherwise.
+
+See also: B<{}>
+
+
+=item B<--joblog> I<logfile>
+
+=item B<--jl> I<logfile>
+
+Logfile for executed jobs.
+
+Save a list of the executed jobs to I<logfile> in the following TAB
+separated format: sequence number, sshlogin, start time as seconds
+since epoch, run time in seconds, bytes in files transferred, bytes in
+files returned, exit status, signal, and command run.
+
+For B<--pipe> bytes transferred and bytes returned are number of input
+and output of bytes.
+
+If B<logfile> is prepended with '+' log lines will be appended to the
+logfile.
+
+To convert the times into ISO-8601 strict do:
+
+  cat logfile | perl -a -F"\t" -ne \
+    'chomp($F[2]=`date -d \@$F[2] +%FT%T`); print join("\t",@F)'
+
+If the host is long, you can use B<column -t> to pretty print it:
+
+  cat joblog | column -t
+
+See also: B<--resume> B<--resume-failed>
+
+
+=item B<--jobs> I<N>
+
+=item B<-j> I<N>
+
+=item B<--max-procs> I<N>
+
+=item B<-P> I<N>
+
+Number of jobslots on each machine.
+
+Run up to N jobs in parallel.  0 means as many as possible (this can
+take a while to determine). Default is 100% which will run one job per
+CPU thread on each machine.
+
+Due to a bug B<-j 0> will also evaluate replacement strings twice up
+to the number of joblots:
+
+  # This will not count from 1 but from number-of-jobslots
+  seq 10000 | parallel -j0   echo '{= $_ = $foo++; =}' | head
+  # This will count from 1
+  seq 10000 | parallel -j100 echo '{= $_ = $foo++; =}' | head
+
+If B<--semaphore> is set, the default is 1 thus making a mutex.
+
+See also: B<--use-cores-instead-of-threads>
+B<--use-sockets-instead-of-threads>
+
+
+
+=item B<--jobs> I<+N>
+
+=item B<-j> I<+N>
+
+=item B<--max-procs> I<+N>
+
+=item B<-P> I<+N>
+
+Add N to the number of CPU threads.
+
+Run this many jobs in parallel.
+
+See also: B<--number-of-threads> B<--number-of-cores>
+B<--number-of-sockets>
+
+
+=item B<--jobs> I<-N>
+
+=item B<-j> I<-N>
+
+=item B<--max-procs> I<-N>
+
+=item B<-P> I<-N>
+
+Subtract N from the number of CPU threads.
+
+Run this many jobs in parallel.  If the evaluated number is less than
+1 then 1 will be used.
+
+See also: B<--number-of-threads> B<--number-of-cores>
+B<--number-of-sockets>
+
+
+=item B<--jobs> I<N>%
+
+=item B<-j> I<N>%
+
+=item B<--max-procs> I<N>%
+
+=item B<-P> I<N>%
+
+Multiply N% with the number of CPU threads.
+
+Run this many jobs in parallel.
+
+See also: B<--number-of-threads> B<--number-of-cores>
+B<--number-of-sockets>
+
+
+=item B<--jobs> I<procfile>
+
+=item B<-j> I<procfile>
+
+=item B<--max-procs> I<procfile>
+
+=item B<-P> I<procfile>
+
+Read parameter from file.
+
+Use the content of I<procfile> as parameter for
+I<-j>. E.g. I<procfile> could contain the string 100% or +2 or 10. If
+I<procfile> is changed when a job completes, I<procfile> is read again
+and the new number of jobs is computed. If the number is lower than
+before, running jobs will be allowed to finish but new jobs will not
+be started until the wanted number of jobs has been reached.  This
+makes it possible to change the number of simultaneous running jobs
+while GNU B<parallel> is running.
+
+
+=item B<--keep-order>
+
+=item B<-k>
+
+Keep sequence of output same as the order of input.
+
+Normally the output of a job will be printed as soon as the job
+completes. Try this to see the difference:
+
+  parallel -j4 sleep {}\; echo {} ::: 2 1 4 3
+  parallel -j4 -k sleep {}\; echo {} ::: 2 1 4 3
+
+If used with B<--onall> or B<--nonall> the output will grouped by
+sshlogin in sorted order.
+
+B<--keep-order> cannot keep the output order when used with B<--pipe
+--round-robin>. Here it instead means, that the jobslots will get the
+same blocks as input in the same order in every run if the input is
+kept the same. Run each of these twice and compare:
+
+  seq 10000000 | parallel --pipe --round-robin 'sleep 0.$RANDOM; wc'
+  seq 10000000 | parallel --pipe -k --round-robin 'sleep 0.$RANDOM; wc'
+
+B<-k> only affects the order in which the output is printed - not the
+order in which jobs are run.
+
+See also: B<--group> B<--line-buffer>
+
+
+=item B<-L> I<recsize>
+
+When used with B<--pipe>: Read records of I<recsize>.
+
+When used otherwise: Use at most I<recsize> nonblank input lines per
+command line.  Trailing blanks cause an input line to be logically
+continued on the next input line.
+
+B<-L 0> means read one line, but insert 0 arguments on the command
+line.
+
+I<recsize> can be postfixed with K, M, G, T, P, k, m, g, t, or p.
+
+Implies B<-X> unless B<-m>, B<--xargs>, or B<--pipe> is set.
+
+See also: UNIT PREFIX B<-N> B<--max-lines> B<--block> B<-X> B<-m>
+B<--xargs> B<--pipe>
+
+
+=item B<--max-lines> [I<recsize>]
+
+=item B<-l>[I<recsize>]
+
+When used with B<--pipe>: Read records of I<recsize> lines.
+
+When used otherwise: Synonym for the B<-L> option.  Unlike B<-L>, the
+I<recsize> argument is optional.  If I<recsize> is not specified,
+it defaults to one.  The B<-l> option is deprecated since the POSIX
+standard specifies B<-L> instead.
+
+B<-l 0> is an alias for B<-l 1>.
+
+Implies B<-X> unless B<-m>, B<--xargs>, or B<--pipe> is set.
+
+See also: UNIT PREFIX B<-N> B<--block> B<-X> B<-m>
+B<--xargs> B<--pipe>
+
+
+=item B<--limit> "I<command> I<args>"
+
+Dynamic job limit.
+
+Before starting a new job run I<command> with I<args>. The exit value
+of I<command> determines what GNU B<parallel> will do:
+
+=over 4
+
+=item Z<>0
+
+Below limit. Start another job.
+
+=item Z<>1
+
+Over limit. Start no jobs.
+
+=item Z<>2
+
+Way over limit. Kill the youngest job.
+
+=back
+
+You can use any shell command. There are 3 predefined commands:
+
+=over 10
+
+=item "io I<n>"
+
+Limit for I/O. The amount of disk I/O will be computed as a value
+0-100, where 0 is no I/O and 100 is at least one disk is 100%
+saturated.
+
+=item "load I<n>"
+
+Similar to B<--load>.
+
+=item "mem I<n>"
+
+Similar to B<--memfree>.
+
+=back
+
+See also: B<--memfree> B<--load>
+
+
+=item B<--latest-line> (alpha testing)
+
+=item B<--ll> (alpha testing)
+
+Print the lastest line. Each job gets a single line that is updated
+with the lastest output from the job.
+
+Example:
+
+  slow_seq() {
+    seq "$@" |
+      perl -ne '$|=1; for(split//){ print; select($a,$a,$a,0.03);}'
+  }
+  export -f slow_seq
+  parallel --shuf -j99 --ll --tag --bar --color slow_seq {} ::: {1..300}
+
+See also: B<--line-buffer>
+
+
+=item B<--line-buffer> (beta testing)
+
+=item B<--lb> (beta testing)
+
+Buffer output on line basis.
+
+B<--group> will keep the output together for a whole job. B<--ungroup>
+allows output to mixup with half a line coming from one job and half a
+line coming from another job. B<--line-buffer> fits between these two:
+GNU B<parallel> will print a full line, but will allow for mixing
+lines of different jobs.
+
+B<--line-buffer> takes more CPU power than both B<--group> and
+B<--ungroup>, but can be much faster than B<--group> if the CPU is not
+the limiting factor.
+
+Normally B<--line-buffer> does not buffer on disk, and can thus
+process an infinite amount of data, but it will buffer on disk when
+combined with: B<--keep-order>, B<--results>, B<--compress>, and
+B<--files>. This will make it as slow as B<--group> and will limit
+output to the available disk space.
+
+With B<--keep-order> B<--line-buffer> will output lines from the first
+job continuously while it is running, then lines from the second job
+while that is running. It will buffer full lines, but jobs will not
+mix. Compare:
+
+  parallel -j0 'echo {};sleep {};echo {}' ::: 1 3 2 4
+  parallel -j0 --lb 'echo {};sleep {};echo {}' ::: 1 3 2 4
+  parallel -j0 -k --lb 'echo {};sleep {};echo {}' ::: 1 3 2 4
+
+See also: B<--group> B<--ungroup> B<--keep-order> B<--tag>
+
+
+=item B<--link>
+
+=item B<--xapply>
+
+Link input sources.
+
+Read multiple input sources like the command B<xapply>. If multiple
+input sources are given, one argument will be read from each of the
+input sources. The arguments can be accessed in the command as B<{1}>
+.. B<{>I<n>B<}>, so B<{1}> will be a line from the first input source,
+and B<{6}> will refer to the line with the same line number from the
+6th input source.
+
+Compare these two:
+
+  parallel echo {1} {2} ::: 1 2 3 ::: a b c
+  parallel --link echo {1} {2} ::: 1 2 3 ::: a b c
+
+Arguments will be recycled if one input source has more arguments than the others:
+
+  parallel --link echo {1} {2} {3} \
+    ::: 1 2 ::: I II III ::: a b c d e f g
+
+See also: B<--header> B<:::+> B<::::+>
+
+
+=item B<--load> I<max-load>
+
+Only start jobs if load is less than max-load.
+
+Do not start new jobs on a given computer unless the number of running
+processes on the computer is less than I<max-load>. I<max-load> uses
+the same syntax as B<--jobs>, so I<100%> for one per CPU is a valid
+setting. Only difference is 0 which is interpreted as 0.01.
+
+See also: B<--limit> B<--jobs>
+
+
+=item B<--controlmaster>
+
+=item B<-M>
+
+Use ssh's ControlMaster to make ssh connections faster.
+
+Useful if jobs run remote and are very fast to run. This is disabled
+for sshlogins that specify their own ssh command.
+
+See also: B<--ssh> B<--sshlogin>
+
+
+=item B<-m>
+
+Multiple arguments.
+
+Insert as many arguments as the command line length permits. If
+multiple jobs are being run in parallel: distribute the arguments
+evenly among the jobs. Use B<-j1> or B<--xargs> to avoid this.
+
+If B<{}> is not used the arguments will be appended to the
+line.  If B<{}> is used multiple times each B<{}> will be replaced
+with all the arguments.
+
+Support for B<-m> with B<--sshlogin> is limited and may fail.
+
+If in doubt use B<-X> as that will most likely do what is needed.
+
+See also: B<-X> B<--xargs>
+
+
+=item B<--memfree> I<size>
+
+Minimum memory free when starting another job.
+
+The I<size> can be postfixed with K, M, G, T, P, k, m, g, t, or p.
+
+If the jobs take up very different amount of RAM, GNU B<parallel> will
+only start as many as there is memory for. If less than I<size> bytes
+are free, no more jobs will be started. If less than 50% I<size> bytes
+are free, the youngest job will be killed (as per B<--term-seq>), and
+put back on the queue to be run later.
+
+B<--retries> must be set to determine how many times GNU B<parallel>
+should retry a given job.
+
+See also: UNIT PREFIX B<--term-seq> B<--retries> B<--memsuspend>
+
+
+=item B<--memsuspend> I<size>
+
+Suspend jobs when there is less memory available.
+
+If the available memory falls below 2 * I<size>, GNU B<parallel> will
+suspend some of the running jobs. If the available memory falls below
+I<size>, only one job will be running.
+
+If a single job takes up at most I<size> RAM, all jobs will complete
+without running out of memory. If you have swap available, you can
+usually lower I<size> to around half the size of a single job - with
+the slight risk of swapping a little.
+
+Jobs will be resumed when more RAM is available - typically when the
+oldest job completes.
+
+B<--memsuspend> only works on local jobs because there is no obvious
+way to suspend remote jobs.
+
+I<size> can be postfixed with K, M, G, T, P, k, m, g, t, or p.
+
+See also: UNIT PREFIX B<--memfree>
+
+
+=item B<--minversion> I<version>
+
+Print the version GNU B<parallel> and exit.
+
+If the current version of GNU B<parallel> is less than I<version> the
+exit code is 255. Otherwise it is 0.
+
+This is useful for scripts that depend on features only available from
+a certain version of GNU B<parallel>:
+
+   parallel --minversion 20170422 &&
+     echo halt done=50% supported from version 20170422 &&
+     parallel --halt now,done=50% echo ::: {1..100}
+
+See also: B<--version>
+
+
+=item B<--max-args> I<max-args>
+
+=item B<-n> I<max-args>
+
+Use at most I<max-args> arguments per command line.
+
+Fewer than I<max-args> arguments will be used if the size (see the
+B<-s> option) is exceeded, unless the B<-x> option is given, in which
+case GNU B<parallel> will exit.
+
+B<-n 0> means read one argument, but insert 0 arguments on the command
+line.
+
+I<max-args> can be postfixed with K, M, G, T, P, k, m, g, t, or p (see
+UNIT PREFIX).
+
+Implies B<-X> unless B<-m> is set.
+
+See also: B<-X> B<-m> B<--xargs> B<--max-replace-args>
+
+
+=item B<--max-replace-args> I<max-args>
+
+=item B<-N> I<max-args>
+
+Use at most I<max-args> arguments per command line.
+
+Like B<-n> but also makes replacement strings B<{1}>
+.. B<{>I<max-args>B<}> that represents argument 1 .. I<max-args>. If
+too few args the B<{>I<n>B<}> will be empty.
+
+B<-N 0> means read one argument, but insert 0 arguments on the command
+line.
+
+This will set the owner of the homedir to the user:
+
+  tr ':' '\n' < /etc/passwd | parallel -N7 chown {1} {6}
+
+Implies B<-X> unless B<-m> or B<--pipe> is set.
+
+I<max-args> can be postfixed with K, M, G, T, P, k, m, g, t, or p.
+
+When used with B<--pipe> B<-N> is the number of records to read. This
+is somewhat slower than B<--block>.
+
+See also: UNIT PREFIX B<--pipe> B<--block> B<-m> B<-X> B<--max-args>
+
+
+=item B<--nonall>
+
+B<--onall> with no arguments.
+
+Run the command on all computers given with B<--sshlogin> but take no
+arguments. GNU B<parallel> will log into B<--jobs> number of computers
+in parallel and run the job on the computer. B<-j> adjusts how many
+computers to log into in parallel.
+
+This is useful for running the same command (e.g. uptime) on a list of
+servers.
+
+See also: B<--onall> B<--sshlogin>
+
+
+=item B<--onall>
+
+Run all the jobs on all computers given with B<--sshlogin>.
+
+GNU B<parallel> will log into B<--jobs> number of computers in
+parallel and run one job at a time on the computer. The order of the
+jobs will not be changed, but some computers may finish before others.
+
+When using B<--group> the output will be grouped by each server, so
+all the output from one server will be grouped together.
+
+B<--joblog> will contain an entry for each job on each server, so
+there will be several job sequence 1.
+
+See also: B<--nonall> B<--sshlogin>
+
+
+=item B<--open-tty>
+
+=item B<-o>
+
+Open terminal tty.
+
+Similar to B<--tty> but does not set B<--jobs> or B<--ungroup>.
+
+See also: B<--tty>
+
+
+=item B<--output-as-files>
+
+=item B<--outputasfiles>
+
+=item B<--files>
+
+Save output to files.
+
+Instead of printing the output to stdout (standard output) the output
+of each job is saved in a file and the filename is then printed.
+
+See also: B<--results>
+
+
+=item B<--pipe>
+
+=item B<--spreadstdin>
+
+Spread input to jobs on stdin (standard input).
+
+Read a block of data from stdin (standard input) and give one block of
+data as input to one job.
+
+The block size is determined by B<--block> (default: 1M). The strings
+B<--recstart> and B<--recend> tell GNU B<parallel> how a record starts
+and/or ends. The block read will have the final partial record removed
+before the block is passed on to the job. The partial record will be
+prepended to next block.
+
+You can limit the number of records to be passed with B<-N>, and set
+the record size with B<-L>.
+
+B<--pipe> maxes out at around 1 GB/s input, and 100 MB/s output. If
+performance is important use B<--pipe-part>.
+
+B<--fifo> and B<--cat> will give stdin (standard input) on a fifo or a
+temporary file.
+
+If data is arriving slowly, you can use B<--block-timeout> to finish
+reading a block early.
+
+The data can be spread between the jobs in specific ways using
+B<--round-robin>, B<--bin>, B<--shard>, B<--group-by>. See the
+section: SPREADING BLOCKS OF DATA
+
+See also: B<--block> B<--block-timeout> B<--recstart> B<--recend>
+B<--fifo> B<--cat> B<--pipe-part> B<-N> B<-L> B<--round-robin>
+
+
+=item B<--pipe-part>
+
+Pipe parts of a physical file.
+
+B<--pipe-part> works similar to B<--pipe>, but is much faster.
+
+B<--pipe-part> has a few limitations:
+
+=over 3
+
+=item *
+
+The file must be a normal file or a block device (technically it must
+be seekable) and must be given using B<--arg-file> or B<::::>. The file cannot
+be a pipe, a fifo, or a stream as they are not seekable.
+
+If using a block device with lot of NUL bytes, remember to set
+B<--recend ''>.
+
+=item *
+
+Record counting (B<-N>) and line counting (B<-L>/B<-l>) do not
+work. Instead use B<--recstart> and B<--recend> to determine
+where records end.
+
+=back
+
+See also: B<--pipe> B<--recstart> B<--recend> B<--arg-file> B<::::>
+
+
+=item B<--plain>
+
+Ignore B<--profile>, $PARALLEL, and ~/.parallel/config.
+
+Ignore any B<--profile>, $PARALLEL, and ~/.parallel/config to get full
+control on the command line (used by GNU B<parallel> internally when
+called with B<--sshlogin>).
+
+See also: B<--profile>
+
+
+=item B<--plus>
+
+Add more replacement strings.
+
+Activate additional replacement strings: {+/} {+.} {+..} {+...} {..}
+{...} {/..} {/...} {##}. The idea being that '{+foo}' matches the opposite of
+'{foo}' and {} = {+/}/{/} = {.}.{+.} = {+/}/{/.}.{+.} = {..}.{+..} =
+{+/}/{/..}.{+..} = {...}.{+...} = {+/}/{/...}.{+...}
+
+B<{##}> is the total number of jobs to be run. It is incompatible with
+B<-X>/B<-m>/B<--xargs>.
+
+B<{0%}> zero-padded jobslot.
+
+B<{0#}> zero-padded sequence number.
+
+B<{choose_k}> is inspired by n choose k: Given a list of n elements,
+choose k. k is the number of input sources and n is the number of
+arguments in an input source.  The content of the input sources must
+be the same and the arguments must be unique.
+
+B<{uniq}> skips jobs where values from two input sources are the same.
+
+Shorthands for variables:
+
+  {slot}         $PARALLEL_JOBSLOT (see {%})
+  {sshlogin}     $PARALLEL_SSHLOGIN
+  {host}         $PARALLEL_SSHHOST
+  {agrp}         $PARALLEL_ARGHOSTGROUPS
+  {hgrp}         $PARALLEL_HOSTGROUPS
+
+The following dynamic replacement strings are also activated. They are
+inspired by bash's parameter expansion:
+
+  {:-str}        str if the value is empty
+  {:num}         remove the first num characters
+  {:pos:len}     substring from position pos length len
+  {#regexp}      remove prefix regexp (non-greedy)
+  {##regexp}     remove prefix regexp (greedy)
+  {%regexp}      remove postfix regexp (non-greedy)
+  {%%regexp}     remove postfix regexp (greedy)
+  {/regexp/str}  replace one regexp with str
+  {//regexp/str} replace every regexp with str
+  {^str}         uppercase str if found at the start
+  {^^str}        uppercase str
+  {,str}         lowercase str if found at the start
+  {,,str}        lowercase str
+
+See also: B<--rpl> B<{}>
+
+
+=item B<--process-slot-var> I<varname>
+
+Set the environment variable I<varname> to the jobslot number-1.
+
+  seq 10 | parallel --process-slot-var=name echo '$name' {}
+
+
+=item B<--progress>
+
+Show progress of computations.
+
+List the computers involved in the task with number of CPUs detected
+and the max number of jobs to run. After that show progress for each
+computer: number of running jobs, number of completed jobs, and
+percentage of all jobs done by this computer. The percentage will only
+be available after all jobs have been scheduled as GNU B<parallel>
+only read the next job when ready to schedule it - this is to avoid
+wasting time and memory by reading everything at startup.
+
+By sending GNU B<parallel> SIGUSR2 you can toggle turning on/off
+B<--progress> on a running GNU B<parallel> process.
+
+See also: B<--eta> B<--bar>
+
+
+=item B<--max-line-length-allowed> (alpha testing)
+
+Print maximal command line length.
+
+Print the maximal number of characters allowed on the command line and
+exit (used by GNU B<parallel> itself to determine the line length
+on remote computers).
+
+See also: B<--show-limits>
+
+
+=item B<--number-of-cpus> (obsolete)
+
+Print the number of physical CPU cores and exit.
+
+
+=item B<--number-of-cores>
+
+Print the number of physical CPU cores and exit (used by GNU B<parallel> itself
+to determine the number of physical CPU cores on remote computers).
+
+See also: B<--number-of-sockets> B<--number-of-threads>
+B<--use-cores-instead-of-threads> B<--jobs>
+
+
+=item B<--number-of-sockets>
+
+Print the number of filled CPU sockets and exit (used by GNU
+B<parallel> itself to determine the number of filled CPU sockets on
+remote computers).
+
+See also: B<--number-of-cores> B<--number-of-threads>
+B<--use-sockets-instead-of-threads> B<--jobs>
+
+
+=item B<--number-of-threads>
+
+Print the number of hyperthreaded CPU cores and exit (used by GNU
+B<parallel> itself to determine the number of hyperthreaded CPU cores
+on remote computers).
+
+See also: B<--number-of-cores> B<--number-of-sockets> B<--jobs>
+
+
+=item B<--no-keep-order>
+
+Overrides an earlier B<--keep-order> (e.g. if set in
+B<~/.parallel/config>).
+
+
+=item B<--nice> I<niceness>
+
+Run the command at this niceness.
+
+By default GNU B<parallel> will run jobs at the same nice level as GNU
+B<parallel> is started - both on the local machine and remote servers,
+so you are unlikely to ever use this option.
+
+Setting B<--nice> will override this nice level. If the nice level is
+smaller than the current nice level, it will only affect remote jobs
+(e.g. if current level is 10 then B<--nice 5> will cause local jobs to
+be run at level 10, but remote jobs run at nice level 5).
+
+
+=item B<--interactive>
+
+=item B<-p>
+
+Ask user before running a job.
+
+Prompt the user about whether to run each command line and read a line
+from the terminal.  Only run the command line if the response starts
+with 'y' or 'Y'.  Implies B<-t>.
+
+
+=item B<--_parset> I<type>,I<varname>
+
+Used internally by B<parset>.
+
+Generate shell code to be eval'ed which will set the variable(s)
+I<varname>. I<type> can be 'assoc' for associative array or 'var' for
+normal variables.
+
+The only supported use is as part of B<parset>.
+
+
+=item B<--parens> I<parensstring>
+
+Use I<parensstring> instead of B<{==}>.
+
+Define start and end parenthesis for B<{=perl expression=}>. The
+left and the right parenthesis can be multiple characters and are
+assumed to be the same length. The default is B<{==}> giving B<{=> as
+the start parenthesis and B<=}> as the end parenthesis.
+
+Another useful setting is B<,,,,> which would make both parenthesis
+B<,,>:
+
+  parallel --parens ,,,, echo foo is ,,s/I/O/g,, ::: FII
+
+See also: B<--rpl> B<{=>I<perl expression>B<=}>
+
+
+=item B<--profile> I<profilename>
+
+=item B<-J> I<profilename>
+
+Use profile I<profilename> for options.
+
+This is useful if you want to have multiple profiles. You could have
+one profile for running jobs in parallel on the local computer and a
+different profile for running jobs on remote computers.
+
+I<profilename> corresponds to the file ~/.parallel/I<profilename>.
+
+You can give multiple profiles by repeating B<--profile>. If parts of
+the profiles conflict, the later ones will be used.
+
+Default: ~/.parallel/config
+
+See also: PROFILE FILES
+
+
+=item B<--quote>
+
+=item B<-q>
+
+Quote I<command>.
+
+If your command contains special characters that should not be
+interpreted by the shell (e.g. ; \ | *), use B<--quote> to escape
+these. The command must be a simple command (see B<man bash>) without
+redirections and without variable assignments.
+
+Most people will not need this. Quoting is disabled by default.
+
+See also: QUOTING I<command> B<--shell-quote> B<uq()> B<Q()>
+
+
+=item B<--no-run-if-empty>
+
+=item B<-r>
+
+Do not run empty input.
+
+If the stdin (standard input) only contains whitespace, do not run the
+command.
+
+If used with B<--pipe> this is slow.
+
+See also: I<command> B<--pipe> B<--interactive>
+
+
+=item B<--noswap>
+
+Do not start job is computer is swapping.
+
+Do not start new jobs on a given computer if there is both swap-in and
+swap-out activity.
+
+The swap activity is only sampled every 10 seconds as the sampling
+takes 1 second to do.
+
+Swap activity is computed as (swap-in)*(swap-out) which in practice is
+a good value: swapping out is not a problem, swapping in is not a
+problem, but both swapping in and out usually indicates a problem.
+
+B<--memfree> and B<--memsuspend> may give better results, so try using
+those first.
+
+See also: B<--memfree> B<--memsuspend>
+
+
+=item B<--record-env>
+
+Record exported environment.
+
+Record current exported environment variables in
+B<~/.parallel/ignored_vars>.  This will ignore variables currently set
+when using B<--env _>. So you should set the variables/fuctions, you
+want to use I<after> running B<--record-env>.
+
+See also: B<--env> B<--session> B<env_parallel>
+
+
+=item B<--recstart> I<startstring>
+
+=item B<--recend> I<endstring>
+
+Split record between I<endstring> and I<startstring>.
+
+If B<--recstart> is given I<startstring> will be used to split at record start.
+
+If B<--recend> is given I<endstring> will be used to split at record end.
+
+If both B<--recstart> and B<--recend> are given the combined string
+I<endstring>I<startstring> will have to match to find a split
+position. This is useful if either I<startstring> or I<endstring>
+match in the middle of a record.
+
+If neither B<--recstart> nor B<--recend> are given, then B<--recend>
+defaults to '\n'. To have no record separator (e.g. for binary files)
+use B<--recend "">.
+
+B<--recstart> and B<--recend> are used with B<--pipe>.
+
+Use B<--regexp> to interpret B<--recstart> and B<--recend> as regular
+expressions. This is slow, however.
+
+Use B<--remove-rec-sep> to remove B<--recstart> and B<--recend> before
+passing the block to the job.
+
+See also: B<--pipe> B<--regexp> B<--remove-rec-sep>
+
+
+=item B<--regexp>
+
+Use B<--regexp> to interpret B<--recstart> and B<--recend> as regular
+expressions. This is slow, however.
+
+See also: B<--pipe> B<--regexp> B<--remove-rec-sep> B<--recstart>
+B<--recend>
+
+
+=item B<--remove-rec-sep>
+
+=item B<--removerecsep>
+
+=item B<--rrs>
+
+Remove record separator.
+
+Remove the text matched by B<--recstart> and B<--recend> before piping
+it to the command.
+
+Only used with B<--pipe>/B<--pipe-part>.
+
+See also: B<--pipe> B<--regexp> B<--pipe-part> B<--recstart>
+B<--recend>
+
+
+=item B<--results> I<name>
+
+=item B<--res> I<name>
+
+Save the output into files.
+
+B<Simple string output dir>
+
+If I<name> does not contain replacement strings and does not end in
+B<.csv/.tsv>, the output will be stored in a directory tree rooted at
+I<name>.  Within this directory tree, each command will result in
+three files: I<name>/<ARGS>/stdout and I<name>/<ARGS>/stderr,
+I<name>/<ARGS>/seq, where <ARGS> is a sequence of directories
+representing the header of the input source (if using B<--header :>)
+or the number of the input source and corresponding values.
+
+E.g:
+
+  parallel --header : --results foo echo {a} {b} \
+    ::: a I II ::: b III IIII
+
+will generate the files:
+
+  foo/a/II/b/III/seq
+  foo/a/II/b/III/stderr
+  foo/a/II/b/III/stdout
+  foo/a/II/b/IIII/seq
+  foo/a/II/b/IIII/stderr
+  foo/a/II/b/IIII/stdout
+  foo/a/I/b/III/seq
+  foo/a/I/b/III/stderr
+  foo/a/I/b/III/stdout
+  foo/a/I/b/IIII/seq
+  foo/a/I/b/IIII/stderr
+  foo/a/I/b/IIII/stdout
+
+and
+
+  parallel --results foo echo {1} {2} ::: I II ::: III IIII
+
+will generate the files:
+
+  foo/1/II/2/III/seq
+  foo/1/II/2/III/stderr
+  foo/1/II/2/III/stdout
+  foo/1/II/2/IIII/seq
+  foo/1/II/2/IIII/stderr
+  foo/1/II/2/IIII/stdout
+  foo/1/I/2/III/seq
+  foo/1/I/2/III/stderr
+  foo/1/I/2/III/stdout
+  foo/1/I/2/IIII/seq
+  foo/1/I/2/IIII/stderr
+  foo/1/I/2/IIII/stdout
+
+
+B<CSV file output>
+
+If I<name> ends in B<.csv>/B<.tsv> the output will be a CSV-file
+named I<name>.
+
+B<.csv> gives a comma separated value file. B<.tsv> gives a TAB
+separated value file.
+
+B<-.csv>/B<-.tsv> are special: It will give the file on stdout
+(standard output).
+
+
+B<JSON file output>
+
+If I<name> ends in B<.json> the output will be a JSON-file
+named I<name>.
+
+B<-.json> is special: It will give the file on stdout (standard
+output).
+
+
+B<Replacement string output file>
+
+If I<name> contains a replacement string and the replaced result does
+not end in /, then the standard output will be stored in a file named
+by this result. Standard error will be stored in the same file name
+with '.err' added, and the sequence number will be stored in the same
+file name with '.seq' added.
+
+E.g.
+
+  parallel --results my_{} echo ::: foo bar baz
+
+will generate the files:
+
+  my_bar
+  my_bar.err
+  my_bar.seq
+  my_baz
+  my_baz.err
+  my_baz.seq
+  my_foo
+  my_foo.err
+  my_foo.seq
+
+
+B<Replacement string output dir>
+
+If I<name> contains a replacement string and the replaced result ends
+in /, then output files will be stored in the resulting dir.
+
+E.g.
+
+  parallel --results my_{}/ echo ::: foo bar baz
+
+will generate the files:
+
+  my_bar/seq
+  my_bar/stderr
+  my_bar/stdout
+  my_baz/seq
+  my_baz/stderr
+  my_baz/stdout
+  my_foo/seq
+  my_foo/stderr
+  my_foo/stdout
+
+See also: B<--output-as-files> B<--tag> B<--header> B<--joblog>
+
+
+=item B<--resume>
+
+Resumes from the last unfinished job.
+
+By reading B<--joblog> or the
+B<--results> dir GNU B<parallel> will figure out the last unfinished
+job and continue from there. As GNU B<parallel> only looks at the
+sequence numbers in B<--joblog> then the input, the command, and
+B<--joblog> all have to remain unchanged; otherwise GNU B<parallel>
+may run wrong commands.
+
+See also: B<--joblog> B<--results> B<--resume-failed> B<--retries>
+
+
+=item B<--resume-failed>
+
+Retry all failed and resume from the last unfinished job.
+
+By reading
+B<--joblog> GNU B<parallel> will figure out the failed jobs and run
+those again. After that it will resume last unfinished job and
+continue from there. As GNU B<parallel> only looks at the sequence
+numbers in B<--joblog> then the input, the command, and B<--joblog>
+all have to remain unchanged; otherwise GNU B<parallel> may run wrong
+commands.
+
+See also: B<--joblog> B<--resume> B<--retry-failed> B<--retries>
+
+
+=item B<--retry-failed>
+
+Retry all failed jobs in joblog.
+
+By reading B<--joblog> GNU
+B<parallel> will figure out the failed jobs and run those again.
+
+B<--retry-failed> ignores the command and arguments on the command
+line: It only looks at the joblog.
+
+B<Differences between --resume, --resume-failed, --retry-failed>
+
+In this example B<exit {= $_%=2 =}> will cause every other job to fail.
+
+  timeout -k 1 4 parallel --joblog log -j10 \
+    'sleep {}; exit {= $_%=2 =}' ::: {10..1}
+
+4 jobs completed. 2 failed:
+
+  Seq	[...]	Exitval	Signal	Command
+  10	[...]	1	0	sleep 1; exit 1
+  9	[...]	0	0	sleep 2; exit 0
+  8	[...]	1	0	sleep 3; exit 1
+  7	[...]	0	0	sleep 4; exit 0
+
+B<--resume> does not care about the Exitval, but only looks at Seq. If
+the Seq is run, it will not be run again. So if needed, you can change
+the command for the seqs not run yet:
+
+  parallel --resume --joblog log -j10 \
+    'sleep .{}; exit {= $_%=2 =}' ::: {10..1}
+
+  Seq	[...]	Exitval	Signal	Command
+  [... as above ...]
+  1	[...]	0	0	sleep .10; exit 0
+  6	[...]	1	0	sleep .5; exit 1
+  5	[...]	0	0	sleep .6; exit 0
+  4	[...]	1	0	sleep .7; exit 1
+  3	[...]	0	0	sleep .8; exit 0
+  2	[...]	1	0	sleep .9; exit 1
+
+B<--resume-failed> cares about the Exitval, but also only looks at Seq
+to figure out which commands to run. Again this means you can change
+the command, but not the arguments. It will run the failed seqs and
+the seqs not yet run:
+
+  parallel --resume-failed --joblog log -j10 \
+    'echo {};sleep .{}; exit {= $_%=3 =}' ::: {10..1}
+
+  Seq	[...]	Exitval	Signal	Command
+  [... as above ...]
+  10	[...]	1	0	echo 1;sleep .1; exit 1
+  8	[...]	0	0	echo 3;sleep .3; exit 0
+  6	[...]	2	0	echo 5;sleep .5; exit 2
+  4	[...]	1	0	echo 7;sleep .7; exit 1
+  2	[...]	0	0	echo 9;sleep .9; exit 0
+
+B<--retry-failed> cares about the Exitval, but takes the command from
+the joblog. It ignores any arguments or commands given on the command
+line:
+
+  parallel --retry-failed --joblog log -j10 this part is ignored
+
+  Seq	[...]	Exitval	Signal	Command
+  [... as above ...]
+  10	[...]	1	0	echo 1;sleep .1; exit 1
+  6	[...]	2	0	echo 5;sleep .5; exit 2
+  4	[...]	1	0	echo 7;sleep .7; exit 1
+
+See also: B<--joblog> B<--resume> B<--resume-failed> B<--retries>
+
+
+=item B<--retries> I<n>
+
+Try failing jobs I<n> times.
+
+If a job fails, retry it on another computer on which it has not
+failed. Do this I<n> times. If there are fewer than I<n> computers in
+B<--sshlogin> GNU B<parallel> will re-use all the computers. This is
+useful if some jobs fail for no apparent reason (such as network
+failure).
+
+I<n>=0 means infinite.
+
+See also: B<--term-seq> B<--sshlogin>
+
+
+=item B<--return> I<filename>
+
+Transfer files from remote computers.
+
+B<--return> is used with
+B<--sshlogin> when the arguments are files on the remote computers. When
+processing is done the file I<filename> will be transferred
+from the remote computer using B<rsync> and will be put relative to
+the default login dir. E.g.
+
+  echo foo/bar.txt | parallel --return {.}.out \
+    --sshlogin server.example.com touch {.}.out
+
+This will transfer the file I<$HOME/foo/bar.out> from the computer
+I<server.example.com> to the file I<foo/bar.out> after running
+B<touch foo/bar.out> on I<server.example.com>.
+
+  parallel -S server --trc out/./{}.out touch {}.out ::: in/file
+
+This will transfer the file I<in/file.out> from the computer
+I<server.example.com> to the files I<out/in/file.out> after running
+B<touch in/file.out> on I<server>.
+
+  echo /tmp/foo/bar.txt | parallel --return {.}.out \
+    --sshlogin server.example.com touch {.}.out
+
+This will transfer the file I</tmp/foo/bar.out> from the computer
+I<server.example.com> to the file I</tmp/foo/bar.out> after running
+B<touch /tmp/foo/bar.out> on I<server.example.com>.
+
+Multiple files can be transferred by repeating the option multiple
+times:
+
+  echo /tmp/foo/bar.txt | parallel \
+    --sshlogin server.example.com \
+    --return {.}.out --return {.}.out2 touch {.}.out {.}.out2
+
+B<--return> is ignored when used with B<--sshlogin :> or when not used
+with B<--sshlogin>.
+
+For details on transferring see B<--transferfile>.
+
+See also: B<--transfer> B<--transferfile> B<--sshlogin> B<--cleanup>
+B<--workdir>
+
+
+=item B<--round-robin>
+
+=item B<--round>
+
+Distribute chunks of standard input in a round robin fashion.
+
+Normally B<--pipe> will give a single block to each instance of the
+command. With B<--round-robin> all blocks will at random be written to
+commands already running. This is useful if the command takes a long
+time to initialize.
+
+B<--keep-order> will not work with B<--round-robin> as it is
+impossible to track which input block corresponds to which output.
+
+B<--round-robin> implies B<--pipe>, except if B<--pipe-part> is given.
+
+See the section: SPREADING BLOCKS OF DATA.
+
+See also: B<--bin> B<--group-by> B<--shard>
+
+
+=item B<--rpl> 'I<tag> I<perl expression>'
+
+Define replacement string.
+
+Use I<tag> as a replacement string for I<perl expression>. This makes
+it possible to define your own replacement strings. GNU B<parallel>'s
+7 replacement strings are implemented as:
+
+  --rpl '{} '
+  --rpl '{#} 1 $_=$job->seq()'
+  --rpl '{%} 1 $_=$job->slot()'
+  --rpl '{/} s:.*/::'
+  --rpl '{//} $Global::use{"File::Basename"} ||=
+              eval "use File::Basename; 1;"; $_ = dirname($_);'
+  --rpl '{/.} s:.*/::; s:\.[^/.]+$::;'
+  --rpl '{.} s:\.[^/.]+$::'
+
+The B<--plus> replacement strings are implemented as:
+
+  --rpl '{+/} s:/[^/]*$:: || s:.*$::'
+  --rpl '{+.} s:.*\.:: || s:.*$::'
+  --rpl '{+..} s:.*\.([^/.]+\.[^/.]+)$:$1: || s:.*$::'
+  --rpl '{+...} s:.*\.([^/.]+\.[^/.]+\.[^/.]+)$:$1: || s:.*$::'
+  --rpl '{..} s:\.[^/.]+\.[^/.]+$::'
+  --rpl '{...} s:\.[^/.]+\.[^/.]+\.[^/.]+$::'
+  --rpl '{/..} s:.*/::; s:\.[^/.]+\.[^/.]+$::'
+  --rpl '{/...} s:.*/::; s:\.[^/.]+\.[^/.]+\.[^/.]+$::'
+  --rpl '{choose_k}
+         for $t (2..$#arg){ if($arg[$t-1] ge $arg[$t]) { skip() } }'
+  --rpl '{##} 1 $_=total_jobs()'
+  --rpl '{0%} 1 $f=1+int((log($Global::max_jobs_running||1)/
+                          log(10))); $_=sprintf("%0${f}d",slot())'
+  --rpl '{0#} 1 $f=1+int((log(total_jobs())/log(10)));
+              $_=sprintf("%0${f}d",seq())'
+
+  --rpl '{:-([^}]+?)} $_ ||= $$1'
+  --rpl '{:(\d+?)} substr($_,0,$$1) = ""'
+  --rpl '{:(\d+?):(\d+?)} $_ = substr($_,$$1,$$2);'
+  --rpl '{#([^#}][^}]*?)} $nongreedy=::make_regexp_ungreedy($$1);
+                          s/^$nongreedy(.*)/$1/;'
+  --rpl '{##([^#}][^}]*?)} s/^$$1//;'
+  --rpl '{%([^}]+?)} $nongreedy=::make_regexp_ungreedy($$1);
+                     s/(.*)$nongreedy$/$1/;'
+  --rpl '{%%([^}]+?)} s/$$1$//;'
+  --rpl '{/([^}]+?)/([^}]*?)} s/$$1/$$2/;'
+  --rpl '{^([^}]+?)} s/^($$1)/uc($1)/e;'
+  --rpl '{^^([^}]+?)} s/($$1)/uc($1)/eg;'
+  --rpl '{,([^}]+?)} s/^($$1)/lc($1)/e;'
+  --rpl '{,,([^}]+?)} s/($$1)/lc($1)/eg;'
+
+  --rpl '{slot} 1 $_="\${PARALLEL_JOBSLOT}";uq()'
+  --rpl '{host} 1 $_="\${PARALLEL_SSHHOST}";uq()'
+  --rpl '{sshlogin} 1 $_="\${PARALLEL_SSHLOGIN}";uq()'
+  --rpl '{hgrp} 1 $_="\${PARALLEL_HOSTGROUPS}";uq()'
+  --rpl '{agrp} 1 $_="\${PARALLEL_ARGHOSTGROUPS}";uq()'
+
+If the user defined replacement string starts with '{' it can also be
+used as a positional replacement string (like B<{2.}>).
+
+It is recommended to only change $_ but you have full access to all
+of GNU B<parallel>'s internal functions and data structures.
+
+Here are a few examples:
+
+  Is the job sequence even or odd?
+  --rpl '{odd} $_ = seq() % 2 ? "odd" : "even"'
+  Pad job sequence with leading zeros to get equal width
+  --rpl '{0#} $f=1+int("".(log(total_jobs())/log(10)));
+    $_=sprintf("%0${f}d",seq())'
+  Job sequence counting from 0
+  --rpl '{#0} $_ = seq() - 1'
+  Job slot counting from 2
+  --rpl '{%1} $_ = slot() + 1'
+  Remove all extensions
+  --rpl '{:} s:(\.[^/]+)*$::'
+
+You can have dynamic replacement strings by including parenthesis in
+the replacement string and adding a regular expression between the
+parenthesis. The matching string will be inserted as $$1:
+
+  parallel --rpl '{%(.*?)} s/$$1//' echo {%.tar.gz} ::: my.tar.gz
+  parallel --rpl '{:%(.+?)} s:$$1(\.[^/]+)*$::' \
+    echo {:%_file} ::: my_file.tar.gz
+  parallel -n3 --rpl '{/:%(.*?)} s:.*/(.*)$$1(\.[^/]+)*$:$1:' \
+    echo job {#}: {2} {2.} {3/:%_1} ::: a/b.c c/d.e f/g_1.h.i
+
+You can even use multiple matches:
+
+  parallel --rpl '{/(.+?)/(.*?)} s/$$1/$$2/;'
+    echo {/replacethis/withthis} {/b/C} ::: a_replacethis_b
+
+  parallel --rpl '{(.*?)/(.*?)} $_="$$2$_$$1"' \
+    echo {swap/these} ::: -middle-
+
+See also: B<{=>I<perl expression>B<=}> B<--parens>
+
+
+=item B<--rsync-opts> I<options>
+
+Options to pass on to B<rsync>.
+
+Setting B<--rsync-opts> takes precedence over setting the environment
+variable $PARALLEL_RSYNC_OPTS.
+
+
+=item B<--max-chars> I<max-chars>
+
+=item B<-s> I<max-chars>
+
+Limit length of command.
+
+Use at most I<max-chars> characters per command line, including the
+command and initial-arguments and the terminating nulls at the ends of
+the argument strings.  The largest allowed value is system-dependent,
+and is calculated as the argument length limit for exec, less the size
+of your environment.  The default value is the maximum.
+
+I<max-chars> can be postfixed with K, M, G, T, P, k, m, g, t, or p
+(see UNIT PREFIX).
+
+Implies B<-X> unless B<-m> or B<--xargs> is set.
+
+See also: B<-X> B<-m> B<--xargs> B<--max-line-length-allowed>
+B<--show-limits>
+
+
+=item B<--show-limits>
+
+Display limits given by the operating system.
+
+Display the limits on the command-line length which are imposed by the
+operating system and the B<-s> option.  Pipe the input from /dev/null
+(and perhaps specify --no-run-if-empty) if you don't want GNU B<parallel>
+to do anything.
+
+See also: B<--max-chars> B<--max-line-length-allowed> B<--version>
+
+
+=item B<--semaphore>
+
+Work as a counting semaphore.
+
+B<--semaphore> will cause GNU B<parallel> to start I<command> in the
+background. When the number of jobs given by B<--jobs> is reached, GNU
+B<parallel> will wait for one of these to complete before starting
+another command.
+
+B<--semaphore> implies B<--bg> unless B<--fg> is specified.
+
+The command B<sem> is an alias for B<parallel --semaphore>.
+
+See also: B<man sem> B<--bg> B<--fg> B<--semaphore-name>
+B<--semaphore-timeout> B<--wait>
+
+
+=item B<--semaphore-name> I<name>
+
+=item B<--id> I<name>
+
+Use B<name> as the name of the semaphore.
+
+The default is the name of the controlling tty (output from B<tty>).
+
+The default normally works as expected when used interactively, but
+when used in a script I<name> should be set. I<$$> or I<my_task_name>
+are often a good value.
+
+The semaphore is stored in ~/.parallel/semaphores/
+
+Implies B<--semaphore>.
+
+See also: B<man sem> B<--semaphore>
+
+
+=item B<--semaphore-timeout> I<secs>
+
+=item B<--st> I<secs>
+
+If I<secs> > 0: If the semaphore is not released within I<secs>
+seconds, take it anyway.
+
+If I<secs> < 0: If the semaphore is not released within I<secs>
+seconds, exit.
+
+I<secs> is in seconds, but can be postfixed with s, m, h, or d (see
+the section TIME POSTFIXES).
+
+Implies B<--semaphore>.
+
+See also: B<man sem>
+
+
+=item B<--seqreplace> I<replace-str>
+
+Use the replacement string I<replace-str> instead of B<{#}> for
+job sequence number.
+
+See also: B<{#}>
+
+
+=item B<--session>
+
+Record names in current environment in B<$PARALLEL_IGNORED_NAMES> and
+exit.
+
+Only used with B<env_parallel>. Aliases, functions, and variables with
+names in B<$PARALLEL_IGNORED_NAMES> will not be copied.  So you should
+set variables/function you want copied I<after> running B<--session>.
+
+It is similar to B<--record-env>, but only for this session.
+
+Only supported in B<Ash, Bash, Dash, Ksh, Sh, and Zsh>.
+
+See also: B<--env> B<--record-env> B<env_parallel>
+
+
+=item B<--shard> I<shardexpr>
+
+Use I<shardexpr> as shard key and shard input to the jobs.
+
+I<shardexpr> is [column number|column name] [perlexpression] e.g.:
+
+  3
+  Address
+  3 $_%=100
+  Address s/\d//g
+
+Each input line is split using B<--colsep>. The value of the column is
+put into $_, the perl expression is executed, the resulting value is
+hashed so that all lines of a given value is given to the same job
+slot.
+
+This is similar to sharding in databases.
+
+The performance is in the order of 100K rows per second. Faster if the
+I<shardcol> is small (<10), slower if it is big (>100).
+
+B<--shard> requires B<--pipe> and a fixed numeric value for B<--jobs>.
+
+See the section: SPREADING BLOCKS OF DATA.
+
+See also: B<--bin> B<--group-by> B<--round-robin>
+
+
+=item B<--shebang>
+
+=item B<--hashbang>
+
+GNU B<parallel> can be called as a shebang (#!) command as the first
+line of a script. The content of the file will be treated as
+inputsource.
+
+Like this:
+
+  #!/usr/bin/parallel --shebang -r wget
+
+  https://ftpmirror.gnu.org/parallel/parallel-20120822.tar.bz2
+  https://ftpmirror.gnu.org/parallel/parallel-20130822.tar.bz2
+  https://ftpmirror.gnu.org/parallel/parallel-20140822.tar.bz2
+
+B<--shebang> must be set as the first option.
+
+On FreeBSD B<env> is needed:
+
+  #!/usr/bin/env -S parallel --shebang -r wget
+
+  https://ftpmirror.gnu.org/parallel/parallel-20120822.tar.bz2
+  https://ftpmirror.gnu.org/parallel/parallel-20130822.tar.bz2
+  https://ftpmirror.gnu.org/parallel/parallel-20140822.tar.bz2
+
+There are many limitations of shebang (#!) depending on your operating
+system. See details on https://www.in-ulm.de/~mascheck/various/shebang/
+
+See also: B<--shebang-wrap>
+
+
+=item B<--shebang-wrap>
+
+GNU B<parallel> can parallelize scripts by wrapping the shebang
+line. If the program can be run like this:
+
+  cat arguments | parallel the_program
+
+then the script can be changed to:
+
+  #!/usr/bin/parallel --shebang-wrap /original/parser --options
+
+E.g.
+
+  #!/usr/bin/parallel --shebang-wrap /usr/bin/python
+
+If the program can be run like this:
+
+  cat data | parallel --pipe the_program
+
+then the script can be changed to:
+
+  #!/usr/bin/parallel --shebang-wrap --pipe /orig/parser --opts
+
+E.g.
+
+  #!/usr/bin/parallel --shebang-wrap --pipe /usr/bin/perl -w
+
+B<--shebang-wrap> must be set as the first option.
+
+See also: B<--shebang>
+
+
+=item B<--shell-completion> I<shell>
+
+Generate shell completion code for interactive shells.
+
+Supported shells: bash zsh.
+
+Use I<auto> as I<shell> to automatically detect running shell.
+
+Activate the completion code with:
+
+  zsh% eval "$(parallel --shell-completion auto)"
+  bash$ eval "$(parallel --shell-completion auto)"
+
+Or put this `/usr/share/zsh/site-functions/_parallel`, then `compinit`
+to generate `~/.zcompdump`:
+
+  #compdef parallel
+  
+  (( $+functions[_comp_parallel] )) ||
+    eval "$(parallel --shell-completion auto)" &&
+    _comp_parallel
+
+
+=item B<--shell-quote>
+
+Does not run the command but quotes it. Useful for making quoted
+composed commands for GNU B<parallel>.
+
+Multiple B<--shell-quote> with quote the string multiple times, so
+B<parallel --shell-quote | parallel --shell-quote> can be written as
+B<parallel --shell-quote --shell-quote>.
+
+See also: B<--quote>
+
+
+=item B<--shuf>
+
+Shuffle jobs.
+
+When having multiple input sources it is hard to randomize
+jobs. B<--shuf> will generate all jobs, and shuffle them before
+running them. This is useful to get a quick preview of the results
+before running the full batch.
+
+Combined with B<--halt soon,done=1%> you can run a random 1% sample of
+all jobs:
+
+  parallel --shuf --halt soon,done=1% echo ::: {1..100} ::: {1..100}
+
+See also: B<--halt>
+
+
+=item B<--skip-first-line>
+
+Do not use the first line of input (used by GNU B<parallel> itself
+when called with B<--shebang>).
+
+
+=item B<--sql> I<DBURL> (obsolete)
+
+Use B<--sql-master> instead.
+
+
+=item B<--sql-master> I<DBURL>
+
+Submit jobs via SQL server. I<DBURL> must point to a table, which will
+contain the same information as B<--joblog>, the values from the input
+sources (stored in columns V1 .. Vn), and the output (stored in
+columns Stdout and Stderr).
+
+If I<DBURL> is prepended with '+' GNU B<parallel> assumes the table is
+already made with the correct columns and appends the jobs to it.
+
+If I<DBURL> is not prepended with '+' the table will be dropped and
+created with the correct amount of V-columns unless
+
+B<--sqlmaster> does not run any jobs, but it creates the values for
+the jobs to be run. One or more B<--sqlworker> must be run to actually
+execute the jobs.
+
+If B<--wait> is set, GNU B<parallel> will wait for the jobs to
+complete.
+
+The format of a DBURL is:
+
+  [sql:]vendor://[[user][:pwd]@][host][:port]/[db]/table
+
+E.g.
+
+  sql:mysql://hr:hr@localhost:3306/hrdb/jobs
+  mysql://scott:tiger@my.example.com/pardb/paralleljobs
+  sql:oracle://scott:tiger@ora.example.com/xe/parjob
+  postgresql://scott:tiger@pg.example.com/pgdb/parjob
+  pg:///parjob
+  sqlite3:///%2Ftmp%2Fpardb.sqlite/parjob
+  csv:///%2Ftmp%2Fpardb/parjob
+
+Notice how / in the path of sqlite and CVS must be encoded as
+%2F. Except the last / in CSV which must be a /.
+
+It can also be an alias from ~/.sql/aliases:
+
+  :myalias mysql:///mydb/paralleljobs
+
+See also: B<--sql-and-worker> B<--sql-worker> B<--joblog>
+
+
+=item B<--sql-and-worker> I<DBURL>
+
+Shorthand for: B<--sql-master> I<DBURL> B<--sql-worker> I<DBURL>.
+
+See also: B<--sql-master> B<--sql-worker>
+
+
+=item B<--sql-worker> I<DBURL>
+
+Execute jobs via SQL server. Read the input sources variables from the
+table pointed to by I<DBURL>. The I<command> on the command line
+should be the same as given by B<--sqlmaster>.
+
+If you have more than one B<--sqlworker> jobs may be run more than
+once.
+
+If B<--sqlworker> runs on the local machine, the hostname in the SQL
+table will not be ':' but instead the hostname of the machine.
+
+See also: B<--sql-master> B<--sql-and-worker>
+
+
+=item B<--ssh> I<sshcommand>
+
+GNU B<parallel> defaults to using B<ssh> for remote access. This can
+be overridden with B<--ssh>. It can also be set on a per server
+basis with B<--sshlogin>.
+
+See also: B<--sshlogin>
+
+
+=item B<--ssh-delay> I<duration>
+
+Delay starting next ssh by I<duration>.
+
+GNU B<parallel> will not start another ssh for the next I<duration>.
+
+I<duration> is in seconds, but can be postfixed with s, m, h, or d.
+
+See also: TIME POSTFIXES B<--sshlogin> B<--delay>
+
+
+=item B<--sshlogin> I<[@hostgroups/][ncpus/]sshlogin[,[@hostgroups/][ncpus/]sshlogin[,...]]> (alpha testing)
+
+=item B<--sshlogin> I<@hostgroup> (alpha testing)
+
+=item B<-S> I<[@hostgroups/][ncpus/]sshlogin[,[@hostgroups/][ncpus/]sshlogin[,...]]> (alpha testing)
+
+=item B<-S> I<@hostgroup> (alpha testing)
+
+Distribute jobs to remote computers.
+
+The jobs will be run on a list of remote computers.
+
+If I<hostgroups> is given, the I<sshlogin> will be added to that
+hostgroup. Multiple hostgroups are separated by '+'. The I<sshlogin>
+will always be added to a hostgroup named the same as I<sshlogin>.
+
+If only the I<@hostgroup> is given, only the sshlogins in that
+hostgroup will be used. Multiple I<@hostgroup> can be given.
+
+GNU B<parallel> will determine the number of CPUs on the remote
+computers and run the number of jobs as specified by B<-j>.  If the
+number I<ncpus> is given GNU B<parallel> will use this number for
+number of CPUs on the host. Normally I<ncpus> will not be
+needed.
+
+An I<sshlogin> is of the form:
+
+  [sshcommand [options]] [username[:password]@]hostname
+
+If I<password> is given, B<sshpass> will be used. Otherwise the
+sshlogin must not require a password (B<ssh-agent> and B<ssh-copy-id>
+may help with that).
+
+If the hostname is an IPv6 address, the port can be given separated
+with p or #. If the address is enclosed in [] you can also use :.
+E.g. ::1p2222 ::1#2222 [::1]:2222
+
+The sshlogin ':' is special, it means 'no ssh' and will therefore run
+on the local computer.
+
+The sshlogin '..' is special, it read sshlogins from ~/.parallel/sshloginfile or
+$XDG_CONFIG_HOME/parallel/sshloginfile
+
+The sshlogin '-' is special, too, it read sshlogins from stdin
+(standard input).
+
+To specify more sshlogins separate the sshlogins by comma, newline (in
+the same string), or repeat the options multiple times.
+
+GNU B<parallel> splits on , (comma) so if your sshlogin contains ,
+(comma) you need to replace it with \, or ,,
+
+For examples: see B<--sshloginfile>.
+
+The remote host must have GNU B<parallel> installed.
+
+B<--sshlogin> is known to cause problems with B<-m> and B<-X>.
+
+See also: B<--basefile> B<--transferfile> B<--return> B<--cleanup>
+B<--trc> B<--sshloginfile> B<--workdir> B<--filter-hosts>
+B<--ssh>
+
+
+=item B<--sshloginfile> I<filename>
+
+=item B<--slf> I<filename>
+
+File with sshlogins. The file consists of sshlogins on separate
+lines. Empty lines and lines starting with '#' are ignored. Example:
+
+  server.example.com
+  username@server2.example.com
+  8/my-8-cpu-server.example.com
+  2/my_other_username@my-dualcore.example.net
+  # This server has SSH running on port 2222
+  ssh -p 2222 server.example.net
+  4/ssh -p 2222 quadserver.example.net
+  # Use a different ssh program
+  myssh -p 2222 -l myusername hexacpu.example.net
+  # Use a different ssh program with default number of CPUs
+  //usr/local/bin/myssh -p 2222 -l myusername hexacpu
+  # Use a different ssh program with 6 CPUs
+  6//usr/local/bin/myssh -p 2222 -l myusername hexacpu
+  # Assume 16 CPUs on the local computer
+  16/:
+  # Put server1 in hostgroup1
+  @hostgroup1/server1
+  # Put myusername@server2 in hostgroup1+hostgroup2
+  @hostgroup1+hostgroup2/myusername@server2
+  # Force 4 CPUs and put 'ssh -p 2222 server3' in hostgroup1
+  @hostgroup1/4/ssh -p 2222 server3
+
+When using a different ssh program the last argument must be the hostname.
+
+Multiple B<--sshloginfile> are allowed.
+
+GNU B<parallel> will first look for the file in current dir; if that
+fails it look for the file in ~/.parallel.
+
+The sshloginfile '..' is special, it read sshlogins from
+~/.parallel/sshloginfile
+
+The sshloginfile '.' is special, it read sshlogins from
+/etc/parallel/sshloginfile
+
+The sshloginfile '-' is special, too, it read sshlogins from stdin
+(standard input).
+
+If the sshloginfile is changed it will be re-read when a job finishes
+though at most once per second. This makes it possible to add and
+remove hosts while running.
+
+This can be used to have a daemon that updates the sshloginfile to
+only contain servers that are up:
+
+    cp original.slf tmp2.slf
+    while [ 1 ] ; do
+      nice parallel --nonall -j0 -k --slf original.slf \
+        --tag echo | perl 's/\t$//' > tmp.slf
+      if diff tmp.slf tmp2.slf; then
+        mv tmp.slf tmp2.slf
+      fi
+      sleep 10
+    done &
+    parallel --slf tmp2.slf ...
+
+See also: B<--filter-hosts>
+
+
+=item B<--slotreplace> I<replace-str>
+
+Use the replacement string I<replace-str> instead of B<{%}> for
+job slot number.
+
+See also: B<{%}>
+
+
+=item B<--silent>
+
+Silent.
+
+The job to be run will not be printed. This is the default.  Can be
+reversed with B<-v>.
+
+See also: B<-v>
+
+
+=item B<--template> I<file>=I<repl>
+
+=item B<--tmpl> I<file>=I<repl>
+
+Replace replacement strings in I<file> and save it in I<repl>.
+
+All replacement strings in the contents of I<file> will be
+replaced. All replacement strings in the name I<repl> will be
+replaced.
+
+With B<--cleanup> the new file will be removed when the job is done.
+
+If I<my.tmpl> contains this:
+
+  Xval: {x}
+  Yval: {y}
+  FixedValue: 9
+  # x with 2 decimals
+  DecimalX: {=x $_=sprintf("%.2f",$_) =}
+  TenX: {=x $_=$_*10 =}
+  RandomVal: {=1 $_=rand() =}
+
+it can be used like this:
+
+  myprog() { echo Using "$@"; cat "$@"; }
+  export -f myprog
+  parallel --cleanup --header : --tmpl my.tmpl={#}.t myprog {#}.t \
+    ::: x 1.234 2.345 3.45678 ::: y 1 2 3
+
+See also: B<{}> B<--cleanup>
+
+
+=item B<--tty>
+
+Open terminal tty.
+
+If GNU B<parallel> is used for starting a program that accesses the
+tty (such as an interactive program) then this option may be
+needed. It will default to starting only one job at a time
+(i.e. B<-j1>), not buffer the output (i.e. B<-u>), and it will open a
+tty for the job.
+
+You can of course override B<-j1> and B<-u>.
+
+Using B<--tty> unfortunately means that GNU B<parallel> cannot kill
+the jobs (with B<--timeout>, B<--memfree>, or B<--halt>). This is due
+to GNU B<parallel> giving each child its own process group, which is
+then killed. Process groups are dependant on the tty.
+
+See also: B<--ungroup> B<--open-tty>
+
+
+=item B<--tag> (alpha testing)
+
+Tag lines with arguments.
+
+Each output line will be prepended with the arguments and TAB
+(\t). When combined with B<--onall> or B<--nonall> the lines will be
+prepended with the sshlogin instead.
+
+B<--tag> is ignored when using B<-u>.
+
+See also: B<--tagstring> B<--ctag>
+
+
+=item B<--tagstring> I<str> (alpha testing)
+
+Tag lines with a string.
+
+Each output line will be prepended with I<str> and TAB (\t). I<str>
+can contain replacement strings such as B<{}>.
+
+B<--tagstring> is ignored when using B<-u>, B<--onall>, and B<--nonall>.
+
+See also: B<--tag> B<--ctagstring>
+
+
+=item B<--tee>
+
+Pipe all data to all jobs.
+
+Used with B<--pipe>/B<--pipe-part> and B<:::>.
+
+  seq 1000 | parallel --pipe --tee -v wc {} ::: -w -l -c
+
+How many numbers in 1..1000 contain 0..9, and how many bytes do they
+fill:
+
+  seq 1000 | parallel --pipe --tee --tag \
+    'grep {1} | wc {2}' ::: {0..9} ::: -l -c
+
+How many words contain a..z and how many bytes do they fill?
+
+  parallel -a /usr/share/dict/words --pipe-part --tee --tag \
+    'grep {1} | wc {2}' ::: {a..z} ::: -l -c
+
+See also: B<:::> B<--pipe> B<--pipe-part>
+
+
+=item B<--term-seq> I<sequence>
+
+Termination sequence.
+
+When a job is killed due to B<--timeout>, B<--memfree>, B<--halt>, or
+abnormal termination of GNU B<parallel>, I<sequence> determines how
+the job is killed. The default is:
+
+    TERM,200,TERM,100,TERM,50,KILL,25
+
+which sends a TERM signal, waits 200 ms, sends another TERM signal,
+waits 100 ms, sends another TERM signal, waits 50 ms, sends a KILL
+signal, waits 25 ms, and exits. GNU B<parallel> detects if a process
+dies before the waiting time is up.
+
+See also: B<--halt> B<--timeout> B<--memfree>
+
+
+=item B<--total-jobs> I<jobs> (alpha testing)
+
+=item B<--total> I<jobs> (alpha testing)
+
+Provide the total number of jobs for computing ETA which is also used
+for B<--bar>.
+
+Without B<--total-jobs> GNU Parallel will read all jobs before
+starting a job. B<--total-jobs> is useful if the input is generated
+slowly.
+
+See also: B<--bar> B<--eta>
+
+
+=item B<--tmpdir> I<dirname>
+
+Directory for temporary files.
+
+GNU B<parallel> normally buffers output into temporary files in
+/tmp. By setting B<--tmpdir> you can use a different dir for the
+files. Setting B<--tmpdir> is equivalent to setting $TMPDIR.
+
+See also: B<--compress> B<$TMPDIR> B<$PARALLEL_REMOTE_TMPDIR>
+
+
+=item B<--tmux> (Long beta testing)
+
+Use B<tmux> for output. Start a B<tmux> session and run each job in a
+window in that session. No other output will be produced.
+
+See also: B<--tmuxpane>
+
+
+=item B<--tmuxpane> (Long beta testing)
+
+Use B<tmux> for output but put output into panes in the first window.
+Useful if you want to monitor the progress of less than 100 concurrent
+jobs.
+
+See also: B<--tmux>
+
+
+=item B<--timeout> I<duration>
+
+Time out for command. If the command runs for longer than I<duration>
+seconds it will get killed as per B<--term-seq>.
+
+If I<duration> is followed by a % then the timeout will dynamically be
+computed as a percentage of the median average runtime of successful
+jobs. Only values > 100% will make sense.
+
+I<duration> is in seconds, but can be postfixed with s, m, h, or d.
+
+See also: TIME POSTFIXES B<--term-seq> B<--retries>
+
+
+=item B<--verbose>
+
+=item B<-t>
+
+Print the job to be run on stderr (standard error).
+
+See also: B<-v> B<--interactive>
+
+
+=item B<--transfer>
+
+Transfer files to remote computers.
+
+Shorthand for: B<--transferfile {}>.
+
+See also: B<--transferfile>.
+
+
+=item B<--transferfile> I<filename>
+
+=item B<--tf> I<filename>
+
+Transfer I<filename> to remote computers.
+
+B<--transferfile> is used with B<--sshlogin> to transfer files to the
+remote computers. The files will be transferred using B<rsync> and
+will be put relative to the work dir.
+
+The I<filename> will normally contain a replacement string.
+
+If the path contains /./ the remaining path will be relative to the
+work dir (for details: see B<rsync>). If the work dir is
+B</home/user>, the transferring will be as follows:
+
+  /tmp/foo/bar   => /tmp/foo/bar
+  tmp/foo/bar    => /home/user/tmp/foo/bar
+  /tmp/./foo/bar => /home/user/foo/bar
+  tmp/./foo/bar  => /home/user/foo/bar
+
+I<Examples>
+
+This will transfer the file I<foo/bar.txt> to the computer
+I<server.example.com> to the file I<$HOME/foo/bar.txt> before running
+B<wc foo/bar.txt> on I<server.example.com>:
+
+  echo foo/bar.txt | parallel --transferfile {} \
+    --sshlogin server.example.com wc
+
+This will transfer the file I</tmp/foo/bar.txt> to the computer
+I<server.example.com> to the file I</tmp/foo/bar.txt> before running
+B<wc /tmp/foo/bar.txt> on I<server.example.com>:
+
+  echo /tmp/foo/bar.txt | parallel --transferfile {} \
+    --sshlogin server.example.com wc
+
+This will transfer the file I</tmp/foo/bar.txt> to the computer
+I<server.example.com> to the file I<foo/bar.txt> before running
+B<wc ./foo/bar.txt> on I<server.example.com>:
+
+  echo /tmp/./foo/bar.txt | parallel --transferfile {} \
+    --sshlogin server.example.com wc {= s:.*/\./:./: =}
+
+B<--transferfile> is often used with B<--return> and B<--cleanup>. A
+shorthand for B<--transferfile {}> is B<--transfer>.
+
+B<--transferfile> is ignored when used with B<--sshlogin :> or when
+not used with B<--sshlogin>.
+
+See also: B<--workdir> B<--sshlogin> B<--basefile> B<--return>
+B<--cleanup>
+
+
+=item B<--trc> I<filename>
+
+Transfer, Return, Cleanup. Shorthand for: B<--transfer> B<--return>
+I<filename> B<--cleanup>
+
+See also: B<--transfer> B<--return> B<--cleanup>
+
+
+=item B<--trim> <n|l|r|lr|rl>
+
+Trim white space in input.
+
+=over 4
+
+=item n
+
+No trim. Input is not modified. This is the default.
+
+=item l
+
+Left trim. Remove white space from start of input. E.g. " a bc " -> "a bc ".
+
+=item r
+
+Right trim. Remove white space from end of input. E.g. " a bc " -> " a bc".
+
+=item lr
+
+=item rl
+
+Both trim. Remove white space from both start and end of input. E.g. "
+a bc " -> "a bc". This is the default if B<--colsep> is used.
+
+=back
+
+See also: B<--no-run-if-empty> B<{}> B<--colsep>
+
+
+=item B<--ungroup>
+
+=item B<-u>
+
+Ungroup output.
+
+Output is printed as soon as possible and bypasses GNU B<parallel>
+internal processing. This may cause output from different commands to
+be mixed thus should only be used if you do not care about the
+output. Compare these:
+
+  seq 4 | parallel -j0 \
+    'sleep {};echo -n start{};sleep {};echo {}end'
+  seq 4 | parallel -u -j0 \
+    'sleep {};echo -n start{};sleep {};echo {}end'
+
+It also disables B<--tag>. GNU B<parallel> outputs faster with
+B<-u>. Compare the speeds of these:
+
+  parallel seq ::: 300000000 >/dev/null
+  parallel -u seq ::: 300000000 >/dev/null
+  parallel --line-buffer seq ::: 300000000 >/dev/null
+
+Can be reversed with B<--group>.
+
+See also: B<--line-buffer> B<--group>
+
+
+=item B<--extensionreplace> I<replace-str>
+
+=item B<--er> I<replace-str>
+
+Use the replacement string I<replace-str> instead of B<{.}> for input
+line without extension.
+
+See also: B<{.}>
+
+
+=item B<--use-sockets-instead-of-threads>
+
+See also: B<--use-cores-instead-of-threads>
+
+
+=item B<--use-cores-instead-of-threads>
+
+=item B<--use-cpus-instead-of-cores> (obsolete)
+
+Determine how GNU B<parallel> counts the number of CPUs.
+
+GNU B<parallel> uses this number when the number of jobslots
+(B<--jobs>) is computed relative to the number of CPUs (e.g. 100% or
++1).
+
+CPUs can be counted in three different ways:
+
+=over 8
+
+=item sockets
+
+The number of filled CPU sockets (i.e. the number of physical chips).
+
+=item cores
+
+The number of physical cores (i.e. the number of physical compute
+cores).
+
+=item threads
+
+The number of hyperthreaded cores (i.e. the number of virtual
+cores - with some of them possibly being hyperthreaded)
+
+=back
+
+Normally the number of CPUs is computed as the number of CPU
+threads. With B<--use-sockets-instead-of-threads> or
+B<--use-cores-instead-of-threads> you can force it to be computed as
+the number of filled sockets or number of cores instead.
+
+Most users will not need these options.
+
+B<--use-cpus-instead-of-cores> is a (misleading) alias for
+B<--use-sockets-instead-of-threads> and is kept for backwards
+compatibility.
+
+See also: B<--number-of-threads> B<--number-of-cores>
+B<--number-of-sockets>
+
+
+=item B<-v>
+
+Verbose.
+
+Print the job to be run on stdout (standard output). Can be reversed
+with B<--silent>.
+
+Use B<-v> B<-v> to print the wrapping ssh command when running remotely.
+
+See also: B<-t>
+
+
+=item B<--version>
+
+=item B<-V>
+
+Print the version GNU B<parallel> and exit.
+
+
+=item B<--workdir> I<mydir>
+
+=item B<--wd> I<mydir>
+
+Jobs will be run in the dir I<mydir>. The default is the current dir
+for the local machine, and the login dir for remote computers.
+
+Files transferred using B<--transferfile> and B<--return> will be
+relative to I<mydir> on remote computers.
+
+The special I<mydir> value B<...> will create working dirs under
+B<~/.parallel/tmp/>. If B<--cleanup> is given these dirs will be
+removed.
+
+The special I<mydir> value B<.> uses the current working dir.  If the
+current working dir is beneath your home dir, the value B<.> is
+treated as the relative path to your home dir. This means that if your
+home dir is different on remote computers (e.g. if your login is
+different) the relative path will still be relative to your home dir.
+
+To see the difference try:
+
+  parallel -S server pwd ::: ""
+  parallel --wd . -S server pwd ::: ""
+  parallel --wd ... -S server pwd ::: ""
+
+I<mydir> can contain GNU B<parallel>'s replacement strings.
+
+
+=item B<--wait>
+
+Wait for all commands to complete.
+
+Used with B<--semaphore> or B<--sqlmaster>.
+
+See also: B<man sem>
+
+
+=item B<-X>
+
+Multiple arguments with context replace. Insert as many arguments as
+the command line length permits. If multiple jobs are being run in
+parallel: distribute the arguments evenly among the jobs. Use B<-j1>
+to avoid this.
+
+If B<{}> is not used the arguments will be appended to the line.  If
+B<{}> is used as part of a word (like I<pic{}.jpg>) then the whole
+word will be repeated. If B<{}> is used multiple times each B<{}> will
+be replaced with the arguments.
+
+Normally B<-X> will do the right thing, whereas B<-m> can give
+unexpected results if B<{}> is used as part of a word.
+
+Support for B<-X> with B<--sshlogin> is limited and may fail.
+
+See also: B<-m>
+
+
+=item B<--exit>
+
+=item B<-x>
+
+Exit if the size (see the B<-s> option) is exceeded.
+
+
+=item B<--xargs>
+
+Multiple arguments. Insert as many arguments as the command line
+length permits.
+
+If B<{}> is not used the arguments will be appended to the
+line.  If B<{}> is used multiple times each B<{}> will be replaced
+with all the arguments.
+
+Support for B<--xargs> with B<--sshlogin> is limited and may fail.
+
+See also: B<-X>
+
+
+=back
+
+
+=head1 EXAMPLES
+
+See: B<man parallel_examples>
+
+
+=head1 SPREADING BLOCKS OF DATA
+
+B<--round-robin>, B<--pipe-part>, B<--shard>, B<--bin> and
+B<--group-by> are all specialized versions of B<--pipe>.
+
+In the following I<n> is the number of jobslots given by B<--jobs>. A
+record starts with B<--recstart> and ends with B<--recend>. It is
+typically a full line. A chunk is a number of full records that is
+approximately the size of a block. A block can contain half records, a
+chunk cannot.
+
+B<--pipe> starts one job per chunk. It reads blocks from stdin
+(standard input). It finds a record end near a block border and passes
+a chunk to the program.
+
+B<--pipe-part> starts one job per chunk - just like normal
+B<--pipe>. It first finds record endings near all block borders in the
+file and then starts the jobs. By using B<--block -1> it will set the
+block size to size-of-file/I<n>. Used this way it will start I<n>
+jobs in total.
+
+B<--round-robin> starts I<n> jobs in total. It reads a block and
+passes a chunk to whichever job is ready to read. It does not parse
+the content except for identifying where a record ends to make sure it
+only passes full records.
+
+B<--shard> starts I<n> jobs in total. It parses each line to read the
+value in the given column. Based on this value the line is passed to
+one of the I<n> jobs. All lines having this value will be given to the
+same jobslot.
+
+B<--bin> works like B<--shard> but the value of the column is the
+jobslot number it will be passed to. If the value is bigger than I<n>,
+then I<n> will be subtracted from the value until the values is
+smaller than or equal to I<n>.
+
+B<--group-by> starts one job per chunk. Record borders are not given
+by B<--recend>/B<--recstart>. Instead a record is defined by a number
+of lines having the same value in a given column. So the value of a
+given column changes at a chunk border. With B<--pipe> every line is
+parsed, with B<--pipe-part> only a few lines are parsed to find the
+chunk border.
+
+B<--group-by> can be combined with B<--round-robin> or B<--pipe-part>.
+
+
+=head1 TIME POSTFIXES
+
+Arguments that give a duration are given in seconds, but can be
+expressed as floats postfixed with B<s>, B<m>, B<h>, or B<d> which
+would multiply the float by 1, 60, 60*60, or 60*60*24. Thus these are
+equivalent: 100000 and 1d3.5h16.6m4s.
+
+
+=head1 UNIT PREFIX
+
+Many numerical arguments in GNU B<parallel> can be postfixed with K,
+M, G, T, P, k, m, g, t, or p which would multiply the number with
+1024, 1048576, 1073741824, 1099511627776, 1125899906842624, 1000,
+1000000, 1000000000, 1000000000000, or 1000000000000000, respectively.
+
+You can even give it as a math expression. E.g. 1000000 can be written
+as 1M-12*2.024*2k.
+
+
+=head1 QUOTING
+
+GNU B<parallel> is very liberal in quoting. You only need to quote
+characters that have special meaning in shell:
+
+  ( ) $ ` ' " < > ; | \
+
+and depending on context these needs to be quoted, too:
+
+  ~ & # ! ? space * {
+
+Therefore most people will never need more quoting than putting '\'
+in front of the special characters.
+
+Often you can simply put \' around every ':
+
+  perl -ne '/^\S+\s+\S+$/ and print $ARGV,"\n"' file
+
+can be quoted:
+
+  parallel perl -ne \''/^\S+\s+\S+$/ and print $ARGV,"\n"'\' ::: file
+
+However, when you want to use a shell variable you need to quote the
+$-sign. Here is an example using $PARALLEL_SEQ. This variable is set
+by GNU B<parallel> itself, so the evaluation of the $ must be done by
+the sub shell started by GNU B<parallel>:
+
+  seq 10 | parallel -N2 echo seq:\$PARALLEL_SEQ arg1:{1} arg2:{2}
+
+If the variable is set before GNU B<parallel> starts you can do this:
+
+  VAR=this_is_set_before_starting
+  echo test | parallel echo {} $VAR
+
+Prints: B<test this_is_set_before_starting>
+
+It is a little more tricky if the variable contains more than one space in a row:
+
+  VAR="two  spaces  between  each  word"
+  echo test | parallel echo {} \'"$VAR"\'
+
+Prints: B<test two  spaces  between  each  word>
+
+If the variable should not be evaluated by the shell starting GNU
+B<parallel> but be evaluated by the sub shell started by GNU
+B<parallel>, then you need to quote it:
+
+  echo test | parallel VAR=this_is_set_after_starting \; echo {} \$VAR
+
+Prints: B<test this_is_set_after_starting>
+
+It is a little more tricky if the variable contains space:
+
+  echo test |\
+    parallel VAR='"two  spaces  between  each  word"' echo {} \'"$VAR"\'
+
+Prints: B<test two  spaces  between  each  word>
+
+$$ is the shell variable containing the process id of the shell. This
+will print the process id of the shell running GNU B<parallel>:
+
+  seq 10 | parallel echo $$
+
+And this will print the process ids of the sub shells started by GNU
+B<parallel>.
+
+  seq 10 | parallel echo \$\$
+
+If the special characters should not be evaluated by the sub shell
+then you need to protect it against evaluation from both the shell
+starting GNU B<parallel> and the sub shell:
+
+  echo test | parallel echo {} \\\$VAR
+
+Prints: B<test $VAR>
+
+GNU B<parallel> can protect against evaluation by the sub shell by
+using -q:
+
+  echo test | parallel -q echo {} \$VAR
+
+Prints: B<test $VAR>
+
+This is particularly useful if you have lots of quoting. If you want
+to run a perl script like this:
+
+  perl -ne '/^\S+\s+\S+$/ and print $ARGV,"\n"' file
+
+It needs to be quoted like one of these:
+
+  ls | parallel perl -ne '/^\\S+\\s+\\S+\$/\ and\ print\ \$ARGV,\"\\n\"'
+  ls | parallel perl -ne \''/^\S+\s+\S+$/ and print $ARGV,"\n"'\'
+
+Notice how spaces, \'s, "'s, and $'s need to be quoted. GNU
+B<parallel> can do the quoting by using option -q:
+
+  ls | parallel -q  perl -ne '/^\S+\s+\S+$/ and print $ARGV,"\n"'
+
+However, this means you cannot make the sub shell interpret special
+characters. For example because of B<-q> this WILL NOT WORK:
+
+  ls *.gz | parallel -q "zcat {} >{.}"
+  ls *.gz | parallel -q "zcat {} | bzip2 >{.}.bz2"
+
+because > and | need to be interpreted by the sub shell.
+
+If you get errors like:
+
+  sh: -c: line 0: syntax error near unexpected token
+  sh: Syntax error: Unterminated quoted string
+  sh: -c: line 0: unexpected EOF while looking for matching `''
+  sh: -c: line 1: syntax error: unexpected end of file
+  zsh:1: no matches found:
+
+then you might try using B<-q>.
+
+If you are using B<bash> process substitution like B<<(cat foo)> then
+you may try B<-q> and prepending I<command> with B<bash -c>:
+
+  ls | parallel -q bash -c 'wc -c <(echo {})'
+
+Or for substituting output:
+
+  ls | parallel -q bash -c \
+    'tar c {} | tee >(gzip >{}.tar.gz) | bzip2 >{}.tar.bz2'
+
+B<Conclusion>: If this is confusing consider avoiding having to deal
+with quoting by writing a small script or a function (remember to
+B<export -f> the function) and have GNU B<parallel> call that.
+
+
+=head1 LIST RUNNING JOBS
+
+If you want a list of the jobs currently running you can run:
+
+  killall -USR1 parallel
+
+GNU B<parallel> will then print the currently running jobs on stderr
+(standard error).
+
+
+=head1 COMPLETE RUNNING JOBS BUT DO NOT START NEW JOBS
+
+If you regret starting a lot of jobs you can simply break GNU B<parallel>,
+but if you want to make sure you do not have half-completed jobs you
+should send the signal B<SIGHUP> to GNU B<parallel>:
+
+  killall -HUP parallel
+
+This will tell GNU B<parallel> to not start any new jobs, but wait until
+the currently running jobs are finished before exiting.
+
+
+=head1 ENVIRONMENT VARIABLES
+
+=over 9
+
+=item $PARALLEL_HOME
+
+Dir where GNU B<parallel> stores config files, semaphores, and caches
+information between invocations. If set to a non-existent dir, the dir
+will be created.
+
+Default: $HOME/.parallel.
+
+
+=item $PARALLEL_ARGHOSTGROUPS
+
+When using B<--hostgroups> GNU B<parallel> sets this to the hostgroups
+of the job.
+
+Remember to quote the $, so it gets evaluated by the correct shell. Or
+use B<--plus> and {agrp}.
+
+
+=item $PARALLEL_HOSTGROUPS
+
+When using B<--hostgroups> GNU B<parallel> sets this to the hostgroups
+of the sshlogin that the job is run on.
+
+Remember to quote the $, so it gets evaluated by the correct shell. Or
+use B<--plus> and {hgrp}.
+
+
+=item $PARALLEL_JOBSLOT
+
+Set by GNU B<parallel> and can be used in jobs run by GNU B<parallel>.
+Remember to quote the $, so it gets evaluated by the correct shell. Or
+use B<--plus> and {slot}.
+
+$PARALLEL_JOBSLOT is the jobslot of the job. It is equal to {%} unless
+the job is being retried. See {%} for details.
+
+
+=item $PARALLEL_PID
+
+Set by GNU B<parallel> and can be used in jobs run by GNU B<parallel>.
+Remember to quote the $, so it gets evaluated by the correct shell.
+
+This makes it possible for the jobs to communicate directly to GNU
+B<parallel>.
+
+B<Example:> If each of the jobs tests a solution and one of jobs finds
+the solution the job can tell GNU B<parallel> not to start more jobs
+by: B<kill -HUP $PARALLEL_PID>. This only works on the local
+computer.
+
+
+=item $PARALLEL_RSYNC_OPTS
+
+Options to pass on to B<rsync>. Defaults to: -rlDzR.
+
+
+=item $PARALLEL_SHELL
+
+Use this shell for the commands run by GNU B<parallel>:
+
+=over 2
+
+=item *
+
+$PARALLEL_SHELL. If undefined use:
+
+=item *
+
+The shell that started GNU B<parallel>. If that cannot be determined:
+
+=item *
+
+$SHELL. If undefined use:
+
+=item *
+
+/bin/sh
+
+=back
+
+
+=item $PARALLEL_SSH
+
+GNU B<parallel> defaults to using the B<ssh> command for remote
+access. This can be overridden with $PARALLEL_SSH, which again can be
+overridden with B<--ssh>. It can also be set on a per server basis
+(see B<--sshlogin>).
+
+
+=item $PARALLEL_SSHHOST
+
+Set by GNU B<parallel> and can be used in jobs run by GNU B<parallel>.
+Remember to quote the $, so it gets evaluated by the correct shell. Or
+use B<--plus> and {host}.
+
+
+$PARALLEL_SSHHOST is the host part of an sshlogin line. E.g.
+
+  4//usr/bin/specialssh user@host
+
+becomes:
+
+  host
+
+
+=item $PARALLEL_SSHLOGIN
+
+Set by GNU B<parallel> and can be used in jobs run by GNU B<parallel>.
+Remember to quote the $, so it gets evaluated by the correct shell. Or
+use B<--plus> and {sshlogin}.
+
+
+The value is the sshlogin line with number of threads removed. E.g.
+
+  4//usr/bin/specialssh user@host
+
+becomes:
+
+  /usr/bin/specialssh user@host
+
+
+=item $PARALLEL_SEQ
+
+Set by GNU B<parallel> and can be used in jobs run by GNU B<parallel>.
+Remember to quote the $, so it gets evaluated by the correct shell.
+
+$PARALLEL_SEQ is the sequence number of the job running.
+
+B<Example:>
+
+  seq 10 | parallel -N2 \
+    echo seq:'$'PARALLEL_SEQ arg1:{1} arg2:{2}
+
+{#} is a shorthand for $PARALLEL_SEQ.
+
+
+=item $PARALLEL_TMUX
+
+Path to B<tmux>. If unset the B<tmux> in $PATH is used.
+
+
+=item $TMPDIR
+
+Directory for temporary files.
+
+See also: B<--tmpdir>
+
+
+=item $PARALLEL_REMOTE_TMPDIR
+
+Directory for temporary files on remote servers.
+
+See also: B<--tmpdir>
+
+
+=item $PARALLEL
+
+The environment variable $PARALLEL will be used as default options for
+GNU B<parallel>. If the variable contains special shell characters
+(e.g. $, *, or space) then these need to be to be escaped with \.
+
+B<Example:>
+
+  cat list | parallel -j1 -k -v ls
+  cat list | parallel -j1 -k -v -S"myssh user@server" ls
+
+can be written as:
+
+  cat list | PARALLEL="-kvj1" parallel ls
+  cat list | PARALLEL='-kvj1 -S myssh\ user@server' \
+    parallel echo
+
+Notice the \ after 'myssh' is needed because 'myssh' and 'user@server'
+must be one argument.
+
+See also: B<--profile>
+
+=back
+
+
+=head1 DEFAULT PROFILE (CONFIG FILE)
+
+The global configuration file /etc/parallel/config, followed by user
+configuration file ~/.parallel/config (formerly known as .parallelrc)
+will be read in turn if they exist.  Lines starting with '#' will be
+ignored. The format can follow that of the environment variable
+$PARALLEL, but it is often easier to simply put each option on its own
+line.
+
+Options on the command line take precedence, followed by the
+environment variable $PARALLEL, user configuration file
+~/.parallel/config, and finally the global configuration file
+/etc/parallel/config.
+
+Note that no file that is read for options, nor the environment
+variable $PARALLEL, may contain retired options such as B<--tollef>.
+
+=head1 PROFILE FILES
+
+If B<--profile> set, GNU B<parallel> will read the profile from that
+file rather than the global or user configuration files. You can have
+multiple B<--profiles>.
+
+Profiles are searched for in B<~/.parallel>. If the name starts with
+B</> it is seen as an absolute path. If the name starts with B<./> it
+is seen as a relative path from current dir.
+
+Example: Profile for running a command on every sshlogin in
+~/.ssh/sshlogins and prepend the output with the sshlogin:
+
+  echo --tag -S .. --nonall > ~/.parallel/nonall_profile
+  parallel -J nonall_profile uptime
+
+Example: Profile for running every command with B<-j-1> and B<nice>
+
+  echo -j-1 nice > ~/.parallel/nice_profile
+  parallel -J nice_profile bzip2 -9 ::: *
+
+Example: Profile for running a perl script before every command:
+
+  echo "perl -e '\$a=\$\$; print \$a,\" \",'\$PARALLEL_SEQ',\" \";';" \
+    > ~/.parallel/pre_perl
+  parallel -J pre_perl echo ::: *
+
+Note how the $ and " need to be quoted using \.
+
+Example: Profile for running distributed jobs with B<nice> on the
+remote computers:
+
+  echo -S .. nice > ~/.parallel/dist
+  parallel -J dist --trc {.}.bz2 bzip2 -9 ::: *
+
+
+=head1 EXIT STATUS
+
+Exit status depends on B<--halt-on-error> if one of these is used:
+success=X, success=Y%, fail=Y%.
+
+=over 6
+
+=item Z<>0
+
+All jobs ran without error. If success=X is used: X jobs ran without
+error. If success=Y% is used: Y% of the jobs ran without error.
+
+=item Z<>1-100
+
+Some of the jobs failed. The exit status gives the number of failed
+jobs. If Y% is used the exit status is the percentage of jobs that
+failed.
+
+=item Z<>101
+
+More than 100 jobs failed.
+
+=item Z<>255
+
+Other error.
+
+=item Z<>-1 (In joblog and SQL table)
+
+Killed by Ctrl-C, timeout, not enough memory or similar.
+
+=item Z<>-2 (In joblog and SQL table)
+
+skip() was called in B<{= =}>.
+
+=item Z<>-1000 (In SQL table)
+
+Job is ready to run (set by --sqlmaster).
+
+=item Z<>-1220 (In SQL table)
+
+Job is taken by worker (set by --sqlworker).
+
+=back
+
+If fail=1 is used, the exit status will be the exit status of the
+failing job.
+
+
+=head1 DIFFERENCES BETWEEN GNU Parallel AND ALTERNATIVES
+
+See: B<man parallel_alternatives>
+
+
+=head1 BUGS
+
+=head2 Quoting of newline
+
+Because of the way newline is quoted this will not work:
+
+  echo 1,2,3 | parallel -vkd, "echo 'a{}b'"
+
+However, these will all work:
+
+  echo 1,2,3 | parallel -vkd, echo a{}b
+  echo 1,2,3 | parallel -vkd, "echo 'a'{}'b'"
+  echo 1,2,3 | parallel -vkd, "echo 'a'"{}"'b'"
+
+
+=head2 Speed
+
+=head3 Startup
+
+GNU B<parallel> is slow at starting up - around 250 ms the first time
+and 150 ms after that.
+
+=head3 Job startup
+
+Starting a job on the local machine takes around 3-10 ms. This can be
+a big overhead if the job takes very few ms to run. Often you can
+group small jobs together using B<-X> which will make the overhead
+less significant. Or you can run multiple GNU B<parallel>s as
+described in B<EXAMPLE: Speeding up fast jobs>.
+
+=head3 SSH
+
+When using multiple computers GNU B<parallel> opens B<ssh> connections
+to them to figure out how many connections can be used reliably
+simultaneously (Namely SSHD's MaxStartups). This test is done for each
+host in serial, so if your B<--sshloginfile> contains many hosts it may
+be slow.
+
+If your jobs are short you may see that there are fewer jobs running
+on the remote systems than expected. This is due to time spent logging
+in and out. B<-M> may help here.
+
+=head3 Disk access
+
+A single disk can normally read data faster if it reads one file at a
+time instead of reading a lot of files in parallel, as this will avoid
+disk seeks. However, newer disk systems with multiple drives can read
+faster if reading from multiple files in parallel.
+
+If the jobs are of the form read-all-compute-all-write-all, so
+everything is read before anything is written, it may be faster to
+force only one disk access at the time:
+
+  sem --id diskio cat file | compute | sem --id diskio cat > file
+
+If the jobs are of the form read-compute-write, so writing starts
+before all reading is done, it may be faster to force only one reader
+and writer at the time:
+
+  sem --id read cat file | compute | sem --id write cat > file
+
+If the jobs are of the form read-compute-read-compute, it may be
+faster to run more jobs in parallel than the system has CPUs, as some
+of the jobs will be stuck waiting for disk access.
+
+=head2 --nice limits command length
+
+The current implementation of B<--nice> is too pessimistic in the max
+allowed command length. It only uses a little more than half of what
+it could. This affects B<-X> and B<-m>. If this becomes a real problem for
+you, file a bug-report.
+
+=head2 Aliases and functions do not work
+
+If you get:
+
+  Can't exec "command": No such file or directory
+
+or:
+
+  open3: exec of by command failed
+
+or:
+
+  /bin/bash: command: command not found
+
+it may be because I<command> is not known, but it could also be
+because I<command> is an alias or a function. If it is a function you
+need to B<export -f> the function first or use B<env_parallel>. An
+alias will only work if you use B<env_parallel>.
+
+=head2 Database with MySQL fails randomly
+
+The B<--sql*> options may fail randomly with MySQL. This problem does
+not exist with PostgreSQL.
+
+
+=head1 REPORTING BUGS
+
+Report bugs to <parallel@gnu.org> or
+https://savannah.gnu.org/bugs/?func=additem&group=parallel
+
+When you write your report, please keep in mind, that you must give
+the reader enough information to be able to run exactly what you
+run. So you need to include all data and programs that you use to
+show the problem.
+
+See a perfect bug report on
+https://lists.gnu.org/archive/html/bug-parallel/2015-01/msg00000.html
+
+Your bug report should always include:
+
+=over 2
+
+=item *
+
+The error message you get (if any). If the error message is not from
+GNU B<parallel> you need to show why you think GNU B<parallel> caused
+this.
+
+=item *
+
+The complete output of B<parallel --version>. If you are not running
+the latest released version (see https://ftp.gnu.org/gnu/parallel/) you
+should specify why you believe the problem is not fixed in that
+version.
+
+=item *
+
+A minimal, complete, and verifiable example (See description on
+https://stackoverflow.com/help/mcve).
+
+It should be a complete example that others can run which shows the
+problem including all files needed to run the example. This should
+preferably be small and simple, so try to remove as many options as
+possible.
+
+A combination of B<yes>, B<seq>, B<cat>, B<echo>, B<wc>, and B<sleep>
+can reproduce most errors.
+
+If your example requires large files, see if you can make them with
+something like B<seq 100000000> > B<bigfile> or B<yes | head -n
+1000000000> > B<file>. If you need multiple columns: B<paste <(seq
+1000) <(seq 1000 1999)>
+
+If your example requires remote execution, see if you can use
+B<localhost> - maybe using another login.
+
+If you have access to a different system (maybe a VirtualBox on your
+own machine), test if your MCVE shows the problem on that system. If
+it does not, read below.
+
+=item *
+
+The output of your example. If your problem is not easily reproduced
+by others, the output might help them figure out the problem.
+
+=item *
+
+Whether you have watched the intro videos
+(https://www.youtube.com/playlist?list=PL284C9FF2488BC6D1), walked
+through the tutorial (man parallel_tutorial), and read the examples
+(man parallel_examples).
+
+=back
+
+=head2 Bug dependent on environment
+
+If you suspect the error is dependent on your environment or
+distribution, please see if you can reproduce the error on one of
+these VirtualBox images:
+https://sourceforge.net/projects/virtualboximage/files/
+https://www.osboxes.org/virtualbox-images/
+
+Specifying the name of your distribution is not enough as you may have
+installed software that is not in the VirtualBox images.
+
+If you cannot reproduce the error on any of the VirtualBox images
+above, see if you can build a VirtualBox image on which you can
+reproduce the error. If not you should assume the debugging will be
+done through you. That will put a lot more burden on you and it is
+extra important you give any information that help. In general the
+problem will be fixed faster and with much less work for you if you
+can reproduce the error on a VirtualBox - even if you have to build a
+VirtualBox image.
+
+=head2 In summary
+
+Your report must include:
+
+=over 2
+
+=item *
+
+B<parallel --version>
+
+=item *
+
+output + error message
+
+=item *
+
+full example including all files
+
+=item *
+
+VirtualBox image, if you cannot reproduce it on other systems
+
+=back
+
+
+
+=head1 AUTHOR
+
+When using GNU B<parallel> for a publication please cite:
+
+O. Tange (2011): GNU Parallel - The Command-Line Power Tool, ;login:
+The USENIX Magazine, February 2011:42-47.
+
+This helps funding further development; and it won't cost you a cent.
+If you pay 10000 EUR you should feel free to use GNU Parallel without citing.
+
+Copyright (C) 2007-10-18 Ole Tange, http://ole.tange.dk
+
+Copyright (C) 2008-2010 Ole Tange, http://ole.tange.dk
+
+Copyright (C) 2010-2022 Ole Tange, http://ole.tange.dk and Free
+Software Foundation, Inc.
+
+Parts of the manual concerning B<xargs> compatibility is inspired by
+the manual of B<xargs> from GNU findutils 4.4.2.
+
+
+=head1 LICENSE
+
+This program is free software; you can redistribute it and/or modify
+it under the terms of the GNU General Public License as published by
+the Free Software Foundation; either version 3 of the License, or
+at your option any later version.
+
+This program is distributed in the hope that it will be useful,
+but WITHOUT ANY WARRANTY; without even the implied warranty of
+MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the
+GNU General Public License for more details.
+
+You should have received a copy of the GNU General Public License
+along with this program.  If not, see <https://www.gnu.org/licenses/>.
+
+=head2 Documentation license I
+
+Permission is granted to copy, distribute and/or modify this
+documentation under the terms of the GNU Free Documentation License,
+Version 1.3 or any later version published by the Free Software
+Foundation; with no Invariant Sections, with no Front-Cover Texts, and
+with no Back-Cover Texts.  A copy of the license is included in the
+file LICENSES/GFDL-1.3-or-later.txt.
+
+=head2 Documentation license II
+
+You are free:
+
+=over 9
+
+=item B<to Share>
+
+to copy, distribute and transmit the work
+
+=item B<to Remix>
+
+to adapt the work
+
+=back
+
+Under the following conditions:
+
+=over 9
+
+=item B<Attribution>
+
+You must attribute the work in the manner specified by the author or
+licensor (but not in any way that suggests that they endorse you or
+your use of the work).
+
+=item B<Share Alike>
+
+If you alter, transform, or build upon this work, you may distribute
+the resulting work only under the same, similar or a compatible
+license.
+
+=back
+
+With the understanding that:
+
+=over 9
+
+=item B<Waiver>
+
+Any of the above conditions can be waived if you get permission from
+the copyright holder.
+
+=item B<Public Domain>
+
+Where the work or any of its elements is in the public domain under
+applicable law, that status is in no way affected by the license.
+
+=item B<Other Rights>
+
+In no way are any of the following rights affected by the license:
+
+=over 2
+
+=item *
+
+Your fair dealing or fair use rights, or other applicable
+copyright exceptions and limitations;
+
+=item *
+
+The author's moral rights;
+
+=item *
+
+Rights other persons may have either in the work itself or in
+how the work is used, such as publicity or privacy rights.
+
+=back
+
+=back
+
+=over 9
+
+=item B<Notice>
+
+For any reuse or distribution, you must make clear to others the
+license terms of this work.
+
+=back
+
+A copy of the full license is included in the file as
+LICENCES/CC-BY-SA-4.0.txt
+
+
+=head1 DEPENDENCIES
+
+GNU B<parallel> uses Perl, and the Perl modules Getopt::Long,
+IPC::Open3, Symbol, IO::File, POSIX, and File::Temp.
+
+For B<--csv> it uses the Perl module Text::CSV.
+
+For remote usage it uses B<rsync> with B<ssh>.
+
+
+=head1 SEE ALSO
+
+B<parallel_tutorial>(1), B<env_parallel>(1), B<parset>(1),
+B<parsort>(1), B<parallel_alternatives>(1), B<parallel_design>(7),
+B<niceload>(1), B<sql>(1), B<ssh>(1), B<ssh-agent>(1), B<sshpass>(1),
+B<ssh-copy-id>(1), B<rsync>(1)
+
+=cut
diff --git a/src/parallel_alternatives.pod b/src/parallel_alternatives.pod
new file mode 100644
index 0000000..6e7e780
--- /dev/null
+++ b/src/parallel_alternatives.pod
@@ -0,0 +1,3916 @@
+#!/usr/bin/perl -w
+
+# SPDX-FileCopyrightText: 2021-2022 Ole Tange, http://ole.tange.dk and Free Software and Foundation, Inc.
+# SPDX-License-Identifier: GFDL-1.3-or-later
+# SPDX-License-Identifier: CC-BY-SA-4.0
+
+=encoding utf8
+
+=head1 NAME
+
+parallel_alternatives - Alternatives to GNU B<parallel>
+
+
+=head1 DIFFERENCES BETWEEN GNU Parallel AND ALTERNATIVES
+
+There are a lot programs that share functionality with GNU
+B<parallel>. Some of these are specialized tools, and while GNU
+B<parallel> can emulate many of them, a specialized tool can be better
+at a given task. GNU B<parallel> strives to include the best of the
+general functionality without sacrificing ease of use.
+
+B<parallel> has existed since 2002-01-06 and as GNU B<parallel> since
+2010. A lot of the alternatives have not had the vitality to survive
+that long, but have come and gone during that time.
+
+GNU B<parallel> is actively maintained with a new release every month
+since 2010. Most other alternatives are fleeting interests of the
+developers with irregular releases and only maintained for a few
+years.
+
+
+=head2 SUMMARY LEGEND
+
+The following features are in some of the comparable tools:
+
+=head3 Inputs
+
+=over
+
+=item I1. Arguments can be read from stdin
+
+=item I2. Arguments can be read from a file
+
+=item I3. Arguments can be read from multiple files
+
+=item I4. Arguments can be read from command line
+
+=item I5. Arguments can be read from a table
+
+=item I6. Arguments can be read from the same file using #! (shebang)
+
+=item I7. Line oriented input as default (Quoting of special chars not needed)
+
+=back
+
+
+=head3 Manipulation of input
+
+=over
+
+=item M1. Composed command
+
+=item M2. Multiple arguments can fill up an execution line
+
+=item M3. Arguments can be put anywhere in the execution line
+
+=item M4. Multiple arguments can be put anywhere in the execution line
+
+=item M5. Arguments can be replaced with context
+
+=item M6. Input can be treated as the complete command line
+
+=back
+
+
+=head3 Outputs
+
+=over
+
+=item O1. Grouping output so output from different jobs do not mix
+
+=item O2. Send stderr (standard error) to stderr (standard error)
+
+=item O3. Send stdout (standard output) to stdout (standard output)
+
+=item O4. Order of output can be same as order of input
+
+=item O5. Stdout only contains stdout (standard output) from the command
+
+=item O6. Stderr only contains stderr (standard error) from the command
+
+=item O7. Buffering on disk
+
+=item O8. No temporary files left if killed
+
+=item O9. Test if disk runs full during run
+
+=item O10. Output of a line bigger than 4 GB
+
+=back
+
+
+=head3 Execution
+
+=over
+
+=item E1. Running jobs in parallel
+
+=item E2. List running jobs
+
+=item E3. Finish running jobs, but do not start new jobs
+
+=item E4. Number of running jobs can depend on number of cpus
+
+=item E5. Finish running jobs, but do not start new jobs after first failure
+
+=item E6. Number of running jobs can be adjusted while running
+
+=item E7. Only spawn new jobs if load is less than a limit
+
+=back
+
+
+=head3 Remote execution
+
+=over
+
+=item R1. Jobs can be run on remote computers
+
+=item R2. Basefiles can be transferred
+
+=item R3. Argument files can be transferred
+
+=item R4. Result files can be transferred
+
+=item R5. Cleanup of transferred files
+
+=item R6. No config files needed
+
+=item R7. Do not run more than SSHD's MaxStartups can handle
+
+=item R8. Configurable SSH command
+
+=item R9. Retry if connection breaks occasionally
+
+=back
+
+
+=head3 Semaphore
+
+=over
+
+=item S1. Possibility to work as a mutex
+
+=item S2. Possibility to work as a counting semaphore
+
+=back
+
+
+=head3 Legend
+
+=over
+
+=item - = no
+
+=item x = not applicable
+
+=item ID = yes
+
+=back
+
+As every new version of the programs are not tested the table may be
+outdated. Please file a bug report if you find errors (See REPORTING
+BUGS).
+
+parallel:
+
+=over
+
+=item I1 I2 I3 I4 I5 I6 I7
+
+=item M1 M2 M3 M4 M5 M6
+
+=item O1 O2 O3 O4 O5 O6 O7 O8 O9 O10
+
+=item E1 E2 E3 E4 E5 E6 E7
+
+=item R1 R2 R3 R4 R5 R6 R7 R8 R9
+
+=item S1 S2
+
+=back
+
+
+=head2 DIFFERENCES BETWEEN xargs AND GNU Parallel
+
+Summary (see legend above):
+
+=over
+
+=item I1 I2 - - - - -
+
+=item - M2 M3 - - -
+
+=item - O2 O3 - O5 O6
+
+=item E1 - - - - - -
+
+=item - - - - - x - - -
+
+=item - -
+
+=back
+
+B<xargs> offers some of the same possibilities as GNU B<parallel>.
+
+B<xargs> deals badly with special characters (such as space, \, ' and
+"). To see the problem try this:
+
+  touch important_file
+  touch 'not important_file'
+  ls not* | xargs rm
+  mkdir -p "My brother's 12\" records"
+  ls | xargs rmdir
+  touch 'c:\windows\system32\clfs.sys'
+  echo 'c:\windows\system32\clfs.sys' | xargs ls -l
+
+You can specify B<-0>, but many input generators are not optimized for
+using B<NUL> as separator but are optimized for B<newline> as
+separator. E.g. B<awk>, B<ls>, B<echo>, B<tar -v>, B<head> (requires
+using B<-z>), B<tail> (requires using B<-z>), B<sed> (requires using
+B<-z>), B<perl> (B<-0> and \0 instead of \n), B<locate> (requires
+using B<-0>), B<find> (requires using B<-print0>), B<grep> (requires
+using B<-z> or B<-Z>), B<sort> (requires using B<-z>).
+
+GNU B<parallel>'s newline separation can be emulated with:
+
+  cat | xargs -d "\n" -n1 command
+
+B<xargs> can run a given number of jobs in parallel, but has no
+support for running number-of-cpu-cores jobs in parallel.
+
+B<xargs> has no support for grouping the output, therefore output may
+run together, e.g. the first half of a line is from one process and
+the last half of the line is from another process. The example
+B<Parallel grep> cannot be done reliably with B<xargs> because of
+this. To see this in action try:
+
+  parallel perl -e '\$a=\"1\".\"{}\"x10000000\;print\ \$a,\"\\n\"' \
+    '>' {} ::: a b c d e f g h
+  # Serial = no mixing = the wanted result
+  # 'tr -s a-z' squeezes repeating letters into a single letter
+  echo a b c d e f g h | xargs -P1 -n1 grep 1 | tr -s a-z
+  # Compare to 8 jobs in parallel
+  parallel -kP8 -n1 grep 1 ::: a b c d e f g h | tr -s a-z
+  echo a b c d e f g h | xargs -P8 -n1 grep 1 | tr -s a-z
+  echo a b c d e f g h | xargs -P8 -n1 grep --line-buffered 1 | \
+    tr -s a-z
+
+Or try this:
+
+  slow_seq() {
+    echo Count to "$@"
+    seq "$@" |
+      perl -ne '$|=1; for(split//){ print; select($a,$a,$a,0.100);}'
+  }
+  export -f slow_seq
+  # Serial = no mixing = the wanted result
+  seq 8 | xargs -n1 -P1 -I {} bash -c 'slow_seq {}'
+  # Compare to 8 jobs in parallel
+  seq 8 | parallel -P8 slow_seq {}
+  seq 8 | xargs -n1 -P8 -I {} bash -c 'slow_seq {}'
+
+B<xargs> has no support for keeping the order of the output, therefore
+if running jobs in parallel using B<xargs> the output of the second
+job cannot be postponed till the first job is done.
+
+B<xargs> has no support for running jobs on remote computers.
+
+B<xargs> has no support for context replace, so you will have to create the
+arguments.
+
+If you use a replace string in B<xargs> (B<-I>) you can not force
+B<xargs> to use more than one argument.
+
+Quoting in B<xargs> works like B<-q> in GNU B<parallel>. This means
+composed commands and redirection require using B<bash -c>.
+
+  ls | parallel "wc {} >{}.wc"
+  ls | parallel "echo {}; ls {}|wc"
+
+becomes (assuming you have 8 cores and that none of the filenames
+contain space, " or ').
+
+  ls | xargs -d "\n" -P8 -I {} bash -c "wc {} >{}.wc"
+  ls | xargs -d "\n" -P8 -I {} bash -c "echo {}; ls {}|wc"
+
+A more extreme example can be found on:
+https://unix.stackexchange.com/q/405552/
+
+https://www.gnu.org/software/findutils/
+
+
+=head2 DIFFERENCES BETWEEN find -exec AND GNU Parallel
+
+Summary (see legend above):
+
+=over
+
+=item -  -  -  x  -  x  -
+
+=item -  M2 M3 -  -  -  -
+
+=item -  O2 O3 O4 O5 O6
+
+=item -  -  -  -  -  -  -
+
+=item -  -  -  -  -  -  -  -  -
+
+=item x  x
+
+=back
+
+B<find -exec> offers some of the same possibilities as GNU B<parallel>.
+
+B<find -exec> only works on files. Processing other input (such as
+hosts or URLs) will require creating these inputs as files. B<find
+-exec> has no support for running commands in parallel.
+
+https://www.gnu.org/software/findutils/ (Last checked: 2019-01)
+
+
+=head2 DIFFERENCES BETWEEN make -j AND GNU Parallel
+
+Summary (see legend above):
+
+=over
+
+=item -  -  -  -  -  -  -
+
+=item -  -  -  -  -  -
+
+=item O1 O2 O3 -  x  O6
+
+=item E1 -  -  -  E5 -
+
+=item -  -  -  -  -  -  -  -  -
+
+=item -  -
+
+=back
+
+B<make -j> can run jobs in parallel, but requires a crafted Makefile
+to do this. That results in extra quoting to get filenames containing
+newlines to work correctly.
+
+B<make -j> computes a dependency graph before running jobs. Jobs run
+by GNU B<parallel> does not depend on each other.
+
+(Very early versions of GNU B<parallel> were coincidentally implemented
+using B<make -j>).
+
+https://www.gnu.org/software/make/ (Last checked: 2019-01)
+
+
+=head2 DIFFERENCES BETWEEN ppss AND GNU Parallel
+
+Summary (see legend above):
+
+=over
+
+=item I1 I2 - - - - I7
+
+=item M1 - M3 - - M6
+
+=item O1 - - x - -
+
+=item E1 E2 ?E3 E4 - - -
+
+=item R1 R2 R3 R4 - - ?R7 ? ?
+
+=item - -
+
+=back
+
+B<ppss> is also a tool for running jobs in parallel.
+
+The output of B<ppss> is status information and thus not useful for
+using as input for another command. The output from the jobs are put
+into files.
+
+The argument replace string ($ITEM) cannot be changed. Arguments must
+be quoted - thus arguments containing special characters (space '"&!*)
+may cause problems. More than one argument is not supported. Filenames
+containing newlines are not processed correctly. When reading input
+from a file null cannot be used as a terminator. B<ppss> needs to read
+the whole input file before starting any jobs.
+
+Output and status information is stored in ppss_dir and thus requires
+cleanup when completed. If the dir is not removed before running
+B<ppss> again it may cause nothing to happen as B<ppss> thinks the
+task is already done. GNU B<parallel> will normally not need cleaning
+up if running locally and will only need cleaning up if stopped
+abnormally and running remote (B<--cleanup> may not complete if
+stopped abnormally). The example B<Parallel grep> would require extra
+postprocessing if written using B<ppss>.
+
+For remote systems PPSS requires 3 steps: config, deploy, and
+start. GNU B<parallel> only requires one step.
+
+=head3 EXAMPLES FROM ppss MANUAL
+
+Here are the examples from B<ppss>'s manual page with the equivalent
+using GNU B<parallel>:
+
+  1$ ./ppss.sh standalone -d /path/to/files -c 'gzip '
+
+  1$ find /path/to/files -type f | parallel gzip
+
+  2$ ./ppss.sh standalone -d /path/to/files -c 'cp "$ITEM" /destination/dir '
+
+  2$ find /path/to/files -type f | parallel cp {} /destination/dir
+
+  3$ ./ppss.sh standalone -f list-of-urls.txt -c 'wget -q '
+
+  3$ parallel -a list-of-urls.txt wget -q
+
+  4$ ./ppss.sh standalone -f list-of-urls.txt -c 'wget -q "$ITEM"'
+
+  4$ parallel -a list-of-urls.txt wget -q {}
+
+  5$ ./ppss config -C config.cfg -c 'encode.sh ' -d /source/dir \
+       -m 192.168.1.100 -u ppss -k ppss-key.key -S ./encode.sh \
+       -n nodes.txt -o /some/output/dir --upload --download;
+     ./ppss deploy -C config.cfg
+     ./ppss start -C config
+
+  5$ # parallel does not use configs. If you want a different username put it in nodes.txt: user@hostname
+     find source/dir -type f |
+       parallel --sshloginfile nodes.txt --trc {.}.mp3 lame -a {} -o {.}.mp3 --preset standard --quiet
+
+  6$ ./ppss stop -C config.cfg
+
+  6$ killall -TERM parallel
+
+  7$ ./ppss pause -C config.cfg
+
+  7$ Press: CTRL-Z or killall -SIGTSTP parallel
+
+  8$ ./ppss continue -C config.cfg
+
+  8$ Enter: fg or killall -SIGCONT parallel
+
+  9$ ./ppss.sh status -C config.cfg
+
+  9$ killall -SIGUSR2 parallel
+
+https://github.com/louwrentius/PPSS
+
+
+=head2 DIFFERENCES BETWEEN pexec AND GNU Parallel
+
+Summary (see legend above):
+
+=over
+
+=item I1 I2 - I4 I5 - -
+
+=item M1 - M3 - - M6
+
+=item O1 O2 O3 - O5 O6
+
+=item E1 - - E4 - E6 -
+
+=item R1 - - - - R6 - - -
+
+=item S1 -
+
+=back
+
+B<pexec> is also a tool for running jobs in parallel.
+
+=head3 EXAMPLES FROM pexec MANUAL
+
+Here are the examples from B<pexec>'s info page with the equivalent
+using GNU B<parallel>:
+
+  1$ pexec -o sqrt-%s.dat -p "$(seq 10)" -e NUM -n 4 -c -- \
+       'echo "scale=10000;sqrt($NUM)" | bc'
+
+  1$ seq 10 | parallel -j4 'echo "scale=10000;sqrt({})" | \
+       bc > sqrt-{}.dat'
+
+  2$ pexec -p "$(ls myfiles*.ext)" -i %s -o %s.sort -- sort
+
+  2$ ls myfiles*.ext | parallel sort {} ">{}.sort"
+
+  3$ pexec -f image.list -n auto -e B -u star.log -c -- \
+       'fistar $B.fits -f 100 -F id,x,y,flux -o $B.star'
+
+  3$ parallel -a image.list \
+       'fistar {}.fits -f 100 -F id,x,y,flux -o {}.star' 2>star.log
+
+  4$ pexec -r *.png -e IMG -c -o - -- \
+       'convert $IMG ${IMG%.png}.jpeg ; "echo $IMG: done"'
+
+  4$ ls *.png | parallel 'convert {} {.}.jpeg; echo {}: done'
+
+  5$ pexec -r *.png -i %s -o %s.jpg -c 'pngtopnm | pnmtojpeg'
+
+  5$ ls *.png | parallel 'pngtopnm < {} | pnmtojpeg > {}.jpg'
+
+  6$ for p in *.png ; do echo ${p%.png} ; done | \
+       pexec -f - -i %s.png -o %s.jpg -c 'pngtopnm | pnmtojpeg'
+
+  6$ ls *.png | parallel 'pngtopnm < {} | pnmtojpeg > {.}.jpg'
+
+  7$ LIST=$(for p in *.png ; do echo ${p%.png} ; done)
+     pexec -r $LIST -i %s.png -o %s.jpg -c 'pngtopnm | pnmtojpeg'
+
+  7$ ls *.png | parallel 'pngtopnm < {} | pnmtojpeg > {.}.jpg'
+
+  8$ pexec -n 8 -r *.jpg -y unix -e IMG -c \
+       'pexec -j -m blockread -d $IMG | \
+        jpegtopnm | pnmscale 0.5 | pnmtojpeg | \
+        pexec -j -m blockwrite -s th_$IMG'
+
+  8$ # Combining GNU B<parallel> and GNU B<sem>.
+     ls *jpg | parallel -j8 'sem --id blockread cat {} | jpegtopnm |' \
+       'pnmscale 0.5 | pnmtojpeg | sem --id blockwrite cat > th_{}'
+
+     # If reading and writing is done to the same disk, this may be
+     # faster as only one process will be either reading or writing:
+     ls *jpg | parallel -j8 'sem --id diskio cat {} | jpegtopnm |' \
+       'pnmscale 0.5 | pnmtojpeg | sem --id diskio cat > th_{}'
+
+https://www.gnu.org/software/pexec/
+
+
+=head2 DIFFERENCES BETWEEN xjobs AND GNU Parallel
+
+B<xjobs> is also a tool for running jobs in parallel. It only supports
+running jobs on your local computer.
+
+B<xjobs> deals badly with special characters just like B<xargs>. See
+the section B<DIFFERENCES BETWEEN xargs AND GNU Parallel>.
+
+=head3 EXAMPLES FROM xjobs MANUAL
+
+Here are the examples from B<xjobs>'s man page with the equivalent
+using GNU B<parallel>:
+
+  1$ ls -1 *.zip | xjobs unzip
+
+  1$ ls *.zip | parallel unzip
+
+  2$ ls -1 *.zip | xjobs -n unzip
+
+  2$ ls *.zip | parallel unzip >/dev/null
+
+  3$ find . -name '*.bak' | xjobs gzip
+
+  3$ find . -name '*.bak' | parallel gzip
+
+  4$ ls -1 *.jar | sed 's/\(.*\)/\1 > \1.idx/' | xjobs jar tf
+
+  4$ ls *.jar | parallel jar tf {} '>' {}.idx
+
+  5$ xjobs -s script
+
+  5$ cat script | parallel
+
+  6$ mkfifo /var/run/my_named_pipe;
+     xjobs -s /var/run/my_named_pipe &
+     echo unzip 1.zip >> /var/run/my_named_pipe;
+     echo tar cf /backup/myhome.tar /home/me >> /var/run/my_named_pipe
+
+  6$ mkfifo /var/run/my_named_pipe;
+     cat /var/run/my_named_pipe | parallel &
+     echo unzip 1.zip >> /var/run/my_named_pipe;
+     echo tar cf /backup/myhome.tar /home/me >> /var/run/my_named_pipe
+
+https://www.maier-komor.de/xjobs.html (Last checked: 2019-01)
+
+
+=head2 DIFFERENCES BETWEEN prll AND GNU Parallel
+
+B<prll> is also a tool for running jobs in parallel. It does not
+support running jobs on remote computers.
+
+B<prll> encourages using BASH aliases and BASH functions instead of
+scripts. GNU B<parallel> supports scripts directly, functions if they
+are exported using B<export -f>, and aliases if using B<env_parallel>.
+
+B<prll> generates a lot of status information on stderr (standard
+error) which makes it harder to use the stderr (standard error) output
+of the job directly as input for another program.
+
+=head3 EXAMPLES FROM prll's MANUAL
+
+Here is the example from B<prll>'s man page with the equivalent
+using GNU B<parallel>:
+
+  1$ prll -s 'mogrify -flip $1' *.jpg
+
+  1$ parallel mogrify -flip ::: *.jpg
+
+https://github.com/exzombie/prll (Last checked: 2019-01)
+
+
+=head2 DIFFERENCES BETWEEN dxargs AND GNU Parallel
+
+B<dxargs> is also a tool for running jobs in parallel.
+
+B<dxargs> does not deal well with more simultaneous jobs than SSHD's
+MaxStartups. B<dxargs> is only built for remote run jobs, but does not
+support transferring of files.
+
+https://web.archive.org/web/20120518070250/http://www.
+semicomplete.com/blog/geekery/distributed-xargs.html (Last checked: 2019-01)
+
+
+=head2 DIFFERENCES BETWEEN mdm/middleman AND GNU Parallel
+
+middleman(mdm) is also a tool for running jobs in parallel.
+
+=head3 EXAMPLES FROM middleman's WEBSITE
+
+Here are the shellscripts of
+https://web.archive.org/web/20110728064735/http://mdm.
+berlios.de/usage.html ported to GNU B<parallel>:
+
+  1$ seq 19 | parallel buffon -o - | sort -n > result
+     cat files | parallel cmd
+     find dir -execdir sem cmd {} \;
+
+https://github.com/cklin/mdm (Last checked: 2019-01)
+
+
+=head2 DIFFERENCES BETWEEN xapply AND GNU Parallel
+
+B<xapply> can run jobs in parallel on the local computer.
+
+=head3 EXAMPLES FROM xapply's MANUAL
+
+Here are the examples from B<xapply>'s man page with the equivalent
+using GNU B<parallel>:
+
+  1$ xapply '(cd %1 && make all)' */
+
+  1$ parallel 'cd {} && make all' ::: */
+
+  2$ xapply -f 'diff %1 ../version5/%1' manifest | more
+
+  2$ parallel diff {} ../version5/{} < manifest | more
+
+  3$ xapply -p/dev/null -f 'diff %1 %2' manifest1 checklist1
+
+  3$ parallel --link diff {1} {2} :::: manifest1 checklist1
+
+  4$ xapply 'indent' *.c
+
+  4$ parallel indent ::: *.c
+
+  5$ find ~ksb/bin -type f ! -perm -111 -print | \
+       xapply -f -v 'chmod a+x' -
+
+  5$ find ~ksb/bin -type f ! -perm -111 -print | \
+       parallel -v chmod a+x
+
+  6$ find */ -... | fmt 960 1024 | xapply -f -i /dev/tty 'vi' -
+
+  6$ sh <(find */ -... | parallel -s 1024 echo vi)
+
+  6$ find */ -... | parallel -s 1024 -Xuj1 vi
+
+  7$ find ... | xapply -f -5 -i /dev/tty 'vi' - - - - -
+
+  7$ sh <(find ... | parallel -n5 echo vi)
+
+  7$ find ... | parallel -n5 -uj1 vi
+
+  8$ xapply -fn "" /etc/passwd
+
+  8$ parallel -k echo < /etc/passwd
+
+  9$ tr ':' '\012' < /etc/passwd | \
+       xapply -7 -nf 'chown %1 %6' - - - - - - -
+
+  9$ tr ':' '\012' < /etc/passwd | parallel -N7 chown {1} {6}
+
+  10$ xapply '[ -d %1/RCS ] || echo %1' */
+
+  10$ parallel '[ -d {}/RCS ] || echo {}' ::: */
+
+  11$ xapply -f '[ -f %1 ] && echo %1' List | ...
+
+  11$ parallel '[ -f {} ] && echo {}' < List | ...
+
+https://www.databits.net/~ksb/msrc/local/bin/xapply/xapply.html
+
+
+=head2 DIFFERENCES BETWEEN AIX apply AND GNU Parallel
+
+B<apply> can build command lines based on a template and arguments -
+very much like GNU B<parallel>. B<apply> does not run jobs in
+parallel. B<apply> does not use an argument separator (like B<:::>);
+instead the template must be the first argument.
+
+=head3 EXAMPLES FROM IBM's KNOWLEDGE CENTER
+
+Here are the examples from IBM's Knowledge Center and the
+corresponding command using GNU B<parallel>:
+
+=head4 To obtain results similar to those of the B<ls> command, enter:
+
+  1$ apply echo *
+  1$ parallel echo ::: *
+
+=head4 To compare the file named a1 to the file named b1, and
+the file named a2 to the file named b2, enter:
+
+  2$ apply -2 cmp a1 b1 a2 b2
+  2$ parallel -N2 cmp ::: a1 b1 a2 b2
+
+=head4 To run the B<who> command five times, enter:
+
+  3$ apply -0 who 1 2 3 4 5
+  3$ parallel -N0 who ::: 1 2 3 4 5
+
+=head4 To link all files in the current directory to the directory
+/usr/joe, enter:
+
+  4$ apply 'ln %1 /usr/joe' *
+  4$ parallel ln {} /usr/joe ::: *
+
+https://www-01.ibm.com/support/knowledgecenter/
+ssw_aix_71/com.ibm.aix.cmds1/apply.htm (Last checked: 2019-01)
+
+
+=head2 DIFFERENCES BETWEEN paexec AND GNU Parallel
+
+B<paexec> can run jobs in parallel on both the local and remote computers.
+
+B<paexec> requires commands to print a blank line as the last
+output. This means you will have to write a wrapper for most programs.
+
+B<paexec> has a job dependency facility so a job can depend on another
+job to be executed successfully. Sort of a poor-man's B<make>.
+
+=head3 EXAMPLES FROM paexec's EXAMPLE CATALOG
+
+Here are the examples from B<paexec>'s example catalog with the equivalent
+using GNU B<parallel>:
+
+=head4 1_div_X_run
+
+  1$ ../../paexec -s -l -c "`pwd`/1_div_X_cmd" -n +1 <<EOF [...]
+
+  1$ parallel echo {} '|' `pwd`/1_div_X_cmd <<EOF [...]
+
+=head4 all_substr_run
+
+  2$ ../../paexec -lp -c "`pwd`/all_substr_cmd" -n +3 <<EOF [...]
+
+  2$ parallel echo {} '|' `pwd`/all_substr_cmd <<EOF [...]
+
+=head4 cc_wrapper_run
+
+  3$ ../../paexec -c "env CC=gcc CFLAGS=-O2 `pwd`/cc_wrapper_cmd" \
+             -n 'host1 host2' \
+             -t '/usr/bin/ssh -x' <<EOF [...]
+
+  3$ parallel echo {} '|' "env CC=gcc CFLAGS=-O2 `pwd`/cc_wrapper_cmd" \
+             -S host1,host2 <<EOF [...]
+
+     # This is not exactly the same, but avoids the wrapper
+     parallel gcc -O2 -c -o {.}.o {} \
+             -S host1,host2 <<EOF [...]
+
+=head4 toupper_run
+
+  4$ ../../paexec -lp -c "`pwd`/toupper_cmd" -n +10 <<EOF [...]
+
+  4$ parallel echo {} '|' ./toupper_cmd <<EOF [...]
+
+     # Without the wrapper:
+     parallel echo {} '| awk {print\ toupper\(\$0\)}' <<EOF [...]
+
+https://github.com/cheusov/paexec
+
+
+=head2 DIFFERENCES BETWEEN map(sitaramc) AND GNU Parallel
+
+Summary (see legend above):
+
+=over
+
+=item I1 - - I4 - - (I7)
+
+=item M1 (M2) M3 (M4) M5 M6
+
+=item - O2 O3 - O5 - - N/A N/A O10
+
+=item E1 - - - - - -
+
+=item - - - - - - - - -
+
+=item - -
+
+=back
+
+(I7): Only under special circumstances. See below.
+
+(M2+M4): Only if there is a single replacement string.
+
+B<map> rejects input with special characters:
+
+  echo "The Cure" > My\ brother\'s\ 12\"\ records
+
+  ls | map 'echo %; wc %'
+
+It works with GNU B<parallel>:
+
+  ls | parallel 'echo {}; wc {}'
+
+Under some circumstances it also works with B<map>:
+
+  ls | map 'echo % works %'
+
+But tiny changes make it reject the input with special characters:
+
+  ls | map 'echo % does not work "%"'
+
+This means that many UTF-8 characters will be rejected. This is by
+design. From the web page: "As such, programs that I<quietly handle
+them, with no warnings at all,> are doing their users a disservice."
+
+B<map> delays each job by 0.01 s. This can be emulated by using
+B<parallel --delay 0.01>.
+
+B<map> prints '+' on stderr when a job starts, and '-' when a job
+finishes. This cannot be disabled. B<parallel> has B<--bar> if you
+need to see progress.
+
+B<map>'s replacement strings (% %D %B %E) can be simulated in GNU
+B<parallel> by putting this in B<~/.parallel/config>:
+
+  --rpl '%'
+  --rpl '%D $_=Q(::dirname($_));'
+  --rpl '%B s:.*/::;s:\.[^/.]+$::;'
+  --rpl '%E s:.*\.::'
+
+B<map> does not have an argument separator on the command line, but
+uses the first argument as command. This makes quoting harder which again
+may affect readability. Compare:
+
+  map -p 2 'perl -ne '"'"'/^\S+\s+\S+$/ and print $ARGV,"\n"'"'" *
+
+  parallel -q perl -ne '/^\S+\s+\S+$/ and print $ARGV,"\n"' ::: *
+
+B<map> can do multiple arguments with context replace, but not without
+context replace:
+
+  parallel --xargs echo 'BEGIN{'{}'}END' ::: 1 2 3
+
+  map "echo 'BEGIN{'%'}END'" 1 2 3
+
+B<map> has no support for grouping. So this gives the wrong results:
+
+  parallel perl -e '\$a=\"1{}\"x10000000\;print\ \$a,\"\\n\"' '>' {} \
+    ::: a b c d e f
+  ls -l a b c d e f
+  parallel -kP4 -n1 grep 1 ::: a b c d e f > out.par
+  map -n1 -p 4 'grep 1' a b c d e f > out.map-unbuf
+  map -n1 -p 4 'grep --line-buffered 1' a b c d e f > out.map-linebuf
+  map -n1 -p 1 'grep --line-buffered 1' a b c d e f > out.map-serial
+  ls -l out*
+  md5sum out*
+
+=head3 EXAMPLES FROM map's WEBSITE
+
+Here are the examples from B<map>'s web page with the equivalent using
+GNU B<parallel>:
+
+  1$ ls *.gif | map convert % %B.png         # default max-args: 1
+
+  1$ ls *.gif | parallel convert {} {.}.png
+
+  2$ map "mkdir %B; tar -C %B -xf %" *.tgz   # default max-args: 1
+
+  2$ parallel 'mkdir {.}; tar -C {.} -xf {}' :::  *.tgz
+
+  3$ ls *.gif | map cp % /tmp                # default max-args: 100
+
+  3$ ls *.gif | parallel -X cp {} /tmp
+
+  4$ ls *.tar | map -n 1 tar -xf %
+
+  4$ ls *.tar | parallel tar -xf
+
+  5$ map "cp % /tmp" *.tgz
+
+  5$ parallel cp {} /tmp ::: *.tgz
+
+  6$ map "du -sm /home/%/mail" alice bob carol
+
+  6$ parallel "du -sm /home/{}/mail" ::: alice bob carol
+  or if you prefer running a single job with multiple args:
+  6$ parallel -Xj1 "du -sm /home/{}/mail" ::: alice bob carol
+
+  7$ cat /etc/passwd | map -d: 'echo user %1 has shell %7'
+
+  7$ cat /etc/passwd | parallel --colsep : 'echo user {1} has shell {7}'
+
+  8$ export MAP_MAX_PROCS=$(( `nproc` / 2 ))
+
+  8$ export PARALLEL=-j50%
+
+https://github.com/sitaramc/map (Last checked: 2020-05)
+
+
+=head2 DIFFERENCES BETWEEN ladon AND GNU Parallel
+
+B<ladon> can run multiple jobs on files in parallel.
+
+B<ladon> only works on files and the only way to specify files is
+using a quoted glob string (such as \*.jpg). It is not possible to
+list the files manually.
+
+As replacement strings it uses FULLPATH DIRNAME BASENAME EXT RELDIR
+RELPATH
+
+These can be simulated using GNU B<parallel> by putting this in
+B<~/.parallel/config>:
+
+  --rpl 'FULLPATH $_=Q($_);chomp($_=qx{readlink -f $_});'
+  --rpl 'DIRNAME $_=Q(::dirname($_));chomp($_=qx{readlink -f $_});'
+  --rpl 'BASENAME s:.*/::;s:\.[^/.]+$::;'
+  --rpl 'EXT s:.*\.::'
+  --rpl 'RELDIR $_=Q($_);chomp(($_,$c)=qx{readlink -f $_;pwd});
+         s:\Q$c/\E::;$_=::dirname($_);'
+  --rpl 'RELPATH $_=Q($_);chomp(($_,$c)=qx{readlink -f $_;pwd});
+         s:\Q$c/\E::;'
+
+B<ladon> deals badly with filenames containing " and newline, and it
+fails for output larger than 200k:
+
+  ladon '*' -- seq 36000 | wc
+
+=head3 EXAMPLES FROM ladon MANUAL
+
+It is assumed that the '--rpl's above are put in B<~/.parallel/config>
+and that it is run under a shell that supports '**' globbing (such as B<zsh>):
+
+  1$ ladon "**/*.txt" -- echo RELPATH
+
+  1$ parallel echo RELPATH ::: **/*.txt
+
+  2$ ladon "~/Documents/**/*.pdf" -- shasum FULLPATH >hashes.txt
+
+  2$ parallel shasum FULLPATH ::: ~/Documents/**/*.pdf >hashes.txt
+
+  3$ ladon -m thumbs/RELDIR "**/*.jpg" -- convert FULLPATH \
+       -thumbnail 100x100^ -gravity center -extent 100x100 \
+       thumbs/RELPATH
+
+  3$ parallel mkdir -p thumbs/RELDIR\; convert FULLPATH
+       -thumbnail 100x100^ -gravity center -extent 100x100 \
+       thumbs/RELPATH ::: **/*.jpg
+
+  4$ ladon "~/Music/*.wav" -- lame -V 2 FULLPATH DIRNAME/BASENAME.mp3
+
+  4$ parallel lame -V 2 FULLPATH DIRNAME/BASENAME.mp3 ::: ~/Music/*.wav
+
+https://github.com/danielgtaylor/ladon (Last checked: 2019-01)
+
+
+=head2 DIFFERENCES BETWEEN jobflow AND GNU Parallel
+
+Summary (see legend above):
+
+=over
+
+=item I1 - - - - - I7
+
+=item - - M3 - - (M6)
+
+=item O1 O2 O3 - O5 O6 (O7) - - O10
+
+=item E1 - - - - E6 -
+
+=item - - - - - - - - -
+
+=item - -
+
+=back
+
+
+B<jobflow> can run multiple jobs in parallel.
+
+Just like B<xargs> output from B<jobflow> jobs running in parallel mix
+together by default. B<jobflow> can buffer into files with
+B<-buffered> (placed in /run/shm), but these are not cleaned up if
+B<jobflow> dies unexpectedly (e.g. by Ctrl-C). If the total output is
+big (in the order of RAM+swap) it can cause the system to slow to a
+crawl and eventually run out of memory.
+
+Just like B<xargs> redirection and composed commands require wrapping
+with B<bash -c>.
+
+Input lines can at most be 4096 bytes.
+
+B<jobflow> is faster than GNU B<parallel> but around 6 times slower
+than B<parallel-bash>.
+
+B<jobflow> has no equivalent for B<--pipe>, or B<--sshlogin>.
+
+B<jobflow> makes it possible to set resource limits on the running
+jobs. This can be emulated by GNU B<parallel> using B<bash>'s B<ulimit>:
+
+  jobflow -limits=mem=100M,cpu=3,fsize=20M,nofiles=300 myjob
+
+  parallel 'ulimit -v 102400 -t 3 -f 204800 -n 300 myjob'
+
+
+=head3 EXAMPLES FROM jobflow README
+
+  1$ cat things.list | jobflow -threads=8 -exec ./mytask {}
+
+  1$ cat things.list | parallel -j8 ./mytask {}
+
+  2$ seq 100 | jobflow -threads=100 -exec echo {}
+
+  2$ seq 100 | parallel -j100 echo {}
+
+  3$ cat urls.txt | jobflow -threads=32 -exec wget {}
+
+  3$ cat urls.txt | parallel -j32 wget {}
+
+  4$ find . -name '*.bmp' | \
+       jobflow -threads=8 -exec bmp2jpeg {.}.bmp {.}.jpg
+
+  4$ find . -name '*.bmp' | \
+       parallel -j8 bmp2jpeg {.}.bmp {.}.jpg
+
+  5$ seq 100 | jobflow -skip 10 -count 10
+
+  5$ seq 100 | parallel --filter '{1} > 10 and {1} <= 20' echo
+
+  5$ seq 100 | parallel echo '{= $_>10 and $_<=20 or skip() =}'
+
+https://github.com/rofl0r/jobflow (Last checked: 2022-05)
+
+
+=head2 DIFFERENCES BETWEEN gargs AND GNU Parallel
+
+B<gargs> can run multiple jobs in parallel.
+
+Older versions cache output in memory. This causes it to be extremely
+slow when the output is larger than the physical RAM, and can cause
+the system to run out of memory.
+
+See more details on this in B<man parallel_design>.
+
+Newer versions cache output in files, but leave files in $TMPDIR if it
+is killed.
+
+Output to stderr (standard error) is changed if the command fails.
+
+=head3 EXAMPLES FROM gargs WEBSITE
+
+  1$ seq 12 -1 1 | gargs -p 4 -n 3 "sleep {0}; echo {1} {2}"
+
+  1$ seq 12 -1 1 | parallel -P 4 -n 3 "sleep {1}; echo {2} {3}"
+
+  2$ cat t.txt | gargs --sep "\s+" \
+       -p 2 "echo '{0}:{1}-{2}' full-line: \'{}\'"
+
+  2$ cat t.txt | parallel --colsep "\\s+" \
+       -P 2 "echo '{1}:{2}-{3}' full-line: \'{}\'"
+
+https://github.com/brentp/gargs
+
+
+=head2 DIFFERENCES BETWEEN orgalorg AND GNU Parallel
+
+B<orgalorg> can run the same job on multiple machines. This is related
+to B<--onall> and B<--nonall>.
+
+B<orgalorg> supports entering the SSH password - provided it is the
+same for all servers. GNU B<parallel> advocates using B<ssh-agent>
+instead, but it is possible to emulate B<orgalorg>'s behavior by
+setting SSHPASS and by using B<--ssh "sshpass ssh">.
+
+To make the emulation easier, make a simple alias:
+
+  alias par_emul="parallel -j0 --ssh 'sshpass ssh' --nonall --tag --lb"
+
+If you want to supply a password run:
+
+  SSHPASS=`ssh-askpass`
+
+or set the password directly:
+
+  SSHPASS=P4$$w0rd!
+
+If the above is set up you can then do:
+
+  orgalorg -o frontend1 -o frontend2 -p -C uptime
+  par_emul -S frontend1 -S frontend2 uptime
+
+  orgalorg -o frontend1 -o frontend2 -p -C top -bid 1
+  par_emul -S frontend1 -S frontend2 top -bid 1
+
+  orgalorg -o frontend1 -o frontend2 -p -er /tmp -n \
+    'md5sum /tmp/bigfile' -S bigfile
+  par_emul -S frontend1 -S frontend2 --basefile bigfile \
+    --workdir /tmp md5sum /tmp/bigfile
+
+B<orgalorg> has a progress indicator for the transferring of a
+file. GNU B<parallel> does not.
+
+https://github.com/reconquest/orgalorg
+
+
+=head2 DIFFERENCES BETWEEN Rust parallel AND GNU Parallel
+
+Rust parallel focuses on speed. It is almost as fast as B<xargs>, but
+not as fast as B<parallel-bash>. It implements a few features from GNU
+B<parallel>, but lacks many functions. All these fail:
+
+  # Read arguments from file
+  parallel -a file echo
+  # Changing the delimiter
+  parallel -d _ echo ::: a_b_c_
+
+These do something different from GNU B<parallel>
+
+  # -q to protect quoted $ and space
+  parallel -q perl -e '$a=shift; print "$a"x10000000' ::: a b c
+  # Generation of combination of inputs
+  parallel echo {1} {2} ::: red green blue ::: S M L XL XXL
+  # {= perl expression =} replacement string
+  parallel echo '{= s/new/old/ =}' ::: my.new your.new
+  # --pipe
+  seq 100000 | parallel --pipe wc
+  # linked arguments
+  parallel echo ::: S M L :::+ sml med lrg ::: R G B :::+ red grn blu
+  # Run different shell dialects
+  zsh -c 'parallel echo \={} ::: zsh && true'
+  csh -c 'parallel echo \$\{\} ::: shell && true'
+  bash -c 'parallel echo \$\({}\) ::: pwd && true'
+  # Rust parallel does not start before the last argument is read
+  (seq 10; sleep 5; echo 2) | time parallel -j2 'sleep 2; echo'
+  tail -f /var/log/syslog | parallel echo
+
+Most of the examples from the book GNU Parallel 2018 do not work, thus
+Rust parallel is not close to being a compatible replacement.
+
+Rust parallel has no remote facilities.
+
+It uses /tmp/parallel for tmp files and does not clean up if
+terminated abruptly. If another user on the system uses Rust parallel,
+then /tmp/parallel will have the wrong permissions and Rust parallel
+will fail. A malicious user can setup the right permissions and
+symlink the output file to one of the user's files and next time the
+user uses Rust parallel it will overwrite this file.
+
+  attacker$ mkdir /tmp/parallel
+  attacker$ chmod a+rwX /tmp/parallel
+  # Symlink to the file the attacker wants to zero out
+  attacker$ ln -s ~victim/.important-file /tmp/parallel/stderr_1
+  victim$ seq 1000 | parallel echo
+  # This file is now overwritten with stderr from 'echo'
+  victim$ cat ~victim/.important-file
+
+If /tmp/parallel runs full during the run, Rust parallel does not
+report this, but finishes with success - thereby risking data loss.
+
+https://github.com/mmstick/parallel
+
+
+=head2 DIFFERENCES BETWEEN Rush AND GNU Parallel
+
+B<rush> (https://github.com/shenwei356/rush) is written in Go and
+based on B<gargs>.
+
+Just like GNU B<parallel> B<rush> buffers in temporary files. But
+opposite GNU B<parallel> B<rush> does not clean up, if the process
+dies abnormally.
+
+B<rush> has some string manipulations that can be emulated by putting
+this into ~/.parallel/config (/ is used instead of %, and % is used
+instead of ^ as that is closer to bash's ${var%postfix}):
+
+  --rpl '{:} s:(\.[^/]+)*$::'
+  --rpl '{:%([^}]+?)} s:$$1(\.[^/]+)*$::'
+  --rpl '{/:%([^}]*?)} s:.*/(.*)$$1(\.[^/]+)*$:$1:'
+  --rpl '{/:} s:(.*/)?([^/.]+)(\.[^/]+)*$:$2:'
+  --rpl '{@(.*?)} /$$1/ and $_=$1;'
+
+=head3 EXAMPLES FROM rush's WEBSITE
+
+Here are the examples from B<rush>'s website with the equivalent
+command in GNU B<parallel>.
+
+B<1. Simple run, quoting is not necessary>
+
+  1$ seq 1 3 | rush echo {}
+
+  1$ seq 1 3 | parallel echo {}
+
+B<2. Read data from file (`-i`)>
+
+  2$ rush echo {} -i data1.txt -i data2.txt
+
+  2$ cat data1.txt data2.txt | parallel echo {}
+
+B<3. Keep output order (`-k`)>
+
+  3$ seq 1 3 | rush 'echo {}' -k
+
+  3$ seq 1 3 | parallel -k echo {}
+
+
+B<4. Timeout (`-t`)>
+
+  4$ time seq 1 | rush 'sleep 2; echo {}' -t 1
+
+  4$ time seq 1 | parallel --timeout 1 'sleep 2; echo {}'
+
+B<5. Retry (`-r`)>
+
+  5$ seq 1 | rush 'python unexisted_script.py' -r 1
+
+  5$ seq 1 | parallel --retries 2 'python unexisted_script.py'
+
+Use B<-u> to see it is really run twice:
+
+  5$ seq 1 | parallel -u --retries 2 'python unexisted_script.py'
+
+B<6. Dirname (`{/}`) and basename (`{%}`) and remove custom
+suffix (`{^suffix}`)>
+
+  6$ echo dir/file_1.txt.gz | rush 'echo {/} {%} {^_1.txt.gz}'
+
+  6$ echo dir/file_1.txt.gz |
+       parallel --plus echo {//} {/} {%_1.txt.gz}
+
+B<7. Get basename, and remove last (`{.}`) or any (`{:}`) extension>
+
+  7$ echo dir.d/file.txt.gz | rush 'echo {.} {:} {%.} {%:}'
+
+  7$ echo dir.d/file.txt.gz | parallel 'echo {.} {:} {/.} {/:}'
+
+B<8. Job ID, combine fields index and other replacement strings>
+
+  8$ echo 12 file.txt dir/s_1.fq.gz |
+       rush 'echo job {#}: {2} {2.} {3%:^_1}'
+
+  8$ echo 12 file.txt dir/s_1.fq.gz |
+       parallel --colsep ' ' 'echo job {#}: {2} {2.} {3/:%_1}'
+
+B<9. Capture submatch using regular expression (`{@regexp}`)>
+
+  9$ echo read_1.fq.gz | rush 'echo {@(.+)_\d}'
+
+  9$ echo read_1.fq.gz | parallel 'echo {@(.+)_\d}'
+
+B<10. Custom field delimiter (`-d`)>
+
+  10$ echo a=b=c | rush 'echo {1} {2} {3}' -d =
+
+  10$ echo a=b=c | parallel -d = echo {1} {2} {3}
+
+B<11. Send multi-lines to every command (`-n`)>
+
+  11$ seq 5 | rush -n 2 -k 'echo "{}"; echo'
+
+  11$ seq 5 |
+        parallel -n 2 -k \
+          'echo {=-1 $_=join"\n",@arg[1..$#arg] =}; echo'
+
+  11$ seq 5 | rush -n 2 -k 'echo "{}"; echo' -J ' '
+
+  11$ seq 5 | parallel -n 2 -k 'echo {}; echo'
+
+
+B<12. Custom record delimiter (`-D`), note that empty records are not used.>
+
+  12$ echo a b c d | rush -D " " -k 'echo {}'
+
+  12$ echo a b c d | parallel -d " " -k 'echo {}'
+
+  12$ echo abcd | rush -D "" -k 'echo {}'
+
+  Cannot be done by GNU Parallel
+
+  12$ cat fasta.fa
+  >seq1
+  tag
+  >seq2
+  cat
+  gat
+  >seq3
+  attac
+  a
+  cat
+
+  12$ cat fasta.fa | rush -D ">" \
+        'echo FASTA record {#}: name: {1} sequence: {2}' -k -d "\n"
+      # rush fails to join the multiline sequences
+
+  12$ cat fasta.fa | (read -n1 ignore_first_char;
+        parallel -d '>' --colsep '\n' echo FASTA record {#}: \
+          name: {1} sequence: '{=2 $_=join"",@arg[2..$#arg]=}'
+      )
+
+B<13. Assign value to variable, like `awk -v` (`-v`)>
+
+  13$ seq 1 |
+        rush 'echo Hello, {fname} {lname}!' -v fname=Wei -v lname=Shen
+
+  13$ seq 1 |
+        parallel -N0 \
+          'fname=Wei; lname=Shen; echo Hello, ${fname} ${lname}!'
+
+  13$ for var in a b; do \
+  13$   seq 1 3 | rush -k -v var=$var 'echo var: {var}, data: {}'; \
+  13$ done
+
+In GNU B<parallel> you would typically do:
+
+  13$ seq 1 3 | parallel -k echo var: {1}, data: {2} ::: a b :::: -
+
+If you I<really> want the var:
+
+  13$ seq 1 3 |
+        parallel -k var={1} ';echo var: $var, data: {}' ::: a b :::: -
+
+If you I<really> want the B<for>-loop:
+
+  13$ for var in a b; do
+        export var;
+        seq 1 3 | parallel -k 'echo var: $var, data: {}';
+      done
+
+Contrary to B<rush> this also works if the value is complex like:
+
+  My brother's 12" records
+
+
+B<14. Preset variable (`-v`), avoid repeatedly writing verbose replacement strings>
+
+  14$ # naive way
+      echo read_1.fq.gz | rush 'echo {:^_1} {:^_1}_2.fq.gz'
+
+  14$ echo read_1.fq.gz | parallel 'echo {:%_1} {:%_1}_2.fq.gz'
+
+  14$ # macro + removing suffix
+      echo read_1.fq.gz |
+        rush -v p='{:^_1}' 'echo {p} {p}_2.fq.gz'
+
+  14$ echo read_1.fq.gz |
+        parallel 'p={:%_1}; echo $p ${p}_2.fq.gz'
+
+  14$ # macro + regular expression
+      echo read_1.fq.gz | rush -v p='{@(.+?)_\d}' 'echo {p} {p}_2.fq.gz'
+
+  14$ echo read_1.fq.gz | parallel 'p={@(.+?)_\d}; echo $p ${p}_2.fq.gz'
+
+Contrary to B<rush> GNU B<parallel> works with complex values:
+
+  14$ echo "My brother's 12\"read_1.fq.gz" |
+        parallel 'p={@(.+?)_\d}; echo $p ${p}_2.fq.gz'
+
+B<15. Interrupt jobs by `Ctrl-C`, rush will stop unfinished commands and exit.>
+
+  15$ seq 1 20 | rush 'sleep 1; echo {}'
+      ^C
+
+  15$ seq 1 20 | parallel 'sleep 1; echo {}'
+      ^C
+
+B<16. Continue/resume jobs (`-c`). When some jobs failed (by
+execution failure, timeout, or canceling by user with `Ctrl + C`),
+please switch flag `-c/--continue` on and run again, so that `rush`
+can save successful commands and ignore them in I<NEXT> run.>
+
+  16$ seq 1 3 | rush 'sleep {}; echo {}' -t 3 -c
+      cat successful_cmds.rush
+      seq 1 3 | rush 'sleep {}; echo {}' -t 3 -c
+
+  16$ seq 1 3 | parallel --joblog mylog --timeout 2 \
+        'sleep {}; echo {}'
+      cat mylog
+      seq 1 3 | parallel --joblog mylog --retry-failed \
+        'sleep {}; echo {}'
+
+Multi-line jobs:
+
+  16$ seq 1 3 | rush 'sleep {}; echo {}; \
+        echo finish {}' -t 3 -c -C finished.rush
+      cat finished.rush
+      seq 1 3 | rush 'sleep {}; echo {}; \
+        echo finish {}' -t 3 -c -C finished.rush
+
+  16$ seq 1 3 |
+        parallel --joblog mylog --timeout 2 'sleep {}; echo {}; \
+          echo finish {}'
+      cat mylog
+      seq 1 3 |
+        parallel --joblog mylog --retry-failed 'sleep {}; echo {}; \
+          echo finish {}'
+
+B<17. A comprehensive example: downloading 1K+ pages given by
+three URL list files using `phantomjs save_page.js` (some page
+contents are dynamically generated by Javascript, so `wget` does not
+work). Here I set max jobs number (`-j`) as `20`, each job has a max
+running time (`-t`) of `60` seconds and `3` retry changes
+(`-r`). Continue flag `-c` is also switched on, so we can continue
+unfinished jobs. Luckily, it's accomplished in one run :)>
+
+  17$ for f in $(seq 2014 2016); do \
+        /bin/rm -rf $f; mkdir -p $f; \
+        cat $f.html.txt | rush -v d=$f -d = \
+          'phantomjs save_page.js "{}" > {d}/{3}.html' \
+          -j 20 -t 60 -r 3 -c; \
+      done
+
+GNU B<parallel> can append to an existing joblog with '+':
+
+  17$ rm mylog
+      for f in $(seq 2014 2016); do
+        /bin/rm -rf $f; mkdir -p $f;
+        cat $f.html.txt |
+          parallel -j20 --timeout 60 --retries 4 --joblog +mylog \
+            --colsep = \
+            phantomjs save_page.js {1}={2}={3} '>' $f/{3}.html
+      done
+
+B<18. A bioinformatics example: mapping with `bwa`, and
+processing result with `samtools`:>
+
+  18$ ref=ref/xxx.fa
+      threads=25
+      ls -d raw.cluster.clean.mapping/* \
+        | rush -v ref=$ref -v j=$threads -v p='{}/{%}' \
+        'bwa mem -t {j} -M -a {ref} {p}_1.fq.gz {p}_2.fq.gz >{p}.sam;\
+        samtools view -bS {p}.sam > {p}.bam; \
+        samtools sort -T {p}.tmp -@ {j} {p}.bam -o {p}.sorted.bam; \
+        samtools index {p}.sorted.bam; \
+        samtools flagstat {p}.sorted.bam > {p}.sorted.bam.flagstat; \
+        /bin/rm {p}.bam {p}.sam;' \
+        -j 2 --verbose -c -C mapping.rush
+
+GNU B<parallel> would use a function:
+
+  18$ ref=ref/xxx.fa
+      export ref
+      thr=25
+      export thr
+      bwa_sam() {
+        p="$1"
+        bam="$p".bam
+        sam="$p".sam
+        sortbam="$p".sorted.bam
+        bwa mem -t $thr -M -a $ref ${p}_1.fq.gz ${p}_2.fq.gz > "$sam"
+        samtools view -bS "$sam" > "$bam"
+        samtools sort -T ${p}.tmp -@ $thr "$bam" -o "$sortbam"
+        samtools index "$sortbam"
+        samtools flagstat "$sortbam" > "$sortbam".flagstat
+        /bin/rm "$bam" "$sam"
+      }
+      export -f bwa_sam
+      ls -d raw.cluster.clean.mapping/* |
+        parallel -j 2 --verbose --joblog mylog bwa_sam
+
+=head3 Other B<rush> features
+
+B<rush> has:
+
+=over 4
+
+=item * B<awk -v> like custom defined variables (B<-v>)
+
+With GNU B<parallel> you would simply set a shell variable:
+
+   parallel 'v={}; echo "$v"' ::: foo
+   echo foo | rush -v v={} 'echo {v}'
+
+Also B<rush> does not like special chars. So these B<do not work>:
+
+   echo does not work | rush -v v=\" 'echo {v}'
+   echo "My  brother's  12\"  records" | rush -v v={} 'echo {v}'
+
+Whereas the corresponding GNU B<parallel> version works:
+
+   parallel 'v=\"; echo "$v"' ::: works
+   parallel 'v={}; echo "$v"' ::: "My  brother's  12\"  records"
+
+=item * Exit on first error(s) (-e)
+
+This is called B<--halt now,fail=1> (or shorter: B<--halt 2>) when
+used with GNU B<parallel>.
+
+=item * Settable records sending to every command (B<-n>, default 1)
+
+This is also called B<-n> in GNU B<parallel>.
+
+=item * Practical replacement strings
+
+=over 4
+
+=item {:} remove any extension
+
+With GNU B<parallel> this can be emulated by:
+
+  parallel --plus echo '{/\..*/}' ::: foo.ext.bar.gz
+
+=item {^suffix}, remove suffix
+
+With GNU B<parallel> this can be emulated by:
+
+  parallel --plus echo '{%.bar.gz}' ::: foo.ext.bar.gz
+
+=item {@regexp}, capture submatch using regular expression
+
+With GNU B<parallel> this can be emulated by:
+
+  parallel --rpl '{@(.*?)} /$$1/ and $_=$1;' \
+    echo '{@\d_(.*).gz}' ::: 1_foo.gz
+
+=item {%.}, {%:}, basename without extension
+
+With GNU B<parallel> this can be emulated by:
+
+  parallel echo '{= s:.*/::;s/\..*// =}' ::: dir/foo.bar.gz
+
+And if you need it often, you define a B<--rpl> in
+B<$HOME/.parallel/config>:
+
+  --rpl '{%.} s:.*/::;s/\..*//'
+  --rpl '{%:} s:.*/::;s/\..*//'
+
+Then you can use them as:
+
+  parallel echo {%.} {%:} ::: dir/foo.bar.gz
+
+=back
+
+=item * Preset variable (macro)
+
+E.g.
+
+  echo foosuffix | rush -v p={^suffix} 'echo {p}_new_suffix'
+
+With GNU B<parallel> this can be emulated by:
+
+  echo foosuffix |
+    parallel --plus 'p={%suffix}; echo ${p}_new_suffix'
+
+Opposite B<rush> GNU B<parallel> works fine if the input contains
+double space, ' and ":
+
+  echo "1'6\"  foosuffix" |
+    parallel --plus 'p={%suffix}; echo "${p}"_new_suffix'
+
+
+=item * Commands of multi-lines
+
+While you I<can> use multi-lined commands in GNU B<parallel>, to
+improve readability GNU B<parallel> discourages the use of multi-line
+commands. In most cases it can be written as a function:
+
+  seq 1 3 |
+    parallel --timeout 2 --joblog my.log 'sleep {}; echo {}; \
+      echo finish {}'
+
+Could be written as:
+
+  doit() {
+    sleep "$1"
+    echo "$1"
+    echo finish "$1"
+  }
+  export -f doit
+  seq 1 3 | parallel --timeout 2 --joblog my.log doit
+
+The failed commands can be resumed with:
+
+  seq 1 3 |
+    parallel --resume-failed --joblog my.log 'sleep {}; echo {};\
+      echo finish {}'
+
+=back
+
+https://github.com/shenwei356/rush
+
+
+=head2 DIFFERENCES BETWEEN ClusterSSH AND GNU Parallel
+
+ClusterSSH solves a different problem than GNU B<parallel>.
+
+ClusterSSH opens a terminal window for each computer and using a
+master window you can run the same command on all the computers. This
+is typically used for administrating several computers that are almost
+identical.
+
+GNU B<parallel> runs the same (or different) commands with different
+arguments in parallel possibly using remote computers to help
+computing. If more than one computer is listed in B<-S> GNU B<parallel> may
+only use one of these (e.g. if there are 8 jobs to be run and one
+computer has 8 cores).
+
+GNU B<parallel> can be used as a poor-man's version of ClusterSSH:
+
+B<parallel --nonall -S server-a,server-b do_stuff foo bar>
+
+https://github.com/duncs/clusterssh
+
+
+=head2 DIFFERENCES BETWEEN coshell AND GNU Parallel
+
+B<coshell> only accepts full commands on standard input. Any quoting
+needs to be done by the user.
+
+Commands are run in B<sh> so any B<bash>/B<tcsh>/B<zsh> specific
+syntax will not work.
+
+Output can be buffered by using B<-d>. Output is buffered in memory,
+so big output can cause swapping and therefore be terrible slow or
+even cause out of memory.
+
+https://github.com/gdm85/coshell (Last checked: 2019-01)
+
+
+=head2 DIFFERENCES BETWEEN spread AND GNU Parallel
+
+B<spread> runs commands on all directories.
+
+It can be emulated with GNU B<parallel> using this Bash function:
+
+  spread() {
+    _cmds() {
+      perl -e '$"=" && ";print "@ARGV"' "cd {}" "$@"
+    }
+    parallel $(_cmds "$@")'|| echo exit status $?' ::: */
+  }
+
+This works except for the B<--exclude> option.
+
+(Last checked: 2017-11)
+
+
+=head2 DIFFERENCES BETWEEN pyargs AND GNU Parallel
+
+B<pyargs> deals badly with input containing spaces. It buffers stdout,
+but not stderr. It buffers in RAM. {} does not work as replacement
+string. It does not support running functions.
+
+B<pyargs> does not support composed commands if run with B<--lines>,
+and fails on B<pyargs traceroute gnu.org fsf.org>.
+
+=head3 Examples
+
+  seq 5 | pyargs -P50 -L seq
+  seq 5 | parallel -P50 --lb seq
+
+  seq 5 | pyargs -P50 --mark -L seq
+  seq 5 | parallel -P50 --lb \
+    --tagstring OUTPUT'[{= $_=$job->replaced()=}]' seq
+  # Similar, but not precisely the same
+  seq 5 | parallel -P50 --lb --tag seq
+
+  seq 5 | pyargs -P50  --mark command
+  # Somewhat longer with GNU Parallel due to the special
+  #   --mark formatting
+  cmd="$(echo "command" | parallel --shellquote)"
+  wrap_cmd() {
+     echo "MARK $cmd $@================================" >&3
+     echo "OUTPUT START[$cmd $@]:"
+     eval $cmd "$@"
+     echo "OUTPUT END[$cmd $@]"
+  }
+  (seq 5 | env_parallel -P2 wrap_cmd) 3>&1
+  # Similar, but not exactly the same
+  seq 5 | parallel -t --tag command
+
+  (echo '1  2  3';echo 4 5 6) | pyargs  --stream seq
+  (echo '1  2  3';echo 4 5 6) | perl -pe 's/\n/ /' |
+    parallel -r -d' ' seq
+  # Similar, but not exactly the same
+  parallel seq ::: 1 2 3 4 5 6
+
+https://github.com/robertblackwell/pyargs (Last checked: 2019-01)
+
+
+=head2 DIFFERENCES BETWEEN concurrently AND GNU Parallel
+
+B<concurrently> runs jobs in parallel.
+
+The output is prepended with the job number, and may be incomplete:
+
+  $ concurrently 'seq 100000' | (sleep 3;wc -l)
+  7165
+
+When pretty printing it caches output in memory. Output mixes by using
+test MIX below whether or not output is cached.
+
+There seems to be no way of making a template command and have
+B<concurrently> fill that with different args. The full commands must
+be given on the command line.
+
+There is also no way of controlling how many jobs should be run in
+parallel at a time - i.e. "number of jobslots". Instead all jobs are
+simply started in parallel.
+
+https://github.com/kimmobrunfeldt/concurrently (Last checked: 2019-01)
+
+
+=head2 DIFFERENCES BETWEEN map(soveran) AND GNU Parallel
+
+B<map> does not run jobs in parallel by default. The README suggests using:
+
+  ... | map t 'sleep $t && say done &'
+
+But this fails if more jobs are run in parallel than the number of
+available processes. Since there is no support for parallelization in
+B<map> itself, the output also mixes:
+
+  seq 10 | map i 'echo start-$i && sleep 0.$i && echo end-$i &'
+
+The major difference is that GNU B<parallel> is built for parallelization
+and B<map> is not. So GNU B<parallel> has lots of ways of dealing with the
+issues that parallelization raises:
+
+=over 4
+
+=item *
+
+Keep the number of processes manageable
+
+=item *
+
+Make sure output does not mix
+
+=item *
+
+Make Ctrl-C kill all running processes
+
+=back
+
+=head3 EXAMPLES FROM maps WEBSITE
+
+Here are the 5 examples converted to GNU Parallel:
+
+  1$ ls *.c | map f 'foo $f'
+  1$ ls *.c | parallel foo
+
+  2$ ls *.c | map f 'foo $f; bar $f'
+  2$ ls *.c | parallel 'foo {}; bar {}'
+
+  3$ cat urls | map u 'curl -O $u'
+  3$ cat urls | parallel curl -O
+
+  4$ printf "1\n1\n1\n" | map t 'sleep $t && say done'
+  4$ printf "1\n1\n1\n" | parallel 'sleep {} && say done'
+  4$ parallel 'sleep {} && say done' ::: 1 1 1
+
+  5$ printf "1\n1\n1\n" | map t 'sleep $t && say done &'
+  5$ printf "1\n1\n1\n" | parallel -j0 'sleep {} && say done'
+  5$ parallel -j0 'sleep {} && say done' ::: 1 1 1
+
+https://github.com/soveran/map (Last checked: 2019-01)
+
+
+=head2 DIFFERENCES BETWEEN loop AND GNU Parallel
+
+B<loop> mixes stdout and stderr:
+
+    loop 'ls /no-such-file' >/dev/null
+
+B<loop>'s replacement string B<$ITEM> does not quote strings:
+
+    echo 'two  spaces' | loop 'echo $ITEM'
+
+B<loop> cannot run functions:
+
+    myfunc() { echo joe; }
+    export -f myfunc
+    loop 'myfunc this fails'
+
+=head3 EXAMPLES FROM loop's WEBSITE
+
+Some of the examples from https://github.com/Miserlou/Loop/ can be
+emulated with GNU B<parallel>:
+
+    # A couple of functions will make the code easier to read
+    $ loopy() {
+        yes | parallel -uN0 -j1 "$@"
+      }
+    $ export -f loopy
+    $ time_out() {
+        parallel -uN0 -q --timeout "$@" ::: 1
+      }
+    $ match() {
+        perl -0777 -ne 'grep /'"$1"'/,$_ and print or exit 1'
+      }
+    $ export -f match
+
+    $ loop 'ls' --every 10s
+    $ loopy --delay 10s ls
+
+    $ loop 'touch $COUNT.txt' --count-by 5
+    $ loopy touch '{= $_=seq()*5 =}'.txt
+
+    $ loop --until-contains 200 -- \
+        ./get_response_code.sh --site mysite.biz`
+    $ loopy --halt now,success=1 \
+        './get_response_code.sh --site mysite.biz | match 200'
+
+    $ loop './poke_server' --for-duration 8h
+    $ time_out 8h loopy ./poke_server
+
+    $ loop './poke_server' --until-success
+    $ loopy --halt now,success=1 ./poke_server
+
+    $ cat files_to_create.txt | loop 'touch $ITEM'
+    $ cat files_to_create.txt | parallel touch {}
+
+    $ loop 'ls' --for-duration 10min --summary
+    # --joblog is somewhat more verbose than --summary
+    $ time_out 10m loopy --joblog my.log ./poke_server; cat my.log
+
+    $ loop 'echo hello'
+    $ loopy echo hello
+
+    $ loop 'echo $COUNT'
+    # GNU Parallel counts from 1
+    $ loopy echo {#}
+    # Counting from 0 can be forced
+    $ loopy echo '{= $_=seq()-1 =}'
+
+    $ loop 'echo $COUNT' --count-by 2
+    $ loopy echo '{= $_=2*(seq()-1) =}'
+
+    $ loop 'echo $COUNT' --count-by 2 --offset 10
+    $ loopy echo '{= $_=10+2*(seq()-1) =}'
+
+    $ loop 'echo $COUNT' --count-by 1.1
+    # GNU Parallel rounds 3.3000000000000003 to 3.3
+    $ loopy echo '{= $_=1.1*(seq()-1) =}'
+
+    $ loop 'echo $COUNT $ACTUALCOUNT' --count-by 2
+    $ loopy echo '{= $_=2*(seq()-1) =} {#}'
+
+    $ loop 'echo $COUNT' --num 3 --summary
+    # --joblog is somewhat more verbose than --summary
+    $ seq 3 | parallel --joblog my.log echo; cat my.log
+
+    $ loop 'ls -foobarbatz' --num 3 --summary
+    # --joblog is somewhat more verbose than --summary
+    $ seq 3 | parallel --joblog my.log -N0 ls -foobarbatz; cat my.log
+
+    $ loop 'echo $COUNT' --count-by 2 --num 50 --only-last
+    # Can be emulated by running 2 jobs
+    $ seq 49 | parallel echo '{= $_=2*(seq()-1) =}' >/dev/null
+    $ echo 50| parallel echo '{= $_=2*(seq()-1) =}'
+
+    $ loop 'date' --every 5s
+    $ loopy --delay 5s date
+
+    $ loop 'date' --for-duration 8s --every 2s
+    $ time_out 8s loopy --delay 2s date
+
+    $ loop 'date -u' --until-time '2018-05-25 20:50:00' --every 5s
+    $ seconds=$((`date -d 2019-05-25T20:50:00 +%s` - `date  +%s`))s
+    $ time_out $seconds loopy --delay 5s date -u
+
+    $ loop 'echo $RANDOM' --until-contains "666"
+    $ loopy --halt now,success=1 'echo $RANDOM | match 666'
+
+    $ loop 'if (( RANDOM % 2 )); then
+              (echo "TRUE"; true);
+            else
+              (echo "FALSE"; false);
+            fi' --until-success
+    $ loopy --halt now,success=1 'if (( $RANDOM % 2 )); then
+                                    (echo "TRUE"; true);
+                                  else
+                                    (echo "FALSE"; false);
+                                  fi'
+
+    $ loop 'if (( RANDOM % 2 )); then
+        (echo "TRUE"; true);
+      else
+        (echo "FALSE"; false);
+      fi' --until-error
+    $ loopy --halt now,fail=1 'if (( $RANDOM % 2 )); then
+                                 (echo "TRUE"; true);
+                               else
+                                 (echo "FALSE"; false);
+                               fi'
+
+    $ loop 'date' --until-match "(\d{4})"
+    $ loopy --halt now,success=1 'date | match [0-9][0-9][0-9][0-9]'
+
+    $ loop 'echo $ITEM' --for red,green,blue
+    $ parallel echo ::: red green blue
+
+    $ cat /tmp/my-list-of-files-to-create.txt | loop 'touch $ITEM'
+    $ cat /tmp/my-list-of-files-to-create.txt | parallel touch
+
+    $ ls | loop 'cp $ITEM $ITEM.bak'; ls
+    $ ls | parallel cp {} {}.bak; ls
+
+    $ loop 'echo $ITEM | tr a-z A-Z' -i
+    $ parallel 'echo {} | tr a-z A-Z'
+    # Or more efficiently:
+    $ parallel --pipe tr a-z A-Z
+
+    $ loop 'echo $ITEM' --for "`ls`"
+    $ parallel echo {} ::: "`ls`"
+
+    $ ls | loop './my_program $ITEM' --until-success;
+    $ ls | parallel --halt now,success=1 ./my_program {}
+
+    $ ls | loop './my_program $ITEM' --until-fail;
+    $ ls | parallel --halt now,fail=1 ./my_program {}
+
+    $ ./deploy.sh;
+      loop 'curl -sw "%{http_code}" http://coolwebsite.biz' \
+        --every 5s --until-contains 200;
+      ./announce_to_slack.sh
+    $ ./deploy.sh;
+      loopy --delay 5s --halt now,success=1 \
+      'curl -sw "%{http_code}" http://coolwebsite.biz | match 200';
+      ./announce_to_slack.sh
+
+    $ loop "ping -c 1 mysite.com" --until-success; ./do_next_thing
+    $ loopy --halt now,success=1 ping -c 1 mysite.com; ./do_next_thing
+
+    $ ./create_big_file -o my_big_file.bin;
+      loop 'ls' --until-contains 'my_big_file.bin';
+      ./upload_big_file my_big_file.bin
+    # inotifywait is a better tool to detect file system changes.
+    # It can even make sure the file is complete
+    # so you are not uploading an incomplete file
+    $ inotifywait -qmre MOVED_TO -e CLOSE_WRITE --format %w%f . |
+        grep my_big_file.bin
+
+    $ ls | loop 'cp $ITEM $ITEM.bak'
+    $ ls | parallel cp {} {}.bak
+
+    $ loop './do_thing.sh' --every 15s --until-success --num 5
+    $ parallel --retries 5 --delay 15s ::: ./do_thing.sh
+
+https://github.com/Miserlou/Loop/ (Last checked: 2018-10)
+
+
+=head2 DIFFERENCES BETWEEN lorikeet AND GNU Parallel
+
+B<lorikeet> can run jobs in parallel. It does this based on a
+dependency graph described in a file, so this is similar to B<make>.
+
+https://github.com/cetra3/lorikeet (Last checked: 2018-10)
+
+
+=head2 DIFFERENCES BETWEEN spp AND GNU Parallel
+
+B<spp> can run jobs in parallel. B<spp> does not use a command
+template to generate the jobs, but requires jobs to be in a
+file. Output from the jobs mix.
+
+https://github.com/john01dav/spp (Last checked: 2019-01)
+
+
+=head2 DIFFERENCES BETWEEN paral AND GNU Parallel
+
+B<paral> prints a lot of status information and stores the output from
+the commands run into files. This means it cannot be used the middle
+of a pipe like this
+
+  paral "echo this" "echo does not" "echo work" | wc
+
+Instead it puts the output into files named like
+B<out_#_I<command>.out.log>. To get a very similar behaviour with GNU
+B<parallel> use B<--results
+'out_{#}_{=s/[^\sa-z_0-9]//g;s/\s+/_/g=}.log' --eta>
+
+B<paral> only takes arguments on the command line and each argument
+should be a full command. Thus it does not use command templates.
+
+This limits how many jobs it can run in total, because they all need
+to fit on a single command line.
+
+B<paral> has no support for running jobs remotely.
+
+=head3 EXAMPLES FROM README.markdown
+
+The examples from B<README.markdown> and the corresponding command run
+with GNU B<parallel> (B<--results
+'out_{#}_{=s/[^\sa-z_0-9]//g;s/\s+/_/g=}.log' --eta> is omitted from
+the GNU B<parallel> command):
+
+  1$ paral "command 1" "command 2 --flag" "command arg1 arg2"
+  1$ parallel ::: "command 1" "command 2 --flag" "command arg1 arg2"
+
+  2$ paral "sleep 1 && echo c1" "sleep 2 && echo c2" \
+       "sleep 3 && echo c3" "sleep 4 && echo c4"  "sleep 5 && echo c5"
+  2$ parallel ::: "sleep 1 && echo c1" "sleep 2 && echo c2" \
+       "sleep 3 && echo c3" "sleep 4 && echo c4"  "sleep 5 && echo c5"
+     # Or shorter:
+     parallel "sleep {} && echo c{}" ::: {1..5}
+
+  3$ paral -n=0 "sleep 5 && echo c5" "sleep 4 && echo c4" \
+       "sleep 3 && echo c3" "sleep 2 && echo c2" "sleep 1 && echo c1"
+  3$ parallel ::: "sleep 5 && echo c5" "sleep 4 && echo c4" \
+       "sleep 3 && echo c3" "sleep 2 && echo c2" "sleep 1 && echo c1"
+     # Or shorter:
+     parallel -j0 "sleep {} && echo c{}" ::: 5 4 3 2 1
+
+  4$ paral -n=1 "sleep 5 && echo c5" "sleep 4 && echo c4" \
+       "sleep 3 && echo c3" "sleep 2 && echo c2" "sleep 1 && echo c1"
+  4$ parallel -j1 "sleep {} && echo c{}" ::: 5 4 3 2 1
+
+  5$ paral -n=2 "sleep 5 && echo c5" "sleep 4 && echo c4" \
+       "sleep 3 && echo c3" "sleep 2 && echo c2" "sleep 1 && echo c1"
+  5$ parallel -j2 "sleep {} && echo c{}" ::: 5 4 3 2 1
+
+  6$ paral -n=5 "sleep 5 && echo c5" "sleep 4 && echo c4" \
+       "sleep 3 && echo c3" "sleep 2 && echo c2" "sleep 1 && echo c1"
+  6$ parallel -j5 "sleep {} && echo c{}" ::: 5 4 3 2 1
+
+  7$ paral -n=1 "echo a && sleep 0.5 && echo b && sleep 0.5 && \
+       echo c && sleep 0.5 && echo d && sleep 0.5 && \
+       echo e && sleep 0.5 && echo f && sleep 0.5 && \
+       echo g && sleep 0.5 && echo h"
+  7$ parallel ::: "echo a && sleep 0.5 && echo b && sleep 0.5 && \
+       echo c && sleep 0.5 && echo d && sleep 0.5 && \
+       echo e && sleep 0.5 && echo f && sleep 0.5 && \
+       echo g && sleep 0.5 && echo h"
+
+https://github.com/amattn/paral (Last checked: 2019-01)
+
+
+=head2 DIFFERENCES BETWEEN concurr AND GNU Parallel
+
+B<concurr> is built to run jobs in parallel using a client/server
+model.
+
+=head3 EXAMPLES FROM README.md
+
+The examples from B<README.md>:
+
+  1$ concurr 'echo job {#} on slot {%}: {}' : arg1 arg2 arg3 arg4
+  1$ parallel 'echo job {#} on slot {%}: {}' ::: arg1 arg2 arg3 arg4
+
+  2$ concurr 'echo job {#} on slot {%}: {}' :: file1 file2 file3
+  2$ parallel 'echo job {#} on slot {%}: {}' :::: file1 file2 file3
+
+  3$ concurr 'echo {}' < input_file
+  3$ parallel 'echo {}' < input_file
+
+  4$ cat file | concurr 'echo {}'
+  4$ cat file | parallel 'echo {}'
+
+B<concurr> deals badly empty input files and with output larger than
+64 KB.
+
+https://github.com/mmstick/concurr (Last checked: 2019-01)
+
+
+=head2 DIFFERENCES BETWEEN lesser-parallel AND GNU Parallel
+
+B<lesser-parallel> is the inspiration for B<parallel --embed>. Both
+B<lesser-parallel> and B<parallel --embed> define bash functions that
+can be included as part of a bash script to run jobs in parallel.
+
+B<lesser-parallel> implements a few of the replacement strings, but
+hardly any options, whereas B<parallel --embed> gives you the full
+GNU B<parallel> experience.
+
+https://github.com/kou1okada/lesser-parallel (Last checked: 2019-01)
+
+
+=head2 DIFFERENCES BETWEEN npm-parallel AND GNU Parallel
+
+B<npm-parallel> can run npm tasks in parallel.
+
+There are no examples and very little documentation, so it is hard to
+compare to GNU B<parallel>.
+
+https://github.com/spion/npm-parallel (Last checked: 2019-01)
+
+
+=head2 DIFFERENCES BETWEEN machma AND GNU Parallel
+
+B<machma> runs tasks in parallel. It gives time stamped
+output. It buffers in RAM.
+
+=head3 EXAMPLES FROM README.md
+
+The examples from README.md:
+
+  1$ # Put shorthand for timestamp in config for the examples
+     echo '--rpl '\
+       \''{time} $_=::strftime("%Y-%m-%d %H:%M:%S",localtime())'\' \
+       > ~/.parallel/machma
+     echo '--line-buffer --tagstring "{#} {time} {}"' \
+       >> ~/.parallel/machma
+
+  2$ find . -iname '*.jpg' |
+       machma --  mogrify -resize 1200x1200 -filter Lanczos {}
+     find . -iname '*.jpg' |
+       parallel --bar -Jmachma mogrify -resize 1200x1200 \
+         -filter Lanczos {}
+
+  3$ cat /tmp/ips | machma -p 2 -- ping -c 2 -q {}
+  3$ cat /tmp/ips | parallel -j2 -Jmachma ping -c 2 -q {}
+
+  4$ cat /tmp/ips |
+       machma -- sh -c 'ping -c 2 -q $0 > /dev/null && echo alive' {}
+  4$ cat /tmp/ips |
+       parallel -Jmachma 'ping -c 2 -q {} > /dev/null && echo alive'
+
+  5$ find . -iname '*.jpg' |
+       machma --timeout 5s -- mogrify -resize 1200x1200 \
+         -filter Lanczos {}
+  5$ find . -iname '*.jpg' |
+       parallel --timeout 5s --bar mogrify -resize 1200x1200 \
+         -filter Lanczos {}
+
+  6$ find . -iname '*.jpg' -print0 |
+       machma --null --  mogrify -resize 1200x1200 -filter Lanczos {}
+  6$ find . -iname '*.jpg' -print0 |
+       parallel --null --bar mogrify -resize 1200x1200 \
+         -filter Lanczos {}
+
+https://github.com/fd0/machma (Last checked: 2019-06)
+
+
+=head2 DIFFERENCES BETWEEN interlace AND GNU Parallel
+
+Summary (see legend above):
+
+=over
+
+=item - I2 I3 I4 - - -
+
+=item M1 - M3 - - M6
+
+=item - O2 O3 - - - - x x
+
+=item E1 E2 - - - - -
+
+=item - - - - - - - - -
+
+=item - -
+
+=back
+
+B<interlace> is built for network analysis to run network tools in parallel.
+
+B<interface> does not buffer output, so output from different jobs mixes.
+
+The overhead for each target is O(n*n), so with 1000 targets it
+becomes very slow with an overhead in the order of 500ms/target.
+
+=head3 EXAMPLES FROM interlace's WEBSITE
+
+Using B<prips> most of the examples from
+https://github.com/codingo/Interlace can be run with GNU B<parallel>:
+
+Blocker
+
+  commands.txt:
+    mkdir -p _output_/_target_/scans/
+    _blocker_
+    nmap _target_ -oA _output_/_target_/scans/_target_-nmap
+  interlace -tL ./targets.txt -cL commands.txt -o $output
+
+  parallel -a targets.txt \
+    mkdir -p $output/{}/scans/\; nmap {} -oA $output/{}/scans/{}-nmap
+
+Blocks
+
+  commands.txt:
+    _block:nmap_
+    mkdir -p _target_/output/scans/
+    nmap _target_ -oN _target_/output/scans/_target_-nmap
+    _block:nmap_
+    nikto --host _target_
+  interlace -tL ./targets.txt -cL commands.txt
+
+  _nmap() {
+    mkdir -p $1/output/scans/
+    nmap $1 -oN $1/output/scans/$1-nmap
+  }
+  export -f _nmap
+  parallel ::: _nmap "nikto --host" :::: targets.txt
+
+Run Nikto Over Multiple Sites
+
+  interlace -tL ./targets.txt -threads 5 \
+    -c "nikto --host _target_ > ./_target_-nikto.txt" -v
+
+  parallel -a targets.txt -P5 nikto --host {} \> ./{}_-nikto.txt
+
+Run Nikto Over Multiple Sites and Ports
+
+  interlace -tL ./targets.txt -threads 5 -c \
+    "nikto --host _target_:_port_ > ./_target_-_port_-nikto.txt" \
+    -p 80,443 -v
+
+  parallel -P5 nikto --host {1}:{2} \> ./{1}-{2}-nikto.txt \
+    :::: targets.txt ::: 80 443
+
+Run a List of Commands against Target Hosts
+
+  commands.txt:
+    nikto --host _target_:_port_ > _output_/_target_-nikto.txt
+    sslscan _target_:_port_ >  _output_/_target_-sslscan.txt
+    testssl.sh _target_:_port_ > _output_/_target_-testssl.txt
+  interlace -t example.com -o ~/Engagements/example/ \
+    -cL ./commands.txt -p 80,443
+
+  parallel --results ~/Engagements/example/{2}:{3}{1} {1} {2}:{3} \
+    ::: "nikto --host" sslscan testssl.sh ::: example.com ::: 80 443
+
+CIDR notation with an application that doesn't support it
+
+  interlace -t 192.168.12.0/24 -c "vhostscan _target_ \
+    -oN _output_/_target_-vhosts.txt" -o ~/scans/ -threads 50
+
+  prips 192.168.12.0/24 |
+    parallel -P50 vhostscan {} -oN ~/scans/{}-vhosts.txt
+
+Glob notation with an application that doesn't support it
+
+  interlace -t 192.168.12.* -c "vhostscan _target_ \
+    -oN _output_/_target_-vhosts.txt" -o ~/scans/ -threads 50
+
+  # Glob is not supported in prips
+  prips 192.168.12.0/24 |
+    parallel -P50 vhostscan {} -oN ~/scans/{}-vhosts.txt
+
+Dash (-) notation with an application that doesn't support it
+
+  interlace -t 192.168.12.1-15 -c \
+    "vhostscan _target_ -oN _output_/_target_-vhosts.txt" \
+    -o ~/scans/ -threads 50
+
+  # Dash notation is not supported in prips
+  prips 192.168.12.1 192.168.12.15 |
+    parallel -P50 vhostscan {} -oN ~/scans/{}-vhosts.txt
+
+Threading Support for an application that doesn't support it
+
+  interlace -tL ./target-list.txt -c \
+    "vhostscan -t _target_ -oN _output_/_target_-vhosts.txt" \
+    -o ~/scans/ -threads 50
+
+  cat ./target-list.txt |
+    parallel -P50 vhostscan -t {} -oN ~/scans/{}-vhosts.txt
+
+alternatively
+
+  ./vhosts-commands.txt:
+    vhostscan -t $target -oN _output_/_target_-vhosts.txt
+  interlace -cL ./vhosts-commands.txt -tL ./target-list.txt \
+    -threads 50 -o ~/scans
+
+  ./vhosts-commands.txt:
+    vhostscan -t "$1" -oN "$2"
+  parallel -P50 ./vhosts-commands.txt {} ~/scans/{}-vhosts.txt \
+    :::: ./target-list.txt
+
+Exclusions
+
+  interlace -t 192.168.12.0/24 -e 192.168.12.0/26 -c \
+    "vhostscan _target_ -oN _output_/_target_-vhosts.txt" \
+    -o ~/scans/ -threads 50
+
+  prips 192.168.12.0/24 | grep -xv -Ff <(prips 192.168.12.0/26) |
+    parallel -P50 vhostscan {} -oN ~/scans/{}-vhosts.txt
+
+Run Nikto Using Multiple Proxies
+
+   interlace -tL ./targets.txt -pL ./proxies.txt -threads 5 -c \
+     "nikto --host _target_:_port_ -useproxy _proxy_ > \
+      ./_target_-_port_-nikto.txt" -p 80,443 -v
+
+   parallel -j5 \
+     "nikto --host {1}:{2} -useproxy {3} > ./{1}-{2}-nikto.txt" \
+     :::: ./targets.txt ::: 80 443 :::: ./proxies.txt
+
+https://github.com/codingo/Interlace (Last checked: 2019-09)
+
+
+=head2 DIFFERENCES BETWEEN otonvm Parallel AND GNU Parallel
+
+I have been unable to get the code to run at all. It seems unfinished.
+
+https://github.com/otonvm/Parallel (Last checked: 2019-02)
+
+
+=head2 DIFFERENCES BETWEEN k-bx par AND GNU Parallel
+
+B<par> requires Haskell to work. This limits the number of platforms
+this can work on.
+
+B<par> does line buffering in memory. The memory usage is 3x the
+longest line (compared to 1x for B<parallel --lb>). Commands must be
+given as arguments. There is no template.
+
+These are the examples from https://github.com/k-bx/par with the
+corresponding GNU B<parallel> command.
+
+  par "echo foo; sleep 1; echo foo; sleep 1; echo foo" \
+      "echo bar; sleep 1; echo bar; sleep 1; echo bar" && echo "success"
+  parallel --lb ::: "echo foo; sleep 1; echo foo; sleep 1; echo foo" \
+      "echo bar; sleep 1; echo bar; sleep 1; echo bar" && echo "success"
+
+  par "echo foo; sleep 1; foofoo" \
+      "echo bar; sleep 1; echo bar; sleep 1; echo bar" && echo "success"
+  parallel --lb --halt 1 ::: "echo foo; sleep 1; foofoo" \
+      "echo bar; sleep 1; echo bar; sleep 1; echo bar" && echo "success"
+
+  par "PARPREFIX=[fooechoer] echo foo" "PARPREFIX=[bar] echo bar"
+  parallel --lb --colsep , --tagstring {1} {2} \
+    ::: "[fooechoer],echo foo" "[bar],echo bar"
+
+  par --succeed "foo" "bar" && echo 'wow'
+  parallel "foo" "bar"; true && echo 'wow'
+
+https://github.com/k-bx/par (Last checked: 2019-02)
+
+=head2 DIFFERENCES BETWEEN parallelshell AND GNU Parallel
+
+B<parallelshell> does not allow for composed commands:
+
+  # This does not work
+  parallelshell 'echo foo;echo bar' 'echo baz;echo quuz'
+
+Instead you have to wrap that in a shell:
+
+  parallelshell 'sh -c "echo foo;echo bar"' 'sh -c "echo baz;echo quuz"'
+
+It buffers output in RAM. All commands must be given on the command
+line and all commands are started in parallel at the same time. This
+will cause the system to freeze if there are so many jobs that there
+is not enough memory to run them all at the same time.
+
+https://github.com/keithamus/parallelshell (Last checked: 2019-02)
+
+https://github.com/darkguy2008/parallelshell (Last checked: 2019-03)
+
+
+=head2 DIFFERENCES BETWEEN shell-executor AND GNU Parallel
+
+B<shell-executor> does not allow for composed commands:
+
+  # This does not work
+  sx 'echo foo;echo bar' 'echo baz;echo quuz'
+
+Instead you have to wrap that in a shell:
+
+  sx 'sh -c "echo foo;echo bar"' 'sh -c "echo baz;echo quuz"'
+
+It buffers output in RAM. All commands must be given on the command
+line and all commands are started in parallel at the same time. This
+will cause the system to freeze if there are so many jobs that there
+is not enough memory to run them all at the same time.
+
+https://github.com/royriojas/shell-executor (Last checked: 2019-02)
+
+
+=head2 DIFFERENCES BETWEEN non-GNU par AND GNU Parallel
+
+B<par> buffers in memory to avoid mixing of jobs. It takes 1s per 1
+million output lines.
+
+B<par> needs to have all commands before starting the first job. The
+jobs are read from stdin (standard input) so any quoting will have to
+be done by the user.
+
+Stdout (standard output) is prepended with o:. Stderr (standard error)
+is sendt to stdout (standard output) and prepended with e:.
+
+For short jobs with little output B<par> is 20% faster than GNU
+B<parallel> and 60% slower than B<xargs>.
+
+https://github.com/UnixJunkie/PAR
+
+https://savannah.nongnu.org/projects/par (Last checked: 2019-02)
+
+
+=head2 DIFFERENCES BETWEEN fd AND GNU Parallel
+
+B<fd> does not support composed commands, so commands must be wrapped
+in B<sh -c>.
+
+It buffers output in RAM.
+
+It only takes file names from the filesystem as input (similar to B<find>).
+
+https://github.com/sharkdp/fd (Last checked: 2019-02)
+
+
+=head2 DIFFERENCES BETWEEN lateral AND GNU Parallel
+
+B<lateral> is very similar to B<sem>: It takes a single command and
+runs it in the background. The design means that output from parallel
+running jobs may mix. If it dies unexpectly it leaves a socket in
+~/.lateral/socket.PID.
+
+B<lateral> deals badly with too long command lines. This makes the
+B<lateral> server crash:
+
+  lateral run echo `seq 100000| head -c 1000k`
+
+Any options will be read by B<lateral> so this does not work
+(B<lateral> interprets the B<-l>):
+
+  lateral run ls -l
+
+Composed commands do not work:
+
+  lateral run pwd ';' ls
+
+Functions do not work:
+
+  myfunc() { echo a; }
+  export -f myfunc
+  lateral run myfunc
+
+Running B<emacs> in the terminal causes the parent shell to die:
+
+  echo '#!/bin/bash' > mycmd
+  echo emacs -nw >> mycmd
+  chmod +x mycmd
+  lateral start
+  lateral run ./mycmd
+
+Here are the examples from https://github.com/akramer/lateral with the
+corresponding GNU B<sem> and GNU B<parallel> commands:
+
+  1$ lateral start
+     for i in $(cat /tmp/names); do
+       lateral run -- some_command $i
+     done
+     lateral wait
+  
+  1$ for i in $(cat /tmp/names); do
+       sem some_command $i
+     done
+     sem --wait
+  
+  1$ parallel some_command :::: /tmp/names
+
+  2$ lateral start
+     for i in $(seq 1 100); do
+       lateral run -- my_slow_command < workfile$i > /tmp/logfile$i
+     done
+     lateral wait
+    
+  2$ for i in $(seq 1 100); do
+       sem my_slow_command < workfile$i > /tmp/logfile$i
+     done
+     sem --wait
+    
+  2$ parallel 'my_slow_command < workfile{} > /tmp/logfile{}' \
+       ::: {1..100}
+
+  3$ lateral start -p 0 # yup, it will just queue tasks
+     for i in $(seq 1 100); do
+       lateral run -- command_still_outputs_but_wont_spam inputfile$i
+     done
+     # command output spam can commence
+     lateral config -p 10; lateral wait
+    
+  3$ for i in $(seq 1 100); do
+       echo "command inputfile$i" >> joblist
+     done
+     parallel -j 10 :::: joblist
+  
+  3$ echo 1 > /tmp/njobs
+     parallel -j /tmp/njobs command inputfile{} \
+       ::: {1..100} &
+     echo 10 >/tmp/njobs
+     wait
+
+https://github.com/akramer/lateral (Last checked: 2019-03)
+
+
+=head2 DIFFERENCES BETWEEN with-this AND GNU Parallel
+
+The examples from https://github.com/amritb/with-this.git and the
+corresponding GNU B<parallel> command:
+
+  with -v "$(cat myurls.txt)" "curl -L this"
+  parallel curl -L ::: myurls.txt
+
+  with -v "$(cat myregions.txt)" \
+    "aws --region=this ec2 describe-instance-status"
+  parallel aws --region={} ec2 describe-instance-status \
+    :::: myregions.txt
+
+  with -v "$(ls)" "kubectl --kubeconfig=this get pods"
+  ls | parallel kubectl --kubeconfig={} get pods
+
+  with -v "$(ls | grep config)" "kubectl --kubeconfig=this get pods"
+  ls | grep config | parallel kubectl --kubeconfig={} get pods
+
+  with -v "$(echo {1..10})" "echo 123"
+  parallel -N0 echo 123 ::: {1..10}
+
+Stderr is merged with stdout. B<with-this> buffers in RAM. It uses 3x
+the output size, so you cannot have output larger than 1/3rd the
+amount of RAM. The input values cannot contain spaces. Composed
+commands do not work.
+
+B<with-this> gives some additional information, so the output has to
+be cleaned before piping it to the next command.
+
+https://github.com/amritb/with-this.git (Last checked: 2019-03)
+
+
+=head2 DIFFERENCES BETWEEN Tollef's parallel (moreutils) AND GNU Parallel
+
+Summary (see legend above):
+
+=over
+
+=item - - - I4 - - I7
+
+=item - - M3 - - M6
+
+=item - O2 O3 - O5 O6 - x x
+
+=item E1 - - - - - E7
+
+=item - x x x x x x x x
+
+=item - -
+
+=back
+
+=head3 EXAMPLES FROM Tollef's parallel MANUAL
+
+B<Tollef> parallel sh -c "echo hi; sleep 2; echo bye" -- 1 2 3
+
+B<GNU> parallel "echo hi; sleep 2; echo bye" ::: 1 2 3
+
+B<Tollef> parallel -j 3 ufraw -o processed -- *.NEF
+
+B<GNU> parallel -j 3 ufraw -o processed ::: *.NEF
+
+B<Tollef> parallel -j 3 -- ls df "echo hi"
+
+B<GNU> parallel -j 3 ::: ls df "echo hi"
+
+(Last checked: 2019-08)
+
+=head2 DIFFERENCES BETWEEN rargs AND GNU Parallel
+
+Summary (see legend above):
+
+=over
+
+=item I1 - - - - - I7
+
+=item - - M3 M4 - -
+
+=item - O2 O3 - O5 O6 - O8 -
+
+=item E1 - - E4 - - -
+
+=item - - - - - - - - -
+
+=item - -
+
+=back
+
+B<rargs> has elegant ways of doing named regexp capture and field ranges.
+
+With GNU B<parallel> you can use B<--rpl> to get a similar
+functionality as regexp capture gives, and use B<join> and B<@arg> to
+get the field ranges. But the syntax is longer. This:
+
+  --rpl '{r(\d+)\.\.(\d+)} $_=join"$opt::colsep",@arg[$$1..$$2]'
+
+would make it possible to use:
+
+  {1r3..6}
+
+for field 3..6.
+
+For full support of {n..m:s} including negative numbers use a dynamic
+replacement string like this:
+
+
+  PARALLEL=--rpl\ \''{r((-?\d+)?)\.\.((-?\d+)?)((:([^}]*))?)}
+          $a = defined $$2 ? $$2 < 0 ? 1+$#arg+$$2 : $$2 : 1;
+          $b = defined $$4 ? $$4 < 0 ? 1+$#arg+$$4 : $$4 : $#arg+1;
+          $s = defined $$6 ? $$7 : " ";
+          $_ = join $s,@arg[$a..$b]'\'
+  export PARALLEL
+
+You can then do:
+
+  head /etc/passwd | parallel --colsep : echo ..={1r..} ..3={1r..3} \
+    4..={1r4..} 2..4={1r2..4} 3..3={1r3..3} ..3:-={1r..3:-} \
+    ..3:/={1r..3:/} -1={-1} -5={-5} -6={-6} -3..={1r-3..}
+
+=head3 EXAMPLES FROM rargs MANUAL
+
+  ls *.bak | rargs -p '(.*)\.bak' mv {0} {1}
+  ls *.bak | parallel mv {} {.}
+
+  cat download-list.csv | rargs -p '(?P<url>.*),(?P<filename>.*)' wget {url} -O {filename}
+  cat download-list.csv | parallel --csv wget {1} -O {2}
+  # or use regexps:
+  cat download-list.csv |
+    parallel --rpl '{url} s/,.*//' --rpl '{filename} s/.*?,//' wget {url} -O {filename}
+
+  cat /etc/passwd | rargs -d: echo -e 'id: "{1}"\t name: "{5}"\t rest: "{6..::}"'
+  cat /etc/passwd |
+    parallel -q --colsep : echo -e 'id: "{1}"\t name: "{5}"\t rest: "{=6 $_=join":",@arg[6..$#arg]=}"'
+
+https://github.com/lotabout/rargs (Last checked: 2020-01)
+
+
+=head2 DIFFERENCES BETWEEN threader AND GNU Parallel
+
+Summary (see legend above):
+
+=over
+
+=item I1 - - - - - -
+
+=item M1 - M3 - - M6
+
+=item O1 - O3 - O5 - - N/A N/A
+
+=item E1 - - E4 - - -
+
+=item - - - - - - - - -
+
+=item - -
+
+=back
+
+Newline separates arguments, but newline at the end of file is treated
+as an empty argument. So this runs 2 jobs:
+
+  echo two_jobs | threader -run 'echo "$THREADID"'
+
+B<threader> ignores stderr, so any output to stderr is
+lost. B<threader> buffers in RAM, so output bigger than the machine's
+virtual memory will cause the machine to crash.
+
+https://github.com/voodooEntity/threader (Last checked: 2020-04)
+
+
+=head2 DIFFERENCES BETWEEN runp AND GNU Parallel
+
+Summary (see legend above):
+
+=over
+
+=item I1 I2 - - - - -
+
+=item M1 - (M3) - - M6
+
+=item O1 O2 O3 - O5 O6 - N/A N/A -
+
+=item E1 - - - - - -
+
+=item - - - - - - - - -
+
+=item - -
+
+=back
+
+(M3): You can add a prefix and a postfix to the input, so it means you can
+only insert the argument on the command line once.
+
+B<runp> runs 10 jobs in parallel by default.  B<runp> blocks if output
+of a command is > 64 Kbytes.  Quoting of input is needed.  It adds
+output to stderr (this can be prevented with -q)
+
+=head3 Examples as GNU Parallel
+
+  base='https://images-api.nasa.gov/search'
+  query='jupiter'
+  desc='planet'
+  type='image'
+  url="$base?q=$query&description=$desc&media_type=$type"
+  
+  # Download the images in parallel using runp
+  curl -s $url | jq -r .collection.items[].href | \
+    runp -p 'curl -s' | jq -r .[] | grep large | \
+    runp -p 'curl -s -L -O'
+
+  time curl -s $url | jq -r .collection.items[].href | \
+    runp -g 1 -q -p 'curl -s' | jq -r .[] | grep large | \
+    runp -g 1 -q -p 'curl -s -L -O'
+
+  # Download the images in parallel
+  curl -s $url | jq -r .collection.items[].href | \
+    parallel curl -s | jq -r .[] | grep large | \
+    parallel curl -s -L -O
+  
+  time curl -s $url | jq -r .collection.items[].href | \
+    parallel -j 1 curl -s | jq -r .[] | grep large | \
+    parallel -j 1 curl -s -L -O
+
+
+=head4 Run some test commands (read from file)
+
+  # Create a file containing commands to run in parallel.
+  cat << EOF > /tmp/test-commands.txt
+  sleep 5
+  sleep 3
+  blah     # this will fail
+  ls $PWD  # PWD shell variable is used here
+  EOF
+  
+  # Run commands from the file.
+  runp /tmp/test-commands.txt > /dev/null
+  
+  parallel -a /tmp/test-commands.txt > /dev/null
+
+=head4 Ping several hosts and see packet loss (read from stdin)
+
+  # First copy this line and press Enter
+  runp -p 'ping -c 5 -W 2' -s '| grep loss'
+  localhost
+  1.1.1.1
+  8.8.8.8
+  # Press Enter and Ctrl-D when done entering the hosts
+
+  # First copy this line and press Enter
+  parallel ping -c 5 -W 2 {} '| grep loss'
+  localhost
+  1.1.1.1
+  8.8.8.8
+  # Press Enter and Ctrl-D when done entering the hosts
+
+=head4 Get directories' sizes (read from stdin)
+
+  echo -e "$HOME\n/etc\n/tmp" | runp -q -p 'sudo du -sh'
+
+  echo -e "$HOME\n/etc\n/tmp" | parallel sudo du -sh
+  # or:
+  parallel sudo du -sh ::: "$HOME" /etc /tmp
+
+=head4 Compress files
+
+  find . -iname '*.txt' | runp -p 'gzip --best'
+
+  find . -iname '*.txt' | parallel gzip --best
+
+=head4 Measure HTTP request + response time
+
+  export CURL="curl -w 'time_total:  %{time_total}\n'"
+  CURL="$CURL -o /dev/null -s https://golang.org/"
+  perl -wE 'for (1..10) { say $ENV{CURL} }' |
+     runp -q  # Make 10 requests
+
+  perl -wE 'for (1..10) { say $ENV{CURL} }' | parallel
+  # or:
+  parallel -N0 "$CURL" ::: {1..10}
+
+=head4 Find open TCP ports
+
+  cat << EOF > /tmp/host-port.txt
+  localhost 22
+  localhost 80
+  localhost 81
+  127.0.0.1 443
+  127.0.0.1 444
+  scanme.nmap.org 22
+  scanme.nmap.org 23
+  scanme.nmap.org 443
+  EOF
+  
+  1$ cat /tmp/host-port.txt |
+       runp -q -p 'netcat -v -w2 -z' 2>&1 | egrep '(succeeded!|open)$'
+  
+  # --colsep is needed to split the line
+  1$ cat /tmp/host-port.txt |
+       parallel --colsep ' ' netcat -v -w2 -z 2>&1 |
+       egrep '(succeeded!|open)$'
+  # or use uq for unquoted:
+  1$ cat /tmp/host-port.txt |
+       parallel netcat -v -w2 -z {=uq=} 2>&1 |
+       egrep '(succeeded!|open)$'
+
+https://github.com/jreisinger/runp (Last checked: 2020-04)
+
+
+=head2 DIFFERENCES BETWEEN papply AND GNU Parallel
+
+Summary (see legend above):
+
+=over
+
+=item - - - I4 - - -
+
+=item M1 - M3 - - M6
+
+=item - - O3 - O5 - - N/A N/A O10
+
+=item E1 - - E4 - - -
+
+=item - - - - - - - - -
+
+=item - -
+
+=back
+
+B<papply> does not print the output if the command fails:
+
+  $ papply 'echo %F; false' foo
+  "echo foo; false" did not succeed
+
+B<papply>'s replacement strings (%F %d %f %n %e %z) can be simulated in GNU
+B<parallel> by putting this in B<~/.parallel/config>:
+
+  --rpl '%F'
+  --rpl '%d $_=Q(::dirname($_));'
+  --rpl '%f s:.*/::;'
+  --rpl '%n s:.*/::;s:\.[^/.]+$::;'
+  --rpl '%e s:.*\.:.:'
+  --rpl '%z $_=""'
+
+B<papply> buffers in RAM, and uses twice the amount of output. So
+output of 5 GB takes 10 GB RAM.
+
+The buffering is very CPU intensive: Buffering a line of 5 GB takes 40
+seconds (compared to 10 seconds with GNU B<parallel>).
+
+
+=head3 Examples as GNU Parallel
+
+  1$ papply gzip *.txt
+  
+  1$ parallel gzip ::: *.txt
+  
+  2$ papply "convert %F %n.jpg" *.png
+  
+  2$ parallel convert {} {.}.jpg ::: *.png
+
+
+https://pypi.org/project/papply/ (Last checked: 2020-04)
+
+
+=head2 DIFFERENCES BETWEEN async AND GNU Parallel
+
+Summary (see legend above):
+
+=over
+
+=item - - - I4 - - I7
+
+=item - - - - - M6
+
+=item - O2 O3 - O5 O6 - N/A N/A O10
+
+=item E1 - - E4 - E6 -
+
+=item - - - - - - - - -
+
+=item S1 S2
+
+=back
+
+B<async> is very similary to GNU B<parallel>'s B<--semaphore> mode
+(aka B<sem>). B<async> requires the user to start a server process.
+
+The input is quoted like B<-q> so you need B<bash -c "...;..."> to run
+composed commands.
+
+=head3 Examples as GNU Parallel
+
+  1$ S="/tmp/example_socket"
+  
+  1$ ID=myid
+  
+  2$ async -s="$S" server --start
+  
+  2$ # GNU Parallel does not need a server to run
+  
+  3$ for i in {1..20}; do
+         # prints command output to stdout
+         async -s="$S" cmd -- bash -c "sleep 1 && echo test $i"
+     done
+  
+  3$ for i in {1..20}; do
+         # prints command output to stdout
+         sem --id "$ID" -j100% "sleep 1 && echo test $i"
+         # GNU Parallel will only print job when it is done
+         # If you need output from different jobs to mix
+         # use -u or --line-buffer
+         sem --id "$ID" -j100% --line-buffer "sleep 1 && echo test $i"
+     done
+  
+  4$ # wait until all commands are finished
+     async -s="$S" wait
+  
+  4$ sem --id "$ID" --wait
+  
+  5$ # configure the server to run four commands in parallel
+     async -s="$S" server -j4
+  
+  5$ export PARALLEL=-j4
+  
+  6$ mkdir "/tmp/ex_dir"
+     for i in {21..40}; do
+       # redirects command output to /tmp/ex_dir/file*
+       async -s="$S" cmd -o "/tmp/ex_dir/file$i" -- \
+         bash -c "sleep 1 && echo test $i"
+     done
+  
+  6$ mkdir "/tmp/ex_dir"
+     for i in {21..40}; do
+       # redirects command output to /tmp/ex_dir/file*
+       sem --id "$ID" --result '/tmp/my-ex/file-{=$_=""=}'"$i" \
+         "sleep 1 && echo test $i"
+     done
+  
+  7$ sem --id "$ID" --wait
+  
+  7$ async -s="$S" wait
+  
+  8$ # stops server
+     async -s="$S" server --stop
+  
+  8$ # GNU Parallel does not need to stop a server
+
+
+https://github.com/ctbur/async/ (Last checked: 2020-11)
+
+
+=head2 DIFFERENCES BETWEEN pardi AND GNU Parallel
+
+Summary (see legend above):
+
+=over
+
+=item I1 I2 - - - - I7
+
+=item M1 - - - - M6
+
+=item O1 O2 O3 O4 O5 - O7 - - O10
+
+=item E1 - - E4 - - -
+
+=item - - - - - - - - -
+
+=item - -
+
+=back
+
+B<pardi> is very similar to B<parallel --pipe --cat>: It reads blocks
+of data and not arguments. So it cannot insert an argument in the
+command line. It puts the block into a temporary file, and this file
+name (%IN) can be put in the command line. You can only use %IN once.
+
+It can also run full command lines in parallel (like: B<cat file |
+parallel>).
+
+=head3 EXAMPLES FROM pardi test.sh
+
+  1$ time pardi -v -c 100 -i data/decoys.smi -ie .smi -oe .smi \
+       -o data/decoys_std_pardi.smi \
+          -w '(standardiser -i %IN -o %OUT 2>&1) > /dev/null'
+  
+  1$ cat data/decoys.smi |
+       time parallel -N 100 --pipe --cat \
+         '(standardiser -i {} -o {#} 2>&1) > /dev/null; cat {#}; rm {#}' \
+         > data/decoys_std_pardi.smi
+  
+  2$ pardi -n 1 -i data/test_in.types -o data/test_out.types \
+             -d 'r:^#atoms:' -w 'cat %IN > %OUT'
+  
+  2$ cat data/test_in.types | parallel -n 1 -k --pipe --cat \
+             --regexp --recstart '^#atoms' 'cat {}' > data/test_out.types
+  
+  3$ pardi -c 6 -i data/test_in.types -o data/test_out.types \
+             -d 'r:^#atoms:' -w 'cat %IN > %OUT'
+  
+  3$ cat data/test_in.types | parallel -n 6 -k --pipe --cat \
+             --regexp --recstart '^#atoms' 'cat {}' > data/test_out.types
+  
+  4$ pardi -i data/decoys.mol2 -o data/still_decoys.mol2 \
+             -d 's:@<TRIPOS>MOLECULE' -w 'cp %IN %OUT'
+  
+  4$ cat data/decoys.mol2 |
+       parallel -n 1 --pipe --cat --recstart '@<TRIPOS>MOLECULE' \
+         'cp {} {#}; cat {#}; rm {#}' > data/still_decoys.mol2
+  
+  5$ pardi -i data/decoys.mol2 -o data/decoys2.mol2 \
+             -d b:10000 -w 'cp %IN %OUT' --preserve
+  
+  5$ cat data/decoys.mol2 |
+       parallel -k --pipe --block 10k --recend '' --cat \
+         'cat {} > {#}; cat {#}; rm {#}' > data/decoys2.mol2
+
+https://github.com/UnixJunkie/pardi (Last checked: 2021-01)
+
+
+=head2 DIFFERENCES BETWEEN bthread AND GNU Parallel
+
+Summary (see legend above):
+
+=over
+
+=item - - - I4 -  - -
+
+=item - - - - - M6
+
+=item O1 - O3 - - - O7 O8 - -
+
+=item E1 - - - - - -
+
+=item - - - - - - - - -
+
+=item - -
+
+=back
+
+B<bthread> takes around 1 sec per MB of output. The maximal output
+line length is 1073741759.
+
+You cannot quote space in the command, so you cannot run composed
+commands like B<sh -c "echo a; echo b">.
+
+https://gitlab.com/netikras/bthread (Last checked: 2021-01)
+
+
+=head2 DIFFERENCES BETWEEN simple_gpu_scheduler AND GNU Parallel
+
+Summary (see legend above):
+
+=over
+
+=item I1 - - - - - I7
+
+=item M1 - - - - M6
+
+=item - O2 O3 - - O6 - x x O10
+
+=item E1 - - - - - -
+
+=item - - - - - - - - -
+
+=item - -
+
+=back
+
+=head3 EXAMPLES FROM simple_gpu_scheduler MANUAL
+
+  1$ simple_gpu_scheduler --gpus 0 1 2 < gpu_commands.txt
+
+  1$ parallel -j3 --shuf \
+     CUDA_VISIBLE_DEVICES='{=1 $_=slot()-1 =} {=uq;=}' < gpu_commands.txt
+
+  2$ simple_hypersearch "python3 train_dnn.py --lr {lr} --batch_size {bs}" \
+       -p lr 0.001 0.0005 0.0001 -p bs 32 64 128 |
+       simple_gpu_scheduler --gpus 0,1,2
+
+  2$ parallel --header : --shuf -j3 -v \
+       CUDA_VISIBLE_DEVICES='{=1 $_=slot()-1 =}' \
+       python3 train_dnn.py --lr {lr} --batch_size {bs} \
+       ::: lr 0.001 0.0005 0.0001 ::: bs 32 64 128
+
+  3$ simple_hypersearch \
+       "python3 train_dnn.py --lr {lr} --batch_size {bs}" \
+       --n-samples 5 -p lr 0.001 0.0005 0.0001 -p bs 32 64 128 |
+       simple_gpu_scheduler --gpus 0,1,2
+
+  3$ parallel --header : --shuf \
+       CUDA_VISIBLE_DEVICES='{=1 $_=slot()-1; seq() > 5 and skip() =}' \
+       python3 train_dnn.py --lr {lr} --batch_size {bs} \
+       ::: lr 0.001 0.0005 0.0001 ::: bs 32 64 128
+
+  4$ touch gpu.queue
+     tail -f -n 0 gpu.queue | simple_gpu_scheduler --gpus 0,1,2 &
+     echo "my_command_with | and stuff > logfile" >> gpu.queue
+
+  4$ touch gpu.queue
+     tail -f -n 0 gpu.queue |
+       parallel -j3 CUDA_VISIBLE_DEVICES='{=1 $_=slot()-1 =} {=uq;=}' &
+     # Needed to fill job slots once
+     seq 3 | parallel echo true >> gpu.queue
+     # Add jobs
+     echo "my_command_with | and stuff > logfile" >> gpu.queue
+     # Needed to flush output from completed jobs
+     seq 3 | parallel echo true >> gpu.queue
+
+https://github.com/ExpectationMax/simple_gpu_scheduler (Last checked:
+2021-01)
+
+
+=head2 DIFFERENCES BETWEEN parasweep AND GNU Parallel
+
+B<parasweep> is a Python module for facilitating parallel parameter
+sweeps.
+
+A B<parasweep> job will normally take a text file as input. The text
+file contains arguments for the job. Some of these arguments will be
+fixed and some of them will be changed by B<parasweep>.
+
+It does this by having a template file such as template.txt:
+
+  Xval: {x}
+  Yval: {y}
+  FixedValue: 9
+  # x with 2 decimals
+  DecimalX: {x:.2f}
+  TenX: ${x*10}
+  RandomVal: {r}
+
+and from this template it generates the file to be used by the job by
+replacing the replacement strings.
+
+Being a Python module B<parasweep> integrates tighter with Python than
+GNU B<parallel>. You get the parameters directly in a Python data
+structure. With GNU B<parallel> you can use the JSON or CSV output
+format to get something similar, but you would have to read the
+output.
+
+B<parasweep> has a filtering method to ignore parameter combinations
+you do not need.
+
+Instead of calling the jobs directly, B<parasweep> can use Python's
+Distributed Resource Management Application API to make jobs run with
+different cluster software.
+
+
+GNU B<parallel> B<--tmpl> supports templates with replacement
+strings. Such as:
+
+  Xval: {x}
+  Yval: {y}
+  FixedValue: 9
+  # x with 2 decimals
+  DecimalX: {=x $_=sprintf("%.2f",$_) =}
+  TenX: {=x $_=$_*10 =}
+  RandomVal: {=1 $_=rand() =}
+
+that can be used like:
+
+  parallel --header : --tmpl my.tmpl={#}.t myprog {#}.t \
+    ::: x 1 2 3 ::: y 1 2 3
+
+Filtering is supported as:
+
+  parallel --filter '{1} > {2}' echo ::: 1 2 3 ::: 1 2 3
+
+https://github.com/eviatarbach/parasweep (Last checked: 2021-01)
+
+
+=head2 DIFFERENCES BETWEEN parallel-bash AND GNU Parallel
+
+Summary (see legend above):
+
+=over
+
+=item I1 I2 - - - - -
+
+=item - - M3 - - M6
+
+=item - O2 O3 - O5 O6 - O8 x O10
+
+=item E1 - - - - - -
+
+=item - - - - - - - - -
+
+=item - -
+
+=back
+
+B<parallel-bash> is written in pure bash. It is really fast (overhead
+of ~0.05 ms/job compared to GNU B<parallel>'s 3-10 ms/job). So if your
+jobs are extremely short lived, and you can live with the quite
+limited command, this may be useful.
+
+It works by making a queue for each process. Then the jobs are
+distributed to the queues in a round robin fashion. Finally the queues
+are started in parallel. This works fine, if you are lucky, but if
+not, all the long jobs may end up in the same queue, so you may see:
+
+  $ printf "%b\n" 1 1 1 4 1 1 1 4 1 1 1 4 |
+      time parallel -P4 sleep {}
+  (7 seconds)
+  $ printf "%b\n" 1 1 1 4 1 1 1 4 1 1 1 4 |
+      time ./parallel-bash.bash -p 4 -c sleep {}
+  (12 seconds)
+
+Because it uses bash lists, the total number of jobs is limited to
+167000..265000 depending on your environment. You get a segmentation
+fault, when you reach the limit.
+
+Ctrl-C does not stop spawning new jobs. Ctrl-Z does not suspend
+running jobs.
+
+
+=head3 EXAMPLES FROM parallel-bash
+
+  1$ some_input | parallel-bash -p 5 -c echo
+
+  1$ some_input | parallel -j 5 echo
+
+  2$ parallel-bash -p 5 -c echo < some_file
+
+  2$ parallel -j 5 echo < some_file
+
+  3$ parallel-bash -p 5 -c echo <<< 'some string'
+
+  3$ parallel -j 5 -c echo <<< 'some string'
+
+  4$ something | parallel-bash -p 5 -c echo {} {}
+
+  4$ something | parallel -j 5 echo {} {}
+
+https://reposhub.com/python/command-line-tools/Akianonymus-parallel-bash.html
+(Last checked: 2021-06)
+
+
+=head2 DIFFERENCES BETWEEN bash-concurrent AND GNU Parallel
+
+B<bash-concurrent> is more an alternative to B<make> than to GNU
+B<parallel>. Its input is very similar to a Makefile, where jobs
+depend on other jobs.
+
+It has a nice progress indicator where you can see which jobs
+completed successfully, which jobs are currently running, which jobs
+failed, and which jobs were skipped due to a depending job failed.
+The indicator does not deal well with resizing the window.
+
+Output is cached in tempfiles on disk, but is only shown if there is
+an error, so it is not meant to be part of a UNIX pipeline. If
+B<bash-concurrent> crashes these tempfiles are not removed.
+
+It uses an O(n*n) algorithm, so if you have 1000 independent jobs it
+takes 22 seconds to start it.
+
+https://github.com/themattrix/bash-concurrent
+(Last checked: 2021-02)
+
+
+=head2 DIFFERENCES BETWEEN spawntool AND GNU Parallel
+
+Summary (see legend above):
+
+=over
+
+=item I1 - - - - - -
+
+=item M1 - - - - M6
+
+=item - O2 O3 - O5 O6 - x x O10
+
+=item E1 - - - - - -
+
+=item - - - - - - - - -
+
+=item - -
+
+=back
+
+B<spawn> reads a full command line from stdin which it executes in
+parallel.
+
+
+http://code.google.com/p/spawntool/
+(Last checked: 2021-07)
+
+
+=head2 DIFFERENCES BETWEEN go-pssh AND GNU Parallel
+
+Summary (see legend above):
+
+=over
+
+=item - - - - - - -
+
+=item M1 - - - - -
+
+=item O1 - - - - - - x x O10
+
+=item E1 - - - - - -
+
+=item R1 R2 - - - R6 - - -
+
+=item - -
+
+=back
+
+B<go-pssh> does B<ssh> in parallel to multiple machines. It runs the
+same command on multiple machines similar to B<--nonall>.
+
+The hostnames must be given as IP-addresses (not as hostnames).
+
+Output is sent to stdout (standard output) if command is successful,
+and to stderr (standard error) if the command fails.
+
+=head3 EXAMPLES FROM go-pssh
+
+  1$ go-pssh -l <ip>,<ip> -u <user> -p <port> -P <passwd> -c "<command>"
+
+  1$ parallel -S 'sshpass -p <passwd> ssh -p <port> <user>@<ip>' \
+       --nonall "<command>"
+
+  2$ go-pssh scp -f host.txt -u <user> -p <port> -P <password> \
+       -s /local/file_or_directory -d /remote/directory
+
+  2$ parallel --nonall --slf host.txt \
+       --basefile /local/file_or_directory/./ --wd /remote/directory
+       --ssh 'sshpass -p <password> ssh -p <port> -l <user>' true
+
+  3$ go-pssh scp -l <ip>,<ip> -u <user> -p <port> -P <password> \
+       -s /local/file_or_directory -d /remote/directory
+
+  3$ parallel --nonall -S <ip>,<ip> \
+       --basefile /local/file_or_directory/./ --wd /remote/directory
+       --ssh 'sshpass -p <password> ssh -p <port> -l <user>' true
+
+https://github.com/xuchenCN/go-pssh
+(Last checked: 2021-07)
+
+
+=head2 DIFFERENCES BETWEEN go-parallel AND GNU Parallel
+
+Summary (see legend above):
+
+=over
+
+=item I1 I2 - - - - I7
+
+=item - - M3 - - M6
+
+=item - O2 O3 - O5 - - x x - O10
+
+=item E1 - - E4 - - -
+
+=item - - - - - - - - -
+
+=item - -
+
+=back
+
+B<go-parallel> uses Go templates for replacement strings. Quite
+similar to the I<{= perl expr =}> replacement string.
+
+=head3 EXAMPLES FROM go-parallel
+
+  1$ go-parallel -a ./files.txt -t 'cp {{.Input}} {{.Input | dirname | dirname}}'
+
+  1$ parallel -a ./files.txt cp {} '{= $_=::dirname(::dirname($_)) =}'
+
+  2$ go-parallel -a ./files.txt -t 'mkdir -p {{.Input}} {{noExt .Input}}'
+
+  2$ parallel -a ./files.txt echo mkdir -p {} {.}
+
+  3$ go-parallel -a ./files.txt -t 'mkdir -p {{.Input}} {{.Input | basename | noExt}}'
+
+  3$ parallel -a ./files.txt echo mkdir -p {} {/.}
+
+https://github.com/mylanconnolly/parallel
+(Last checked: 2021-07)
+
+
+=head2 DIFFERENCES BETWEEN p AND GNU Parallel
+
+Summary (see legend above):
+
+=over
+
+=item - - - I4 - - N/A
+
+=item - - - - - M6
+
+=item - O2 O3 - O5 O6 - x x - O10
+
+=item E1 - - - - - -
+
+=item - - - - - - - - -
+
+=item - -
+
+=back
+
+B<p> is a tiny shell script. It can color output with some predefined
+colors, but is otherwise quite limited.
+
+It maxes out at around 116000 jobs (probably due to limitations in Bash).
+
+=head3 EXAMPLES FROM p
+
+Some of the examples from B<p> cannot be implemented 100% by GNU
+B<parallel>: The coloring is a bit different, and GNU B<parallel>
+cannot have B<--tag> for some inputs and not for others.
+
+The coloring done by GNU B<parallel> is not exactly the same as B<p>.
+
+  1$ p -bc blue "ping 127.0.0.1" -uc red "ping 192.168.0.1" \
+     -rc yellow "ping 192.168.1.1" -t example "ping example.com"
+
+  1$ parallel --lb -j0 --color --tag ping \
+     ::: 127.0.0.1 192.168.0.1 192.168.1.1 example.com
+
+  2$ p "tail -f /var/log/httpd/access_log" \
+     -bc red "tail -f /var/log/httpd/error_log"
+
+  2$ cd /var/log/httpd;
+     parallel --lb --color --tag tail -f ::: access_log error_log
+
+  3$ p tail -f "some file" \& p tail -f "other file with space.txt"
+
+  3$ parallel --lb tail -f ::: 'some file' "other file with space.txt"
+
+  4$ p -t project1 "hg pull project1" -t project2 \
+     "hg pull project2" -t project3 "hg pull project3"
+
+  4$ parallel --lb hg pull ::: project{1..3}
+
+https://github.com/rudymatela/evenmoreutils/blob/master/man/p.1.adoc
+(Last checked: 2022-04)
+
+
+=head2 DIFFERENCES BETWEEN senechal AND GNU Parallel
+
+Summary (see legend above):
+
+=over
+
+=item I1 - - - - - -
+
+=item M1 - M3 - - M6
+
+=item O1 - O3 O4 - - - x x -
+
+=item E1 - - - - - -
+
+=item - - - - - - - - -
+
+=item - -
+
+=back
+
+B<seneschal> only starts the first job after reading the last job, and
+output from the first job is only printed after the last job finishes.
+
+1 byte of output requites 3.5 bytes of RAM.
+
+This makes it impossible to have a total output bigger than the
+virtual memory.
+
+Even though output is kept in RAM outputing is quite slow: 30 MB/s.
+
+Output larger than 4 GB causes random problems - it looks like a race
+condition.
+
+This:
+
+  echo 1 | seneschal  --prefix='yes `seq 1000`|head -c 1G' >/dev/null
+
+takes 4100(!) CPU seconds to run on a 64C64T server, but only 140 CPU
+seconds on a 4C8T laptop. So it looks like B<seneschal> wastes a lot
+of CPU time coordinating the CPUs.
+
+Compare this to:
+
+  echo 1 | time -v parallel -N0 'yes `seq 1000`|head -c 1G' >/dev/null
+
+which takes 3-8 CPU seconds.
+
+=head3 EXAMPLES FROM seneschal README.md
+
+  1$ echo $REPOS | seneschal --prefix="cd {} && git pull"
+
+  # If $REPOS is newline separated
+  1$ echo "$REPOS" | parallel -k "cd {} && git pull"
+  # If $REPOS is space separated
+  1$ echo -n "$REPOS" | parallel -d' ' -k "cd {} && git pull"
+
+  COMMANDS="pwd
+  sleep 5 && echo boom
+  echo Howdy
+  whoami"
+  
+  2$ echo "$COMMANDS" | seneschal --debug
+  
+  2$ echo "$COMMANDS" | parallel -k -v
+  
+  3$ ls -1 | seneschal --prefix="pushd {}; git pull; popd;"
+  
+  3$ ls -1 | parallel -k "pushd {}; git pull; popd;"
+  # Or if current dir also contains files:
+  3$ parallel -k "pushd {}; git pull; popd;" ::: */
+
+https://github.com/TheWizardTower/seneschal
+(Last checked: 2022-06)
+
+
+=head2 Todo
+
+http://code.google.com/p/push/ (cannot compile)
+
+https://github.com/krashanoff/parallel
+
+https://github.com/Nukesor/pueue
+
+https://arxiv.org/pdf/2012.15443.pdf KumQuat
+
+https://arxiv.org/pdf/2007.09436.pdf PaSH: Light-touch Data-Parallel Shell Processing
+
+https://github.com/JeiKeiLim/simple_distribute_job
+
+https://github.com/reggi/pkgrun - not obvious how to use
+
+https://github.com/benoror/better-npm-run - not obvious how to use
+
+https://github.com/bahmutov/with-package
+
+https://github.com/flesler/parallel
+
+https://github.com/Julian/Verge
+
+https://manpages.ubuntu.com/manpages/xenial/man1/tsp.1.html
+
+https://vicerveza.homeunix.net/~viric/soft/ts/
+
+https://github.com/chapmanjacobd/que
+
+
+
+=head1 TESTING OTHER TOOLS
+
+There are certain issues that are very common on parallelizing
+tools. Here are a few stress tests. Be warned: If the tool is badly
+coded it may overload your machine.
+
+
+=head2 MIX: Output mixes
+
+Output from 2 jobs should not mix. If the output is not used, this
+does not matter; but if the output I<is> used then it is important
+that you do not get half a line from one job followed by half a line
+from another job.
+
+If the tool does not buffer, output will most likely mix now and then.
+
+This test stresses whether output mixes.
+
+  #!/bin/bash
+
+  paralleltool="parallel -j0"
+
+  cat <<-EOF > mycommand
+  #!/bin/bash
+
+  # If a, b, c, d, e, and f mix: Very bad
+  perl -e 'print STDOUT "a"x3000_000," "'
+  perl -e 'print STDERR "b"x3000_000," "'
+  perl -e 'print STDOUT "c"x3000_000," "'
+  perl -e 'print STDERR "d"x3000_000," "'
+  perl -e 'print STDOUT "e"x3000_000," "'
+  perl -e 'print STDERR "f"x3000_000," "'
+  echo
+  echo >&2
+  EOF
+  chmod +x mycommand
+
+  # Run 30 jobs in parallel
+  seq 30 |
+    $paralleltool ./mycommand > >(tr -s abcdef) 2> >(tr -s abcdef >&2)
+
+  # 'a c e' and 'b d f' should always stay together
+  # and there should only be a single line per job
+
+
+=head2 STDERRMERGE: Stderr is merged with stdout
+
+Output from stdout and stderr should not be merged, but kept separated.
+
+This test shows whether stdout is mixed with stderr.
+
+  #!/bin/bash
+
+  paralleltool="parallel -j0"
+
+  cat <<-EOF > mycommand
+  #!/bin/bash
+
+  echo stdout
+  echo stderr >&2
+  echo stdout
+  echo stderr >&2
+  EOF
+  chmod +x mycommand
+
+  # Run one job
+  echo |
+    $paralleltool ./mycommand > stdout 2> stderr
+  cat stdout
+  cat stderr
+
+
+=head2 RAM: Output limited by RAM
+
+Some tools cache output in RAM. This makes them extremely slow if the
+output is bigger than physical memory and crash if the output is
+bigger than the virtual memory.
+
+  #!/bin/bash
+
+  paralleltool="parallel -j0"
+
+  cat <<'EOF' > mycommand
+  #!/bin/bash
+
+  # Generate 1 GB output
+  yes "`perl -e 'print \"c\"x30_000'`" | head -c 1G
+  EOF
+  chmod +x mycommand
+
+  # Run 20 jobs in parallel
+  # Adjust 20 to be > physical RAM and < free space on /tmp
+  seq 20 | time $paralleltool ./mycommand | wc -c
+
+
+=head2 DISKFULL: Incomplete data if /tmp runs full
+
+If caching is done on disk, the disk can run full during the run. Not
+all programs discover this. GNU Parallel discovers it, if it stays
+full for at least 2 seconds.
+
+  #!/bin/bash
+
+  paralleltool="parallel -j0"
+
+  # This should be a dir with less than 100 GB free space
+  smalldisk=/tmp/shm/parallel
+  
+  TMPDIR="$smalldisk"
+  export TMPDIR
+  
+  max_output() {
+      # Force worst case scenario:
+      # Make GNU Parallel only check once per second
+      sleep 10
+      # Generate 100 GB to fill $TMPDIR
+      # Adjust if /tmp is bigger than 100 GB
+      yes | head -c 100G >$TMPDIR/$$
+      # Generate 10 MB output that will not be buffered due to full disk
+      perl -e 'print "X"x10_000_000' | head -c 10M
+      echo This part is missing from incomplete output
+      sleep 2
+      rm $TMPDIR/$$
+      echo Final output
+  }
+  
+  export -f max_output
+  seq 10 | $paralleltool max_output | tr -s X
+
+
+=head2 CLEANUP: Leaving tmp files at unexpected death
+
+Some tools do not clean up tmp files if they are killed. If the tool
+buffers on disk, they may not clean up, if they are killed.
+
+  #!/bin/bash
+
+  paralleltool=parallel
+
+  ls /tmp >/tmp/before
+  seq 10 | $paralleltool sleep &
+  pid=$!
+  # Give the tool time to start up
+  sleep 1
+  # Kill it without giving it a chance to cleanup
+  kill -9 $!
+  # Should be empty: No files should be left behind
+  diff <(ls /tmp) /tmp/before
+
+
+=head2 SPCCHAR: Dealing badly with special file names.
+
+It is not uncommon for users to create files like:
+
+  My brother's 12" *** record  (costs $$$).jpg
+
+Some tools break on this.
+
+  #!/bin/bash
+
+  paralleltool=parallel
+
+  touch "My brother's 12\" *** record  (costs \$\$\$).jpg"
+  ls My*jpg | $paralleltool ls -l
+
+
+=head2 COMPOSED: Composed commands do not work
+
+Some tools require you to wrap composed commands into B<bash -c>.
+
+  echo bar | $paralleltool echo foo';' echo {}
+
+
+=head2 ONEREP: Only one replacement string allowed
+
+Some tools can only insert the argument once.
+
+  echo bar | $paralleltool echo {} foo {}
+
+
+=head2 INPUTSIZE: Length of input should not be limited
+
+Some tools limit the length of the input lines artificially with no good
+reason. GNU B<parallel> does not:
+
+  perl -e 'print "foo."."x"x100_000_000' | parallel echo {.}
+
+GNU B<parallel> limits the command to run to 128 KB due to execve(1):
+
+  perl -e 'print "x"x131_000' | parallel echo {} | wc
+
+
+=head2 NUMWORDS: Speed depends on number of words
+
+Some tools become very slow if output lines have many words.
+
+  #!/bin/bash
+
+  paralleltool=parallel
+
+  cat <<-EOF > mycommand
+  #!/bin/bash
+
+  # 10 MB of lines with 1000 words
+  yes "`seq 1000`" | head -c 10M
+  EOF
+  chmod +x mycommand
+
+  # Run 30 jobs in parallel
+  seq 30 | time $paralleltool -j0 ./mycommand > /dev/null
+
+=head2 4GB: Output with a line > 4GB should be OK
+
+  #!/bin/bash
+  
+  paralleltool="parallel -j0"
+  
+  cat <<-EOF > mycommand
+  #!/bin/bash
+  
+  perl -e '\$a="a"x1000_000; for(1..5000) { print \$a }'
+  EOF
+  chmod +x mycommand
+  
+  # Run 1 job
+  seq 1 | $paralleltool ./mycommand | LC_ALL=C wc
+
+
+=head1 AUTHOR
+
+When using GNU B<parallel> for a publication please cite:
+
+O. Tange (2011): GNU Parallel - The Command-Line Power Tool, ;login:
+The USENIX Magazine, February 2011:42-47.
+
+This helps funding further development; and it won't cost you a cent.
+If you pay 10000 EUR you should feel free to use GNU Parallel without citing.
+
+Copyright (C) 2007-10-18 Ole Tange, http://ole.tange.dk
+
+Copyright (C) 2008-2010 Ole Tange, http://ole.tange.dk
+
+Copyright (C) 2010-2022 Ole Tange, http://ole.tange.dk and Free
+Software Foundation, Inc.
+
+Parts of the manual concerning B<xargs> compatibility is inspired by
+the manual of B<xargs> from GNU findutils 4.4.2.
+
+
+=head1 LICENSE
+
+This program is free software; you can redistribute it and/or modify
+it under the terms of the GNU General Public License as published by
+the Free Software Foundation; either version 3 of the License, or
+at your option any later version.
+
+This program is distributed in the hope that it will be useful,
+but WITHOUT ANY WARRANTY; without even the implied warranty of
+MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the
+GNU General Public License for more details.
+
+You should have received a copy of the GNU General Public License
+along with this program.  If not, see <https://www.gnu.org/licenses/>.
+
+=head2 Documentation license I
+
+Permission is granted to copy, distribute and/or modify this
+documentation under the terms of the GNU Free Documentation License,
+Version 1.3 or any later version published by the Free Software
+Foundation; with no Invariant Sections, with no Front-Cover Texts, and
+with no Back-Cover Texts.  A copy of the license is included in the
+file LICENSES/GFDL-1.3-or-later.txt.
+
+=head2 Documentation license II
+
+You are free:
+
+=over 9
+
+=item B<to Share>
+
+to copy, distribute and transmit the work
+
+=item B<to Remix>
+
+to adapt the work
+
+=back
+
+Under the following conditions:
+
+=over 9
+
+=item B<Attribution>
+
+You must attribute the work in the manner specified by the author or
+licensor (but not in any way that suggests that they endorse you or
+your use of the work).
+
+=item B<Share Alike>
+
+If you alter, transform, or build upon this work, you may distribute
+the resulting work only under the same, similar or a compatible
+license.
+
+=back
+
+With the understanding that:
+
+=over 9
+
+=item B<Waiver>
+
+Any of the above conditions can be waived if you get permission from
+the copyright holder.
+
+=item B<Public Domain>
+
+Where the work or any of its elements is in the public domain under
+applicable law, that status is in no way affected by the license.
+
+=item B<Other Rights>
+
+In no way are any of the following rights affected by the license:
+
+=over 2
+
+=item *
+
+Your fair dealing or fair use rights, or other applicable
+copyright exceptions and limitations;
+
+=item *
+
+The author's moral rights;
+
+=item *
+
+Rights other persons may have either in the work itself or in
+how the work is used, such as publicity or privacy rights.
+
+=back
+
+=back
+
+=over 9
+
+=item B<Notice>
+
+For any reuse or distribution, you must make clear to others the
+license terms of this work.
+
+=back
+
+A copy of the full license is included in the file as
+LICENCES/CC-BY-SA-4.0.txt
+
+
+=head1 DEPENDENCIES
+
+GNU B<parallel> uses Perl, and the Perl modules Getopt::Long,
+IPC::Open3, Symbol, IO::File, POSIX, and File::Temp. For remote usage
+it also uses rsync with ssh.
+
+
+=head1 SEE ALSO
+
+B<find>(1), B<xargs>(1), B<make>(1), B<pexec>(1), B<ppss>(1),
+B<xjobs>(1), B<prll>(1), B<dxargs>(1), B<mdm>(1)
+
+=cut
diff --git a/src/parallel_book.pod b/src/parallel_book.pod
new file mode 100644
index 0000000..5bbb432
--- /dev/null
+++ b/src/parallel_book.pod
@@ -0,0 +1,403 @@
+#!/usr/bin/perl -w
+
+# SPDX-FileCopyrightText: 2021-2022 Ole Tange, http://ole.tange.dk and Free Software and Foundation, Inc.
+# SPDX-License-Identifier: GFDL-1.3-or-later
+# SPDX-License-Identifier: CC-BY-SA-4.0
+
+=encoding utf8
+
+=head1 Why should you read this book?
+
+If you write shell scripts to do the same processing for different
+input, then GNU B<parallel> will make your life easier and make your
+scripts run faster.
+
+The book is written so you get the juicy parts first: The goal is that
+you read just enough to get you going. GNU B<parallel> has an
+overwhelming amount of special features to help in different
+situations, and to avoid overloading you with information, the most
+used features are presented first.
+
+All the examples are tested in Bash, and most will work in other
+shells, too, but there are a few exceptions. So you are recommended to
+use Bash while testing out the examples.
+
+
+=head1 Learn GNU Parallel in 5 minutes
+
+You just need to run commands in parallel. You do not care about fine
+tuning.
+
+To get going please run this to make some example files:
+
+  # If your system does not have 'seq', replace 'seq' with 'jot'
+  seq 5 | parallel seq {} '>' example.{}
+
+=head2 Input sources
+
+GNU B<parallel> reads values from input sources. One input source is
+the command line. The values are put after B<:::> :
+
+  parallel echo ::: 1 2 3 4 5
+
+This makes it easy to run the same program on some files:
+
+  parallel wc ::: example.*
+
+If you give multiple B<:::>s, GNU B<parallel> will generate all
+combinations:
+
+  parallel wc ::: -l -c ::: example.*
+
+GNU B<parallel> can also read the values from stdin (standard input):
+
+  seq 5 | parallel echo
+
+
+=head2 Building the command line
+
+The command line is put before the B<:::>. It can contain contain a
+command and options for the command:
+
+  parallel wc -l ::: example.*
+
+The command can contain multiple programs. Just remember to quote
+characters that are interpreted by the shell (such as B<;>):
+
+  parallel echo counting lines';' wc -l ::: example.*
+
+The value will normally be appended to the command, but can be placed
+anywhere by using the replacement string B<{}>:
+
+  parallel echo counting {}';' wc -l {} ::: example.*
+
+When using multiple input sources you use the positional replacement
+strings B<{1}> and B<{2}>:
+
+  parallel echo count {1} in {2}';' wc {1} {2} ::: -l -c ::: example.*
+
+You can check what will be run with B<--dry-run>:
+
+  parallel --dry-run echo count {1} in {2}';' wc {1} {2} ::: -l -c ::: example.*
+
+This is a good idea to do for every command until you are comfortable
+with GNU B<parallel>.
+
+=head2 Controlling the output
+
+The output will be printed as soon as the command completes. This
+means the output may come in a different order than the input:
+
+  parallel sleep {}';' echo {} done ::: 5 4 3 2 1
+
+You can force GNU B<parallel> to print in the order of the values with
+B<--keep-order>/B<-k>. This will still run the commands in parallel.
+The output of the later jobs will be delayed, until the earlier jobs
+are printed:
+
+  parallel -k sleep {}';' echo {} done ::: 5 4 3 2 1
+
+
+=head2 Controlling the execution
+
+If your jobs are compute intensive, you will most likely run one job
+for each core in the system. This is the default for GNU B<parallel>.
+
+But sometimes you want more jobs running. You control the number of
+job slots with B<-j>. Give B<-j> the number of jobs to run in
+parallel:
+
+  parallel -j50 \
+    wget https://ftpmirror.gnu.org/parallel/parallel-{1}{2}22.tar.bz2 \
+    ::: 2012 2013 2014 2015 2016 \
+    ::: 01 02 03 04 05 06 07 08 09 10 11 12
+
+
+=head2 Pipe mode
+
+GNU B<parallel> can also pass blocks of data to commands on stdin
+(standard input):
+
+  seq 1000000 | parallel --pipe wc
+
+This can be used to process big text files. By default GNU B<parallel>
+splits on \n (newline) and passes a block of around 1 MB to each job.
+
+
+=head2 That's it
+
+You have now learned the basic use of GNU B<parallel>. This will
+probably cover most cases of your use of GNU B<parallel>.
+
+The rest of this document will go into more details on each of the
+sections and cover special use cases.
+
+
+=head1 Learn GNU Parallel in an hour
+
+In this part we will dive deeper into what you learned in the first 5 minutes.
+
+To get going please run this to make some example files:
+
+  seq 6 > seq6
+  seq 6 -1 1 > seq-6
+
+=head2 Input sources
+
+On top of the command line, input sources can also be stdin (standard
+input or '-'), files and fifos and they can be mixed. Files are given
+after B<-a> or B<::::>. So these all do the same:
+
+  parallel echo Dice1={1} Dice2={2} ::: 1 2 3 4 5 6 ::: 6 5 4 3 2 1
+  parallel echo Dice1={1} Dice2={2} :::: <(seq 6) :::: <(seq 6 -1 1)
+  parallel echo Dice1={1} Dice2={2} :::: seq6 seq-6
+  parallel echo Dice1={1} Dice2={2} :::: seq6 :::: seq-6
+  parallel -a seq6 -a seq-6 echo Dice1={1} Dice2={2}
+  parallel -a seq6 echo Dice1={1} Dice2={2} :::: seq-6
+  parallel echo Dice1={1} Dice2={2} ::: 1 2 3 4 5 6 :::: seq-6
+  cat seq-6 | parallel echo Dice1={1} Dice2={2} :::: seq6 -
+
+If stdin (standard input) is the only input source, you do not need the '-':
+
+  cat seq6 | parallel echo Dice1={1}
+
+=head3 Linking input sources
+
+You can link multiple input sources with B<:::+> and B<::::+>:
+
+  parallel echo {1}={2} ::: I II III IV V VI :::+ 1 2 3 4 5 6
+  parallel echo {1}={2} ::: I II III IV V VI ::::+ seq6
+
+The B<:::+> (and B<::::+>) will link each value to the corresponding
+value in the previous input source, so value number 3 from the first
+input source will be linked to value number 3 from the second input
+source.
+
+You can combine B<:::+> and B<:::>, so you link 2 input sources, but
+generate all combinations with other input sources:
+
+  parallel echo Dice1={1}={2} Dice2={3}={4} ::: I II III IV V VI ::::+ seq6 \
+    ::: VI V IV III II I ::::+ seq-6
+
+
+=head2 Building the command line
+
+=head3 The command
+
+The command can be a script, a binary or a Bash function if the
+function is exported using B<export -f>:
+
+  # Works only in Bash
+  my_func() {
+    echo in my_func "$1"
+  }
+  export -f my_func
+  parallel my_func ::: 1 2 3
+
+If the command is complex, it often improves readability to make it
+into a function.
+
+
+=head3 The replacement strings
+
+GNU B<parallel> has some replacement strings to make it easier to
+refer to the input read from the input sources.
+
+If the input is B<mydir/mysubdir/myfile.myext> then:
+
+  {} = mydir/mysubdir/myfile.myext
+  {.} = mydir/mysubdir/myfile
+  {/} = myfile.myext
+  {//} = mydir/mysubdir
+  {/.} = myfile
+  {#} = the sequence number of the job
+  {%} = the job slot number
+
+When a job is started it gets a sequence number that starts at 1 and
+increases by 1 for each new job. The job also gets assigned a slot
+number. This number is from 1 to the number of jobs running in
+parallel. It is unique between the running jobs, but is re-used as
+soon as a job finishes.
+
+=head4 The positional replacement strings
+
+The replacement strings have corresponding positional replacement
+strings. If the value from the 3rd input source is
+B<mydir/mysubdir/myfile.myext>:
+
+  {3} = mydir/mysubdir/myfile.myext
+  {3.} = mydir/mysubdir/myfile
+  {3/} = myfile.myext
+  {3//} = mydir/mysubdir
+  {3/.} = myfile
+
+So the number of the input source is simply prepended inside the {}'s.
+
+
+=head1 Replacement strings
+
+--plus replacement strings
+
+change the replacement string (-I --extensionreplace --basenamereplace --basenamereplace --dirnamereplace --basenameextensionreplace --seqreplace --slotreplace
+
+--header with named replacement string
+
+{= =}
+
+Dynamic replacement strings
+
+=head2 Defining replacement strings
+
+
+
+
+=head2 Copying environment
+
+env_parallel
+
+=head2 Controlling the output
+
+=head3 parset
+
+B<parset> is a shell function to get the output from GNU B<parallel>
+into shell variables.
+
+B<parset> is fully supported for B<Bash/Zsh/Ksh> and partially supported
+for B<ash/dash>. I will assume you run B<Bash>.
+
+To activate B<parset> you have to run:
+
+  . `which env_parallel.bash`
+
+(replace B<bash> with your shell's name).
+
+Then you can run:
+
+  parset a,b,c seq ::: 4 5 6
+  echo "$c"
+
+or:
+
+  parset 'a b c' seq ::: 4 5 6
+  echo "$c"
+
+If you give a single variable, this will become an array:
+
+  parset arr seq ::: 4 5 6
+  echo "${arr[1]}"
+
+B<parset> has one limitation: If it reads from a pipe, the output will
+be lost.
+
+  echo This will not work | parset myarr echo
+  echo Nothing: "${myarr[*]}"
+
+Instead you can do this:
+
+  echo This will work > tempfile
+  parset myarr echo < tempfile
+  echo ${myarr[*]}
+
+sql
+cvs
+
+
+=head2 Controlling the execution
+
+--dryrun -v
+
+=head2 Remote execution
+
+For this section you must have B<ssh> access with no password to 2
+servers: B<$server1> and B<$server2>.
+
+  server1=server.example.com
+  server2=server2.example.net
+
+So you must be able to do this:
+
+  ssh $server1 echo works
+  ssh $server2 echo works
+
+It can be setup by running 'ssh-keygen -t dsa; ssh-copy-id $server1'
+and using an empty passphrase. Or you can use B<ssh-agent>.
+
+=head3 Workers
+
+=head3 --transferfile
+
+B<--transferfile> I<filename> will transfer I<filename> to the
+worker. I<filename> can contain a replacement string:
+
+  parallel -S $server1,$server2 --transferfile {} wc ::: example.*
+  parallel -S $server1,$server2 --transferfile {2} \
+     echo count {1} in {2}';' wc {1} {2} ::: -l -c ::: example.*
+
+A shorthand for B<--transferfile {}> is B<--transfer>.
+
+=head3 --return
+
+
+
+=head3 --cleanup
+
+A shorthand for B<--transfer --return {} --cleanup> is B<--trc {}>.
+
+
+=head2 Pipe mode
+
+--pipepart
+
+
+=head2 That's it
+
+=head1 Advanced usage
+
+parset fifo, cmd substitution, arrayelements, array with var names and cmds, env_parset
+
+
+env_parallel
+
+Interfacing with R.
+
+Interfacing with JSON/jq
+
+4dl() {
+  board="$(printf -- '%s' "${1}" | cut -d '/' -f4)"
+  thread="$(printf -- '%s' "${1}" | cut -d '/' -f6)"
+  wget -qO- "https://a.4cdn.org/${board}/thread/${thread}.json" |
+    jq -r '
+      .posts
+      | map(select(.tim != null))
+      | map((.tim | tostring) + .ext)
+      | map("https://i.4cdn.org/'"${board}"'/"+.)[]
+    ' |
+      parallel --gnu -j 0 wget -nv
+}
+
+Interfacing with XML/?
+
+Interfacing with HTML/?
+
+=head2 Controlling the execution
+
+--termseq
+
+
+=head2 Remote execution
+
+seq 10 | parallel --sshlogin 'ssh -i "key.pem" a@b.com' echo
+
+seq 10 | PARALLEL_SSH='ssh -i "key.pem"' parallel --sshlogin a@b.com echo
+
+seq 10 | parallel --ssh 'ssh -i "key.pem"' --sshlogin a@b.com echo
+
+ssh-agent
+
+The sshlogin file format
+
+Check if servers are up
+
+
+
+=cut
diff --git a/src/parallel_cheat_bw.fodt b/src/parallel_cheat_bw.fodt
new file mode 100644
index 0000000..fb3e80f
--- /dev/null
+++ b/src/parallel_cheat_bw.fodt
@@ -0,0 +1,1001 @@
+<?xml version="1.0" encoding="UTF-8"?>
+
+<office:document xmlns:office="urn:oasis:names:tc:opendocument:xmlns:office:1.0" xmlns:style="urn:oasis:names:tc:opendocument:xmlns:style:1.0" xmlns:text="urn:oasis:names:tc:opendocument:xmlns:text:1.0" xmlns:table="urn:oasis:names:tc:opendocument:xmlns:table:1.0" xmlns:draw="urn:oasis:names:tc:opendocument:xmlns:drawing:1.0" xmlns:fo="urn:oasis:names:tc:opendocument:xmlns:xsl-fo-compatible:1.0" xmlns:xlink="http://www.w3.org/1999/xlink" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:meta="urn:oasis:names:tc:opendocument:xmlns:meta:1.0" xmlns:number="urn:oasis:names:tc:opendocument:xmlns:datastyle:1.0" xmlns:svg="urn:oasis:names:tc:opendocument:xmlns:svg-compatible:1.0" xmlns:chart="urn:oasis:names:tc:opendocument:xmlns:chart:1.0" xmlns:dr3d="urn:oasis:names:tc:opendocument:xmlns:dr3d:1.0" xmlns:math="http://www.w3.org/1998/Math/MathML" xmlns:form="urn:oasis:names:tc:opendocument:xmlns:form:1.0" xmlns:script="urn:oasis:names:tc:opendocument:xmlns:script:1.0" xmlns:config="urn:oasis:names:tc:opendocument:xmlns:config:1.0" xmlns:ooo="http://openoffice.org/2004/office" xmlns:ooow="http://openoffice.org/2004/writer" xmlns:oooc="http://openoffice.org/2004/calc" xmlns:dom="http://www.w3.org/2001/xml-events" xmlns:xforms="http://www.w3.org/2002/xforms" xmlns:xsd="http://www.w3.org/2001/XMLSchema" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xmlns:rpt="http://openoffice.org/2005/report" xmlns:of="urn:oasis:names:tc:opendocument:xmlns:of:1.2" xmlns:xhtml="http://www.w3.org/1999/xhtml" xmlns:grddl="http://www.w3.org/2003/g/data-view#" xmlns:officeooo="http://openoffice.org/2009/office" xmlns:tableooo="http://openoffice.org/2009/table" xmlns:drawooo="http://openoffice.org/2010/draw" xmlns:calcext="urn:org:documentfoundation:names:experimental:calc:xmlns:calcext:1.0" xmlns:loext="urn:org:documentfoundation:names:experimental:office:xmlns:loext:1.0" xmlns:field="urn:openoffice:names:experimental:ooo-ms-interop:xmlns:field:1.0" xmlns:formx="urn:openoffice:names:experimental:ooxml-odf-interop:xmlns:form:1.0" xmlns:css3t="http://www.w3.org/TR/css3-text/" office:version="1.2" office:mimetype="application/vnd.oasis.opendocument.text">
+ <office:meta><meta:creation-date>2019-02-27T22:13:36.781924718</meta:creation-date><dc:date>2019-03-12T01:40:23.357999303</dc:date><meta:editing-duration>P11DT5H49M15S</meta:editing-duration><meta:editing-cycles>40</meta:editing-cycles><meta:generator>LibreOffice/6.0.6.2$Linux_X86_64 LibreOffice_project/00m0$Build-2</meta:generator><meta:print-date>2019-03-08T23:06:56.779293422</meta:print-date><meta:document-statistic meta:table-count="9" meta:image-count="0" meta:object-count="0" meta:page-count="1" meta:paragraph-count="47" meta:word-count="337" meta:character-count="1950" meta:non-whitespace-character-count="1661"/></office:meta>
+ <office:settings>
+  <config:config-item-set config:name="ooo:view-settings">
+   <config:config-item config:name="ViewAreaTop" config:type="long">15875</config:config-item>
+   <config:config-item config:name="ViewAreaLeft" config:type="long">0</config:config-item>
+   <config:config-item config:name="ViewAreaWidth" config:type="long">22287</config:config-item>
+   <config:config-item config:name="ViewAreaHeight" config:type="long">11042</config:config-item>
+   <config:config-item config:name="ShowRedlineChanges" config:type="boolean">true</config:config-item>
+   <config:config-item config:name="InBrowseMode" config:type="boolean">false</config:config-item>
+   <config:config-item-map-indexed config:name="Views">
+    <config:config-item-map-entry>
+     <config:config-item config:name="ViewId" config:type="string">view2</config:config-item>
+     <config:config-item config:name="ViewLeft" config:type="long">18724</config:config-item>
+     <config:config-item config:name="ViewTop" config:type="long">25474</config:config-item>
+     <config:config-item config:name="VisibleLeft" config:type="long">0</config:config-item>
+     <config:config-item config:name="VisibleTop" config:type="long">15875</config:config-item>
+     <config:config-item config:name="VisibleRight" config:type="long">22285</config:config-item>
+     <config:config-item config:name="VisibleBottom" config:type="long">26915</config:config-item>
+     <config:config-item config:name="ZoomType" config:type="short">0</config:config-item>
+     <config:config-item config:name="ViewLayoutColumns" config:type="short">1</config:config-item>
+     <config:config-item config:name="ViewLayoutBookMode" config:type="boolean">false</config:config-item>
+     <config:config-item config:name="ZoomFactor" config:type="short">250</config:config-item>
+     <config:config-item config:name="IsSelectedFrame" config:type="boolean">false</config:config-item>
+     <config:config-item config:name="AnchoredTextOverflowLegacy" config:type="boolean">false</config:config-item>
+    </config:config-item-map-entry>
+   </config:config-item-map-indexed>
+  </config:config-item-set>
+  <config:config-item-set config:name="ooo:configuration-settings">
+   <config:config-item config:name="PrintPaperFromSetup" config:type="boolean">false</config:config-item>
+   <config:config-item config:name="PrintFaxName" config:type="string"/>
+   <config:config-item config:name="PrintSingleJobs" config:type="boolean">false</config:config-item>
+   <config:config-item config:name="PrintProspectRTL" config:type="boolean">false</config:config-item>
+   <config:config-item config:name="PrintProspect" config:type="boolean">false</config:config-item>
+   <config:config-item config:name="PrintReversed" config:type="boolean">false</config:config-item>
+   <config:config-item config:name="PrintTextPlaceholder" config:type="boolean">false</config:config-item>
+   <config:config-item config:name="PrintTables" config:type="boolean">true</config:config-item>
+   <config:config-item config:name="DoNotJustifyLinesWithManualBreak" config:type="boolean">false</config:config-item>
+   <config:config-item config:name="AlignTabStopPosition" config:type="boolean">true</config:config-item>
+   <config:config-item config:name="PrintLeftPages" config:type="boolean">true</config:config-item>
+   <config:config-item config:name="IgnoreFirstLineIndentInNumbering" config:type="boolean">false</config:config-item>
+   <config:config-item config:name="PrinterSetup" config:type="base64Binary">uAH+/1hlcm94X1BoYXNlcl82MTQwRE4AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAQ1VQUzpYZXJveF9QaGFzZXJfNjE0MEROAAAAAAAAAAAWAAMA2QAAAAAAAAAEAAhSAAAEdAAASm9iRGF0YSAxCnByaW50ZXI9WGVyb3hfUGhhc2VyXzYxNDBETgpvcmllbnRhdGlvbj1Qb3J0cmFpdApjb3BpZXM9MQpjb2xsYXRlPWZhbHNlCm1hcmdpbmRhanVzdG1lbnQ9MCwwLDAsMApjb2xvcmRlcHRoPTI0CnBzbGV2ZWw9MApwZGZkZXZpY2U9MQpjb2xvcmRldmljZT0wClBQRENvbnRleERhdGEKRHVwbGV4Ok5vbmUAUGFnZVNpemU6QTQASW5wdXRTbG90OkF1dG9TZWxlY3QAABIAQ09NUEFUX0RVUExFWF9NT0RFDwBEdXBsZXhNb2RlOjpPZmY=</config:config-item>
+   <config:config-item config:name="CollapseEmptyCellPara" config:type="boolean">true</config:config-item>
+   <config:config-item config:name="RedlineProtectionKey" config:type="base64Binary"/>
+   <config:config-item config:name="UseOldPrinterMetrics" config:type="boolean">false</config:config-item>
+   <config:config-item config:name="UseOldNumbering" config:type="boolean">false</config:config-item>
+   <config:config-item config:name="AddExternalLeading" config:type="boolean">true</config:config-item>
+   <config:config-item config:name="TreatSingleColumnBreakAsPageBreak" config:type="boolean">false</config:config-item>
+   <config:config-item config:name="UpdateFromTemplate" config:type="boolean">true</config:config-item>
+   <config:config-item config:name="IsLabelDocument" config:type="boolean">false</config:config-item>
+   <config:config-item config:name="RsidRoot" config:type="int">816919</config:config-item>
+   <config:config-item config:name="ConsiderTextWrapOnObjPos" config:type="boolean">false</config:config-item>
+   <config:config-item config:name="TableRowKeep" config:type="boolean">false</config:config-item>
+   <config:config-item config:name="TabsRelativeToIndent" config:type="boolean">true</config:config-item>
+   <config:config-item config:name="SaveVersionOnClose" config:type="boolean">false</config:config-item>
+   <config:config-item config:name="UseFormerTextWrapping" config:type="boolean">false</config:config-item>
+   <config:config-item config:name="ChartAutoUpdate" config:type="boolean">true</config:config-item>
+   <config:config-item config:name="AddParaTableSpacingAtStart" config:type="boolean">true</config:config-item>
+   <config:config-item config:name="AllowPrintJobCancel" config:type="boolean">true</config:config-item>
+   <config:config-item config:name="AddParaTableSpacing" config:type="boolean">true</config:config-item>
+   <config:config-item config:name="PrintDrawings" config:type="boolean">true</config:config-item>
+   <config:config-item config:name="AddParaSpacingToTableCells" config:type="boolean">true</config:config-item>
+   <config:config-item config:name="UseFormerLineSpacing" config:type="boolean">false</config:config-item>
+   <config:config-item config:name="OutlineLevelYieldsNumbering" config:type="boolean">false</config:config-item>
+   <config:config-item config:name="LinkUpdateMode" config:type="short">1</config:config-item>
+   <config:config-item config:name="DoNotResetParaAttrsForNumFont" config:type="boolean">false</config:config-item>
+   <config:config-item config:name="ApplyUserData" config:type="boolean">true</config:config-item>
+   <config:config-item config:name="StylesNoDefault" config:type="boolean">false</config:config-item>
+   <config:config-item config:name="EmbeddedDatabaseName" config:type="string"/>
+   <config:config-item config:name="FloattableNomargins" config:type="boolean">false</config:config-item>
+   <config:config-item config:name="BackgroundParaOverDrawings" config:type="boolean">false</config:config-item>
+   <config:config-item config:name="PrinterName" config:type="string">Xerox_Phaser_6140DN</config:config-item>
+   <config:config-item config:name="UseFormerObjectPositioning" config:type="boolean">false</config:config-item>
+   <config:config-item config:name="TabOverMargin" config:type="boolean">false</config:config-item>
+   <config:config-item config:name="SaveGlobalDocumentLinks" config:type="boolean">false</config:config-item>
+   <config:config-item config:name="CurrentDatabaseDataSource" config:type="string"/>
+   <config:config-item config:name="IsKernAsianPunctuation" config:type="boolean">false</config:config-item>
+   <config:config-item config:name="CharacterCompressionType" config:type="short">0</config:config-item>
+   <config:config-item config:name="SmallCapsPercentage66" config:type="boolean">false</config:config-item>
+   <config:config-item config:name="CurrentDatabaseCommand" config:type="string"/>
+   <config:config-item config:name="CurrentDatabaseCommandType" config:type="int">0</config:config-item>
+   <config:config-item config:name="FieldAutoUpdate" config:type="boolean">true</config:config-item>
+   <config:config-item config:name="IgnoreTabsAndBlanksForLineCalculation" config:type="boolean">false</config:config-item>
+   <config:config-item config:name="LoadReadonly" config:type="boolean">false</config:config-item>
+   <config:config-item config:name="DoNotCaptureDrawObjsOnPage" config:type="boolean">false</config:config-item>
+   <config:config-item config:name="ClipAsCharacterAnchoredWriterFlyFrames" config:type="boolean">false</config:config-item>
+   <config:config-item config:name="PrintBlackFonts" config:type="boolean">false</config:config-item>
+   <config:config-item config:name="DisableOffPagePositioning" config:type="boolean">true</config:config-item>
+   <config:config-item config:name="SurroundTextWrapSmall" config:type="boolean">false</config:config-item>
+   <config:config-item config:name="UnxForceZeroExtLeading" config:type="boolean">false</config:config-item>
+   <config:config-item config:name="TabAtLeftIndentForParagraphsInList" config:type="boolean">false</config:config-item>
+   <config:config-item config:name="PrintRightPages" config:type="boolean">true</config:config-item>
+   <config:config-item config:name="Rsid" config:type="int">1662577</config:config-item>
+   <config:config-item config:name="MathBaselineAlignment" config:type="boolean">true</config:config-item>
+   <config:config-item config:name="MsWordCompTrailingBlanks" config:type="boolean">false</config:config-item>
+   <config:config-item config:name="InvertBorderSpacing" config:type="boolean">false</config:config-item>
+   <config:config-item config:name="EmbedFonts" config:type="boolean">false</config:config-item>
+   <config:config-item config:name="PrinterIndependentLayout" config:type="string">high-resolution</config:config-item>
+   <config:config-item config:name="TabOverflow" config:type="boolean">true</config:config-item>
+   <config:config-item config:name="PrintGraphics" config:type="boolean">true</config:config-item>
+   <config:config-item config:name="PropLineSpacingShrinksFirstLine" config:type="boolean">true</config:config-item>
+   <config:config-item config:name="UnbreakableNumberings" config:type="boolean">false</config:config-item>
+   <config:config-item config:name="AddFrameOffsets" config:type="boolean">false</config:config-item>
+   <config:config-item config:name="ClippedPictures" config:type="boolean">false</config:config-item>
+   <config:config-item config:name="EmbedSystemFonts" config:type="boolean">false</config:config-item>
+   <config:config-item config:name="ApplyParagraphMarkFormatToNumbering" config:type="boolean">false</config:config-item>
+   <config:config-item config:name="SubtractFlysAnchoredAtFlys" config:type="boolean">false</config:config-item>
+   <config:config-item config:name="AddVerticalFrameOffsets" config:type="boolean">false</config:config-item>
+   <config:config-item config:name="ProtectForm" config:type="boolean">false</config:config-item>
+   <config:config-item config:name="PrintEmptyPages" config:type="boolean">false</config:config-item>
+   <config:config-item config:name="PrintControls" config:type="boolean">true</config:config-item>
+   <config:config-item config:name="PrintHiddenText" config:type="boolean">false</config:config-item>
+   <config:config-item config:name="PrintAnnotationMode" config:type="short">0</config:config-item>
+   <config:config-item config:name="PrintPageBackground" config:type="boolean">true</config:config-item>
+  </config:config-item-set>
+ </office:settings>
+ <office:scripts>
+  <office:script script:language="ooo:Basic">
+   <ooo:libraries xmlns:ooo="http://openoffice.org/2004/office" xmlns:xlink="http://www.w3.org/1999/xlink">
+    <ooo:library-embedded ooo:name="Standard"/>
+   </ooo:libraries>
+  </office:script>
+ </office:scripts>
+ <office:font-face-decls>
+  <style:font-face style:name="Lohit Devanagari1" svg:font-family="&apos;Lohit Devanagari&apos;"/>
+  <style:font-face style:name="monospace" svg:font-family="monospace"/>
+  <style:font-face style:name="DejaVu Sans Mono" svg:font-family="&apos;DejaVu Sans Mono&apos;" style:font-family-generic="modern" style:font-pitch="fixed"/>
+  <style:font-face style:name="Liberation Mono" svg:font-family="&apos;Liberation Mono&apos;" style:font-family-generic="modern" style:font-pitch="fixed"/>
+  <style:font-face style:name="Bitstream Vera Serif1" svg:font-family="&apos;Bitstream Vera Serif&apos;" style:font-family-generic="roman" style:font-pitch="variable"/>
+  <style:font-face style:name="Bitstream Vera Serif" svg:font-family="&apos;Bitstream Vera Serif&apos;" style:font-adornments="Roman" style:font-family-generic="roman" style:font-pitch="variable"/>
+  <style:font-face style:name="Liberation Serif" svg:font-family="&apos;Liberation Serif&apos;" style:font-family-generic="roman" style:font-pitch="variable"/>
+  <style:font-face style:name="Thorndale" svg:font-family="Thorndale" style:font-family-generic="roman" style:font-pitch="variable"/>
+  <style:font-face style:name="DejaVu Sans" svg:font-family="&apos;DejaVu Sans&apos;" style:font-family-generic="swiss" style:font-pitch="variable"/>
+  <style:font-face style:name="FreeSans" svg:font-family="FreeSans" style:font-adornments="Bold" style:font-family-generic="swiss" style:font-pitch="variable"/>
+  <style:font-face style:name="Liberation Sans" svg:font-family="&apos;Liberation Sans&apos;" style:font-family-generic="swiss" style:font-pitch="variable"/>
+  <style:font-face style:name="Lohit Devanagari" svg:font-family="&apos;Lohit Devanagari&apos;" style:font-family-generic="system" style:font-pitch="variable"/>
+  <style:font-face style:name="Noto Sans CJK SC Regular" svg:font-family="&apos;Noto Sans CJK SC Regular&apos;" style:font-family-generic="system" style:font-pitch="variable"/>
+ </office:font-face-decls>
+ <office:styles>
+  <style:default-style style:family="graphic">
+   <style:graphic-properties svg:stroke-color="#3465a4" draw:fill-color="#729fcf" fo:wrap-option="no-wrap" draw:shadow-offset-x="0.1181in" draw:shadow-offset-y="0.1181in" draw:start-line-spacing-horizontal="0.1114in" draw:start-line-spacing-vertical="0.1114in" draw:end-line-spacing-horizontal="0.1114in" draw:end-line-spacing-vertical="0.1114in" style:flow-with-text="false"/>
+   <style:paragraph-properties style:text-autospace="ideograph-alpha" style:line-break="strict" style:font-independent-line-spacing="false">
+    <style:tab-stops/>
+   </style:paragraph-properties>
+   <style:text-properties style:use-window-font-color="true" style:font-name="Liberation Serif" fo:font-size="12pt" fo:language="en" fo:country="US" style:letter-kerning="true" style:font-name-asian="Noto Sans CJK SC Regular" style:font-size-asian="10.5pt" style:language-asian="zh" style:country-asian="CN" style:font-name-complex="Lohit Devanagari" style:font-size-complex="12pt" style:language-complex="hi" style:country-complex="IN"/>
+  </style:default-style>
+  <style:default-style style:family="paragraph">
+   <style:paragraph-properties fo:orphans="2" fo:widows="2" fo:hyphenation-ladder-count="no-limit" style:text-autospace="ideograph-alpha" style:punctuation-wrap="hanging" style:line-break="strict" style:tab-stop-distance="0.4925in" style:writing-mode="page"/>
+   <style:text-properties style:use-window-font-color="true" style:font-name="Liberation Serif" fo:font-size="12pt" fo:language="en" fo:country="US" style:letter-kerning="true" style:font-name-asian="Noto Sans CJK SC Regular" style:font-size-asian="10.5pt" style:language-asian="zh" style:country-asian="CN" style:font-name-complex="Lohit Devanagari" style:font-size-complex="12pt" style:language-complex="hi" style:country-complex="IN" fo:hyphenate="false" fo:hyphenation-remain-char-count="2" fo:hyphenation-push-char-count="2"/>
+  </style:default-style>
+  <style:default-style style:family="table">
+   <style:table-properties table:border-model="collapsing"/>
+  </style:default-style>
+  <style:default-style style:family="table-row">
+   <style:table-row-properties fo:keep-together="auto"/>
+  </style:default-style>
+  <style:style style:name="Standard" style:family="paragraph" style:class="text"/>
+  <style:style style:name="Heading" style:family="paragraph" style:parent-style-name="Standard" style:next-style-name="Text_20_body" style:class="text">
+   <style:paragraph-properties fo:margin-top="0.1665in" fo:margin-bottom="0.0835in" loext:contextual-spacing="false" fo:keep-with-next="always"/>
+   <style:text-properties style:font-name="Liberation Sans" fo:font-family="&apos;Liberation Sans&apos;" style:font-family-generic="swiss" style:font-pitch="variable" fo:font-size="14pt" style:font-name-asian="Noto Sans CJK SC Regular" style:font-family-asian="&apos;Noto Sans CJK SC Regular&apos;" style:font-family-generic-asian="system" style:font-pitch-asian="variable" style:font-size-asian="14pt" style:font-name-complex="Lohit Devanagari" style:font-family-complex="&apos;Lohit Devanagari&apos;" style:font-family-generic-complex="system" style:font-pitch-complex="variable" style:font-size-complex="14pt"/>
+  </style:style>
+  <style:style style:name="Text_20_body" style:display-name="Text body" style:family="paragraph" style:parent-style-name="Standard" style:class="text">
+   <style:paragraph-properties fo:margin-top="0in" fo:margin-bottom="0.0972in" loext:contextual-spacing="false" fo:line-height="115%"/>
+  </style:style>
+  <style:style style:name="List" style:family="paragraph" style:parent-style-name="Text_20_body" style:class="list">
+   <style:text-properties style:font-size-asian="12pt" style:font-name-complex="Lohit Devanagari1" style:font-family-complex="&apos;Lohit Devanagari&apos;"/>
+  </style:style>
+  <style:style style:name="Caption" style:family="paragraph" style:parent-style-name="Standard" style:class="extra">
+   <style:paragraph-properties fo:margin-top="0.0835in" fo:margin-bottom="0.0835in" loext:contextual-spacing="false" text:number-lines="false" text:line-number="0"/>
+   <style:text-properties fo:font-size="12pt" fo:font-style="italic" style:font-size-asian="12pt" style:font-style-asian="italic" style:font-name-complex="Lohit Devanagari1" style:font-family-complex="&apos;Lohit Devanagari&apos;" style:font-size-complex="12pt" style:font-style-complex="italic"/>
+  </style:style>
+  <style:style style:name="Index" style:family="paragraph" style:parent-style-name="Standard" style:class="index">
+   <style:paragraph-properties text:number-lines="false" text:line-number="0"/>
+   <style:text-properties style:font-size-asian="12pt" style:font-name-complex="Lohit Devanagari1" style:font-family-complex="&apos;Lohit Devanagari&apos;"/>
+  </style:style>
+  <style:style style:name="Table_20_Contents" style:display-name="Table Contents" style:family="paragraph" style:parent-style-name="Standard" style:class="extra">
+   <loext:graphic-properties draw:fill="none" draw:fill-color="#729fcf"/>
+   <style:paragraph-properties fo:line-height="115%" fo:background-color="transparent" style:shadow="none" text:number-lines="false" text:line-number="0"/>
+   <style:text-properties style:font-name="Bitstream Vera Serif" fo:font-family="&apos;Bitstream Vera Serif&apos;" style:font-style-name="Roman" style:font-family-generic="roman" style:font-pitch="variable" fo:font-size="10pt" style:font-size-asian="10.5pt"/>
+  </style:style>
+  <style:style style:name="Header" style:family="paragraph" style:parent-style-name="Standard" style:class="extra">
+   <style:paragraph-properties text:number-lines="false" text:line-number="0">
+    <style:tab-stops>
+     <style:tab-stop style:position="3.3472in" style:type="center"/>
+     <style:tab-stop style:position="6.6953in" style:type="right"/>
+    </style:tab-stops>
+   </style:paragraph-properties>
+  </style:style>
+  <style:style style:name="Table_20_Heading" style:display-name="Table Heading" style:family="paragraph" style:parent-style-name="Table_20_Contents" style:class="extra">
+   <style:paragraph-properties fo:text-align="center" style:justify-single-word="false" text:number-lines="false" text:line-number="0"/>
+   <style:text-properties fo:font-weight="bold" style:font-weight-asian="bold" style:font-weight-complex="bold"/>
+  </style:style>
+  <style:style style:name="Preformatted_20_Text" style:display-name="Preformatted Text" style:family="paragraph" style:parent-style-name="Standard" style:class="html" style:master-page-name="">
+   <loext:graphic-properties draw:fill="none" draw:fill-color="#729fcf"/>
+   <style:paragraph-properties fo:margin-left="0.2in" fo:margin-right="0.2in" fo:margin-top="0in" fo:margin-bottom="0in" loext:contextual-spacing="true" fo:orphans="3" fo:widows="3" fo:text-indent="0in" style:auto-text-indent="false" style:page-number="auto" fo:background-color="transparent" style:shadow="none" fo:keep-with-next="auto" style:writing-mode="page"/>
+   <style:text-properties style:font-name="Liberation Mono" fo:font-family="&apos;Liberation Mono&apos;" style:font-family-generic="modern" style:font-pitch="fixed" fo:font-size="10pt" style:font-name-asian="DejaVu Sans Mono" style:font-family-asian="&apos;DejaVu Sans Mono&apos;" style:font-family-generic-asian="modern" style:font-pitch-asian="fixed" style:font-size-asian="10pt" style:font-name-complex="Liberation Mono" style:font-family-complex="&apos;Liberation Mono&apos;" style:font-family-generic-complex="modern" style:font-pitch-complex="fixed" style:font-size-complex="10pt"/>
+  </style:style>
+  <style:style style:name="Level1_20_body" style:display-name="Level1 body" style:family="paragraph" style:parent-style-name="Text_20_body">
+   <style:paragraph-properties fo:margin-top="0.1in" fo:margin-bottom="0.1in" loext:contextual-spacing="false" fo:padding="0.1in" fo:border-left="0.51pt solid #000000" fo:border-right="none" fo:border-top="none" fo:border-bottom="none" style:shadow="none" style:writing-mode="page"/>
+  </style:style>
+  <style:style style:name="Numbering_20_Symbols" style:display-name="Numbering Symbols" style:family="text"/>
+  <style:style style:name="Source_20_Text" style:display-name="Source Text" style:family="text">
+   <style:text-properties style:font-name="Liberation Mono" fo:font-family="&apos;Liberation Mono&apos;" style:font-family-generic="modern" style:font-pitch="fixed" fo:font-size="10.5pt" fo:font-weight="normal" fo:background-color="#dddddd" style:font-name-asian="DejaVu Sans Mono" style:font-family-asian="&apos;DejaVu Sans Mono&apos;" style:font-family-generic-asian="modern" style:font-pitch-asian="fixed" style:font-size-asian="9.60000038146973pt" style:font-weight-asian="normal" style:font-name-complex="Liberation Mono" style:font-family-complex="&apos;Liberation Mono&apos;" style:font-family-generic-complex="modern" style:font-pitch-complex="fixed" style:font-size-complex="11pt" style:font-weight-complex="normal"/>
+  </style:style>
+  <text:outline-style style:name="Outline">
+   <text:outline-level-style text:level="1" style:num-format="">
+    <style:list-level-properties text:list-level-position-and-space-mode="label-alignment">
+     <style:list-level-label-alignment text:label-followed-by="listtab"/>
+    </style:list-level-properties>
+   </text:outline-level-style>
+   <text:outline-level-style text:level="2" style:num-format="">
+    <style:list-level-properties text:list-level-position-and-space-mode="label-alignment">
+     <style:list-level-label-alignment text:label-followed-by="listtab"/>
+    </style:list-level-properties>
+   </text:outline-level-style>
+   <text:outline-level-style text:level="3" style:num-format="">
+    <style:list-level-properties text:list-level-position-and-space-mode="label-alignment">
+     <style:list-level-label-alignment text:label-followed-by="listtab"/>
+    </style:list-level-properties>
+   </text:outline-level-style>
+   <text:outline-level-style text:level="4" style:num-format="">
+    <style:list-level-properties text:list-level-position-and-space-mode="label-alignment">
+     <style:list-level-label-alignment text:label-followed-by="listtab"/>
+    </style:list-level-properties>
+   </text:outline-level-style>
+   <text:outline-level-style text:level="5" style:num-format="">
+    <style:list-level-properties text:list-level-position-and-space-mode="label-alignment">
+     <style:list-level-label-alignment text:label-followed-by="listtab"/>
+    </style:list-level-properties>
+   </text:outline-level-style>
+   <text:outline-level-style text:level="6" style:num-format="">
+    <style:list-level-properties text:list-level-position-and-space-mode="label-alignment">
+     <style:list-level-label-alignment text:label-followed-by="listtab"/>
+    </style:list-level-properties>
+   </text:outline-level-style>
+   <text:outline-level-style text:level="7" style:num-format="">
+    <style:list-level-properties text:list-level-position-and-space-mode="label-alignment">
+     <style:list-level-label-alignment text:label-followed-by="listtab"/>
+    </style:list-level-properties>
+   </text:outline-level-style>
+   <text:outline-level-style text:level="8" style:num-format="">
+    <style:list-level-properties text:list-level-position-and-space-mode="label-alignment">
+     <style:list-level-label-alignment text:label-followed-by="listtab"/>
+    </style:list-level-properties>
+   </text:outline-level-style>
+   <text:outline-level-style text:level="9" style:num-format="">
+    <style:list-level-properties text:list-level-position-and-space-mode="label-alignment">
+     <style:list-level-label-alignment text:label-followed-by="listtab"/>
+    </style:list-level-properties>
+   </text:outline-level-style>
+   <text:outline-level-style text:level="10" style:num-format="">
+    <style:list-level-properties text:list-level-position-and-space-mode="label-alignment">
+     <style:list-level-label-alignment text:label-followed-by="listtab"/>
+    </style:list-level-properties>
+   </text:outline-level-style>
+  </text:outline-style>
+  <text:notes-configuration text:note-class="footnote" style:num-format="1" text:start-value="0" text:footnotes-position="page" text:start-numbering-at="document"/>
+  <text:notes-configuration text:note-class="endnote" style:num-format="i" text:start-value="0"/>
+  <text:linenumbering-configuration text:number-lines="false" text:offset="0.1965in" style:num-format="1" text:number-position="left" text:increment="5"/>
+ </office:styles>
+ <office:automatic-styles>
+  <style:style style:name="Table7" style:family="table">
+   <style:table-properties style:width="6.6951in" fo:margin-top="0in" fo:margin-bottom="0in" fo:break-before="auto" fo:break-after="auto" table:align="margins" fo:background-color="#dddddd" fo:keep-with-next="auto" style:may-break-between-rows="false" style:writing-mode="page" table:border-model="collapsing">
+    <style:background-image/>
+   </style:table-properties>
+  </style:style>
+  <style:style style:name="Table7.A" style:family="table-column">
+   <style:table-column-properties style:column-width="6.6951in" style:rel-column-width="65535*"/>
+  </style:style>
+  <style:style style:name="Table7.1" style:family="table-row">
+   <style:table-row-properties style:min-row-height="0.1778in" fo:background-color="#000000" fo:keep-together="auto">
+    <style:background-image/>
+   </style:table-row-properties>
+  </style:style>
+  <style:style style:name="Table7.A1" style:family="table-cell">
+   <style:table-cell-properties style:vertical-align="middle" fo:background-color="transparent" fo:padding-left="0.1in" fo:padding-right="0in" fo:padding-top="0in" fo:padding-bottom="0in" fo:border-left="1pt solid #ffffff" fo:border-right="none" fo:border-top="1pt solid #ffffff" fo:border-bottom="1pt solid #ffffff" style:writing-mode="lr-tb">
+    <style:background-image/>
+   </style:table-cell-properties>
+  </style:style>
+  <style:style style:name="Table7.2" style:family="table-row">
+   <style:table-row-properties style:min-row-height="0.1778in" fo:keep-together="auto"/>
+  </style:style>
+  <style:style style:name="Table7.A2" style:family="table-cell" style:data-style-name="N10100">
+   <style:table-cell-properties style:vertical-align="middle" fo:background-color="transparent" fo:padding-left="0.1in" fo:padding-right="0in" fo:padding-top="0in" fo:padding-bottom="0in" fo:border-left="1pt solid #ffffff" fo:border-right="none" fo:border-top="none" fo:border-bottom="1pt solid #ffffff" style:writing-mode="lr-tb">
+    <style:background-image/>
+   </style:table-cell-properties>
+  </style:style>
+  <style:style style:name="Table8" style:family="table">
+   <style:table-properties style:width="6.6951in" fo:margin-top="0in" fo:margin-bottom="0in" fo:break-before="auto" fo:break-after="auto" table:align="margins" fo:background-color="#dddddd" fo:keep-with-next="auto" style:may-break-between-rows="false" style:writing-mode="page" table:border-model="collapsing">
+    <style:background-image/>
+   </style:table-properties>
+  </style:style>
+  <style:style style:name="Table8.A" style:family="table-column">
+   <style:table-column-properties style:column-width="6.6951in" style:rel-column-width="65535*"/>
+  </style:style>
+  <style:style style:name="Table8.1" style:family="table-row">
+   <style:table-row-properties style:min-row-height="0.1778in" fo:background-color="#000000" fo:keep-together="auto">
+    <style:background-image/>
+   </style:table-row-properties>
+  </style:style>
+  <style:style style:name="Table8.A1" style:family="table-cell">
+   <style:table-cell-properties style:vertical-align="middle" fo:background-color="transparent" fo:padding-left="0.1in" fo:padding-right="0in" fo:padding-top="0in" fo:padding-bottom="0in" fo:border-left="1pt solid #ffffff" fo:border-right="none" fo:border-top="1pt solid #ffffff" fo:border-bottom="1pt solid #ffffff" style:writing-mode="lr-tb">
+    <style:background-image/>
+   </style:table-cell-properties>
+  </style:style>
+  <style:style style:name="Table8.2" style:family="table-row">
+   <style:table-row-properties style:min-row-height="0.1778in" fo:keep-together="auto"/>
+  </style:style>
+  <style:style style:name="Table8.A2" style:family="table-cell" style:data-style-name="N10100">
+   <style:table-cell-properties style:vertical-align="middle" fo:background-color="transparent" fo:padding-left="0.1in" fo:padding-right="0in" fo:padding-top="0in" fo:padding-bottom="0in" fo:border-left="1pt solid #ffffff" fo:border-right="none" fo:border-top="none" fo:border-bottom="1pt solid #ffffff" style:writing-mode="lr-tb">
+    <style:background-image/>
+   </style:table-cell-properties>
+  </style:style>
+  <style:style style:name="Table8.3" style:family="table-row">
+   <style:table-row-properties style:min-row-height="0.1778in" fo:keep-together="auto"/>
+  </style:style>
+  <style:style style:name="Table8.4" style:family="table-row">
+   <style:table-row-properties style:min-row-height="0.1778in" fo:keep-together="auto"/>
+  </style:style>
+  <style:style style:name="Table9" style:family="table">
+   <style:table-properties style:width="6.6951in" fo:margin-top="0in" fo:margin-bottom="0in" fo:break-before="auto" fo:break-after="auto" table:align="margins" fo:background-color="#dddddd" fo:keep-with-next="auto" style:may-break-between-rows="false" style:writing-mode="page" table:border-model="collapsing">
+    <style:background-image/>
+   </style:table-properties>
+  </style:style>
+  <style:style style:name="Table9.A" style:family="table-column">
+   <style:table-column-properties style:column-width="6.6951in" style:rel-column-width="65535*"/>
+  </style:style>
+  <style:style style:name="Table9.1" style:family="table-row">
+   <style:table-row-properties style:min-row-height="0.1778in" fo:background-color="#000000" fo:keep-together="auto">
+    <style:background-image/>
+   </style:table-row-properties>
+  </style:style>
+  <style:style style:name="Table9.A1" style:family="table-cell">
+   <style:table-cell-properties style:vertical-align="middle" fo:background-color="transparent" fo:padding-left="0.1in" fo:padding-right="0in" fo:padding-top="0in" fo:padding-bottom="0in" fo:border-left="1pt solid #ffffff" fo:border-right="none" fo:border-top="1pt solid #ffffff" fo:border-bottom="1pt solid #ffffff" style:writing-mode="lr-tb">
+    <style:background-image/>
+   </style:table-cell-properties>
+  </style:style>
+  <style:style style:name="Table9.2" style:family="table-row">
+   <style:table-row-properties style:min-row-height="0.1778in" fo:keep-together="auto"/>
+  </style:style>
+  <style:style style:name="Table9.A2" style:family="table-cell">
+   <style:table-cell-properties style:vertical-align="middle" fo:background-color="transparent" fo:padding-left="0.1in" fo:padding-right="0in" fo:padding-top="0in" fo:padding-bottom="0in" fo:border-left="1pt solid #ffffff" fo:border-right="none" fo:border-top="none" fo:border-bottom="1pt solid #ffffff" style:writing-mode="lr-tb">
+    <style:background-image/>
+   </style:table-cell-properties>
+  </style:style>
+  <style:style style:name="Table9.3" style:family="table-row">
+   <style:table-row-properties style:min-row-height="0.1778in" fo:keep-together="auto"/>
+  </style:style>
+  <style:style style:name="Table9.4" style:family="table-row">
+   <style:table-row-properties style:min-row-height="0.1778in" fo:keep-together="auto"/>
+  </style:style>
+  <style:style style:name="Table9.5" style:family="table-row">
+   <style:table-row-properties style:min-row-height="0.1778in" fo:keep-together="auto"/>
+  </style:style>
+  <style:style style:name="Table9.6" style:family="table-row">
+   <style:table-row-properties style:min-row-height="0.1778in" fo:keep-together="auto"/>
+  </style:style>
+  <style:style style:name="Table9.7" style:family="table-row">
+   <style:table-row-properties style:min-row-height="0.1778in" fo:keep-together="auto"/>
+  </style:style>
+  <style:style style:name="Table10" style:family="table">
+   <style:table-properties style:width="6.6951in" fo:margin-top="0in" fo:margin-bottom="0in" fo:break-before="auto" fo:break-after="auto" table:align="margins" fo:background-color="#dddddd" fo:keep-with-next="auto" style:may-break-between-rows="false" style:writing-mode="page" table:border-model="collapsing">
+    <style:background-image/>
+   </style:table-properties>
+  </style:style>
+  <style:style style:name="Table10.A" style:family="table-column">
+   <style:table-column-properties style:column-width="2.3736in" style:rel-column-width="3418*"/>
+  </style:style>
+  <style:style style:name="Table10.B" style:family="table-column">
+   <style:table-column-properties style:column-width="4.3215in" style:rel-column-width="6223*"/>
+  </style:style>
+  <style:style style:name="Table10.1" style:family="table-row">
+   <style:table-row-properties style:min-row-height="0.1778in" fo:background-color="#000000" fo:keep-together="auto">
+    <style:background-image/>
+   </style:table-row-properties>
+  </style:style>
+  <style:style style:name="Table10.A1" style:family="table-cell">
+   <style:table-cell-properties style:vertical-align="middle" fo:background-color="transparent" fo:padding-left="0.1in" fo:padding-right="0in" fo:padding-top="0in" fo:padding-bottom="0in" fo:border-left="1pt solid #ffffff" fo:border-right="none" fo:border-top="1pt solid #ffffff" fo:border-bottom="1pt solid #ffffff" style:writing-mode="lr-tb">
+    <style:background-image/>
+   </style:table-cell-properties>
+  </style:style>
+  <style:style style:name="Table10.B1" style:family="table-cell">
+   <style:table-cell-properties style:vertical-align="middle" fo:background-color="transparent" fo:padding-left="0.1in" fo:padding-right="0in" fo:padding-top="0in" fo:padding-bottom="0in" fo:border="1pt solid #ffffff" style:writing-mode="lr-tb">
+    <style:background-image/>
+   </style:table-cell-properties>
+  </style:style>
+  <style:style style:name="Table10.2" style:family="table-row">
+   <style:table-row-properties style:min-row-height="0.1778in" fo:keep-together="auto"/>
+  </style:style>
+  <style:style style:name="Table10.A2" style:family="table-cell">
+   <style:table-cell-properties style:vertical-align="middle" fo:background-color="transparent" fo:padding-left="0.1in" fo:padding-right="0in" fo:padding-top="0in" fo:padding-bottom="0in" fo:border-left="1pt solid #ffffff" fo:border-right="none" fo:border-top="none" fo:border-bottom="1pt solid #ffffff" style:writing-mode="lr-tb">
+    <style:background-image/>
+   </style:table-cell-properties>
+  </style:style>
+  <style:style style:name="Table10.B2" style:family="table-cell">
+   <style:table-cell-properties style:vertical-align="middle" fo:background-color="transparent" fo:padding-left="0.1in" fo:padding-right="0in" fo:padding-top="0in" fo:padding-bottom="0in" fo:border-left="1pt solid #ffffff" fo:border-right="1pt solid #ffffff" fo:border-top="none" fo:border-bottom="1pt solid #ffffff" style:writing-mode="lr-tb">
+    <style:background-image/>
+   </style:table-cell-properties>
+  </style:style>
+  <style:style style:name="Table10.3" style:family="table-row">
+   <style:table-row-properties style:min-row-height="0.1778in" fo:keep-together="auto"/>
+  </style:style>
+  <style:style style:name="Table10.4" style:family="table-row">
+   <style:table-row-properties style:min-row-height="0.1778in" fo:keep-together="auto"/>
+  </style:style>
+  <style:style style:name="Table10.5" style:family="table-row">
+   <style:table-row-properties style:min-row-height="0.1778in" fo:keep-together="auto"/>
+  </style:style>
+  <style:style style:name="Table10.6" style:family="table-row">
+   <style:table-row-properties style:min-row-height="0.1778in" fo:keep-together="auto"/>
+  </style:style>
+  <style:style style:name="Table10.7" style:family="table-row">
+   <style:table-row-properties style:min-row-height="0.1778in" fo:keep-together="auto"/>
+  </style:style>
+  <style:style style:name="Table10.8" style:family="table-row">
+   <style:table-row-properties style:min-row-height="0.1778in" fo:keep-together="auto"/>
+  </style:style>
+  <style:style style:name="Table10.9" style:family="table-row">
+   <style:table-row-properties style:min-row-height="0.1778in" fo:keep-together="auto"/>
+  </style:style>
+  <style:style style:name="Table11" style:family="table">
+   <style:table-properties style:width="6.6951in" fo:margin-top="0in" fo:margin-bottom="0in" fo:break-before="auto" fo:break-after="auto" table:align="margins" fo:background-color="#dddddd" fo:keep-with-next="auto" style:may-break-between-rows="false" style:writing-mode="page" table:border-model="collapsing">
+    <style:background-image/>
+   </style:table-properties>
+  </style:style>
+  <style:style style:name="Table11.A" style:family="table-column">
+   <style:table-column-properties style:column-width="6.6951in" style:rel-column-width="65535*"/>
+  </style:style>
+  <style:style style:name="Table11.1" style:family="table-row">
+   <style:table-row-properties style:min-row-height="0.1778in" fo:background-color="#000000" fo:keep-together="auto">
+    <style:background-image/>
+   </style:table-row-properties>
+  </style:style>
+  <style:style style:name="Table11.A1" style:family="table-cell">
+   <style:table-cell-properties style:vertical-align="middle" fo:background-color="transparent" fo:padding-left="0.1in" fo:padding-right="0in" fo:padding-top="0in" fo:padding-bottom="0in" fo:border-left="1pt solid #ffffff" fo:border-right="none" fo:border-top="1pt solid #ffffff" fo:border-bottom="1pt solid #ffffff" style:writing-mode="lr-tb">
+    <style:background-image/>
+   </style:table-cell-properties>
+  </style:style>
+  <style:style style:name="Table11.2" style:family="table-row">
+   <style:table-row-properties style:min-row-height="0.1778in" fo:keep-together="auto"/>
+  </style:style>
+  <style:style style:name="Table11.A2" style:family="table-cell">
+   <style:table-cell-properties style:vertical-align="middle" fo:background-color="transparent" fo:padding-left="0.1in" fo:padding-right="0in" fo:padding-top="0in" fo:padding-bottom="0in" fo:border-left="1pt solid #ffffff" fo:border-right="none" fo:border-top="none" fo:border-bottom="1pt solid #ffffff" style:writing-mode="lr-tb">
+    <style:background-image/>
+   </style:table-cell-properties>
+  </style:style>
+  <style:style style:name="Table12" style:family="table">
+   <style:table-properties style:width="6.6951in" fo:margin-top="0in" fo:margin-bottom="0in" fo:break-before="auto" fo:break-after="auto" table:align="margins" fo:background-color="#dddddd" fo:keep-with-next="auto" style:may-break-between-rows="false" style:writing-mode="page" table:border-model="collapsing">
+    <style:background-image/>
+   </style:table-properties>
+  </style:style>
+  <style:style style:name="Table12.A" style:family="table-column">
+   <style:table-column-properties style:column-width="6.6951in" style:rel-column-width="65535*"/>
+  </style:style>
+  <style:style style:name="Table12.1" style:family="table-row">
+   <style:table-row-properties style:min-row-height="0.1778in" fo:background-color="#000000" fo:keep-together="auto">
+    <style:background-image/>
+   </style:table-row-properties>
+  </style:style>
+  <style:style style:name="Table12.A1" style:family="table-cell">
+   <style:table-cell-properties style:vertical-align="middle" fo:background-color="transparent" fo:padding-left="0.1in" fo:padding-right="0in" fo:padding-top="0in" fo:padding-bottom="0in" fo:border-left="1pt solid #ffffff" fo:border-right="none" fo:border-top="1pt solid #ffffff" fo:border-bottom="1pt solid #ffffff" style:writing-mode="lr-tb">
+    <style:background-image/>
+   </style:table-cell-properties>
+  </style:style>
+  <style:style style:name="Table12.2" style:family="table-row">
+   <style:table-row-properties style:min-row-height="0.1778in" fo:keep-together="auto"/>
+  </style:style>
+  <style:style style:name="Table12.A2" style:family="table-cell">
+   <style:table-cell-properties style:vertical-align="middle" fo:background-color="transparent" fo:padding-left="0.1in" fo:padding-right="0in" fo:padding-top="0in" fo:padding-bottom="0in" fo:border-left="1pt solid #ffffff" fo:border-right="none" fo:border-top="none" fo:border-bottom="1pt solid #ffffff" style:writing-mode="lr-tb">
+    <style:background-image/>
+   </style:table-cell-properties>
+  </style:style>
+  <style:style style:name="Table12.3" style:family="table-row">
+   <style:table-row-properties style:min-row-height="0.1778in" fo:keep-together="auto"/>
+  </style:style>
+  <style:style style:name="Table13" style:family="table">
+   <style:table-properties style:width="6.6951in" fo:margin-top="0in" fo:margin-bottom="0in" fo:break-before="auto" fo:break-after="auto" table:align="margins" fo:background-color="#dddddd" fo:keep-with-next="auto" style:may-break-between-rows="false" style:writing-mode="page" table:border-model="collapsing">
+    <style:background-image/>
+   </style:table-properties>
+  </style:style>
+  <style:style style:name="Table13.A" style:family="table-column">
+   <style:table-column-properties style:column-width="6.6951in" style:rel-column-width="65535*"/>
+  </style:style>
+  <style:style style:name="Table13.1" style:family="table-row">
+   <style:table-row-properties style:min-row-height="0.1778in" fo:background-color="#000000" fo:keep-together="auto">
+    <style:background-image/>
+   </style:table-row-properties>
+  </style:style>
+  <style:style style:name="Table13.A1" style:family="table-cell">
+   <style:table-cell-properties style:vertical-align="middle" fo:background-color="transparent" fo:padding-left="0.1in" fo:padding-right="0in" fo:padding-top="0in" fo:padding-bottom="0in" fo:border-left="1pt solid #ffffff" fo:border-right="none" fo:border-top="1pt solid #ffffff" fo:border-bottom="1pt solid #ffffff" style:writing-mode="lr-tb">
+    <style:background-image/>
+   </style:table-cell-properties>
+  </style:style>
+  <style:style style:name="Table13.2" style:family="table-row">
+   <style:table-row-properties style:min-row-height="0.1778in" fo:keep-together="auto"/>
+  </style:style>
+  <style:style style:name="Table13.A2" style:family="table-cell">
+   <style:table-cell-properties style:vertical-align="middle" fo:background-color="transparent" fo:padding-left="0.1in" fo:padding-right="0in" fo:padding-top="0in" fo:padding-bottom="0in" fo:border-left="1pt solid #ffffff" fo:border-right="none" fo:border-top="none" fo:border-bottom="1pt solid #ffffff" style:writing-mode="lr-tb">
+    <style:background-image/>
+   </style:table-cell-properties>
+  </style:style>
+  <style:style style:name="Table1" style:family="table">
+   <style:table-properties style:width="6.6951in" fo:margin-top="0in" fo:margin-bottom="0in" fo:break-before="auto" fo:break-after="auto" table:align="margins" fo:background-color="#dddddd" fo:keep-with-next="auto" style:may-break-between-rows="false" style:writing-mode="page" table:border-model="collapsing">
+    <style:background-image/>
+   </style:table-properties>
+  </style:style>
+  <style:style style:name="Table1.A" style:family="table-column">
+   <style:table-column-properties style:column-width="6.6951in" style:rel-column-width="65535*"/>
+  </style:style>
+  <style:style style:name="Table1.1" style:family="table-row">
+   <style:table-row-properties style:min-row-height="0.1778in" fo:background-color="#000000" fo:keep-together="auto">
+    <style:background-image/>
+   </style:table-row-properties>
+  </style:style>
+  <style:style style:name="Table1.A1" style:family="table-cell">
+   <style:table-cell-properties style:vertical-align="middle" fo:background-color="transparent" fo:padding-left="0.1in" fo:padding-right="0in" fo:padding-top="0in" fo:padding-bottom="0in" fo:border-left="1pt solid #ffffff" fo:border-right="none" fo:border-top="1pt solid #ffffff" fo:border-bottom="1pt solid #ffffff" style:writing-mode="lr-tb">
+    <style:background-image/>
+   </style:table-cell-properties>
+  </style:style>
+  <style:style style:name="Table1.2" style:family="table-row">
+   <style:table-row-properties style:min-row-height="0.1778in" fo:keep-together="auto"/>
+  </style:style>
+  <style:style style:name="Table1.A2" style:family="table-cell">
+   <style:table-cell-properties style:vertical-align="middle" fo:background-color="transparent" fo:padding-left="0.1in" fo:padding-right="0in" fo:padding-top="0in" fo:padding-bottom="0in" fo:border-left="1pt solid #ffffff" fo:border-right="none" fo:border-top="none" fo:border-bottom="1pt solid #ffffff" style:writing-mode="lr-tb">
+    <style:background-image/>
+   </style:table-cell-properties>
+  </style:style>
+  <style:style style:name="Table1.3" style:family="table-row">
+   <style:table-row-properties style:min-row-height="0.1778in" fo:keep-together="auto"/>
+  </style:style>
+  <style:style style:name="Table2" style:family="table">
+   <style:table-properties style:width="6.6951in" fo:margin-top="0in" fo:margin-bottom="0in" fo:break-before="auto" fo:break-after="auto" table:align="margins" fo:background-color="#dddddd" fo:keep-with-next="auto" style:may-break-between-rows="false" style:writing-mode="page" table:border-model="collapsing">
+    <style:background-image/>
+   </style:table-properties>
+  </style:style>
+  <style:style style:name="Table2.A" style:family="table-column">
+   <style:table-column-properties style:column-width="6.6951in" style:rel-column-width="65535*"/>
+  </style:style>
+  <style:style style:name="Table2.1" style:family="table-row">
+   <style:table-row-properties style:min-row-height="0.1778in" fo:background-color="#000000" fo:keep-together="auto">
+    <style:background-image/>
+   </style:table-row-properties>
+  </style:style>
+  <style:style style:name="Table2.A1" style:family="table-cell">
+   <style:table-cell-properties style:vertical-align="middle" fo:background-color="transparent" fo:padding-left="0.1in" fo:padding-right="0in" fo:padding-top="0in" fo:padding-bottom="0in" fo:border-left="1pt solid #ffffff" fo:border-right="none" fo:border-top="1pt solid #ffffff" fo:border-bottom="1pt solid #ffffff" style:writing-mode="lr-tb">
+    <style:background-image/>
+   </style:table-cell-properties>
+  </style:style>
+  <style:style style:name="Table2.2" style:family="table-row">
+   <style:table-row-properties style:min-row-height="0.1778in" fo:keep-together="auto"/>
+  </style:style>
+  <style:style style:name="Table2.A2" style:family="table-cell">
+   <style:table-cell-properties style:vertical-align="middle" fo:background-color="transparent" fo:padding-left="0.1in" fo:padding-right="0in" fo:padding-top="0in" fo:padding-bottom="0in" fo:border-left="1pt solid #ffffff" fo:border-right="none" fo:border-top="none" fo:border-bottom="1pt solid #ffffff" style:writing-mode="lr-tb">
+    <style:background-image/>
+   </style:table-cell-properties>
+  </style:style>
+  <style:style style:name="Table2.3" style:family="table-row">
+   <style:table-row-properties style:min-row-height="0.1778in" fo:keep-together="auto"/>
+  </style:style>
+  <style:style style:name="P1" style:family="paragraph" style:parent-style-name="Standard">
+   <style:text-properties officeooo:paragraph-rsid="0015544e"/>
+  </style:style>
+  <style:style style:name="P2" style:family="paragraph" style:parent-style-name="Standard">
+   <style:text-properties fo:font-size="8pt" officeooo:paragraph-rsid="001483d1" style:font-size-asian="7pt" style:font-size-complex="8pt"/>
+  </style:style>
+  <style:style style:name="P3" style:family="paragraph" style:parent-style-name="Text_20_body">
+   <style:paragraph-properties fo:text-align="center" style:justify-single-word="false" fo:break-before="auto" fo:break-after="auto"/>
+   <style:text-properties fo:font-size="18pt" fo:font-weight="bold" officeooo:paragraph-rsid="001483d1" style:font-size-asian="18pt" style:font-weight-asian="bold" style:font-size-complex="18pt" style:font-weight-complex="bold"/>
+  </style:style>
+  <style:style style:name="P4" style:family="paragraph" style:parent-style-name="Table_20_Contents">
+   <style:paragraph-properties fo:text-align="start" style:justify-single-word="false"/>
+   <style:text-properties fo:color="#000000" style:text-outline="false" style:text-line-through-style="none" style:text-line-through-type="none" style:font-name="Thorndale" fo:font-size="12pt" fo:font-style="normal" fo:text-shadow="none" style:text-underline-style="none" fo:font-weight="bold" officeooo:rsid="0010bcb2" officeooo:paragraph-rsid="001483d1" style:font-size-asian="12pt" style:font-style-asian="normal" style:font-weight-asian="bold" style:font-size-complex="12pt" style:font-style-complex="normal" style:font-weight-complex="bold" style:text-overline-style="none" style:text-overline-color="font-color"/>
+  </style:style>
+  <style:style style:name="P5" style:family="paragraph" style:parent-style-name="Table_20_Contents">
+   <style:text-properties fo:font-weight="normal" officeooo:rsid="0012b9fe" officeooo:paragraph-rsid="001483d1" style:font-weight-asian="normal" style:font-weight-complex="normal"/>
+  </style:style>
+  <style:style style:name="P6" style:family="paragraph" style:parent-style-name="Table_20_Contents">
+   <style:text-properties fo:font-weight="bold" style:font-weight-asian="bold" style:font-weight-complex="bold"/>
+  </style:style>
+  <style:style style:name="P7" style:family="paragraph" style:parent-style-name="Table_20_Contents">
+   <style:text-properties fo:font-style="italic" officeooo:rsid="0012b9fe" officeooo:paragraph-rsid="001483d1" style:font-style-asian="italic" style:font-style-complex="italic"/>
+  </style:style>
+  <style:style style:name="P8" style:family="paragraph" style:parent-style-name="Table_20_Contents">
+   <style:text-properties fo:font-style="italic" officeooo:paragraph-rsid="001483d1" style:font-style-asian="italic" style:font-style-complex="italic"/>
+  </style:style>
+  <style:style style:name="P9" style:family="paragraph" style:parent-style-name="Table_20_Contents">
+   <style:text-properties officeooo:rsid="0012b9fe" officeooo:paragraph-rsid="001483d1"/>
+  </style:style>
+  <style:style style:name="P10" style:family="paragraph" style:parent-style-name="Table_20_Contents">
+   <style:text-properties officeooo:rsid="00137669" officeooo:paragraph-rsid="001483d1"/>
+  </style:style>
+  <style:style style:name="P11" style:family="paragraph" style:parent-style-name="Table_20_Contents">
+   <style:text-properties officeooo:paragraph-rsid="001483d1"/>
+  </style:style>
+  <style:style style:name="P12" style:family="paragraph" style:parent-style-name="Table_20_Contents">
+   <style:text-properties officeooo:paragraph-rsid="0015544e"/>
+  </style:style>
+  <style:style style:name="P13" style:family="paragraph" style:parent-style-name="Table_20_Heading">
+   <style:paragraph-properties fo:text-align="start" style:justify-single-word="false"/>
+   <style:text-properties style:use-window-font-color="true" style:text-outline="false" style:text-line-through-style="none" style:text-line-through-type="none" style:font-name="FreeSans" fo:font-size="12pt" fo:font-style="normal" fo:text-shadow="none" style:text-underline-style="none" fo:font-weight="600" officeooo:paragraph-rsid="001483d1" style:font-size-asian="12pt" style:font-style-asian="normal" style:font-weight-asian="600" style:font-size-complex="12pt" style:font-style-complex="normal" style:font-weight-complex="600" style:text-overline-style="none" style:text-overline-color="font-color"/>
+  </style:style>
+  <style:style style:name="P14" style:family="paragraph" style:parent-style-name="Table_20_Heading">
+   <style:paragraph-properties fo:text-align="start" style:justify-single-word="false"/>
+   <style:text-properties style:use-window-font-color="true" style:text-outline="false" style:text-line-through-style="none" style:text-line-through-type="none" style:font-name="FreeSans" fo:font-size="12pt" fo:font-style="normal" fo:text-shadow="none" style:text-underline-style="none" fo:font-weight="600" officeooo:paragraph-rsid="0015544e" style:font-size-asian="12pt" style:font-style-asian="normal" style:font-weight-asian="600" style:font-size-complex="12pt" style:font-style-complex="normal" style:font-weight-complex="600" style:text-overline-style="none" style:text-overline-color="font-color"/>
+  </style:style>
+  <style:style style:name="P15" style:family="paragraph" style:parent-style-name="Table_20_Heading">
+   <style:text-properties style:font-name="DejaVu Sans" fo:font-size="18pt" style:font-size-asian="18pt" style:font-size-complex="18pt"/>
+  </style:style>
+  <style:style style:name="P16" style:family="paragraph" style:parent-style-name="Standard">
+   <style:text-properties officeooo:paragraph-rsid="0015544e"/>
+  </style:style>
+  <style:style style:name="P17" style:family="paragraph" style:parent-style-name="Standard">
+   <style:paragraph-properties fo:text-align="end" style:justify-single-word="false"/>
+   <style:text-properties fo:font-size="6pt" officeooo:rsid="00180262" officeooo:paragraph-rsid="00180262" style:font-size-asian="6pt" style:font-size-complex="6pt"/>
+  </style:style>
+  <style:style style:name="P18" style:family="paragraph" style:parent-style-name="Table_20_Contents">
+   <style:text-properties officeooo:paragraph-rsid="0016fdaa"/>
+  </style:style>
+  <style:style style:name="P19" style:family="paragraph" style:parent-style-name="Table_20_Contents">
+   <style:paragraph-properties fo:text-align="start" style:justify-single-word="false"/>
+   <style:text-properties fo:color="#000000" style:text-outline="false" style:text-line-through-style="none" style:text-line-through-type="none" style:font-name="Thorndale" fo:font-size="12pt" fo:font-style="normal" fo:text-shadow="none" style:text-underline-style="none" fo:font-weight="bold" officeooo:rsid="0010bcb2" officeooo:paragraph-rsid="001483d1" style:font-size-asian="12pt" style:font-style-asian="normal" style:font-weight-asian="bold" style:font-size-complex="12pt" style:font-style-complex="normal" style:font-weight-complex="bold" style:text-overline-style="none" style:text-overline-color="font-color"/>
+  </style:style>
+  <style:style style:name="P20" style:family="paragraph" style:parent-style-name="Table_20_Contents">
+   <style:text-properties fo:font-weight="bold" officeooo:rsid="0016fdaa" officeooo:paragraph-rsid="0016fdaa" style:font-weight-asian="bold" style:font-weight-complex="bold"/>
+  </style:style>
+  <style:style style:name="P21" style:family="paragraph" style:parent-style-name="Table_20_Contents">
+   <style:text-properties fo:font-weight="bold" officeooo:paragraph-rsid="0016fdaa" style:font-weight-asian="bold" style:font-weight-complex="bold"/>
+  </style:style>
+  <style:style style:name="P22" style:family="paragraph" style:parent-style-name="Table_20_Contents">
+   <style:text-properties officeooo:rsid="0016fdaa" officeooo:paragraph-rsid="0016fdaa"/>
+  </style:style>
+  <style:style style:name="P23" style:family="paragraph" style:parent-style-name="Table_20_Contents">
+   <style:text-properties officeooo:paragraph-rsid="00180262"/>
+  </style:style>
+  <style:style style:name="P24" style:family="paragraph" style:parent-style-name="Table_20_Heading">
+   <style:paragraph-properties fo:text-align="start" style:justify-single-word="false"/>
+   <style:text-properties style:use-window-font-color="true" style:text-outline="false" style:text-line-through-style="none" style:text-line-through-type="none" style:font-name="FreeSans" fo:font-size="12pt" fo:font-style="normal" fo:text-shadow="none" style:text-underline-style="none" fo:font-weight="600" officeooo:rsid="001483d1" officeooo:paragraph-rsid="001483d1" style:font-size-asian="12pt" style:font-style-asian="normal" style:font-weight-asian="600" style:font-size-complex="12pt" style:font-style-complex="normal" style:font-weight-complex="600" style:text-overline-style="none" style:text-overline-color="font-color"/>
+  </style:style>
+  <style:style style:name="P25" style:family="paragraph" style:parent-style-name="Table_20_Heading">
+   <style:paragraph-properties fo:text-align="start" style:justify-single-word="false"/>
+   <style:text-properties style:use-window-font-color="true" style:text-outline="false" style:text-line-through-style="none" style:text-line-through-type="none" style:font-name="FreeSans" fo:font-size="12pt" fo:font-style="normal" fo:text-shadow="none" style:text-underline-style="none" fo:font-weight="600" officeooo:rsid="0015544e" officeooo:paragraph-rsid="0015544e" style:font-size-asian="12pt" style:font-style-asian="normal" style:font-weight-asian="600" style:font-size-complex="12pt" style:font-style-complex="normal" style:font-weight-complex="600" style:text-overline-style="none" style:text-overline-color="font-color"/>
+  </style:style>
+  <style:style style:name="P26" style:family="paragraph" style:parent-style-name="Table_20_Heading">
+   <style:paragraph-properties fo:text-align="start" style:justify-single-word="false"/>
+   <style:text-properties officeooo:paragraph-rsid="001483d1"/>
+  </style:style>
+  <style:style style:name="T1" style:family="text">
+   <style:text-properties fo:font-weight="bold" style:font-weight-asian="bold" style:font-weight-complex="bold"/>
+  </style:style>
+  <style:style style:name="T2" style:family="text">
+   <style:text-properties fo:font-weight="bold" officeooo:rsid="0015544e" style:font-weight-asian="bold" style:font-weight-complex="bold"/>
+  </style:style>
+  <style:style style:name="T3" style:family="text">
+   <style:text-properties fo:font-weight="bold" officeooo:rsid="00180262" style:font-weight-asian="bold" style:font-weight-complex="bold"/>
+  </style:style>
+  <style:style style:name="T4" style:family="text">
+   <style:text-properties officeooo:rsid="0012b9fe"/>
+  </style:style>
+  <style:style style:name="T5" style:family="text">
+   <style:text-properties fo:font-weight="normal" style:font-weight-asian="normal" style:font-weight-complex="normal"/>
+  </style:style>
+  <style:style style:name="T6" style:family="text">
+   <style:text-properties fo:font-weight="normal" officeooo:rsid="001483d1" style:font-weight-asian="normal" style:font-weight-complex="normal"/>
+  </style:style>
+  <style:style style:name="T7" style:family="text">
+   <style:text-properties fo:font-weight="normal" officeooo:rsid="0015544e" style:font-weight-asian="normal" style:font-weight-complex="normal"/>
+  </style:style>
+  <style:style style:name="T8" style:family="text">
+   <style:text-properties fo:font-weight="normal" officeooo:rsid="0016fdaa" style:font-weight-asian="normal" style:font-weight-complex="normal"/>
+  </style:style>
+  <style:style style:name="T9" style:family="text">
+   <style:text-properties officeooo:rsid="00137669"/>
+  </style:style>
+  <style:style style:name="T10" style:family="text">
+   <style:text-properties officeooo:rsid="001483d1"/>
+  </style:style>
+  <style:style style:name="T11" style:family="text">
+   <style:text-properties style:font-name="DejaVu Sans" officeooo:rsid="000ccaed"/>
+  </style:style>
+  <style:style style:name="T12" style:family="text">
+   <style:text-properties fo:color="#000000" style:text-outline="false" style:text-line-through-style="none" style:text-line-through-type="none" fo:font-style="normal" fo:text-shadow="none" style:text-underline-style="none" fo:font-weight="normal" officeooo:rsid="0010bcb2" style:font-style-asian="normal" style:font-weight-asian="normal" style:font-style-complex="normal" style:font-weight-complex="normal" style:text-overline-style="none" style:text-overline-color="font-color"/>
+  </style:style>
+  <style:style style:name="T13" style:family="text">
+   <style:text-properties fo:color="#000000" style:text-outline="false" style:text-line-through-style="none" style:text-line-through-type="none" fo:font-style="normal" fo:text-shadow="none" style:text-underline-style="none" fo:font-weight="normal" officeooo:rsid="0015544e" style:font-style-asian="normal" style:font-weight-asian="normal" style:font-style-complex="normal" style:font-weight-complex="normal" style:text-overline-style="none" style:text-overline-color="font-color"/>
+  </style:style>
+  <style:style style:name="T14" style:family="text">
+   <style:text-properties fo:color="#000000" style:text-outline="false" style:text-line-through-style="none" style:text-line-through-type="none" fo:font-style="normal" fo:text-shadow="none" style:text-underline-style="none" fo:font-weight="normal" officeooo:rsid="001483d1" style:font-style-asian="normal" style:font-weight-asian="normal" style:font-style-complex="normal" style:font-weight-complex="normal" style:text-overline-style="none" style:text-overline-color="font-color"/>
+  </style:style>
+  <style:style style:name="T15" style:family="text">
+   <style:text-properties officeooo:rsid="0015544e"/>
+  </style:style>
+  <style:style style:name="T16" style:family="text">
+   <style:text-properties style:use-window-font-color="true" style:text-outline="false" style:text-line-through-style="none" style:text-line-through-type="none" style:font-name="FreeSans" fo:font-size="12pt" fo:font-style="normal" fo:text-shadow="none" style:text-underline-style="none" fo:font-weight="600" style:font-size-asian="12pt" style:font-style-asian="normal" style:font-weight-asian="600" style:font-size-complex="12pt" style:font-style-complex="normal" style:font-weight-complex="600" style:text-overline-style="none" style:text-overline-color="font-color"/>
+  </style:style>
+  <style:style style:name="T17" style:family="text">
+   <style:text-properties style:use-window-font-color="true" style:text-outline="false" style:text-line-through-style="none" style:text-line-through-type="none" style:font-name="FreeSans" fo:font-size="12pt" fo:font-style="normal" fo:text-shadow="none" style:text-underline-style="none" fo:font-weight="600" officeooo:rsid="001483d1" style:font-size-asian="12pt" style:font-style-asian="normal" style:font-weight-asian="600" style:font-size-complex="12pt" style:font-style-complex="normal" style:font-weight-complex="600" style:text-overline-style="none" style:text-overline-color="font-color"/>
+  </style:style>
+  <style:style style:name="T18" style:family="text">
+   <style:text-properties style:use-window-font-color="true" style:text-outline="false" style:text-line-through-style="none" style:text-line-through-type="none" style:font-name="FreeSans" fo:font-size="12pt" fo:font-style="normal" fo:text-shadow="none" style:text-underline-style="none" fo:font-weight="600" officeooo:rsid="00195e71" style:font-size-asian="12pt" style:font-style-asian="normal" style:font-weight-asian="600" style:font-size-complex="12pt" style:font-style-complex="normal" style:font-weight-complex="600" style:text-overline-style="none" style:text-overline-color="font-color"/>
+  </style:style>
+  <style:style style:name="T19" style:family="text">
+   <style:text-properties style:font-name="Bitstream Vera Serif1" fo:font-weight="normal" officeooo:rsid="0015544e" style:font-weight-asian="normal" style:font-weight-complex="normal"/>
+  </style:style>
+  <style:style style:name="T20" style:family="text">
+   <style:text-properties style:font-name="Bitstream Vera Serif1" fo:font-weight="bold" officeooo:rsid="0015544e" style:font-weight-asian="bold" style:font-weight-complex="bold"/>
+  </style:style>
+  <style:style style:name="T21" style:family="text">
+   <style:text-properties officeooo:rsid="0016fdaa"/>
+  </style:style>
+  <style:style style:name="T22" style:family="text">
+   <style:text-properties fo:font-style="italic" style:font-style-asian="italic" style:font-style-complex="italic"/>
+  </style:style>
+  <style:style style:name="T23" style:family="text">
+   <style:text-properties fo:font-style="italic" fo:font-weight="normal" officeooo:rsid="0015544e" style:font-style-asian="italic" style:font-weight-asian="normal" style:font-style-complex="italic" style:font-weight-complex="normal"/>
+  </style:style>
+  <style:style style:name="T24" style:family="text">
+   <style:text-properties officeooo:rsid="00180262"/>
+  </style:style>
+  <style:style style:name="T25" style:family="text">
+   <style:text-properties fo:font-style="normal" style:font-style-asian="normal" style:font-style-complex="normal"/>
+  </style:style>
+  <style:style style:name="T26" style:family="text">
+   <style:text-properties fo:font-style="normal" fo:font-weight="bold" style:font-style-asian="normal" style:font-weight-asian="bold" style:font-style-complex="normal" style:font-weight-complex="bold"/>
+  </style:style>
+  <style:style style:name="T27" style:family="text">
+   <style:text-properties fo:font-style="normal" fo:font-weight="bold" officeooo:rsid="00180262" style:font-style-asian="normal" style:font-weight-asian="bold" style:font-style-complex="normal" style:font-weight-complex="bold"/>
+  </style:style>
+  <style:style style:name="T28" style:family="text">
+   <style:text-properties officeooo:rsid="00195e71"/>
+  </style:style>
+  <style:page-layout style:name="pm1">
+   <style:page-layout-properties fo:page-width="8.2701in" fo:page-height="11.6902in" style:num-format="1" style:print-orientation="portrait" fo:margin-top="0.7874in" fo:margin-bottom="0.7874in" fo:margin-left="0.7874in" fo:margin-right="0.7874in" style:writing-mode="lr-tb" style:layout-grid-color="#c0c0c0" style:layout-grid-lines="20" style:layout-grid-base-height="0.278in" style:layout-grid-ruby-height="0.139in" style:layout-grid-mode="none" style:layout-grid-ruby-below="false" style:layout-grid-print="false" style:layout-grid-display="false" style:footnote-max-height="0in">
+    <style:columns fo:column-count="1" fo:column-gap="0in"/>
+    <style:footnote-sep style:width="0.0071in" style:distance-before-sep="0.0398in" style:distance-after-sep="0.0398in" style:line-style="solid" style:adjustment="left" style:rel-width="25%" style:color="#000000"/>
+   </style:page-layout-properties>
+   <style:header-style/>
+   <style:footer-style/>
+  </style:page-layout>
+  <number:text-style style:name="N10100" number:language="en" number:country="US">
+   <number:text-content/>
+  </number:text-style>
+ </office:automatic-styles>
+ <office:master-styles>
+  <style:master-page style:name="Standard" style:page-layout-name="pm1"/>
+ </office:master-styles>
+ <office:body>
+  <office:text>
+   <office:forms form:automatic-focus="false" form:apply-design-mode="false"/>
+   <text:sequence-decls>
+    <text:sequence-decl text:display-outline-level="0" text:name="Illustration"/>
+    <text:sequence-decl text:display-outline-level="0" text:name="Table"/>
+    <text:sequence-decl text:display-outline-level="0" text:name="Text"/>
+    <text:sequence-decl text:display-outline-level="0" text:name="Drawing"/>
+   </text:sequence-decls>
+   <table:table table:name="Table7" table:style-name="Table7">
+    <table:table-column table:style-name="Table7.A"/>
+    <table:table-row table:style-name="Table7.1">
+     <table:table-cell table:style-name="Table7.A1" office:value-type="string">
+      <text:p text:style-name="P15">GNU Para<text:span text:style-name="T22">ll</text:span>el Cheat Sheet</text:p>
+     </table:table-cell>
+    </table:table-row>
+    <table:table-row table:style-name="Table7.2">
+     <table:table-cell table:style-name="Table7.A2" office:value-type="float" office:value="0">
+      <text:p text:style-name="P6">GNU Parallel is a replacement for <text:span text:style-name="Source_20_Text"><text:span text:style-name="T22">xargs</text:span></text:span> and <text:span text:style-name="Source_20_Text"><text:span text:style-name="T22">for</text:span></text:span> loops. It can also split a file or a stream into blocks and pass those to commands <text:span text:style-name="T15">running in parallel.</text:span></text:p>
+     </table:table-cell>
+    </table:table-row>
+   </table:table>
+   <text:p text:style-name="P2"/>
+   <table:table table:name="Table8" table:style-name="Table8">
+    <table:table-column table:style-name="Table8.A"/>
+    <table:table-row table:style-name="Table8.1">
+     <table:table-cell table:style-name="Table8.A1" office:value-type="string">
+      <text:p text:style-name="P13">Example<text:span text:style-name="T10">s</text:span></text:p>
+     </table:table-cell>
+    </table:table-row>
+    <table:table-row table:style-name="Table8.2">
+     <table:table-cell table:style-name="Table8.A2" office:value-type="float" office:value="0">
+      <text:p text:style-name="P12"><text:span text:style-name="T1">Compress all *.html files in parallel – 2 </text:span><text:span text:style-name="T3">jobs </text:span><text:span text:style-name="T1">per CPU thread </text:span><text:span text:style-name="T3">in parallel</text:span><text:line-break/><text:span text:style-name="Source_20_Text"><text:span text:style-name="T12">parallel --</text:span></text:span><text:span text:style-name="Source_20_Text"><text:span text:style-name="T13">jobs 200% </text:span></text:span><text:span text:style-name="Source_20_Text"><text:span text:style-name="T12">gzip ::: *.html</text:span></text:span></text:p>
+     </table:table-cell>
+    </table:table-row>
+    <table:table-row table:style-name="Table8.3">
+     <table:table-cell table:style-name="Table8.A2" office:value-type="float" office:value="0">
+      <text:p text:style-name="P23"><text:span text:style-name="T1">Convert all *.wav to *.mp3 using </text:span><text:span text:style-name="Source_20_Text"><text:span text:style-name="T22">lame</text:span></text:span><text:span text:style-name="T1"> – </text:span><text:span text:style-name="T3">1</text:span><text:span text:style-name="T1"> job per CPU thread in parallel </text:span><text:span text:style-name="T3">(default)</text:span><text:line-break/><text:span text:style-name="Source_20_Text"><text:span text:style-name="T12">parallel lame {} -o {.}.mp3 ::: *.wav</text:span></text:span></text:p>
+     </table:table-cell>
+    </table:table-row>
+    <table:table-row table:style-name="Table8.4">
+     <table:table-cell table:style-name="Table8.A2" office:value-type="float" office:value="0">
+      <text:p text:style-name="P12"><text:span text:style-name="T1">Chop bigfile into 1MB blocks and grep for the string foobar</text:span><text:line-break/><text:span text:style-name="Source_20_Text"><text:span text:style-name="T14">cat bigfile | </text:span></text:span><text:span text:style-name="Source_20_Text"><text:span text:style-name="T12">parallel --pipe grep foobar</text:span></text:span></text:p>
+     </table:table-cell>
+    </table:table-row>
+   </table:table>
+   <text:p text:style-name="P2"/>
+   <table:table table:name="Table9" table:style-name="Table9">
+    <table:table-column table:style-name="Table9.A"/>
+    <table:table-row table:style-name="Table9.1">
+     <table:table-cell table:style-name="Table9.A1" office:value-type="string">
+      <text:p text:style-name="P13">Input sources</text:p>
+     </table:table-cell>
+    </table:table-row>
+    <table:table-row table:style-name="Table9.2">
+     <table:table-cell table:style-name="Table9.A2" office:value-type="string">
+      <text:p text:style-name="P11"><text:span text:style-name="Source_20_Text"><text:span text:style-name="T5">parallel echo ::: cmd line input source</text:span></text:span></text:p>
+     </table:table-cell>
+    </table:table-row>
+    <table:table-row table:style-name="Table9.3">
+     <table:table-cell table:style-name="Table9.A2" office:value-type="string">
+      <text:p text:style-name="P11"><text:span text:style-name="Source_20_Text"><text:span text:style-name="T5">cat input_from_stdin | parallel echo</text:span></text:span></text:p>
+     </table:table-cell>
+    </table:table-row>
+    <table:table-row table:style-name="Table9.4">
+     <table:table-cell table:style-name="Table9.A2" office:value-type="string">
+      <text:p text:style-name="P11"><text:span text:style-name="Source_20_Text"><text:span text:style-name="T5">parallel echo ::: multiple input source</text:span></text:span><text:span text:style-name="Source_20_Text"><text:span text:style-name="T8">s ::: with </text:span></text:span><text:span text:style-name="Source_20_Text"><text:span text:style-name="T5">values</text:span></text:span></text:p>
+     </table:table-cell>
+    </table:table-row>
+    <table:table-row table:style-name="Table9.5">
+     <table:table-cell table:style-name="Table9.A2" office:value-type="string">
+      <text:p text:style-name="P11"><text:span text:style-name="Source_20_Text"><text:span text:style-name="T5">parallel -a input_from_file echo</text:span></text:span></text:p>
+     </table:table-cell>
+    </table:table-row>
+    <table:table-row table:style-name="Table9.6">
+     <table:table-cell table:style-name="Table9.A2" office:value-type="string">
+      <text:p text:style-name="P11"><text:span text:style-name="Source_20_Text"><text:span text:style-name="T5">parallel echo :::: input_from_file</text:span></text:span></text:p>
+     </table:table-cell>
+    </table:table-row>
+    <table:table-row table:style-name="Table9.7">
+     <table:table-cell table:style-name="Table9.A2" office:value-type="string">
+      <text:p text:style-name="P10"><text:span text:style-name="Source_20_Text"><text:span text:style-name="T5">parallel echo :::: input_from_file ::: and command line</text:span></text:span></text:p>
+     </table:table-cell>
+    </table:table-row>
+   </table:table>
+   <text:p text:style-name="P2"/>
+   <table:table table:name="Table10" table:style-name="Table10">
+    <table:table-column table:style-name="Table10.A"/>
+    <table:table-column table:style-name="Table10.B"/>
+    <table:table-row table:style-name="Table10.1">
+     <table:table-cell table:style-name="Table10.A1" office:value-type="string">
+      <text:p text:style-name="P13">Replacement string</text:p>
+     </table:table-cell>
+     <table:table-cell table:style-name="Table10.B1" office:value-type="string">
+      <text:p text:style-name="P26"><text:span text:style-name="T16">Value </text:span><text:span text:style-name="T18">if input is mydir/mysubdir/myfile.myext</text:span></text:p>
+     </table:table-cell>
+    </table:table-row>
+    <table:table-row table:style-name="Table10.2">
+     <table:table-cell table:style-name="Table10.A2" office:value-type="string">
+      <text:p text:style-name="P11"><text:span text:style-name="Source_20_Text">{}</text:span></text:p>
+     </table:table-cell>
+     <table:table-cell table:style-name="Table10.B2" office:value-type="string">
+      <text:p text:style-name="P11"><text:span text:style-name="Source_20_Text">mydir/mysubdir/myfile.myext</text:span></text:p>
+     </table:table-cell>
+    </table:table-row>
+    <table:table-row table:style-name="Table10.3">
+     <table:table-cell table:style-name="Table10.A2" office:value-type="string">
+      <text:p text:style-name="P11"><text:span text:style-name="Source_20_Text">{.}</text:span></text:p>
+     </table:table-cell>
+     <table:table-cell table:style-name="Table10.B2" office:value-type="string">
+      <text:p text:style-name="P11"><text:span text:style-name="Source_20_Text">mydir/mysubdir/myfile</text:span></text:p>
+     </table:table-cell>
+    </table:table-row>
+    <table:table-row table:style-name="Table10.4">
+     <table:table-cell table:style-name="Table10.A2" office:value-type="string">
+      <text:p text:style-name="P18"><text:span text:style-name="Source_20_Text">{/}, {//}, </text:span><text:span text:style-name="Source_20_Text">{/.}</text:span></text:p>
+     </table:table-cell>
+     <table:table-cell table:style-name="Table10.B2" office:value-type="string">
+      <text:p text:style-name="P18"><text:span text:style-name="Source_20_Text">myfile.myext, mydir/mysubdir, </text:span><text:span text:style-name="Source_20_Text">myfile</text:span></text:p>
+     </table:table-cell>
+    </table:table-row>
+    <table:table-row table:style-name="Table10.5">
+     <table:table-cell table:style-name="Table10.A2" office:value-type="string">
+      <text:p text:style-name="P11"><text:span text:style-name="Source_20_Text">{#}</text:span></text:p>
+     </table:table-cell>
+     <table:table-cell table:style-name="Table10.B2" office:value-type="string">
+      <text:p text:style-name="P8"><text:span text:style-name="T4">T</text:span>he sequence number of the job</text:p>
+     </table:table-cell>
+    </table:table-row>
+    <table:table-row table:style-name="Table10.6">
+     <table:table-cell table:style-name="Table10.A2" office:value-type="string">
+      <text:p text:style-name="P11"><text:span text:style-name="Source_20_Text">{%}</text:span></text:p>
+     </table:table-cell>
+     <table:table-cell table:style-name="Table10.B2" office:value-type="string">
+      <text:p text:style-name="P8"><text:span text:style-name="T4">T</text:span>he job slot number</text:p>
+     </table:table-cell>
+    </table:table-row>
+    <table:table-row table:style-name="Table10.7">
+     <table:table-cell table:style-name="Table10.A2" office:value-type="string">
+      <text:p text:style-name="P5"><text:span text:style-name="Source_20_Text">{2}</text:span></text:p>
+     </table:table-cell>
+     <table:table-cell table:style-name="Table10.B2" office:value-type="string">
+      <text:p text:style-name="P7"><text:span text:style-name="T21">Value from the s</text:span>econd input source</text:p>
+     </table:table-cell>
+    </table:table-row>
+    <table:table-row table:style-name="Table10.8">
+     <table:table-cell table:style-name="Table10.A2" office:value-type="string">
+      <text:p text:style-name="P5"><text:span text:style-name="Source_20_Text">{2.} </text:span><text:span text:style-name="Source_20_Text"><text:span text:style-name="T21">{2/} {2//} {2/.}</text:span></text:span></text:p>
+     </table:table-cell>
+     <table:table-cell table:style-name="Table10.B2" office:value-type="string">
+      <text:p text:style-name="P7">Comb<text:span text:style-name="T21">ination </text:span>of {2} and {.} <text:span text:style-name="T21">{/} {//} {/.}</text:span></text:p>
+     </table:table-cell>
+    </table:table-row>
+    <table:table-row table:style-name="Table10.9">
+     <table:table-cell table:style-name="Table10.A2" office:value-type="string">
+      <text:p text:style-name="P9"><text:span text:style-name="Source_20_Text">{= perl </text:span><text:span text:style-name="Source_20_Text"><text:span text:style-name="T15">expression</text:span></text:span><text:span text:style-name="Source_20_Text"> =}</text:span></text:p>
+     </table:table-cell>
+     <table:table-cell table:style-name="Table10.B2" office:value-type="string">
+      <text:p text:style-name="P7">Change $_ with perl expression</text:p>
+     </table:table-cell>
+    </table:table-row>
+   </table:table>
+   <text:p text:style-name="P2"/>
+   <table:table table:name="Table11" table:style-name="Table11">
+    <table:table-column table:style-name="Table11.A"/>
+    <table:table-row table:style-name="Table11.1">
+     <table:table-cell table:style-name="Table11.A1" office:value-type="string">
+      <text:p text:style-name="P13">Control the output – <text:span text:style-name="T10">keep the same order as the input, prepend with input value</text:span></text:p>
+     </table:table-cell>
+    </table:table-row>
+    <table:table-row table:style-name="Table11.2">
+     <table:table-cell table:style-name="Table11.A2" office:value-type="string">
+      <text:p text:style-name="P18"><text:span text:style-name="Source_20_Text"><text:span text:style-name="T10">parallel --keep-order --tag &quot;sleep {}; echo {}&quot; ::: 5 4 3 2 1</text:span></text:span></text:p>
+     </table:table-cell>
+    </table:table-row>
+   </table:table>
+   <text:p text:style-name="P2"/>
+   <table:table table:name="Table12" table:style-name="Table12">
+    <table:table-column table:style-name="Table12.A"/>
+    <table:table-row table:style-name="Table12.1">
+     <table:table-cell table:style-name="Table12.A1" office:value-type="string">
+      <text:p text:style-name="P13">Control the execution</text:p>
+     </table:table-cell>
+    </table:table-row>
+    <table:table-row table:style-name="Table12.3">
+     <table:table-cell table:style-name="Table12.A2" office:value-type="string">
+      <text:p text:style-name="P20">Run 2 jobs in parallel – <text:span text:style-name="T24">command is a composed command</text:span></text:p>
+      <text:p text:style-name="P18"><text:span text:style-name="Source_20_Text"><text:span text:style-name="T10">parallel --jobs 2 &quot;sleep {}; echo {}&quot; ::: 5 4 3 2 1</text:span></text:span></text:p>
+     </table:table-cell>
+    </table:table-row>
+    <table:table-row table:style-name="Table12.3">
+     <table:table-cell table:style-name="Table12.A2" office:value-type="string">
+      <text:p text:style-name="P20">See what will be run</text:p>
+      <text:p text:style-name="P22"><text:span text:style-name="Source_20_Text">parallel --dryrun echo </text:span><text:span text:style-name="Source_20_Text"><text:span text:style-name="T28">{2} {1} </text:span></text:span><text:span text:style-name="Source_20_Text">::: </text:span><text:span text:style-name="Source_20_Text"><text:span text:style-name="T28">bird flower fish ::: </text:span></text:span><text:span text:style-name="Source_20_Text">Red Green Blue</text:span></text:p>
+     </table:table-cell>
+    </table:table-row>
+   </table:table>
+   <text:p text:style-name="P2"/>
+   <table:table table:name="Table13" table:style-name="Table13">
+    <table:table-column table:style-name="Table13.A"/>
+    <table:table-row table:style-name="Table13.1">
+     <table:table-cell table:style-name="Table13.A1" office:value-type="string">
+      <text:p text:style-name="P24">Remote execution</text:p>
+     </table:table-cell>
+    </table:table-row>
+    <table:table-row table:style-name="Table13.2">
+     <table:table-cell table:style-name="Table13.A2" office:value-type="string">
+      <text:p text:style-name="P18"><text:span text:style-name="Source_20_Text"><text:span text:style-name="T10">parallel -S server1 -S server2 &quot;hostname; echo {}&quot; ::: foo bar </text:span></text:span></text:p>
+     </table:table-cell>
+    </table:table-row>
+   </table:table>
+   <text:p text:style-name="P2"/>
+   <table:table table:name="Table1" table:style-name="Table1">
+    <table:table-column table:style-name="Table1.A"/>
+    <table:table-row table:style-name="Table1.1">
+     <table:table-cell table:style-name="Table1.A1" office:value-type="string">
+      <text:p text:style-name="P24">Pipe mode</text:p>
+     </table:table-cell>
+    </table:table-row>
+    <table:table-row table:style-name="Table1.2">
+     <table:table-cell table:style-name="Table1.A2" office:value-type="string">
+      <text:p text:style-name="P11"><text:span text:style-name="Source_20_Text"><text:span text:style-name="T10">cat bigfile | parallel --pipe wc -l</text:span></text:span></text:p>
+     </table:table-cell>
+    </table:table-row>
+    <table:table-row table:style-name="Table1.3">
+     <table:table-cell table:style-name="Table1.A2" office:value-type="string">
+      <text:p text:style-name="P4"><text:span text:style-name="Source_20_Text"><text:span text:style-name="T20">Chop bigfile into one block per CPU thread and </text:span></text:span><text:span text:style-name="Source_20_Text"><text:span text:style-name="T23">grep</text:span></text:span><text:span text:style-name="Source_20_Text"><text:span text:style-name="T20"> for foobar</text:span></text:span><text:span text:style-name="Source_20_Text"><text:span text:style-name="T5"><text:line-break/>parallel -a bigfile --pipepart --block -1 grep foobar</text:span></text:span></text:p>
+     </table:table-cell>
+    </table:table-row>
+   </table:table>
+   <text:p text:style-name="P2"/>
+   <table:table table:name="Table2" table:style-name="Table2">
+    <table:table-column table:style-name="Table2.A"/>
+    <table:table-row table:style-name="Table2.1">
+     <table:table-cell table:style-name="Table2.A1" office:value-type="string">
+      <text:p text:style-name="P25">Read more – <text:span text:style-name="T21">Your command line will love you for it</text:span></text:p>
+     </table:table-cell>
+    </table:table-row>
+    <table:table-row table:style-name="Table2.3">
+     <table:table-cell table:style-name="Table2.A2" office:value-type="string">
+      <text:p text:style-name="P21"><text:span text:style-name="Source_20_Text"><text:span text:style-name="T21">parallel --help; <text:s/></text:span></text:span><text:span text:style-name="Source_20_Text">man parallel; <text:s/></text:span><text:span text:style-name="Source_20_Text"><text:span text:style-name="T21">man parallel_tutorial; <text:s/>www.pi.dk/1</text:span></text:span></text:p>
+     </table:table-cell>
+    </table:table-row>
+    <table:table-row table:style-name="Table2.3">
+     <table:table-cell table:style-name="Table2.A2" office:value-type="string">
+      <text:p text:style-name="P6"><text:span text:style-name="T15">GNU Parallel 2018 </text:span>https://doi.org/10.5281/zenodo.1146014</text:p>
+     </table:table-cell>
+    </table:table-row>
+   </table:table>
+   <text:p text:style-name="P17">(CC-By-SA) 2019-03-<text:span text:style-name="T28">11</text:span> Ole Tange</text:p>
+   <text:p text:style-name="P1"/>
+  </office:text>
+ </office:body>
+</office:document>
\ No newline at end of file
diff --git a/src/parallel_design.pod b/src/parallel_design.pod
new file mode 100644
index 0000000..85aee12
--- /dev/null
+++ b/src/parallel_design.pod
@@ -0,0 +1,1477 @@
+#!/usr/bin/perl -w
+
+# SPDX-FileCopyrightText: 2021-2022 Ole Tange, http://ole.tange.dk and Free Software and Foundation, Inc.
+# SPDX-License-Identifier: GFDL-1.3-or-later
+# SPDX-License-Identifier: CC-BY-SA-4.0
+
+=encoding utf8
+
+
+=head1 Design of GNU Parallel
+
+This document describes design decisions made in the development of
+GNU B<parallel> and the reasoning behind them. It will give an
+overview of why some of the code looks the way it does, and will help
+new maintainers understand the code better.
+
+
+=head2 One file program
+
+GNU B<parallel> is a Perl script in a single file. It is object
+oriented, but contrary to normal Perl scripts each class is not in its
+own file. This is due to user experience: The goal is that in a pinch
+the user will be able to get GNU B<parallel> working simply by copying
+a single file: No need to mess around with environment variables like
+PERL5LIB.
+
+
+=head2 Choice of programming language
+
+GNU B<parallel> is designed to be able to run on old systems. That
+means that it cannot depend on a compiler being installed - and
+especially not a compiler for a language that is younger than 20 years
+old.
+
+The goal is that you can use GNU B<parallel> on any system, even if
+you are not allowed to install additional software.
+
+Of all the systems I have experienced, I have yet to see a system that
+had GCC installed that did not have Perl. The same goes for Rust, Go,
+Haskell, and other younger languages. I have, however, seen systems
+with Perl without any of the mentioned compilers.
+
+Most modern systems also have either Python2 or Python3 installed, but
+you still cannot be certain which version, and since Python2 cannot
+run under Python3, Python is not an option.
+
+Perl has the added benefit that implementing the {= perlexpr =}
+replacement string was fairly easy.
+
+The primary drawback is that Perl is slow. So there is an overhead of
+3-10 ms/job and 1 ms/MB output (and even more if you use B<--tag>).
+
+
+=head2 Old Perl style
+
+GNU B<parallel> uses some old, deprecated constructs. This is due to a
+goal of being able to run on old installations. Currently the target
+is CentOS 3.9 and Perl 5.8.0.
+
+
+=head2 Scalability up and down
+
+The smallest system GNU B<parallel> is tested on is a 32 MB ASUS
+WL500gP. The largest is a 2 TB 128-core machine. It scales up to
+around 100 machines - depending on the duration of each job.
+
+
+=head2 Exponentially back off
+
+GNU B<parallel> busy waits. This is because the reason why a job is
+not started may be due to load average (when using B<--load>), and
+thus it will not make sense to just wait for a job to finish. Instead
+the load average must be rechecked regularly. Load average is not the
+only reason: B<--timeout> has a similar problem.
+
+To not burn up too much CPU GNU B<parallel> sleeps exponentially
+longer and longer if nothing happens, maxing out at 1 second.
+
+
+=head2 Shell compatibility
+
+It is a goal to have GNU B<parallel> work equally well in any
+shell. However, in practice GNU B<parallel> is being developed in
+B<bash> and thus testing in other shells is limited to reported bugs.
+
+When an incompatibility is found there is often not an easy fix:
+Fixing the problem in B<csh> often breaks it in B<bash>. In these
+cases the fix is often to use a small Perl script and call that.
+
+
+=head2 env_parallel
+
+B<env_parallel> is a dummy shell script that will run if
+B<env_parallel> is not an alias or a function and tell the user how to
+activate the alias/function for the supported shells.
+
+The alias or function will copy the current environment and run the
+command with GNU B<parallel> in the copy of the environment.
+
+The problem is that you cannot access all of the current environment
+inside Perl. E.g. aliases, functions and unexported shell variables.
+
+The idea is therefore to take the environment and put it in
+B<$PARALLEL_ENV> which GNU B<parallel> prepends to every command.
+
+The only way to have access to the environment is directly from the
+shell, so the program must be written in a shell script that will be
+sourced and there has to deal with the dialect of the relevant shell.
+
+
+=head3 env_parallel.*
+
+These are the files that implements the alias or function
+B<env_parallel> for a given shell. It could be argued that these
+should be put in some obscure place under /usr/lib, but by putting
+them in your path it becomes trivial to find the path to them and
+B<source> them:
+
+  source `which env_parallel.foo`
+
+The beauty is that they can be put anywhere in the path without the
+user having to know the location. So if the user's path includes
+/afs/bin/i386_fc5 or /usr/pkg/parallel/bin or
+/usr/local/parallel/20161222/sunos5.6/bin the files can be put in the
+dir that makes most sense for the sysadmin.
+
+
+=head3 env_parallel.bash / env_parallel.sh / env_parallel.ash /
+env_parallel.dash / env_parallel.zsh / env_parallel.ksh /
+env_parallel.mksh
+
+B<env_parallel.(bash|sh|ash|dash|ksh|mksh|zsh)> defines the function
+B<env_parallel>. It uses B<alias> and B<typeset> to dump the
+configuration (with a few exceptions) into B<$PARALLEL_ENV> before
+running GNU B<parallel>.
+
+After GNU B<parallel> is finished, B<$PARALLEL_ENV> is deleted.
+
+
+=head3 env_parallel.csh
+
+B<env_parallel.csh> has two purposes: If B<env_parallel> is not an
+alias: make it into an alias that sets B<$PARALLEL> with arguments
+and calls B<env_parallel.csh>.
+
+If B<env_parallel> is an alias, then B<env_parallel.csh> uses
+B<$PARALLEL> as the arguments for GNU B<parallel>.
+
+It exports the environment by writing a variable definition to a file
+for each variable.  The definitions of aliases are appended to this
+file. Finally the file is put into B<$PARALLEL_ENV>.
+
+GNU B<parallel> is then run and B<$PARALLEL_ENV> is deleted.
+
+
+=head3 env_parallel.fish
+
+First all functions definitions are generated using a loop and
+B<functions>.
+
+Dumping the scalar variable definitions is harder.
+
+B<fish> can represent non-printable characters in (at least) 2
+ways. To avoid problems all scalars are converted to \XX quoting.
+
+Then commands to generate the definitions are made and separated by
+NUL.
+
+This is then piped into a Perl script that quotes all values. List
+elements will be appended using two spaces.
+
+Finally \n is converted into \1 because B<fish> variables cannot
+contain \n. GNU B<parallel> will later convert all \1 from
+B<$PARALLEL_ENV> into \n.
+
+This is then all saved in B<$PARALLEL_ENV>.
+
+GNU B<parallel> is called, and B<$PARALLEL_ENV> is deleted.
+
+
+=head2 parset (supported in sh, ash, dash, bash, zsh, ksh, mksh)
+
+B<parset> is a shell function. This is the reason why B<parset> can
+set variables: It runs in the shell which is calling it.
+
+It is also the reason why B<parset> does not work, when data is piped
+into it: B<... | parset ...> makes B<parset> start in a subshell, and
+any changes in environment can therefore not make it back to the
+calling shell.
+
+
+=head2 Job slots
+
+The easiest way to explain what GNU B<parallel> does is to assume that
+there are a number of job slots, and when a slot becomes available a
+job from the queue will be run in that slot. But originally GNU
+B<parallel> did not model job slots in the code. Job slots have been
+added to make it possible to use B<{%}> as a replacement string.
+
+While the job sequence number can be computed in advance, the job slot
+can only be computed the moment a slot becomes available. So it has
+been implemented as a stack with lazy evaluation: Draw one from an
+empty stack and the stack is extended by one. When a job is done, push
+the available job slot back on the stack.
+
+This implementation also means that if you re-run the same jobs, you
+cannot assume jobs will get the same slots. And if you use remote
+executions, you cannot assume that a given job slot will remain on the
+same remote server. This goes double since number of job slots can be
+adjusted on the fly (by giving B<--jobs> a file name).
+
+
+=head2 Rsync protocol version
+
+B<rsync> 3.1.x uses protocol 31 which is unsupported by version
+2.5.7. That means that you cannot push a file to a remote system using
+B<rsync> protocol 31, if the remote system uses 2.5.7. B<rsync> does
+not automatically downgrade to protocol 30.
+
+GNU B<parallel> does not require protocol 31, so if the B<rsync>
+version is >= 3.1.0 then B<--protocol 30> is added to force newer
+B<rsync>s to talk to version 2.5.7.
+
+
+=head2 Compression
+
+GNU B<parallel> buffers output in temporary files.  B<--compress>
+compresses the buffered data.  This is a bit tricky because there
+should be no files to clean up if GNU B<parallel> is killed by a power
+outage.
+
+GNU B<parallel> first selects a compression program. If the user has
+not selected one, the first of these that is in $PATH is used: B<pzstd
+lbzip2 pbzip2 zstd pixz lz4 pigz lzop plzip lzip gzip lrz pxz bzip2
+lzma xz clzip>. They are sorted by speed on a 128 core machine.
+
+Schematically the setup is as follows:
+
+  command started by parallel | compress > tmpfile
+  cattail tmpfile | uncompress | parallel which reads the output
+
+The setup is duplicated for both standard output (stdout) and standard
+error (stderr).
+
+GNU B<parallel> pipes output from the command run into the compression
+program which saves to a tmpfile. GNU B<parallel> records the pid of
+the compress program.  At the same time a small Perl script (called
+B<cattail> above) is started: It basically does B<cat> followed by
+B<tail -f>, but it also removes the tmpfile as soon as the first byte
+is read, and it continuously checks if the pid of the compression
+program is dead. If the compress program is dead, B<cattail> reads the
+rest of tmpfile and exits.
+
+As most compression programs write out a header when they start, the
+tmpfile in practice is removed by B<cattail> after around 40 ms.
+
+More detailed it works like this:
+
+  bash ( command ) |
+    sh ( emptywrapper ( bash ( compound compress ) ) >tmpfile )
+  cattail ( rm tmpfile; compound decompress ) < tmpfile
+
+This complex setup is to make sure compress program is only started if
+there is input. This means each job will cause 8 processes to run. If
+combined with B<--keep-order> these processes will run until the job
+has been printed.
+
+
+=head2 Wrapping
+
+The command given by the user can be wrapped in multiple
+templates. Templates can be wrapped in other templates.
+
+
+
+=over 15
+
+=item B<$COMMAND>
+
+the command to run.
+
+
+=item B<$INPUT>
+
+the input to run.
+
+
+=item B<$SHELL>
+
+the shell that started GNU Parallel.
+
+
+=item B<$SSHLOGIN>
+
+the sshlogin.
+
+
+=item B<$WORKDIR>
+
+the working dir.
+
+
+=item B<$FILE>
+
+the file to read parts from.
+
+
+=item B<$STARTPOS>
+
+the first byte position to read from B<$FILE>.
+
+
+=item B<$LENGTH>
+
+the number of bytes to read from B<$FILE>.
+
+
+=item --shellquote
+
+echo I<Double quoted $INPUT>
+
+
+=item --nice I<pri>
+
+Remote: See B<The remote system wrapper>.
+
+Local: B<setpriority(0,0,$nice)>
+
+=item --cat
+
+  cat > {}; $COMMAND {};
+  perl -e '$bash = shift;
+    $csh = shift;
+    for(@ARGV) { unlink;rmdir; }
+    if($bash =~ s/h//) { exit $bash;  }
+    exit $csh;' "$?h" "$status" {};
+
+{} is set to B<$PARALLEL_TMP> which is a tmpfile. The Perl script
+saves the exit value, unlinks the tmpfile, and returns the exit value
+- no matter if the shell is B<bash>/B<ksh>/B<zsh> (using $?) or
+B<*csh>/B<fish> (using $status).
+
+=item --fifo
+
+  perl -e '($s,$c,$f) = @ARGV;
+    # mkfifo $PARALLEL_TMP
+    system "mkfifo", $f;
+    # spawn $shell -c $command &
+    $pid = fork || exec $s, "-c", $c;
+    open($o,">",$f) || die $!;
+    # cat > $PARALLEL_TMP
+    while(sysread(STDIN,$buf,131072)){
+       syswrite $o, $buf;
+    }
+    close $o;
+    # waitpid to get the exit code from $command
+    waitpid $pid,0;
+    # Cleanup
+    unlink $f;
+    exit $?/256;' $SHELL -c $COMMAND $PARALLEL_TMP
+
+This is an elaborate way of: mkfifo {}; run B<$COMMAND> in the
+background using B<$SHELL>; copying STDIN to {}; waiting for background
+to complete; remove {} and exit with the exit code from B<$COMMAND>.
+
+It is made this way to be compatible with B<*csh>/B<fish>.
+
+=item --pipepart
+
+
+  < $FILE perl -e 'while(@ARGV) {
+      sysseek(STDIN,shift,0) || die;
+      $left = shift;
+      while($read =
+            sysread(STDIN,$buf,
+                    ($left > 131072 ? 131072 : $left))){
+        $left -= $read;
+        syswrite(STDOUT,$buf);
+      }
+    }' $STARTPOS $LENGTH
+
+This will read B<$LENGTH> bytes from B<$FILE> starting at B<$STARTPOS>
+and send it to STDOUT.
+
+=item --sshlogin $SSHLOGIN
+
+  ssh $SSHLOGIN "$COMMAND"
+
+=item --transfer
+
+  ssh $SSHLOGIN mkdir -p ./$WORKDIR;
+  rsync --protocol 30 -rlDzR \
+        -essh ./{} $SSHLOGIN:./$WORKDIR;
+  ssh $SSHLOGIN "$COMMAND"
+
+Read about B<--protocol 30> in the section B<Rsync protocol version>.
+
+=item --transferfile I<file>
+
+<<todo>>
+
+=item --basefile
+
+<<todo>>
+
+=item --return I<file>
+
+  $COMMAND; _EXIT_status=$?; mkdir -p $WORKDIR;
+  rsync --protocol 30 \
+    --rsync-path=cd\ ./$WORKDIR\;\ rsync \
+    -rlDzR -essh $SSHLOGIN:./$FILE ./$WORKDIR;
+  exit $_EXIT_status;
+
+The B<--rsync-path=cd ...> is needed because old versions of B<rsync>
+do not support B<--no-implied-dirs>.
+
+The B<$_EXIT_status> trick is to postpone the exit value. This makes it
+incompatible with B<*csh> and should be fixed in the future. Maybe a
+wrapping 'sh -c' is enough?
+
+=item --cleanup
+
+$RETURN is the wrapper from B<--return>
+
+  $COMMAND; _EXIT_status=$?; $RETURN;
+  ssh $SSHLOGIN \(rm\ -f\ ./$WORKDIR/{}\;\
+                  rmdir\ ./$WORKDIR\ \>\&/dev/null\;\);
+  exit $_EXIT_status;
+
+B<$_EXIT_status>: see B<--return> above.
+
+
+=item --pipe
+
+  perl -e 'if(sysread(STDIN, $buf, 1)) {
+	open($fh, "|-", "@ARGV") || die;
+	syswrite($fh, $buf);
+	# Align up to 128k block
+	if($read = sysread(STDIN, $buf, 131071)) {
+	    syswrite($fh, $buf);
+	}
+	while($read = sysread(STDIN, $buf, 131072)) {
+	    syswrite($fh, $buf);
+	}
+	close $fh;
+	exit ($?&127 ? 128+($?&127) : 1+$?>>8)
+    }' $SHELL -c $COMMAND
+
+This small wrapper makes sure that B<$COMMAND> will never be run if
+there is no data.
+
+=item --tmux
+
+<<TODO Fixup with '-quoting>>
+mkfifo /tmp/tmx3cMEV &&
+  sh -c 'tmux -S /tmp/tmsaKpv1 new-session -s p334310 -d "sleep .2" >/dev/null 2>&1';
+tmux -S /tmp/tmsaKpv1 new-window -t p334310 -n wc\ 10 \(wc\ 10\)\;\ perl\ -e\ \'while\(\$t++\<3\)\{\ print\ \$ARGV\[0\],\"\\n\"\ \}\'\ \$\?h/\$status\ \>\>\ /tmp/tmx3cMEV\&echo\ wc\\\ 10\;\ echo\ \Job\ finished\ at:\ \`date\`\;sleep\ 10;
+exec perl -e '$/="/";$_=<>;$c=<>;unlink $ARGV; /(\d+)h/ and exit($1);exit$c' /tmp/tmx3cMEV
+
+
+mkfifo I<tmpfile.tmx>;
+tmux -S <tmpfile.tms> new-session -s pI<PID> -d 'sleep .2' >&/dev/null;
+tmux -S <tmpfile.tms> new-window -t pI<PID> -n <<shell quoted input>> \(<<shell quoted input>>\)\;\ perl\ -e\ \'while\(\$t++\<3\)\{\ print\ \$ARGV\[0\],\"\\n\"\ \}\'\ \$\?h/\$status\ \>\>\ I<tmpfile.tmx>\&echo\ <<shell double quoted input>>\;echo\ \Job\ finished\ at:\ \`date\`\;sleep\ 10;
+exec perl -e '$/="/";$_=<>;$c=<>;unlink $ARGV; /(\d+)h/ and exit($1);exit$c' I<tmpfile.tmx>
+
+First a FIFO is made (.tmx). It is used for communicating exit
+value. Next a new tmux session is made. This may fail if there is
+already a session, so the output is ignored. If all job slots finish
+at the same time, then B<tmux> will close the session. A temporary
+socket is made (.tms) to avoid a race condition in B<tmux>. It is
+cleaned up when GNU B<parallel> finishes.
+
+The input is used as the name of the windows in B<tmux>. When the job
+inside B<tmux> finishes, the exit value is printed to the FIFO (.tmx).
+This FIFO is opened by B<perl> outside B<tmux>, and B<perl> then
+removes the FIFO. B<Perl> blocks until the first value is read from
+the FIFO, and this value is used as exit value.
+
+To make it compatible with B<csh> and B<bash> the exit value is
+printed as: $?h/$status and this is parsed by B<perl>.
+
+There is a bug that makes it necessary to print the exit value 3
+times.
+
+Another bug in B<tmux> requires the length of the tmux title and
+command to not have certain limits.  When inside these limits, 75 '\ '
+are added to the title to force it to be outside the limits.
+
+You can map the bad limits using:
+
+  perl -e 'sub r { int(rand(shift)).($_[0] && "\t".r(@_)) } print map { r(@ARGV)."\n" } 1..10000' 1600 1500 90 |
+    perl -ane '$F[0]+$F[1]+$F[2] < 2037 and print ' |
+    parallel --colsep '\t' --tagstring '{1}\t{2}\t{3}' tmux -S /tmp/p{%}-'{=3 $_="O"x$_ =}' \
+      new-session -d -n '{=1 $_="O"x$_ =}' true'\ {=2 $_="O"x$_ =};echo $?;rm -f /tmp/p{%}-O*'
+
+  perl -e 'sub r { int(rand(shift)).($_[0] && "\t".r(@_)) } print map { r(@ARGV)."\n" } 1..10000' 17000 17000 90 |
+    parallel --colsep '\t' --tagstring '{1}\t{2}\t{3}' \
+  tmux -S /tmp/p{%}-'{=3 $_="O"x$_ =}' new-session -d -n '{=1 $_="O"x$_ =}' true'\ {=2 $_="O"x$_ =};echo $?;rm /tmp/p{%}-O*'
+  > value.csv 2>/dev/null
+
+  R -e 'a<-read.table("value.csv");X11();plot(a[,1],a[,2],col=a[,4]+5,cex=0.1);Sys.sleep(1000)'
+
+For B<tmux 1.8> 17000 can be lowered to 2100.
+
+The interesting areas are title 0..1000 with (title + whole command)
+in 996..1127 and 9331..9636.
+
+=back
+
+The ordering of the wrapping is important:
+
+=over 5
+
+=item *
+
+$PARALLEL_ENV which is set in env_parallel.* must be prepended to the
+command first, as the command may contain exported variables or
+functions.
+
+=item *
+
+B<--nice>/B<--cat>/B<--fifo> should be done on the remote machine
+
+=item *
+
+B<--pipepart>/B<--pipe> should be done on the local machine inside B<--tmux>
+
+=back
+
+
+=head2 Convenience options --nice --basefile --transfer --return
+--cleanup --tmux --group --compress --cat --fifo --workdir --tag
+--tagstring
+
+These are all convenience options that make it easier to do a
+task. But more importantly: They are tested to work on corner cases,
+too. Take B<--nice> as an example:
+
+  nice parallel command ...
+
+will work just fine. But when run remotely, you need to move the nice
+command so it is being run on the server:
+
+  parallel -S server nice command ...
+
+And this will again work just fine, as long as you are running a
+single command. When you are running a composed command you need nice
+to apply to the whole command, and it gets harder still:
+
+  parallel -S server -q nice bash -c 'command1 ...; cmd2 | cmd3'
+
+It is not impossible, but by using B<--nice> GNU B<parallel> will do
+the right thing for you. Similarly when transferring files: It starts
+to get hard when the file names contain space, :, `, *, or other
+special characters.
+
+To run the commands in a B<tmux> session you basically just need to
+quote the command. For simple commands that is easy, but when commands
+contain special characters, it gets much harder to get right.
+
+B<--compress> not only compresses standard output (stdout) but also
+standard error (stderr); and it does so into files, that are open but
+deleted, so a crash will not leave these files around.
+
+B<--cat> and B<--fifo> are easy to do by hand, until you want to clean
+up the tmpfile and keep the exit code of the command.
+
+The real killer comes when you try to combine several of these: Doing
+that correctly for all corner cases is next to impossible to do by
+hand.
+
+=head2 --shard
+
+The simple way to implement sharding would be to:
+
+=over 5
+
+=item 1
+
+start n jobs,
+
+=item 2
+
+split each line into columns,
+
+=item 3
+
+select the data from the relevant column
+
+=item 4
+
+compute a hash value from the data
+
+=item 5
+
+take the modulo n of the hash value
+
+=item 6
+
+pass the full line to the jobslot that has the computed value
+
+=back
+
+Unfortunately Perl is rather slow at computing the hash value (and
+somewhat slow at splitting into columns).
+
+One solution is to use a compiled language for the splitting and
+hashing, but that would go against the design criteria of not
+depending on a compiler.
+
+Luckily those tasks can be parallelized. So GNU B<parallel> starts n
+sharders that do step 2-6, and passes blocks of 100k to each of those
+in a round robin manner. To make sure these sharders compute the hash
+the same way, $PERL_HASH_SEED is set to the same value for all sharders.
+
+Running n sharders poses a new problem: Instead of having n outputs
+(one for each computed value) you now have n outputs for each of the n
+values, so in total n*n outputs; and you need to merge these n*n
+outputs together into n outputs.
+
+This can be done by simply running 'parallel -j0 --lb cat :::
+outputs_for_one_value', but that is rather inefficient, as it spawns a
+process for each file. Instead the core code from 'parcat' is run,
+which is also a bit faster.
+
+All the sharders and parcats communicate through named pipes that are
+unlinked as soon as they are opened.
+
+
+=head2 Shell shock
+
+The shell shock bug in B<bash> did not affect GNU B<parallel>, but the
+solutions did. B<bash> first introduced functions in variables named:
+I<BASH_FUNC_myfunc()> and later changed that to
+I<BASH_FUNC_myfunc%%>. When transferring functions GNU B<parallel>
+reads off the function and changes that into a function definition,
+which is copied to the remote system and executed before the actual
+command is executed. Therefore GNU B<parallel> needs to know how to
+read the function.
+
+From version 20150122 GNU B<parallel> tries both the ()-version and
+the %%-version, and the function definition works on both pre- and
+post-shell shock versions of B<bash>.
+
+
+=head2 The remote system wrapper
+
+The remote system wrapper does some initialization before starting the
+command on the remote system.
+
+=head3 Make quoting unnecessary by hex encoding everything
+
+When you run B<ssh server foo> then B<foo> has to be quoted once:
+
+  ssh server "echo foo; echo bar"
+
+If you run B<ssh server1 ssh server2 foo> then B<foo> has to be quoted
+twice:
+
+  ssh server1 ssh server2 \'"echo foo; echo bar"\'
+
+GNU B<parallel> avoids this by packing everyting into hex values and
+running a command that does not need quoting:
+
+  perl -X -e GNU_Parallel_worker,eval+pack+q/H10000000/,join+q//,@ARGV
+
+This command reads hex from the command line and converts that to
+bytes that are then eval'ed as a Perl expression.
+
+The string B<GNU_Parallel_worker> is not needed. It is simply there to
+let the user know, that this process is GNU B<parallel> working.
+
+=head3 Ctrl-C and standard error (stderr)
+
+If the user presses Ctrl-C the user expects jobs to stop. This works
+out of the box if the jobs are run locally. Unfortunately it is not so
+simple if the jobs are run remotely.
+
+If remote jobs are run in a tty using B<ssh -tt>, then Ctrl-C works,
+but all output to standard error (stderr) is sent to standard output
+(stdout). This is not what the user expects.
+
+If remote jobs are run without a tty using B<ssh> (without B<-tt>),
+then output to standard error (stderr) is kept on stderr, but Ctrl-C
+does not kill remote jobs. This is not what the user expects.
+
+So what is needed is a way to have both. It seems the reason why
+Ctrl-C does not kill the remote jobs is because the shell does not
+propagate the hang-up signal from B<sshd>. But when B<sshd> dies, the
+parent of the login shell becomes B<init> (process id 1). So by
+exec'ing a Perl wrapper to monitor the parent pid and kill the child
+if the parent pid becomes 1, then Ctrl-C works and stderr is kept on
+stderr.
+
+Ctrl-C does, however, kill the ssh connection, so any output from
+a remote dying process is lost.
+
+To be able to kill all (grand)*children a new process group is
+started.
+
+
+=head3 --nice
+
+B<nice>ing the remote process is done by B<setpriority(0,0,$nice)>. A
+few old systems do not implement this and B<--nice> is unsupported on
+those.
+
+
+=head3 Setting $PARALLEL_TMP
+
+B<$PARALLEL_TMP> is used by B<--fifo> and B<--cat> and must point to a
+non-exitent file in B<$TMPDIR>. This file name is computed on the
+remote system.
+
+
+=head3 The wrapper
+
+The wrapper looks like this:
+
+  $shell = $PARALLEL_SHELL || $SHELL;
+  $tmpdir = $TMPDIR || $PARALLEL_REMOTE_TMPDIR;
+  $nice = $opt::nice;
+  $termseq = $opt::termseq;
+
+  # Check that $tmpdir is writable
+  -w $tmpdir ||
+      die("$tmpdir is not writable.".
+  	" Set PARALLEL_REMOTE_TMPDIR");
+  # Set $PARALLEL_TMP to a non-existent file name in $TMPDIR
+  do {
+      $ENV{PARALLEL_TMP} = $tmpdir."/par".
+  	join"", map { (0..9,"a".."z","A".."Z")[rand(62)] } (1..5);
+  } while(-e $ENV{PARALLEL_TMP});
+  # Set $script to a non-existent file name in $TMPDIR
+  do {
+      $script = $tmpdir."/par".
+  	join"", map { (0..9,"a".."z","A".."Z")[rand(62)] } (1..5);
+  } while(-e $script);
+  # Create a script from the hex code
+  # that removes itself and runs the commands
+  open($fh,">",$script) || die;
+  # ' needed due to rc-shell
+  print($fh("rm \'$script\'\n",$bashfunc.$cmd));
+  close $fh;
+  my $parent = getppid;
+  my $done = 0;
+  $SIG{CHLD} = sub { $done = 1; };
+  $pid = fork;
+  unless($pid) {
+      # Make own process group to be able to kill HUP it later
+      eval { setpgrp };
+      # Set nice value
+      eval { setpriority(0,0,$nice) };
+      # Run the script
+      exec($shell,$script);
+      die("exec failed: $!");
+  }
+  while((not $done) and (getppid == $parent)) {
+      # Parent pid is not changed, so sshd is alive
+      # Exponential sleep up to 1 sec
+      $s = $s < 1 ? 0.001 + $s * 1.03 : $s;
+      select(undef, undef, undef, $s);
+  }
+  if(not $done) {
+      # sshd is dead: User pressed Ctrl-C
+      # Kill as per --termseq
+      my @term_seq = split/,/,$termseq;
+      if(not @term_seq) {
+  	@term_seq = ("TERM",200,"TERM",100,"TERM",50,"KILL",25);
+      }
+      while(@term_seq && kill(0,-$pid)) {
+  	kill(shift @term_seq, -$pid);
+  	select(undef, undef, undef, (shift @term_seq)/1000);
+      }
+  }
+  wait;
+  exit ($?&127 ? 128+($?&127) : 1+$?>>8)
+
+
+=head2 Transferring of variables and functions
+
+Transferring of variables and functions given by B<--env> is done by
+running a Perl script remotely that calls the actual command. The Perl
+script sets B<$ENV{>I<variable>B<}> to the correct value before
+exec'ing a shell that runs the function definition followed by the
+actual command.
+
+The function B<env_parallel> copies the full current environment into
+the environment variable B<PARALLEL_ENV>. This variable is picked up
+by GNU B<parallel> and used to create the Perl script mentioned above.
+
+
+=head2 Base64 encoded bzip2
+
+B<csh> limits words of commands to 1024 chars. This is often too little
+when GNU B<parallel> encodes environment variables and wraps the
+command with different templates. All of these are combined and quoted
+into one single word, which often is longer than 1024 chars.
+
+When the line to run is > 1000 chars, GNU B<parallel> therefore
+encodes the line to run. The encoding B<bzip2>s the line to run,
+converts this to base64, splits the base64 into 1000 char blocks (so
+B<csh> does not fail), and prepends it with this Perl script that
+decodes, decompresses and B<eval>s the line.
+
+    @GNU_Parallel=("use","IPC::Open3;","use","MIME::Base64");
+    eval "@GNU_Parallel";
+
+    $SIG{CHLD}="IGNORE";
+    # Search for bzip2. Not found => use default path
+    my $zip = (grep { -x $_ } "/usr/local/bin/bzip2")[0] || "bzip2";
+    # $in = stdin on $zip, $out = stdout from $zip
+    my($in, $out,$eval);
+    open3($in,$out,">&STDERR",$zip,"-dc");
+    if(my $perlpid = fork) {
+        close $in;
+        $eval = join "", <$out>;
+        close $out;
+    } else {
+        close $out;
+        # Pipe decoded base64 into 'bzip2 -dc'
+        print $in (decode_base64(join"",@ARGV));
+        close $in;
+        exit;
+    }
+    wait;
+    eval $eval;
+
+Perl and B<bzip2> must be installed on the remote system, but a small
+test showed that B<bzip2> is installed by default on all platforms
+that runs GNU B<parallel>, so this is not a big problem.
+
+The added bonus of this is that much bigger environments can now be
+transferred as they will be below B<bash>'s limit of 131072 chars.
+
+
+=head2 Which shell to use
+
+Different shells behave differently. A command that works in B<tcsh>
+may not work in B<bash>.  It is therefore important that the correct
+shell is used when GNU B<parallel> executes commands.
+
+GNU B<parallel> tries hard to use the right shell. If GNU B<parallel>
+is called from B<tcsh> it will use B<tcsh>.  If it is called from
+B<bash> it will use B<bash>. It does this by looking at the
+(grand)*parent process: If the (grand)*parent process is a shell, use
+this shell; otherwise look at the parent of this (grand)*parent. If
+none of the (grand)*parents are shells, then $SHELL is used.
+
+This will do the right thing if called from:
+
+=over 2
+
+=item *
+
+an interactive shell
+
+=item *
+
+a shell script
+
+=item *
+
+a Perl script in `` or using B<system> if called as a single string.
+
+=back
+
+While these cover most cases, there are situations where it will fail:
+
+=over 2
+
+=item *
+
+When run using B<exec>.
+
+=item *
+
+When run as the last command using B<-c> from another shell (because
+some shells use B<exec>):
+
+  zsh% bash -c "parallel 'echo {} is not run in bash; \
+       set | grep BASH_VERSION' ::: This"
+
+You can work around that by appending '&& true':
+
+  zsh% bash -c "parallel 'echo {} is run in bash; \
+       set | grep BASH_VERSION' ::: This && true"
+
+=item *
+
+When run in a Perl script using B<system> with parallel as the first
+string:
+
+  #!/usr/bin/perl
+
+  system("parallel",'setenv a {}; echo $a',":::",2);
+
+Here it depends on which shell is used to call the Perl script. If the
+Perl script is called from B<tcsh> it will work just fine, but if it
+is called from B<bash> it will fail, because the command B<setenv> is
+not known to B<bash>.
+
+=back
+
+If GNU B<parallel> guesses wrong in these situation, set the shell using
+B<$PARALLEL_SHELL>.
+
+
+=head2 Always running commands in a shell
+
+If the command is a simple command with no redirection and setting of
+variables, the command I<could> be run without spawning a
+shell. E.g. this simple B<grep> matching either 'ls ' or ' wc E<gt>E<gt> c':
+
+  parallel "grep -E 'ls | wc >> c' {}" ::: foo
+
+could be run as:
+
+  system("grep","-E","ls | wc >> c","foo");
+
+However, as soon as the command is a bit more complex a shell I<must>
+be spawned:
+
+  parallel "grep -E 'ls | wc >> c' {} | wc >> c" ::: foo
+  parallel "LANG=C grep -E 'ls | wc >> c' {}" ::: foo
+
+It is impossible to tell how B<| wc E<gt>E<gt> c> should be
+interpreted without parsing the string (is the B<|> a pipe in shell or
+an alternation in a B<grep> regexp?  Is B<LANG=C> a command in B<csh>
+or setting a variable in B<bash>? Is B<E<gt>E<gt>> redirection or part
+of a regexp?).
+
+On top of this, wrapper scripts will often require a shell to be
+spawned.
+
+The downside is that you need to quote special shell chars twice:
+
+  parallel echo '*' ::: This will expand the asterisk
+  parallel echo "'*'" ::: This will not
+  parallel "echo '*'" ::: This will not
+  parallel echo '\*' ::: This will not
+  parallel echo \''*'\' ::: This will not
+  parallel -q echo '*' ::: This will not
+
+B<-q> will quote all special chars, thus redirection will not work:
+this prints '* > out.1' and I<does not> save '*' into the file out.1:
+
+  parallel -q echo "*" ">" out.{} ::: 1
+
+GNU B<parallel> tries to live up to Principle Of Least Astonishment
+(POLA), and the requirement of using B<-q> is hard to understand, when
+you do not see the whole picture.
+
+
+=head2 Quoting
+
+Quoting depends on the shell. For most shells '-quoting is used for
+strings containing special characters.
+
+For B<tcsh>/B<csh> newline is quoted as \ followed by newline. Other
+special characters are also \-quoted.
+
+For B<rc> everything is quoted using '.
+
+
+=head2 --pipepart vs. --pipe
+
+While B<--pipe> and B<--pipepart> look much the same to the user, they are
+implemented very differently.
+
+With B<--pipe> GNU B<parallel> reads the blocks from standard input
+(stdin), which is then given to the command on standard input (stdin);
+so every block is being processed by GNU B<parallel> itself. This is
+the reason why B<--pipe> maxes out at around 500 MB/sec.
+
+B<--pipepart>, on the other hand, first identifies at which byte
+positions blocks start and how long they are. It does that by seeking
+into the file by the size of a block and then reading until it meets
+end of a block. The seeking explains why GNU B<parallel> does not know
+the line number and why B<-L/-l> and B<-N> do not work.
+
+With a reasonable block and file size this seeking is more than 1000
+time faster than reading the full file. The byte positions are then
+given to a small script that reads from position X to Y and sends
+output to standard output (stdout). This small script is prepended to
+the command and the full command is executed just as if GNU
+B<parallel> had been in its normal mode. The script looks like this:
+
+  < file perl -e 'while(@ARGV) {
+     sysseek(STDIN,shift,0) || die;
+     $left = shift;
+     while($read = sysread(STDIN,$buf,
+                           ($left > 131072 ? 131072 : $left))){
+       $left -= $read; syswrite(STDOUT,$buf);
+     }
+  }' startbyte length_in_bytes
+
+It delivers 1 GB/s per core.
+
+Instead of the script B<dd> was tried, but many versions of B<dd> do
+not support reading from one byte to another and might cause partial
+data. See this for a surprising example:
+
+  yes | dd bs=1024k count=10 | wc
+
+
+=head2 --block-size adjustment
+
+Every time GNU B<parallel> detects a record bigger than
+B<--block-size> it increases the block size by 30%. A small
+B<--block-size> gives very poor performance; by exponentially
+increasing the block size performance will not suffer.
+
+GNU B<parallel> will waste CPU power if B<--block-size> does not
+contain a full record, because it tries to find a full record and will
+fail to do so. The recommendation is therefore to use a
+B<--block-size> > 2 records, so you always get at least one full
+record when you read one block.
+
+If you use B<-N> then B<--block-size> should be big enough to contain
+N+1 records.
+
+
+=head2 Automatic --block-size computation
+
+With B<--pipepart> GNU B<parallel> can compute the B<--block-size>
+automatically. A B<--block-size> of B<-1> will use a block size so
+that each jobslot will receive approximately 1 block.  B<--block -2>
+will pass 2 blocks to each jobslot and B<-I<n>> will pass I<n> blocks
+to each jobslot.
+
+This can be done because B<--pipepart> reads from files, and we can
+compute the total size of the input.
+
+
+=head2 --jobs and --onall
+
+When running the same commands on many servers what should B<--jobs>
+signify? Is it the number of servers to run on in parallel?  Is it the
+number of jobs run in parallel on each server?
+
+GNU B<parallel> lets B<--jobs> represent the number of servers to run
+on in parallel. This is to make it possible to run a sequence of
+commands (that cannot be parallelized) on each server, but run the
+same sequence on multiple servers.
+
+
+=head2 --shuf
+
+When using B<--shuf> to shuffle the jobs, all jobs are read, then they
+are shuffled, and finally executed. When using SQL this makes the
+B<--sqlmaster> be the part that shuffles the jobs. The B<--sqlworker>s
+simply executes according to Seq number.
+
+
+=head2 --csv
+
+B<--pipepart> is incompatible with B<--csv> because you can have
+records like:
+
+  a,b,c
+  a,"
+  a,b,c
+  a,b,c
+  a,b,c
+  ",c
+  a,b,c
+
+Here the second record contains a multi-line field that looks like
+records. Since B<--pipepart> does not read then whole file when
+searching for record endings, it may start reading in this multi-line
+field, which would be wrong.
+
+
+=head2 Buffering on disk
+
+GNU B<parallel> buffers output, because if output is not buffered you
+have to be ridiculously careful on sizes to avoid mixing of outputs
+(see excellent example on https://catern.com/posts/pipes.html).
+
+GNU B<parallel> buffers on disk in $TMPDIR using files, that are
+removed as soon as they are created, but which are kept open. So even
+if GNU B<parallel> is killed by a power outage, there will be no files
+to clean up afterwards. Another advantage is that the file system is
+aware that these files will be lost in case of a crash, so it does
+not need to sync them to disk.
+
+It gives the odd situation that a disk can be fully used, but there
+are no visible files on it.
+
+
+=head3 Partly buffering in memory
+
+When using output formats SQL and CSV then GNU Parallel has to read
+the whole output into memory. When run normally it will only read the
+output from a single job. But when using B<--linebuffer> every line
+printed will also be buffered in memory - for all jobs currently
+running.
+
+If memory is tight, then do not use the output format SQL/CSV with
+B<--linebuffer>.
+
+
+=head3 Comparing to buffering in memory
+
+B<gargs> is a parallelizing tool that buffers in memory. It is
+therefore a useful way of comparing the advantages and disadvantages
+of buffering in memory to buffering on disk.
+
+On an system with 6 GB RAM free and 6 GB free swap these were tested
+with different sizes:
+
+  echo /dev/zero | gargs "head -c $size {}" >/dev/null
+  echo /dev/zero | parallel "head -c $size {}" >/dev/null
+
+The results are here:
+
+  JobRuntime      Command
+       0.344      parallel_test 1M
+       0.362      parallel_test 10M
+       0.640      parallel_test 100M
+       9.818      parallel_test 1000M
+      23.888      parallel_test 2000M
+      30.217      parallel_test 2500M
+      30.963      parallel_test 2750M
+      34.648      parallel_test 3000M
+      43.302      parallel_test 4000M
+      55.167      parallel_test 5000M
+      67.493      parallel_test 6000M
+     178.654      parallel_test 7000M
+     204.138      parallel_test 8000M
+     230.052      parallel_test 9000M
+     255.639      parallel_test 10000M
+     757.981      parallel_test 30000M
+       0.537      gargs_test 1M
+       0.292      gargs_test 10M
+       0.398      gargs_test 100M
+       3.456      gargs_test 1000M
+       8.577      gargs_test 2000M
+      22.705      gargs_test 2500M
+     123.076      gargs_test 2750M
+      89.866      gargs_test 3000M
+     291.798      gargs_test 4000M
+
+GNU B<parallel> is pretty much limited by the speed of the disk: Up to
+6 GB data is written to disk but cached, so reading is fast. Above 6
+GB data are both written and read from disk. When the 30000MB job is
+running, the disk system is slow, but usable: If you are not using the
+disk, you almost do not feel it.
+
+B<gargs> has a speed advantage up until 2500M where it hits a
+wall. Then the system starts swapping like crazy and is completely
+unusable. At 5000M it goes out of memory.
+
+You can make GNU B<parallel> behave similar to B<gargs> if you point
+$TMPDIR to a tmpfs-filesystem: It will be faster for small outputs,
+but may kill your system for larger outputs and cause you to lose
+output.
+
+
+=head2 Disk full
+
+GNU B<parallel> buffers on disk. If the disk is full, data may be
+lost. To check if the disk is full GNU B<parallel> writes a 8193 byte
+file every second. If this file is written successfully, it is removed
+immediately. If it is not written successfully, the disk is full. The
+size 8193 was chosen because 8192 gave wrong result on some file
+systems, whereas 8193 did the correct thing on all tested filesystems.
+
+
+=head2 Memory usage
+
+Normally GNU B<parallel> will use around 17 MB RAM constantly - no
+matter how many jobs or how much output there is. There are a few
+things that cause the memory usage to rise:
+
+=over 3
+
+=item *
+
+Multiple input sources. GNU B<parallel> reads an input source only
+once. This is by design, as an input source can be a stream
+(e.g. FIFO, pipe, standard input (stdin)) which cannot be rewound and
+read again. When reading a single input source, the memory is freed as
+soon as the job is done - thus keeping the memory usage constant.
+
+But when reading multiple input sources GNU B<parallel> keeps the
+already read values for generating all combinations with other input
+sources.
+
+=item *
+
+Computing the number of jobs. B<--bar>, B<--eta>, and B<--halt xx%>
+use B<total_jobs()> to compute the total number of jobs. It does this
+by generating the data structures for all jobs. All these job data
+structures will be stored in memory and take up around 400 bytes/job.
+
+=item *
+
+Buffering a full line. B<--linebuffer> will read a full line per
+running job. A very long output line (say 1 GB without \n) will
+increase RAM usage temporarily: From when the beginning of the line is
+read till the line is printed.
+
+=item *
+
+Buffering the full output of a single job. This happens when using
+B<--results *.csv/*.tsv> or B<--sql*>. Here GNU B<parallel> will read
+the whole output of a single job and save it as csv/tsv or SQL.
+
+=back
+
+
+=head2 Argument separators ::: :::: :::+ ::::+
+
+The argument separator B<:::> was chosen because I have never seen
+B<:::> used in any command. The natural choice B<--> would be a bad
+idea since it is not unlikely that the template command will contain
+B<-->. I have seen B<::> used in programming languanges to separate
+classes, and I did not want the user to be confused that the separator
+had anything to do with classes.
+
+B<:::> also makes a visual separation, which is good if there are
+multiple B<:::>.
+
+When B<:::> was chosen, B<::::> came as a fairly natural extension.
+
+Linking input sources meant having to decide for some way to indicate
+linking of B<:::> and B<::::>. B<:::+> and B<::::+> were chosen, so
+that they were similar to B<:::> and B<::::>.
+
+In 2022 I realized that B<///> would have been an even better choice,
+because you cannot have an file named B<///> whereas you I<can> have a
+file named B<:::>.
+
+
+=head2 Perl replacement strings, {= =}, and --rpl
+
+The shorthands for replacement strings make a command look more
+cryptic. Different users will need different replacement
+strings. Instead of inventing more shorthands you get more
+flexible replacement strings if they can be programmed by the user.
+
+The language Perl was chosen because GNU B<parallel> is written in
+Perl and it was easy and reasonably fast to run the code given by the
+user.
+
+If a user needs the same programmed replacement string again and
+again, the user may want to make his own shorthand for it. This is
+what B<--rpl> is for. It works so well, that even GNU B<parallel>'s
+own shorthands are implemented using B<--rpl>.
+
+In Perl code the bigrams B<{=> and B<=}> rarely exist. They look like a
+matching pair and can be entered on all keyboards. This made them good
+candidates for enclosing the Perl expression in the replacement
+strings. Another candidate ,, and ,, was rejected because they do not
+look like a matching pair. B<--parens> was made, so that the users can
+still use ,, and ,, if they like: B<--parens ,,,,>
+
+Internally, however, the B<{=> and B<=}> are replaced by \257< and
+\257>. This is to make it simpler to make regular expressions. You
+only need to look one character ahead, and never have to look behind.
+
+
+=head2 Test suite
+
+GNU B<parallel> uses its own testing framework. This is mostly due to
+historical reasons. It deals reasonably well with tests that are
+dependent on how long a given test runs (e.g. more than 10 secs is a
+pass, but less is a fail). It parallelizes most tests, but it is easy
+to force a test to run as the single test (which may be important for
+timing issues). It deals reasonably well with tests that fail
+intermittently. It detects which tests failed and pushes these to the
+top, so when running the test suite again, the tests that failed most
+recently are run first.
+
+If GNU B<parallel> should adopt a real testing framework then those
+elements would be important.
+
+Since many tests are dependent on which hardware it is running on,
+these tests break when run on a different hardware than what the test
+was written for.
+
+When most bugs are fixed a test is added, so this bug will not
+reappear. It is, however, sometimes hard to create the environment in
+which the bug shows up - especially if the bug only shows up
+sometimes. One of the harder problems was to make a machine start
+swapping without forcing it to its knees.
+
+
+=head2 Median run time
+
+Using a percentage for B<--timeout> causes GNU B<parallel> to compute
+the median run time of a job. The median is a better indicator of the
+expected run time than average, because there will often be outliers
+taking way longer than the normal run time.
+
+To avoid keeping all run times in memory, an implementation of
+remedian was made (Rousseeuw et al).
+
+
+=head2 Error messages and warnings
+
+Error messages like: ERROR, Not found, and 42 are not very
+helpful. GNU B<parallel> strives to inform the user:
+
+=over 2
+
+=item *
+
+What went wrong?
+
+=item *
+
+Why did it go wrong?
+
+=item *
+
+What can be done about it?
+
+=back
+
+Unfortunately it is not always possible to predict the root cause of
+the error.
+
+
+=head2 Determine number of CPUs
+
+CPUs is an ambiguous term. It can mean the number of socket filled
+(i.e. the number of physical chips). It can mean the number of cores
+(i.e. the number of physical compute cores). It can mean the number of
+hyperthreaded cores (i.e. the number of virtual cores - with some of
+them possibly being hyperthreaded).
+
+On ark.intel.com Intel uses the terms I<cores> and I<threads> for
+number of physical cores and the number of hyperthreaded cores
+respectively.
+
+GNU B<parallel> uses uses I<CPUs> as the number of compute units and
+the terms I<sockets>, I<cores>, and I<threads> to specify how the
+number of compute units is calculated.
+
+
+=head2 Computation of load
+
+Contrary to the obvious B<--load> does not use load average. This is
+due to load average rising too slowly. Instead it uses B<ps> to list
+the number of threads in running or blocked state (state D, O or
+R). This gives an instant load.
+
+As remote calculation of load can be slow, a process is spawned to run
+B<ps> and put the result in a file, which is then used next time.
+
+
+=head2 Killing jobs
+
+GNU B<parallel> kills jobs. It can be due to B<--memfree>, B<--halt>,
+or when GNU B<parallel> meets a condition from which it cannot
+recover. Every job is started as its own process group. This way any
+(grand)*children will get killed, too. The process group is killed
+with the specification mentioned in B<--termseq>.
+
+
+=head2 SQL interface
+
+GNU B<parallel> uses the DBURL from GNU B<sql> to give database
+software, username, password, host, port, database, and table in a
+single string.
+
+The DBURL must point to a table name. The table will be dropped and
+created. The reason for not reusing an existing table is that the user
+may have added more input sources which would require more columns in
+the table. By prepending '+' to the DBURL the table will not be
+dropped.
+
+The table columns are similar to joblog with the addition of B<V1>
+.. B<Vn> which are values from the input sources, and Stdout and
+Stderr which are the output from standard output and standard error,
+respectively.
+
+The Signal column has been renamed to _Signal due to Signal being a
+reserved word in MySQL.
+
+
+=head2 Logo
+
+The logo is inspired by the Cafe Wall illusion. The font is DejaVu
+Sans.
+
+=head2 Citation notice
+
+Funding a free software project is hard. GNU B<parallel> is no
+exception. On top of that it seems the less visible a project is, the
+harder it is to get funding. And the nature of GNU B<parallel> is that
+it will never be seen by "the guy with the checkbook", but only by the
+people doing the actual work.
+
+This problem has been covered by others - though no solution has been
+found: https://www.slideshare.net/NadiaEghbal/consider-the-maintainer
+https://www.numfocus.org/blog/why-is-numpy-only-now-getting-funded/
+
+Before implementing the citation notice it was discussed with the
+users:
+https://lists.gnu.org/archive/html/parallel/2013-11/msg00006.html
+
+Having to spend 10 seconds on running B<parallel --citation> once is
+no doubt not an ideal solution, but no one has so far come up with an
+ideal solution - neither for funding GNU B<parallel> nor other free
+software.
+
+If you believe you have the perfect solution, you should try it out,
+and if it works, you should post it on the email list. Ideas that will
+cost work and which have not been tested are, however, unlikely to be
+prioritized.
+
+Running B<parallel --citation> one single time takes less than 10
+seconds, and will silence the citation notice for future runs. This is
+comparable to graphical tools where you have to click a checkbox
+saying "Do not show this again". But if that is too much trouble for
+you, why not use one of the alternatives instead?  See a list in:
+B<man parallel_alternatives>.
+
+As the request for citation is not a legal requirement this is
+acceptable under GPLv3 and cleared with Richard M. Stallman
+himself. Thus it does not fall under this:
+https://www.gnu.org/licenses/gpl-faq.en.html#RequireCitation
+
+
+=head1 Ideas for new design
+
+=head2 Multiple processes working together
+
+Open3 is slow. Printing is slow. It would be good if they did not tie
+up resources, but were run in separate threads.
+
+
+=head2 --rrs on remote using a perl wrapper
+
+... | perl -pe '$/=$recend$recstart;BEGIN{ if(substr($_) eq $recstart) substr($_)="" } eof and substr($_) eq $recend) substr($_)=""
+
+It ought to be possible to write a filter that removed rec sep on the
+fly instead of inside GNU B<parallel>. This could then use more cpus.
+
+Will that require 2x record size memory?
+
+Will that require 2x block size memory?
+
+
+=head1 Historical decisions
+
+These decisions were relevant for earlier versions of GNU B<parallel>,
+but not the current version. They are kept here as historical record.
+
+
+=head2 --tollef
+
+You can read about the history of GNU B<parallel> on
+https://www.gnu.org/software/parallel/history.html
+
+B<--tollef> was included to make GNU B<parallel> switch compatible
+with the parallel from moreutils (which is made by Tollef Fog
+Heen). This was done so that users of that parallel easily could port
+their use to GNU B<parallel>: Simply set B<PARALLEL="--tollef"> and
+that would be it.
+
+But several distributions chose to make B<--tollef> global (by putting
+it into /etc/parallel/config) without making the users aware of this,
+and that caused much confusion when people tried out the examples from
+GNU B<parallel>'s man page and these did not work.  The users became
+frustrated because the distribution did not make it clear to them that
+it has made B<--tollef> global.
+
+So to lessen the frustration and the resulting support, B<--tollef>
+was obsoleted 20130222 and removed one year later.
+
+
+=cut
diff --git a/src/parallel_examples.pod b/src/parallel_examples.pod
new file mode 100644
index 0000000..e518276
--- /dev/null
+++ b/src/parallel_examples.pod
@@ -0,0 +1,1994 @@
+#!/usr/bin/perl -w
+
+# SPDX-FileCopyrightText: 2021-2022 Ole Tange, http://ole.tange.dk and Free Software and Foundation, Inc.
+# SPDX-License-Identifier: GFDL-1.3-or-later
+# SPDX-License-Identifier: CC-BY-SA-4.0
+
+=encoding utf8
+
+=head1 GNU PARALLEL EXAMPLES
+
+=head2 EXAMPLE: Working as xargs -n1. Argument appending
+
+GNU B<parallel> can work similar to B<xargs -n1>.
+
+To compress all html files using B<gzip> run:
+
+  find . -name '*.html' | parallel gzip --best
+
+If the file names may contain a newline use B<-0>. Substitute FOO BAR with
+FUBAR in all files in this dir and subdirs:
+
+  find . -type f -print0 | \
+    parallel -q0 perl -i -pe 's/FOO BAR/FUBAR/g'
+
+Note B<-q> is needed because of the space in 'FOO BAR'.
+
+
+=head2 EXAMPLE: Simple network scanner
+
+B<prips> can generate IP-addresses from CIDR notation. With GNU
+B<parallel> you can build a simple network scanner to see which
+addresses respond to B<ping>:
+
+  prips 130.229.16.0/20 | \
+    parallel --timeout 2 -j0 \
+      'ping -c 1 {} >/dev/null && echo {}' 2>/dev/null
+
+
+=head2 EXAMPLE: Reading arguments from command line
+
+GNU B<parallel> can take the arguments from command line instead of
+stdin (standard input). To compress all html files in the current dir
+using B<gzip> run:
+
+  parallel gzip --best ::: *.html
+
+To convert *.wav to *.mp3 using LAME running one process per CPU run:
+
+  parallel lame {} -o {.}.mp3 ::: *.wav
+
+
+=head2 EXAMPLE: Inserting multiple arguments
+
+When moving a lot of files like this: B<mv *.log destdir> you will
+sometimes get the error:
+
+  bash: /bin/mv: Argument list too long
+
+because there are too many files. You can instead do:
+
+  ls | grep -E '\.log$' | parallel mv {} destdir
+
+This will run B<mv> for each file. It can be done faster if B<mv> gets
+as many arguments that will fit on the line:
+
+  ls | grep -E '\.log$' | parallel -m mv {} destdir
+
+In many shells you can also use B<printf>:
+
+  printf '%s\0' *.log | parallel -0 -m mv {} destdir
+
+
+=head2 EXAMPLE: Context replace
+
+To remove the files I<pict0000.jpg> .. I<pict9999.jpg> you could do:
+
+  seq -w 0 9999 | parallel rm pict{}.jpg
+
+You could also do:
+
+  seq -w 0 9999 | perl -pe 's/(.*)/pict$1.jpg/' | parallel -m rm
+
+The first will run B<rm> 10000 times, while the last will only run
+B<rm> as many times needed to keep the command line length short
+enough to avoid B<Argument list too long> (it typically runs 1-2 times).
+
+You could also run:
+
+  seq -w 0 9999 | parallel -X rm pict{}.jpg
+
+This will also only run B<rm> as many times needed to keep the command
+line length short enough.
+
+
+=head2 EXAMPLE: Compute intensive jobs and substitution
+
+If ImageMagick is installed this will generate a thumbnail of a jpg
+file:
+
+  convert -geometry 120 foo.jpg thumb_foo.jpg
+
+This will run with number-of-cpus jobs in parallel for all jpg files
+in a directory:
+
+  ls *.jpg | parallel convert -geometry 120 {} thumb_{}
+
+To do it recursively use B<find>:
+
+  find . -name '*.jpg' | \
+    parallel convert -geometry 120 {} {}_thumb.jpg
+
+Notice how the argument has to start with B<{}> as B<{}> will include path
+(e.g. running B<convert -geometry 120 ./foo/bar.jpg
+thumb_./foo/bar.jpg> would clearly be wrong). The command will
+generate files like ./foo/bar.jpg_thumb.jpg.
+
+Use B<{.}> to avoid the extra .jpg in the file name. This command will
+make files like ./foo/bar_thumb.jpg:
+
+  find . -name '*.jpg' | \
+    parallel convert -geometry 120 {} {.}_thumb.jpg
+
+
+=head2 EXAMPLE: Substitution and redirection
+
+This will generate an uncompressed version of .gz-files next to the .gz-file:
+
+  parallel zcat {} ">"{.} ::: *.gz
+
+Quoting of > is necessary to postpone the redirection. Another
+solution is to quote the whole command:
+
+  parallel "zcat {} >{.}" ::: *.gz
+
+Other special shell characters (such as * ; $ > < |  >> <<) also need
+to be put in quotes, as they may otherwise be interpreted by the shell
+and not given to GNU B<parallel>.
+
+
+=head2 EXAMPLE: Composed commands
+
+A job can consist of several commands. This will print the number of
+files in each directory:
+
+  ls | parallel 'echo -n {}" "; ls {}|wc -l'
+
+To put the output in a file called <name>.dir:
+
+  ls | parallel '(echo -n {}" "; ls {}|wc -l) >{}.dir'
+
+Even small shell scripts can be run by GNU B<parallel>:
+
+  find . | parallel 'a={}; name=${a##*/};' \
+    'upper=$(echo "$name" | tr "[:lower:]" "[:upper:]");'\
+    'echo "$name - $upper"'
+
+  ls | parallel 'mv {} "$(echo {} | tr "[:upper:]" "[:lower:]")"'
+
+Given a list of URLs, list all URLs that fail to download. Print the
+line number and the URL.
+
+  cat urlfile | parallel "wget {} 2>/dev/null || grep -n {} urlfile"
+
+Create a mirror directory with the same filenames except all files and
+symlinks are empty files.
+
+  cp -rs /the/source/dir mirror_dir
+  find mirror_dir -type l | parallel -m rm {} '&&' touch {}
+
+Find the files in a list that do not exist
+
+  cat file_list | parallel 'if [ ! -e {} ] ; then echo {}; fi'
+
+
+=head2 EXAMPLE: Composed command with perl replacement string
+
+You have a bunch of file. You want them sorted into dirs. The dir of
+each file should be named the first letter of the file name.
+
+  parallel 'mkdir -p {=s/(.).*/$1/=}; mv {} {=s/(.).*/$1/=}' ::: *
+
+
+=head2 EXAMPLE: Composed command with multiple input sources
+
+You have a dir with files named as 24 hours in 5 minute intervals:
+00:00, 00:05, 00:10 .. 23:55. You want to find the files missing:
+
+  parallel [ -f {1}:{2} ] "||" echo {1}:{2} does not exist \
+    ::: {00..23} ::: {00..55..5}
+
+
+=head2 EXAMPLE: Calling Bash functions
+
+If the composed command is longer than a line, it becomes hard to
+read. In Bash you can use functions. Just remember to B<export -f> the
+function.
+
+  doit() {
+    echo Doing it for $1
+    sleep 2
+    echo Done with $1
+  }
+  export -f doit
+  parallel doit ::: 1 2 3
+
+  doubleit() {
+    echo Doing it for $1 $2
+    sleep 2
+    echo Done with $1 $2
+  }
+  export -f doubleit
+  parallel doubleit ::: 1 2 3 ::: a b
+
+To do this on remote servers you need to transfer the function using
+B<--env>:
+
+  parallel --env doit -S server doit ::: 1 2 3
+  parallel --env doubleit -S server doubleit ::: 1 2 3 ::: a b
+
+If your environment (aliases, variables, and functions) is small you
+can copy the full environment without having to
+B<export -f> anything. See B<env_parallel>.
+
+
+=head2 EXAMPLE: Function tester
+
+To test a program with different parameters:
+
+  tester() {
+    if (eval "$@") >&/dev/null; then
+      perl -e 'printf "\033[30;102m[ OK ]\033[0m @ARGV\n"' "$@"
+    else
+      perl -e 'printf "\033[30;101m[FAIL]\033[0m @ARGV\n"' "$@"
+    fi
+  }
+  export -f tester
+  parallel tester my_program ::: arg1 arg2
+  parallel tester exit ::: 1 0 2 0
+
+If B<my_program> fails a red FAIL will be printed followed by the failing
+command; otherwise a green OK will be printed followed by the command.
+
+
+=head2 EXAMPLE: Continously show the latest line of output
+
+It can be useful to monitor the output of running jobs.
+
+This shows the most recent output line until a job finishes. After
+which the output of the job is printed in full:
+
+  parallel '{} | tee >(cat >&3)' ::: 'command 1' 'command 2' \
+    3> >(perl -ne '$|=1;chomp;printf"%.'$COLUMNS's\r",$_." "x100')
+
+
+=head2 EXAMPLE: Log rotate
+
+Log rotation renames a logfile to an extension with a higher number:
+log.1 becomes log.2, log.2 becomes log.3, and so on. The oldest log is
+removed. To avoid overwriting files the process starts backwards from
+the high number to the low number.  This will keep 10 old versions of
+the log:
+
+  seq 9 -1 1 | parallel -j1 mv log.{} log.'{= $_++ =}'
+  mv log log.1
+
+
+=head2 EXAMPLE: Removing file extension when processing files
+
+When processing files removing the file extension using B<{.}> is
+often useful.
+
+Create a directory for each zip-file and unzip it in that dir:
+
+  parallel 'mkdir {.}; cd {.}; unzip ../{}' ::: *.zip
+
+Recompress all .gz files in current directory using B<bzip2> running 1
+job per CPU in parallel:
+
+  parallel "zcat {} | bzip2 >{.}.bz2 && rm {}" ::: *.gz
+
+Convert all WAV files to MP3 using LAME:
+
+  find sounddir -type f -name '*.wav' | parallel lame {} -o {.}.mp3
+
+Put all converted in the same directory:
+
+  find sounddir -type f -name '*.wav' | \
+    parallel lame {} -o mydir/{/.}.mp3
+
+
+=head2 EXAMPLE: Removing strings from the argument
+
+If you have directory with tar.gz files and want these extracted in
+the corresponding dir (e.g foo.tar.gz will be extracted in the dir
+foo) you can do:
+
+  parallel --plus 'mkdir {..}; tar -C {..} -xf {}' ::: *.tar.gz
+
+If you want to remove a different ending, you can use {%string}:
+
+  parallel --plus echo {%_demo} ::: mycode_demo keep_demo_here
+
+You can also remove a starting string with {#string}
+
+  parallel --plus echo {#demo_} ::: demo_mycode keep_demo_here
+
+To remove a string anywhere you can use regular expressions with
+{/regexp/replacement} and leave the replacement empty:
+
+  parallel --plus echo {/demo_/} ::: demo_mycode remove_demo_here
+
+
+=head2 EXAMPLE: Download 24 images for each of the past 30 days
+
+Let us assume a website stores images like:
+
+  https://www.example.com/path/to/YYYYMMDD_##.jpg
+
+where YYYYMMDD is the date and ## is the number 01-24. This will
+download images for the past 30 days:
+
+  getit() {
+    date=$(date -d "today -$1 days" +%Y%m%d)
+    num=$2
+    echo wget https://www.example.com/path/to/${date}_${num}.jpg
+  }
+  export -f getit
+  
+  parallel getit ::: $(seq 30) ::: $(seq -w 24)
+
+B<$(date -d "today -$1 days" +%Y%m%d)> will give the dates in
+YYYYMMDD with B<$1> days subtracted.
+
+
+=head2 EXAMPLE: Download world map from NASA
+
+NASA provides tiles to download on earthdata.nasa.gov. Download tiles
+for Blue Marble world map and create a 10240x20480 map.
+
+  base=https://map1a.vis.earthdata.nasa.gov/wmts-geo/wmts.cgi
+  service="SERVICE=WMTS&REQUEST=GetTile&VERSION=1.0.0"
+  layer="LAYER=BlueMarble_ShadedRelief_Bathymetry"
+  set="STYLE=&TILEMATRIXSET=EPSG4326_500m&TILEMATRIX=5"
+  tile="TILEROW={1}&TILECOL={2}"
+  format="FORMAT=image%2Fjpeg"
+  url="$base?$service&$layer&$set&$tile&$format"
+
+  parallel -j0 -q wget "$url" -O {1}_{2}.jpg ::: {0..19} ::: {0..39}
+  parallel eval convert +append {}_{0..39}.jpg line{}.jpg ::: {0..19}
+  convert -append line{0..19}.jpg world.jpg
+
+
+=head2 EXAMPLE: Download Apollo-11 images from NASA using jq
+
+Search NASA using their API to get JSON for images related to 'apollo
+11' and has 'moon landing' in the description.
+
+The search query returns JSON containing URLs to JSON containing
+collections of pictures. One of the pictures in each of these
+collection is I<large>.
+
+B<wget> is used to get the JSON for the search query. B<jq> is then
+used to extract the URLs of the collections. B<parallel> then calls
+B<wget> to get each collection, which is passed to B<jq> to extract
+the URLs of all images. B<grep> filters out the I<large> images, and
+B<parallel> finally uses B<wget> to fetch the images.
+
+  base="https://images-api.nasa.gov/search"
+  q="q=apollo 11"
+  description="description=moon landing"
+  media_type="media_type=image"
+  wget -O - "$base?$q&$description&$media_type" |
+    jq -r .collection.items[].href |
+    parallel wget -O - |
+    jq -r .[] |
+    grep large |
+    parallel wget
+
+
+=head2 EXAMPLE: Download video playlist in parallel
+
+B<youtube-dl> is an excellent tool to download videos. It can,
+however, not download videos in parallel. This takes a playlist and
+downloads 10 videos in parallel.
+
+  url='youtu.be/watch?v=0wOf2Fgi3DE&list=UU_cznB5YZZmvAmeq7Y3EriQ'
+  export url
+  youtube-dl --flat-playlist "https://$url" |
+    parallel --tagstring {#} --lb -j10 \
+      youtube-dl --playlist-start {#} --playlist-end {#} '"https://$url"'
+
+
+=head2 EXAMPLE: Prepend last modified date (ISO8601) to file name
+
+  parallel mv {} '{= $a=pQ($_); $b=$_;' \
+    '$_=qx{date -r "$a" +%FT%T}; chomp; $_="$_ $b" =}' ::: *
+
+B<{=> and B<=}> mark a perl expression. B<pQ> perl-quotes the
+string. B<date +%FT%T> is the date in ISO8601 with time.
+
+=head2 EXAMPLE: Save output in ISO8601 dirs
+
+Save output from B<ps aux> every second into dirs named
+yyyy-mm-ddThh:mm:ss+zz:zz.
+
+  seq 1000 | parallel -N0 -j1 --delay 1 \
+    --results '{= $_=`date -Isec`; chomp=}/' ps aux
+
+
+=head2 EXAMPLE: Digital clock with "blinking" :
+
+The : in a digital clock blinks. To make every other line have a ':'
+and the rest a ' ' a perl expression is used to look at the 3rd input
+source. If the value modulo 2 is 1: Use ":" otherwise use " ":
+
+  parallel -k echo {1}'{=3 $_=$_%2?":":" "=}'{2}{3} \
+    ::: {0..12} ::: {0..5} ::: {0..9}
+
+
+=head2 EXAMPLE: Aggregating content of files
+
+This:
+
+  parallel --header : echo x{X}y{Y}z{Z} \> x{X}y{Y}z{Z} \
+  ::: X {1..5} ::: Y {01..10} ::: Z {1..5}
+
+will generate the files x1y01z1 .. x5y10z5. If you want to aggregate
+the output grouping on x and z you can do this:
+
+  parallel eval 'cat {=s/y01/y*/=} > {=s/y01//=}' ::: *y01*
+
+For all values of x and z it runs commands like:
+
+  cat x1y*z1 > x1z1
+
+So you end up with x1z1 .. x5z5 each containing the content of all
+values of y.
+
+
+=head2 EXAMPLE: Breadth first parallel web crawler/mirrorer
+
+This script below will crawl and mirror a URL in parallel.  It
+downloads first pages that are 1 click down, then 2 clicks down, then
+3; instead of the normal depth first, where the first link link on
+each page is fetched first.
+
+Run like this:
+
+  PARALLEL=-j100 ./parallel-crawl http://gatt.org.yeslab.org/
+
+Remove the B<wget> part if you only want a web crawler.
+
+It works by fetching a page from a list of URLs and looking for links
+in that page that are within the same starting URL and that have not
+already been seen. These links are added to a new queue. When all the
+pages from the list is done, the new queue is moved to the list of
+URLs and the process is started over until no unseen links are found.
+
+  #!/bin/bash
+
+  # E.g. http://gatt.org.yeslab.org/
+  URL=$1
+  # Stay inside the start dir
+  BASEURL=$(echo $URL | perl -pe 's:#.*::; s:(//.*/)[^/]*:$1:')
+  URLLIST=$(mktemp urllist.XXXX)
+  URLLIST2=$(mktemp urllist.XXXX)
+  SEEN=$(mktemp seen.XXXX)
+
+  # Spider to get the URLs
+  echo $URL >$URLLIST
+  cp $URLLIST $SEEN
+
+  while [ -s $URLLIST ] ; do
+    cat $URLLIST |
+      parallel lynx -listonly -image_links -dump {} \; \
+        wget -qm -l1 -Q1 {} \; echo Spidered: {} \>\&2 |
+        perl -ne 's/#.*//; s/\s+\d+.\s(\S+)$/$1/ and
+          do { $seen{$1}++ or print }' |
+      grep -F $BASEURL |
+      grep -v -x -F -f $SEEN | tee -a $SEEN > $URLLIST2
+    mv $URLLIST2 $URLLIST
+  done
+
+  rm -f $URLLIST $URLLIST2 $SEEN
+
+
+=head2 EXAMPLE: Process files from a tar file while unpacking
+
+If the files to be processed are in a tar file then unpacking one file
+and processing it immediately may be faster than first unpacking all
+files.
+
+  tar xvf foo.tgz | perl -ne 'print $l;$l=$_;END{print $l}' | \
+    parallel echo
+
+The Perl one-liner is needed to make sure the file is complete before
+handing it to GNU B<parallel>.
+
+
+=head2 EXAMPLE: Rewriting a for-loop and a while-read-loop
+
+for-loops like this:
+
+  (for x in `cat list` ; do
+    do_something $x
+  done) | process_output
+
+and while-read-loops like this:
+
+  cat list | (while read x ; do
+    do_something $x
+  done) | process_output
+
+can be written like this:
+
+  cat list | parallel do_something | process_output
+
+For example: Find which host name in a list has IP address 1.2.3 4:
+
+  cat hosts.txt | parallel -P 100 host | grep 1.2.3.4
+
+If the processing requires more steps the for-loop like this:
+
+  (for x in `cat list` ; do
+    no_extension=${x%.*};
+    do_step1 $x scale $no_extension.jpg
+    do_step2 <$x $no_extension
+  done) | process_output
+
+and while-loops like this:
+
+  cat list | (while read x ; do
+    no_extension=${x%.*};
+    do_step1 $x scale $no_extension.jpg
+    do_step2 <$x $no_extension
+  done) | process_output
+
+can be written like this:
+
+  cat list | parallel "do_step1 {} scale {.}.jpg ; do_step2 <{} {.}" |\
+    process_output
+
+If the body of the loop is bigger, it improves readability to use a function:
+
+  (for x in `cat list` ; do
+    do_something $x
+    [... 100 lines that do something with $x ...]
+  done) | process_output
+
+  cat list | (while read x ; do
+    do_something $x
+    [... 100 lines that do something with $x ...]
+  done) | process_output
+
+can both be rewritten as:
+
+  doit() {
+    x=$1
+    do_something $x
+    [... 100 lines that do something with $x ...]
+  }
+  export -f doit
+  cat list | parallel doit
+
+=head2 EXAMPLE: Rewriting nested for-loops
+
+Nested for-loops like this:
+
+  (for x in `cat xlist` ; do
+    for y in `cat ylist` ; do
+      do_something $x $y
+    done
+  done) | process_output
+
+can be written like this:
+
+  parallel do_something {1} {2} :::: xlist ylist | process_output
+
+Nested for-loops like this:
+
+  (for colour in red green blue ; do
+    for size in S M L XL XXL ; do
+      echo $colour $size
+    done
+  done) | sort
+
+can be written like this:
+
+  parallel echo {1} {2} ::: red green blue ::: S M L XL XXL | sort
+
+
+=head2 EXAMPLE: Finding the lowest difference between files
+
+B<diff> is good for finding differences in text files. B<diff | wc -l>
+gives an indication of the size of the difference. To find the
+differences between all files in the current dir do:
+
+  parallel --tag 'diff {1} {2} | wc -l' ::: * ::: * | sort -nk3
+
+This way it is possible to see if some files are closer to other
+files.
+
+
+=head2 EXAMPLE: for-loops with column names
+
+When doing multiple nested for-loops it can be easier to keep track of
+the loop variable if is is named instead of just having a number. Use
+B<--header :> to let the first argument be an named alias for the
+positional replacement string:
+
+  parallel --header : echo {colour} {size} \
+    ::: colour red green blue ::: size S M L XL XXL
+
+This also works if the input file is a file with columns:
+
+  cat addressbook.tsv | \
+    parallel --colsep '\t' --header : echo {Name} {E-mail address}
+
+
+=head2 EXAMPLE: All combinations in a list
+
+GNU B<parallel> makes all combinations when given two lists.
+
+To make all combinations in a single list with unique values, you
+repeat the list and use replacement string B<{choose_k}>:
+
+  parallel --plus echo {choose_k} ::: A B C D ::: A B C D
+
+  parallel --plus echo 2{2choose_k} 1{1choose_k} ::: A B C D ::: A B C D
+
+B<{choose_k}> works for any number of input sources:
+
+  parallel --plus echo {choose_k} ::: A B C D ::: A B C D ::: A B C D
+
+Where B<{choose_k}> does not care about order, B<{uniq}> cares about
+order. It simply skips jobs where values from different input sources
+are the same:
+
+  parallel --plus echo {uniq} ::: A B C  ::: A B C  ::: A B C
+  parallel --plus echo {1uniq}+{2uniq}+{3uniq} ::: A B C  ::: A B C  ::: A B C
+
+
+=head2 EXAMPLE: From a to b and b to c
+
+Assume you have input like:
+
+  aardvark
+  babble
+  cab
+  dab
+  each
+
+and want to run combinations like:
+
+  aardvark babble
+  babble cab
+  cab dab
+  dab each
+
+If the input is in the file in.txt:
+
+  parallel echo {1} - {2} ::::+ <(head -n -1 in.txt) <(tail -n +2 in.txt)
+
+If the input is in the array $a here are two solutions:
+
+  seq $((${#a[@]}-1)) | \
+    env_parallel --env a echo '${a[{=$_--=}]} - ${a[{}]}'
+  parallel echo {1} - {2} ::: "${a[@]::${#a[@]}-1}" :::+ "${a[@]:1}"
+
+
+=head2 EXAMPLE: Count the differences between all files in a dir
+
+Using B<--results> the results are saved in /tmp/diffcount*.
+
+  parallel --results /tmp/diffcount "diff -U 0 {1} {2} | \
+    tail -n +3 |grep -v '^@'|wc -l" ::: * ::: *
+
+To see the difference between file A and file B look at the file
+'/tmp/diffcount/1/A/2/B'.
+
+
+=head2 EXAMPLE: Speeding up fast jobs
+
+Starting a job on the local machine takes around 3-10 ms. This can be
+a big overhead if the job takes very few ms to run. Often you can
+group small jobs together using B<-X> which will make the overhead
+less significant. Compare the speed of these:
+
+  seq -w 0 9999 | parallel touch pict{}.jpg
+  seq -w 0 9999 | parallel -X touch pict{}.jpg
+
+If your program cannot take multiple arguments, then you can use GNU
+B<parallel> to spawn multiple GNU B<parallel>s:
+
+  seq -w 0 9999999 | \
+    parallel -j10 -q -I,, --pipe parallel -j0 touch pict{}.jpg
+
+If B<-j0> normally spawns 252 jobs, then the above will try to spawn
+2520 jobs. On a normal GNU/Linux system you can spawn 32000 jobs using
+this technique with no problems. To raise the 32000 jobs limit raise
+/proc/sys/kernel/pid_max to 4194303.
+
+If you do not need GNU B<parallel> to have control over each job (so
+no need for B<--retries> or B<--joblog> or similar), then it can be
+even faster if you can generate the command lines and pipe those to a
+shell. So if you can do this:
+
+  mygenerator | sh
+
+Then that can be parallelized like this:
+
+  mygenerator | parallel --pipe --block 10M sh
+
+E.g.
+
+  mygenerator() {
+    seq 10000000 | perl -pe 'print "echo This is fast job number "';
+  }
+  mygenerator | parallel --pipe --block 10M sh
+
+The overhead is 100000 times smaller namely around 100 nanoseconds per
+job.
+
+
+=head2 EXAMPLE: Using shell variables
+
+When using shell variables you need to quote them correctly as they
+may otherwise be interpreted by the shell.
+
+Notice the difference between:
+
+  ARR=("My brother's 12\" records are worth <\$\$\$>"'!' Foo Bar)
+  parallel echo ::: ${ARR[@]} # This is probably not what you want
+
+and:
+
+  ARR=("My brother's 12\" records are worth <\$\$\$>"'!' Foo Bar)
+  parallel echo ::: "${ARR[@]}"
+
+When using variables in the actual command that contains special
+characters (e.g. space) you can quote them using B<'"$VAR"'> or using
+"'s and B<-q>:
+
+  VAR="My brother's 12\" records are worth <\$\$\$>"
+  parallel -q echo "$VAR" ::: '!'
+  export VAR
+  parallel echo '"$VAR"' ::: '!'
+
+If B<$VAR> does not contain ' then B<"'$VAR'"> will also work
+(and does not need B<export>):
+
+  VAR="My 12\" records are worth <\$\$\$>"
+  parallel echo "'$VAR'" ::: '!'
+
+If you use them in a function you just quote as you normally would do:
+
+  VAR="My brother's 12\" records are worth <\$\$\$>"
+  export VAR
+  myfunc() { echo "$VAR" "$1"; }
+  export -f myfunc
+  parallel myfunc ::: '!'
+
+
+=head2 EXAMPLE: Group output lines
+
+When running jobs that output data, you often do not want the output
+of multiple jobs to run together. GNU B<parallel> defaults to grouping
+the output of each job, so the output is printed when the job
+finishes. If you want full lines to be printed while the job is
+running you can use B<--line-buffer>. If you want output to be
+printed as soon as possible you can use B<-u>.
+
+Compare the output of:
+
+  parallel wget --progress=dot --limit-rate=100k \
+    https://ftpmirror.gnu.org/parallel/parallel-20{}0822.tar.bz2 \
+    ::: {12..16}
+  parallel --line-buffer wget --progress=dot --limit-rate=100k \
+    https://ftpmirror.gnu.org/parallel/parallel-20{}0822.tar.bz2 \
+    ::: {12..16}
+  parallel --latest-line wget --progress=dot --limit-rate=100k \
+    https://ftpmirror.gnu.org/parallel/parallel-20{}0822.tar.bz2 \
+    ::: {12..16}
+  parallel -u wget --progress=dot --limit-rate=100k \
+    https://ftpmirror.gnu.org/parallel/parallel-20{}0822.tar.bz2 \
+    ::: {12..16}
+
+=head2 EXAMPLE: Tag output lines
+
+GNU B<parallel> groups the output lines, but it can be hard to see
+where the different jobs begin. B<--tag> prepends the argument to make
+that more visible:
+
+  parallel --tag wget --limit-rate=100k \
+    https://ftpmirror.gnu.org/parallel/parallel-20{}0822.tar.bz2 \
+    ::: {12..16}
+
+B<--tag> works with B<--line-buffer> but not with B<-u>:
+
+  parallel --tag --line-buffer wget --limit-rate=100k \
+    https://ftpmirror.gnu.org/parallel/parallel-20{}0822.tar.bz2 \
+    ::: {12..16}
+
+Check the uptime of the servers in I<~/.parallel/sshloginfile>:
+
+  parallel --tag -S .. --nonall uptime
+
+
+=head2 EXAMPLE: Colorize output
+
+Give each job a new color. Most terminals support ANSI colors with the
+escape code "\033[30;3Xm" where 0 <= X <= 7:
+
+    seq 10 | \
+      parallel --tagstring '\033[30;3{=$_=++$::color%8=}m' seq {}
+    parallel --rpl '{color} $_="\033[30;3".(++$::color%8)."m"' \
+      --tagstring {color} seq {} ::: {1..10}
+
+To get rid of the initial \t (which comes from B<--tagstring>):
+
+    ... | perl -pe 's/\t//'
+
+
+=head2 EXAMPLE: Keep order of output same as order of input
+
+Normally the output of a job will be printed as soon as it
+completes. Sometimes you want the order of the output to remain the
+same as the order of the input. This is often important, if the output
+is used as input for another system. B<-k> will make sure the order of
+output will be in the same order as input even if later jobs end
+before earlier jobs.
+
+Append a string to every line in a text file:
+
+  cat textfile | parallel -k echo {} append_string
+
+If you remove B<-k> some of the lines may come out in the wrong order.
+
+Another example is B<traceroute>:
+
+  parallel traceroute ::: qubes-os.org debian.org freenetproject.org
+
+will give traceroute of qubes-os.org, debian.org and
+freenetproject.org, but it will be sorted according to which job
+completed first.
+
+To keep the order the same as input run:
+
+  parallel -k traceroute ::: qubes-os.org debian.org freenetproject.org
+
+This will make sure the traceroute to qubes-os.org will be printed
+first.
+
+A bit more complex example is downloading a huge file in chunks in
+parallel: Some internet connections will deliver more data if you
+download files in parallel. For downloading files in parallel see:
+"EXAMPLE: Download 10 images for each of the past 30 days". But if you
+are downloading a big file you can download the file in chunks in
+parallel.
+
+To download byte 10000000-19999999 you can use B<curl>:
+
+  curl -r 10000000-19999999 https://example.com/the/big/file >file.part
+
+To download a 1 GB file we need 100 10MB chunks downloaded and
+combined in the correct order.
+
+  seq 0 99 | parallel -k curl -r \
+    {}0000000-{}9999999 https://example.com/the/big/file > file
+
+
+=head2 EXAMPLE: Parallel grep
+
+B<grep -r> greps recursively through directories. GNU B<parallel> can
+often speed this up.
+
+  find . -type f | parallel -k -j150% -n 1000 -m grep -H -n STRING {}
+
+This will run 1.5 job per CPU, and give 1000 arguments to B<grep>.
+
+There are situations where the above will be slower than B<grep -r>:
+
+=over 2
+
+=item *
+
+If data is already in RAM. The overhead of starting jobs and buffering
+output may outweigh the benefit of running in parallel.
+
+=item *
+
+If the files are big. If a file cannot be read in a single seek, the
+disk may start thrashing.
+
+=back
+
+The speedup is caused by two factors:
+
+=over 2
+
+=item *
+
+On rotating harddisks small files often require a seek for each
+file. By searching for more files in parallel, the arm may pass
+another wanted file on its way.
+
+=item *
+
+NVMe drives often perform better by having multiple command running in
+parallel.
+
+=back
+
+
+=head2 EXAMPLE: Grepping n lines for m regular expressions.
+
+The simplest solution to grep a big file for a lot of regexps is:
+
+  grep -f regexps.txt bigfile
+
+Or if the regexps are fixed strings:
+
+  grep -F -f regexps.txt bigfile
+
+There are 3 limiting factors: CPU, RAM, and disk I/O.
+
+RAM is easy to measure: If the B<grep> process takes up most of your
+free memory (e.g. when running B<top>), then RAM is a limiting factor.
+
+CPU is also easy to measure: If the B<grep> takes >90% CPU in B<top>,
+then the CPU is a limiting factor, and parallelization will speed this
+up.
+
+It is harder to see if disk I/O is the limiting factor, and depending
+on the disk system it may be faster or slower to parallelize. The only
+way to know for certain is to test and measure.
+
+
+=head3 Limiting factor: RAM
+
+The normal B<grep -f regexps.txt bigfile> works no matter the size of
+bigfile, but if regexps.txt is so big it cannot fit into memory, then
+you need to split this.
+
+B<grep -F> takes around 100 bytes of RAM and B<grep> takes about 500
+bytes of RAM per 1 byte of regexp. So if regexps.txt is 1% of your
+RAM, then it may be too big.
+
+If you can convert your regexps into fixed strings do that. E.g. if
+the lines you are looking for in bigfile all looks like:
+
+  ID1 foo bar baz Identifier1 quux
+  fubar ID2 foo bar baz Identifier2
+
+then your regexps.txt can be converted from:
+
+  ID1.*Identifier1
+  ID2.*Identifier2
+
+into:
+
+  ID1 foo bar baz Identifier1
+  ID2 foo bar baz Identifier2
+
+This way you can use B<grep -F> which takes around 80% less memory and
+is much faster.
+
+If it still does not fit in memory you can do this:
+
+  parallel --pipe-part -a regexps.txt --block 1M grep -F -f - -n bigfile | \
+    sort -un | perl -pe 's/^\d+://'
+
+The 1M should be your free memory divided by the number of CPU threads and
+divided by 200 for B<grep -F> and by 1000 for normal B<grep>. On
+GNU/Linux you can do:
+
+  free=$(awk '/^((Swap)?Cached|MemFree|Buffers):/ { sum += $2 }
+              END { print sum }' /proc/meminfo)
+  percpu=$((free / 200 / $(parallel --number-of-threads)))k
+
+  parallel --pipe-part -a regexps.txt --block $percpu --compress \
+    grep -F -f - -n bigfile | \
+    sort -un | perl -pe 's/^\d+://'
+
+If you can live with duplicated lines and wrong order, it is faster to do:
+
+  parallel --pipe-part -a regexps.txt --block $percpu --compress \
+    grep -F -f - bigfile
+
+=head3 Limiting factor: CPU
+
+If the CPU is the limiting factor parallelization should be done on
+the regexps:
+
+  cat regexps.txt | parallel --pipe -L1000 --round-robin --compress \
+    grep -f - -n bigfile | \
+    sort -un | perl -pe 's/^\d+://'
+
+The command will start one B<grep> per CPU and read I<bigfile> one
+time per CPU, but as that is done in parallel, all reads except the
+first will be cached in RAM. Depending on the size of I<regexps.txt> it
+may be faster to use B<--block 10m> instead of B<-L1000>.
+
+Some storage systems perform better when reading multiple chunks in
+parallel. This is true for some RAID systems and for some network file
+systems. To parallelize the reading of I<bigfile>:
+
+  parallel --pipe-part --block 100M -a bigfile -k --compress \
+    grep -f regexps.txt
+
+This will split I<bigfile> into 100MB chunks and run B<grep> on each of
+these chunks. To parallelize both reading of I<bigfile> and I<regexps.txt>
+combine the two using B<--cat>:
+
+  parallel --pipe-part --block 100M -a bigfile --cat cat regexps.txt \
+    \| parallel --pipe -L1000 --round-robin grep -f - {}
+
+If a line matches multiple regexps, the line may be duplicated.
+
+=head3 Bigger problem
+
+If the problem is too big to be solved by this, you are probably ready
+for Lucene.
+
+
+=head2 EXAMPLE: Using remote computers
+
+To run commands on a remote computer SSH needs to be set up and you
+must be able to login without entering a password (The commands
+B<ssh-copy-id>, B<ssh-agent>, and B<sshpass> may help you do that).
+
+If you need to login to a whole cluster, you typically do not want to
+accept the host key for every host. You want to accept them the first
+time and be warned if they are ever changed. To do that:
+
+  # Add the servers to the sshloginfile
+  (echo servera; echo serverb) > .parallel/my_cluster
+  # Make sure .ssh/config exist
+  touch .ssh/config
+  cp .ssh/config .ssh/config.backup
+  # Disable StrictHostKeyChecking temporarily
+  (echo 'Host *'; echo StrictHostKeyChecking no) >> .ssh/config
+  parallel --slf my_cluster --nonall true
+  # Remove the disabling of StrictHostKeyChecking
+  mv .ssh/config.backup .ssh/config
+
+The servers in B<.parallel/my_cluster> are now added in B<.ssh/known_hosts>.
+
+To run B<echo> on B<server.example.com>:
+
+  seq 10 | parallel --sshlogin server.example.com echo
+
+To run commands on more than one remote computer run:
+
+  seq 10 | parallel --sshlogin s1.example.com,s2.example.net echo
+
+Or:
+
+  seq 10 | parallel --sshlogin server.example.com \
+    --sshlogin server2.example.net echo
+
+If the login username is I<foo> on I<server2.example.net> use:
+
+  seq 10 | parallel --sshlogin server.example.com \
+    --sshlogin foo@server2.example.net echo
+
+If your list of hosts is I<server1-88.example.net> with login I<foo>:
+
+  seq 10 | parallel -Sfoo@server{1..88}.example.net echo
+
+To distribute the commands to a list of computers, make a file
+I<mycomputers> with all the computers:
+
+  server.example.com
+  foo@server2.example.com
+  server3.example.com
+
+Then run:
+
+  seq 10 | parallel --sshloginfile mycomputers echo
+
+To include the local computer add the special sshlogin ':' to the list:
+
+  server.example.com
+  foo@server2.example.com
+  server3.example.com
+  :
+
+GNU B<parallel> will try to determine the number of CPUs on each of
+the remote computers, and run one job per CPU - even if the remote
+computers do not have the same number of CPUs.
+
+If the number of CPUs on the remote computers is not identified
+correctly the number of CPUs can be added in front. Here the computer
+has 8 CPUs.
+
+  seq 10 | parallel --sshlogin 8/server.example.com echo
+
+
+=head2 EXAMPLE: Transferring of files
+
+To recompress gzipped files with B<bzip2> using a remote computer run:
+
+  find logs/ -name '*.gz' | \
+    parallel --sshlogin server.example.com \
+    --transfer "zcat {} | bzip2 -9 >{.}.bz2"
+
+This will list the .gz-files in the I<logs> directory and all
+directories below. Then it will transfer the files to
+I<server.example.com> to the corresponding directory in
+I<$HOME/logs>. On I<server.example.com> the file will be recompressed
+using B<zcat> and B<bzip2> resulting in the corresponding file with
+I<.gz> replaced with I<.bz2>.
+
+If you want the resulting bz2-file to be transferred back to the local
+computer add I<--return {.}.bz2>:
+
+  find logs/ -name '*.gz' | \
+    parallel --sshlogin server.example.com \
+    --transfer --return {.}.bz2 "zcat {} | bzip2 -9 >{.}.bz2"
+
+After the recompressing is done the I<.bz2>-file is transferred back to
+the local computer and put next to the original I<.gz>-file.
+
+If you want to delete the transferred files on the remote computer add
+I<--cleanup>. This will remove both the file transferred to the remote
+computer and the files transferred from the remote computer:
+
+  find logs/ -name '*.gz' | \
+    parallel --sshlogin server.example.com \
+    --transfer --return {.}.bz2 --cleanup "zcat {} | bzip2 -9 >{.}.bz2"
+
+If you want run on several computers add the computers to I<--sshlogin>
+either using ',' or multiple I<--sshlogin>:
+
+  find logs/ -name '*.gz' | \
+    parallel --sshlogin server.example.com,server2.example.com \
+    --sshlogin server3.example.com \
+    --transfer --return {.}.bz2 --cleanup "zcat {} | bzip2 -9 >{.}.bz2"
+
+You can add the local computer using I<--sshlogin :>. This will disable the
+removing and transferring for the local computer only:
+
+  find logs/ -name '*.gz' | \
+    parallel --sshlogin server.example.com,server2.example.com \
+    --sshlogin server3.example.com \
+    --sshlogin : \
+    --transfer --return {.}.bz2 --cleanup "zcat {} | bzip2 -9 >{.}.bz2"
+
+Often I<--transfer>, I<--return> and I<--cleanup> are used together. They can be
+shortened to I<--trc>:
+
+  find logs/ -name '*.gz' | \
+    parallel --sshlogin server.example.com,server2.example.com \
+    --sshlogin server3.example.com \
+    --sshlogin : \
+    --trc {.}.bz2 "zcat {} | bzip2 -9 >{.}.bz2"
+
+With the file I<mycomputers> containing the list of computers it becomes:
+
+  find logs/ -name '*.gz' | parallel --sshloginfile mycomputers \
+    --trc {.}.bz2 "zcat {} | bzip2 -9 >{.}.bz2"
+
+If the file I<~/.parallel/sshloginfile> contains the list of computers
+the special short hand I<-S ..> can be used:
+
+  find logs/ -name '*.gz' | parallel -S .. \
+    --trc {.}.bz2 "zcat {} | bzip2 -9 >{.}.bz2"
+
+
+=head2 EXAMPLE: Advanced file transfer
+
+Assume you have files in in/*, want them processed on server,
+and transferred back into /other/dir:
+
+  parallel -S server --trc /other/dir/./{/}.out \
+    cp {/} {/}.out ::: in/./*
+
+
+=head2 EXAMPLE: Distributing work to local and remote computers
+
+Convert *.mp3 to *.ogg running one process per CPU on local computer
+and server2:
+
+  parallel --trc {.}.ogg -S server2,: \
+    'mpg321 -w - {} | oggenc -q0 - -o {.}.ogg' ::: *.mp3
+
+
+=head2 EXAMPLE: Running the same command on remote computers
+
+To run the command B<uptime> on remote computers you can do:
+
+  parallel --tag --nonall -S server1,server2 uptime
+
+B<--nonall> reads no arguments. If you have a list of jobs you want
+to run on each computer you can do:
+
+  parallel --tag --onall -S server1,server2 echo ::: 1 2 3
+
+Remove B<--tag> if you do not want the sshlogin added before the
+output.
+
+If you have a lot of hosts use '-j0' to access more hosts in parallel.
+
+
+=head2 EXAMPLE: Running 'sudo' on remote computers
+
+Put the password into passwordfile then run:
+
+  parallel --ssh 'cat passwordfile | ssh' --nonall \
+    -S user@server1,user@server2 sudo -S ls -l /root
+
+
+=head2 EXAMPLE: Using remote computers behind NAT wall
+
+If the workers are behind a NAT wall, you need some trickery to get to
+them.
+
+If you can B<ssh> to a jumphost, and reach the workers from there,
+then the obvious solution would be this, but it B<does not work>:
+
+  parallel --ssh 'ssh jumphost ssh' -S host1 echo ::: DOES NOT WORK
+
+It does not work because the command is dequoted by B<ssh> twice where
+as GNU B<parallel> only expects it to be dequoted once.
+
+You can use a bash function and have GNU B<parallel> quote the command:
+
+  jumpssh() { ssh -A jumphost ssh $(parallel --shellquote ::: "$@"); }
+  export -f jumpssh
+  parallel --ssh jumpssh -S host1 echo ::: this works
+
+Or you can instead put this in B<~/.ssh/config>:
+
+  Host host1 host2 host3
+    ProxyCommand ssh jumphost.domain nc -w 1 %h 22
+
+It requires B<nc(netcat)> to be installed on jumphost. With this you
+can simply:
+
+  parallel -S host1,host2,host3 echo ::: This does work
+
+=head3 No jumphost, but port forwards
+
+If there is no jumphost but each server has port 22 forwarded from the
+firewall (e.g. the firewall's port 22001 = port 22 on host1, 22002 = host2,
+22003 = host3) then you can use B<~/.ssh/config>:
+
+  Host host1.v
+    Port 22001
+  Host host2.v
+    Port 22002
+  Host host3.v
+    Port 22003
+  Host *.v
+    Hostname firewall
+
+And then use host{1..3}.v as normal hosts:
+
+  parallel -S host1.v,host2.v,host3.v echo ::: a b c
+
+=head3 No jumphost, no port forwards
+
+If ports cannot be forwarded, you need some sort of VPN to traverse
+the NAT-wall. TOR is one options for that, as it is very easy to get
+working.
+
+You need to install TOR and setup a hidden service. In B<torrc> put:
+
+  HiddenServiceDir /var/lib/tor/hidden_service/
+  HiddenServicePort 22 127.0.0.1:22
+
+Then start TOR: B</etc/init.d/tor restart>
+
+The TOR hostname is now in B</var/lib/tor/hidden_service/hostname> and
+is something similar to B<izjafdceobowklhz.onion>. Now you simply
+prepend B<torsocks> to B<ssh>:
+
+  parallel --ssh 'torsocks ssh' -S izjafdceobowklhz.onion \
+    -S zfcdaeiojoklbwhz.onion,auclucjzobowklhi.onion echo ::: a b c
+
+If not all hosts are accessible through TOR:
+
+  parallel -S 'torsocks ssh izjafdceobowklhz.onion,host2,host3' \
+    echo ::: a b c
+
+See more B<ssh> tricks on https://en.wikibooks.org/wiki/OpenSSH/Cookbook/Proxies_and_Jump_Hosts
+
+
+=head2 EXAMPLE: Use sshpass with ssh
+
+If you cannot use passwordless login, you may be able to use B<sshpass>:
+
+  seq 10 | parallel -S user-with-password:MyPassword@server echo
+
+or:
+
+  export SSHPASS='MyPa$$w0rd'
+  seq 10 | parallel -S user-with-password:@server echo
+
+
+=head2 EXAMPLE: Use outrun instead of ssh
+
+B<outrun> lets you run a command on a remote server. B<outrun> sets up
+a connection to access files at the source server, and automatically
+transfers files. B<outrun> must be installed on the remote system.
+
+You can use B<outrun> in an sshlogin this way:
+
+  parallel -S 'outrun user@server' command
+
+or:
+
+  parallel --ssh outrun -S server command
+
+
+=head2 EXAMPLE: Slurm cluster
+
+The Slurm Workload Manager is used in many clusters.
+
+Here is a simple example of using GNU B<parallel> to call B<srun>:
+
+  #!/bin/bash
+  
+  #SBATCH --time 00:02:00
+  #SBATCH --ntasks=4
+  #SBATCH --job-name GnuParallelDemo
+  #SBATCH --output gnuparallel.out
+  
+  module purge
+  module load gnu_parallel
+  
+  my_parallel="parallel --delay .2 -j $SLURM_NTASKS"
+  my_srun="srun --export=all --exclusive -n1 --cpus-per-task=1 --cpu-bind=cores"
+  $my_parallel "$my_srun" echo This is job {} ::: {1..20}
+
+
+=head2 EXAMPLE: Parallelizing rsync
+
+B<rsync> is a great tool, but sometimes it will not fill up the
+available bandwidth. Running multiple B<rsync> in parallel can fix
+this.
+
+  cd src-dir
+  find . -type f |
+    parallel -j10 -X rsync -zR -Ha ./{} fooserver:/dest-dir/
+
+Adjust B<-j10> until you find the optimal number.
+
+B<rsync -R> will create the needed subdirectories, so all files are
+not put into a single dir. The B<./> is needed so the resulting command
+looks similar to:
+
+  rsync -zR ././sub/dir/file fooserver:/dest-dir/
+
+The B</./> is what B<rsync -R> works on.
+
+If you are unable to push data, but need to pull them and the files
+are called digits.png (e.g. 000000.png) you might be able to do:
+
+  seq -w 0 99 | parallel rsync -Havessh fooserver:src/*{}.png destdir/
+
+
+=head2 EXAMPLE: Use multiple inputs in one command
+
+Copy files like foo.es.ext to foo.ext:
+
+  ls *.es.* | perl -pe 'print; s/\.es//' | parallel -N2 cp {1} {2}
+
+The perl command spits out 2 lines for each input. GNU B<parallel>
+takes 2 inputs (using B<-N2>) and replaces {1} and {2} with the inputs.
+
+Count in binary:
+
+  parallel -k echo ::: 0 1 ::: 0 1 ::: 0 1 ::: 0 1 ::: 0 1 ::: 0 1
+
+Print the number on the opposing sides of a six sided die:
+
+  parallel --link -a <(seq 6) -a <(seq 6 -1 1) echo
+  parallel --link echo :::: <(seq 6) <(seq 6 -1 1)
+
+Convert files from all subdirs to PNG-files with consecutive numbers
+(useful for making input PNG's for B<ffmpeg>):
+
+  parallel --link -a <(find . -type f | sort) \
+    -a <(seq $(find . -type f|wc -l)) convert {1} {2}.png
+
+Alternative version:
+
+  find . -type f | sort | parallel convert {} {#}.png
+
+
+=head2 EXAMPLE: Use a table as input
+
+Content of table_file.tsv:
+
+  foo<TAB>bar
+  baz <TAB> quux
+
+To run:
+
+  cmd -o bar -i foo
+  cmd -o quux -i baz
+
+you can run:
+
+  parallel -a table_file.tsv --colsep '\t' cmd -o {2} -i {1}
+
+Note: The default for GNU B<parallel> is to remove the spaces around
+the columns. To keep the spaces:
+
+  parallel -a table_file.tsv --trim n --colsep '\t' cmd -o {2} -i {1}
+
+
+=head2 EXAMPLE: Output to database
+
+GNU B<parallel> can output to a database table and a CSV-file:
+
+  dburl=csv:///%2Ftmp%2Fmydir
+  dbtableurl=$dburl/mytable.csv
+  parallel --sqlandworker $dbtableurl seq ::: {1..10}
+
+It is rather slow and takes up a lot of CPU time because GNU
+B<parallel> parses the whole CSV file for each update.
+
+A better approach is to use an SQLite-base and then convert that to CSV:
+
+  dburl=sqlite3:///%2Ftmp%2Fmy.sqlite
+  dbtableurl=$dburl/mytable
+  parallel --sqlandworker $dbtableurl seq ::: {1..10}
+  sql $dburl '.headers on' '.mode csv' 'SELECT * FROM mytable;'
+
+This takes around a second per job.
+
+If you have access to a real database system, such as PostgreSQL, it
+is even faster:
+
+  dburl=pg://user:pass@host/mydb
+  dbtableurl=$dburl/mytable
+  parallel --sqlandworker $dbtableurl seq ::: {1..10}
+  sql $dburl \
+    "COPY (SELECT * FROM mytable) TO stdout DELIMITER ',' CSV HEADER;"
+
+Or MySQL:
+
+  dburl=mysql://user:pass@host/mydb
+  dbtableurl=$dburl/mytable
+  parallel --sqlandworker $dbtableurl seq ::: {1..10}
+  sql -p -B $dburl "SELECT * FROM mytable;" > mytable.tsv
+  perl -pe 's/"/""/g; s/\t/","/g; s/^/"/; s/$/"/;
+    %s=("\\" => "\\", "t" => "\t", "n" => "\n");
+    s/\\([\\tn])/$s{$1}/g;' mytable.tsv
+
+
+=head2 EXAMPLE: Output to CSV-file for R
+
+If you have no need for the advanced job distribution control that a
+database provides, but you simply want output into a CSV file that you
+can read into R or LibreCalc, then you can use B<--results>:
+
+  parallel --results my.csv seq ::: 10 20 30
+  R
+  > mydf <- read.csv("my.csv");
+  > print(mydf[2,])
+  > write(as.character(mydf[2,c("Stdout")]),'')
+
+
+=head2 EXAMPLE: Use XML as input
+
+The show Aflyttet on Radio 24syv publishes an RSS feed with their audio
+podcasts on: http://arkiv.radio24syv.dk/audiopodcast/channel/4466232
+
+Using B<xpath> you can extract the URLs for 2019 and download them
+using GNU B<parallel>:
+
+  wget -O - http://arkiv.radio24syv.dk/audiopodcast/channel/4466232 | \
+    xpath -e "//pubDate[contains(text(),'2019')]/../enclosure/@url" | \
+    parallel -u wget '{= s/ url="//; s/"//; =}'
+
+
+=head2 EXAMPLE: Run the same command 10 times
+
+If you want to run the same command with the same arguments 10 times
+in parallel you can do:
+
+  seq 10 | parallel -n0 my_command my_args
+
+
+=head2 EXAMPLE: Working as cat | sh. Resource inexpensive jobs and evaluation
+
+GNU B<parallel> can work similar to B<cat | sh>.
+
+A resource inexpensive job is a job that takes very little CPU, disk
+I/O and network I/O. Ping is an example of a resource inexpensive
+job. wget is too - if the webpages are small.
+
+The content of the file jobs_to_run:
+
+  ping -c 1 10.0.0.1
+  wget http://example.com/status.cgi?ip=10.0.0.1
+  ping -c 1 10.0.0.2
+  wget http://example.com/status.cgi?ip=10.0.0.2
+  ...
+  ping -c 1 10.0.0.255
+  wget http://example.com/status.cgi?ip=10.0.0.255
+
+To run 100 processes simultaneously do:
+
+  parallel -j 100 < jobs_to_run
+
+As there is not a I<command> the jobs will be evaluated by the shell.
+
+
+=head2 EXAMPLE: Call program with FASTA sequence
+
+FASTA files have the format:
+
+  >Sequence name1
+  sequence
+  sequence continued
+  >Sequence name2
+  sequence
+  sequence continued
+  more sequence
+
+To call B<myprog> with the sequence as argument run:
+
+  cat file.fasta |
+    parallel --pipe -N1 --recstart '>' --rrs \
+      'read a; echo Name: "$a"; myprog $(tr -d "\n")'
+
+
+=head2 EXAMPLE: Call program with interleaved FASTQ records
+
+FASTQ files have the format:
+
+  @M10991:61:000000000-A7EML:1:1101:14011:1001 1:N:0:28
+  CTCCTAGGTCGGCATGATGGGGGAAGGAGAGCATGGGAAGAAATGAGAGAGTAGCAAGG
+  +
+  #8BCCGGGGGFEFECFGGGGGGGGG@;FFGGGEG@FF<EE<@FFC,CEGCCGGFF<FGF
+
+Interleaved FASTQ starts with a line like these:
+
+  @HWUSI-EAS100R:6:73:941:1973#0/1
+  @EAS139:136:FC706VJ:2:2104:15343:197393 1:Y:18:ATCACG
+  @EAS139:136:FC706VJ:2:2104:15343:197393 1:N:18:1
+
+where '/1' and ' 1:' determines this is read 1.
+
+This will cut big.fq into one chunk per CPU thread and pass it on
+stdin (standard input) to the program fastq-reader:
+
+  parallel --pipe-part -a big.fq --block -1 --regexp \
+    --recend '\n' --recstart '@.*(/1| 1:.*)\n[A-Za-z\n\.~]' \
+    fastq-reader
+
+
+=head2 EXAMPLE: Processing a big file using more CPUs
+
+To process a big file or some output you can use B<--pipe> to split up
+the data into blocks and pipe the blocks into the processing program.
+
+If the program is B<gzip -9> you can do:
+
+  cat bigfile | parallel --pipe --recend '' -k gzip -9 > bigfile.gz
+
+This will split B<bigfile> into blocks of 1 MB and pass that to B<gzip
+-9> in parallel. One B<gzip> will be run per CPU. The output of B<gzip
+-9> will be kept in order and saved to B<bigfile.gz>
+
+B<gzip> works fine if the output is appended, but some processing does
+not work like that - for example sorting. For this GNU B<parallel> can
+put the output of each command into a file. This will sort a big file
+in parallel:
+
+  cat bigfile | parallel --pipe --files sort |\
+    parallel -Xj1 sort -m {} ';' rm {} >bigfile.sort
+
+Here B<bigfile> is split into blocks of around 1MB, each block ending
+in '\n' (which is the default for B<--recend>). Each block is passed
+to B<sort> and the output from B<sort> is saved into files. These
+files are passed to the second B<parallel> that runs B<sort -m> on the
+files before it removes the files. The output is saved to
+B<bigfile.sort>.
+
+GNU B<parallel>'s B<--pipe> maxes out at around 100 MB/s because every
+byte has to be copied through GNU B<parallel>. But if B<bigfile> is a
+real (seekable) file GNU B<parallel> can by-pass the copying and send
+the parts directly to the program:
+
+  parallel --pipe-part --block 100m -a bigfile --files sort |\
+    parallel -Xj1 sort -m {} ';' rm {} >bigfile.sort
+
+
+=head2 EXAMPLE: Grouping input lines
+
+When processing with B<--pipe> you may have lines grouped by a
+value. Here is I<my.csv>:
+
+   Transaction Customer Item
+	1	a	53
+	2	b	65
+	3	b	82
+	4	c	96
+	5	c	67
+	6	c	13
+	7	d	90
+	8	d	43
+	9	d	91
+	10	d	84
+	11	e	72
+	12	e	102
+	13	e	63
+	14	e	56
+	15	e	74
+
+Let us assume you want GNU B<parallel> to process each customer. In
+other words: You want all the transactions for a single customer to be
+treated as a single record.
+
+To do this we preprocess the data with a program that inserts a record
+separator before each customer (column 2 = $F[1]). Here we first make
+a 50 character random string, which we then use as the separator:
+
+  sep=`perl -e 'print map { ("a".."z","A".."Z")[rand(52)] } (1..50);'`
+  cat my.csv | \
+     perl -ape '$F[1] ne $l and print "'$sep'"; $l = $F[1]' | \
+     parallel --recend $sep --rrs --pipe -N1 wc
+
+If your program can process multiple customers replace B<-N1> with a
+reasonable B<--blocksize>.
+
+
+=head2 EXAMPLE: Running more than 250 jobs workaround
+
+If you need to run a massive amount of jobs in parallel, then you will
+likely hit the filehandle limit which is often around 250 jobs. If you
+are super user you can raise the limit in /etc/security/limits.conf
+but you can also use this workaround. The filehandle limit is per
+process. That means that if you just spawn more GNU B<parallel>s then
+each of them can run 250 jobs. This will spawn up to 2500 jobs:
+
+  cat myinput |\
+    parallel --pipe -N 50 --round-robin -j50 parallel -j50 your_prg
+
+This will spawn up to 62500 jobs (use with caution - you need 64 GB
+RAM to do this, and you may need to increase /proc/sys/kernel/pid_max):
+
+  cat myinput |\
+    parallel --pipe -N 250 --round-robin -j250 parallel -j250 your_prg
+
+
+=head2 EXAMPLE: Working as mutex and counting semaphore
+
+The command B<sem> is an alias for B<parallel --semaphore>.
+
+A counting semaphore will allow a given number of jobs to be started
+in the background.  When the number of jobs are running in the
+background, GNU B<sem> will wait for one of these to complete before
+starting another command. B<sem --wait> will wait for all jobs to
+complete.
+
+Run 10 jobs concurrently in the background:
+
+  for i in *.log ; do
+    echo $i
+    sem -j10 gzip $i ";" echo done
+  done
+  sem --wait
+
+A mutex is a counting semaphore allowing only one job to run. This
+will edit the file I<myfile> and prepends the file with lines with the
+numbers 1 to 3.
+
+  seq 3 | parallel sem sed -i -e '1i{}' myfile
+
+As I<myfile> can be very big it is important only one process edits
+the file at the same time.
+
+Name the semaphore to have multiple different semaphores active at the
+same time:
+
+  seq 3 | parallel sem --id mymutex sed -i -e '1i{}' myfile
+
+
+=head2 EXAMPLE: Mutex for a script
+
+Assume a script is called from cron or from a web service, but only
+one instance can be run at a time. With B<sem> and B<--shebang-wrap>
+the script can be made to wait for other instances to finish. Here in
+B<bash>:
+
+  #!/usr/bin/sem --shebang-wrap -u --id $0 --fg /bin/bash
+  
+  echo This will run
+  sleep 5
+  echo exclusively
+
+Here B<perl>:
+
+  #!/usr/bin/sem --shebang-wrap -u --id $0 --fg /usr/bin/perl
+  
+  print "This will run ";
+  sleep 5;
+  print "exclusively\n";
+
+Here B<python>:
+
+  #!/usr/local/bin/sem --shebang-wrap -u --id $0 --fg /usr/bin/python
+  
+  import time
+  print "This will run ";
+  time.sleep(5)
+  print "exclusively";
+
+
+=head2 EXAMPLE: Start editor with filenames from stdin (standard input)
+
+You can use GNU B<parallel> to start interactive programs like emacs or vi:
+
+  cat filelist | parallel --tty -X emacs
+  cat filelist | parallel --tty -X vi
+
+If there are more files than will fit on a single command line, the
+editor will be started again with the remaining files.
+
+
+=head2 EXAMPLE: Running sudo
+
+B<sudo> requires a password to run a command as root. It caches the
+access, so you only need to enter the password again if you have not
+used B<sudo> for a while.
+
+The command:
+
+  parallel sudo echo ::: This is a bad idea
+
+is no good, as you would be prompted for the sudo password for each of
+the jobs. Instead do:
+
+  sudo parallel echo ::: This is a good idea
+
+This way you only have to enter the sudo password once.
+
+=head2 EXAMPLE: Run ping in parallel
+
+B<ping> prints out statistics when killed with CTRL-C.
+
+Unfortunately, CTRL-C will also normally kill GNU B<parallel>.
+
+But by using B<--open-tty> and ignoring SIGINT you can get the wanted effect:
+
+  parallel -j0 --open-tty --lb --tag ping '{= $SIG{INT}=sub {} =}' \
+    ::: 1.1.1.1 8.8.8.8 9.9.9.9 21.21.21.21 80.80.80.80 88.88.88.88
+
+B<--open-tty> will make the B<ping>s receive SIGINT (from CTRL-C).
+CTRL-C will not kill GNU B<parallel>, so that will only exit after
+B<ping> is done.
+
+
+=head2 EXAMPLE: GNU Parallel as queue system/batch manager
+
+GNU B<parallel> can work as a simple job queue system or batch manager.
+The idea is to put the jobs into a file and have GNU B<parallel> read
+from that continuously. As GNU B<parallel> will stop at end of file we
+use B<tail> to continue reading:
+
+  true >jobqueue; tail -n+0 -f jobqueue | parallel
+
+To submit your jobs to the queue:
+
+  echo my_command my_arg >> jobqueue
+
+You can of course use B<-S> to distribute the jobs to remote
+computers:
+
+  true >jobqueue; tail -n+0 -f jobqueue | parallel -S ..
+
+Output only will be printed when reading the next input after a job
+has finished: So you need to submit a job after the first has finished
+to see the output from the first job.
+
+If you keep this running for a long time, jobqueue will grow. A way of
+removing the jobs already run is by making GNU B<parallel> stop when
+it hits a special value and then restart. To use B<--eof> to make GNU
+B<parallel> exit, B<tail> also needs to be forced to exit:
+
+  true >jobqueue;
+  while true; do
+    tail -n+0 -f jobqueue |
+      (parallel -E StOpHeRe -S ..; echo GNU Parallel is now done;
+       perl -e 'while(<>){/StOpHeRe/ and last};print <>' jobqueue > j2;
+       (seq 1000 >> jobqueue &);
+       echo Done appending dummy data forcing tail to exit)
+    echo tail exited;
+    mv j2 jobqueue
+  done
+
+In some cases you can run on more CPUs and computers during the night:
+
+  # Day time
+  echo 50% > jobfile
+  cp day_server_list ~/.parallel/sshloginfile
+  # Night time
+  echo 100% > jobfile
+  cp night_server_list ~/.parallel/sshloginfile
+  tail -n+0 -f jobqueue | parallel --jobs jobfile -S ..
+
+GNU B<parallel> discovers if B<jobfile> or B<~/.parallel/sshloginfile>
+changes.
+
+
+=head2 EXAMPLE: GNU Parallel as dir processor
+
+If you have a dir in which users drop files that needs to be processed
+you can do this on GNU/Linux (If you know what B<inotifywait> is
+called on other platforms file a bug report):
+
+  inotifywait -qmre MOVED_TO -e CLOSE_WRITE --format %w%f my_dir |\
+    parallel -u echo
+
+This will run the command B<echo> on each file put into B<my_dir> or
+subdirs of B<my_dir>.
+
+You can of course use B<-S> to distribute the jobs to remote
+computers:
+
+  inotifywait -qmre MOVED_TO -e CLOSE_WRITE --format %w%f my_dir |\
+    parallel -S ..  -u echo
+
+If the files to be processed are in a tar file then unpacking one file
+and processing it immediately may be faster than first unpacking all
+files. Set up the dir processor as above and unpack into the dir.
+
+Using GNU B<parallel> as dir processor has the same limitations as
+using GNU B<parallel> as queue system/batch manager.
+
+
+=head2 EXAMPLE: Locate the missing package
+
+If you have downloaded source and tried compiling it, you may have seen:
+
+  $ ./configure
+  [...]
+  checking for something.h... no
+  configure: error: "libsomething not found"
+
+Often it is not obvious which package you should install to get that
+file. Debian has `apt-file` to search for a file. `tracefile` from
+https://gitlab.com/ole.tange/tangetools can tell which files a program
+tried to access. In this case we are interested in one of the last
+files:
+
+  $ tracefile -un ./configure | tail | parallel -j0 apt-file search
+
+
+=head1 AUTHOR
+
+When using GNU B<parallel> for a publication please cite:
+
+O. Tange (2011): GNU Parallel - The Command-Line Power Tool, ;login:
+The USENIX Magazine, February 2011:42-47.
+
+This helps funding further development; and it won't cost you a cent.
+If you pay 10000 EUR you should feel free to use GNU Parallel without citing.
+
+Copyright (C) 2007-10-18 Ole Tange, http://ole.tange.dk
+
+Copyright (C) 2008-2010 Ole Tange, http://ole.tange.dk
+
+Copyright (C) 2010-2022 Ole Tange, http://ole.tange.dk and Free
+Software Foundation, Inc.
+
+Parts of the manual concerning B<xargs> compatibility is inspired by
+the manual of B<xargs> from GNU findutils 4.4.2.
+
+
+=head1 LICENSE
+
+This program is free software; you can redistribute it and/or modify
+it under the terms of the GNU General Public License as published by
+the Free Software Foundation; either version 3 of the License, or
+at your option any later version.
+
+This program is distributed in the hope that it will be useful,
+but WITHOUT ANY WARRANTY; without even the implied warranty of
+MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the
+GNU General Public License for more details.
+
+You should have received a copy of the GNU General Public License
+along with this program.  If not, see <https://www.gnu.org/licenses/>.
+
+=head2 Documentation license I
+
+Permission is granted to copy, distribute and/or modify this
+documentation under the terms of the GNU Free Documentation License,
+Version 1.3 or any later version published by the Free Software
+Foundation; with no Invariant Sections, with no Front-Cover Texts, and
+with no Back-Cover Texts.  A copy of the license is included in the
+file LICENSES/GFDL-1.3-or-later.txt.
+
+=head2 Documentation license II
+
+You are free:
+
+=over 9
+
+=item B<to Share>
+
+to copy, distribute and transmit the work
+
+=item B<to Remix>
+
+to adapt the work
+
+=back
+
+Under the following conditions:
+
+=over 9
+
+=item B<Attribution>
+
+You must attribute the work in the manner specified by the author or
+licensor (but not in any way that suggests that they endorse you or
+your use of the work).
+
+=item B<Share Alike>
+
+If you alter, transform, or build upon this work, you may distribute
+the resulting work only under the same, similar or a compatible
+license.
+
+=back
+
+With the understanding that:
+
+=over 9
+
+=item B<Waiver>
+
+Any of the above conditions can be waived if you get permission from
+the copyright holder.
+
+=item B<Public Domain>
+
+Where the work or any of its elements is in the public domain under
+applicable law, that status is in no way affected by the license.
+
+=item B<Other Rights>
+
+In no way are any of the following rights affected by the license:
+
+=over 2
+
+=item *
+
+Your fair dealing or fair use rights, or other applicable
+copyright exceptions and limitations;
+
+=item *
+
+The author's moral rights;
+
+=item *
+
+Rights other persons may have either in the work itself or in
+how the work is used, such as publicity or privacy rights.
+
+=back
+
+=back
+
+=over 9
+
+=item B<Notice>
+
+For any reuse or distribution, you must make clear to others the
+license terms of this work.
+
+=back
+
+A copy of the full license is included in the file as
+LICENCES/CC-BY-SA-4.0.txt
+
+
+=head1 SEE ALSO
+
+B<parallel>(1), B<parallel_tutorial>(7), B<env_parallel>(1),
+B<parset>(1), B<parsort>(1), B<parallel_alternatives>(7),
+B<parallel_design>(7), B<niceload>(1), B<sql>(1), B<ssh>(1),
+B<ssh-agent>(1), B<sshpass>(1), B<ssh-copy-id>(1), B<rsync>(1)
+
+=cut
diff --git a/src/parallel_tutorial.pod b/src/parallel_tutorial.pod
new file mode 100644
index 0000000..51b5e1c
--- /dev/null
+++ b/src/parallel_tutorial.pod
@@ -0,0 +1,3172 @@
+#!/usr/bin/perl -w
+
+# SPDX-FileCopyrightText: 2021-2022 Ole Tange, http://ole.tange.dk and Free Software and Foundation, Inc.
+# SPDX-License-Identifier: GFDL-1.3-or-later
+# SPDX-License-Identifier: CC-BY-SA-4.0
+
+=head1 GNU Parallel Tutorial
+
+This tutorial shows off much of GNU B<parallel>'s functionality. The
+tutorial is meant to learn the options in and syntax of GNU
+B<parallel>.  The tutorial is B<not> to show realistic examples from the
+real world.
+
+=head2 Reader's guide
+
+If you prefer reading a book buy B<GNU Parallel 2018> at
+https://www.lulu.com/shop/ole-tange/gnu-parallel-2018/paperback/product-23558902.html
+or download it at: https://doi.org/10.5281/zenodo.1146014
+
+Otherwise start by watching the intro videos for a quick introduction:
+https://www.youtube.com/playlist?list=PL284C9FF2488BC6D1
+
+Then browse through the B<EXAMPLE>s after the list of B<OPTIONS> in
+B<man parallel> (Use B<LESS=+/EXAMPLE: man parallel>). That will give
+you an idea of what GNU B<parallel> is capable of.
+
+If you want to dive even deeper: spend a couple of hours walking
+through the tutorial (B<man parallel_tutorial>). Your command line
+will love you for it.
+
+Finally you may want to look at the rest of the manual (B<man
+parallel>) if you have special needs not already covered.
+
+If you want to know the design decisions behind GNU B<parallel>, try:
+B<man parallel_design>. This is also a good intro if you intend to
+change GNU B<parallel>.
+
+
+
+=head1 Prerequisites
+
+To run this tutorial you must have the following:
+
+=over 9
+
+=item parallel >= version 20160822
+
+Install the newest version using your package manager (recommended for
+security reasons), the way described in README, or with this command:
+
+  $ (wget -O - pi.dk/3 || lynx -source pi.dk/3 || curl pi.dk/3/ || \
+     fetch -o - http://pi.dk/3 ) > install.sh
+  $ sha1sum install.sh
+  12345678 3374ec53 bacb199b 245af2dd a86df6c9
+  $ md5sum install.sh
+  029a9ac0 6e8b5bc6 052eac57 b2c3c9ca
+  $ sha512sum install.sh
+  40f53af6 9e20dae5 713ba06c f517006d 9897747b ed8a4694 b1acba1b 1464beb4
+  60055629 3f2356f3 3e9c4e3c 76e3f3af a9db4b32 bd33322b 975696fc e6b23cfb
+  $ bash install.sh
+
+This will also install the newest version of the tutorial which you
+can see by running this:
+
+  man parallel_tutorial
+
+Most of the tutorial will work on older versions, too.
+
+
+=item abc-file:
+
+The file can be generated by this command:
+
+  parallel -k echo ::: A B C > abc-file
+
+=item def-file:
+
+The file can be generated by this command:
+
+  parallel -k echo ::: D E F > def-file
+
+=item abc0-file:
+
+The file can be generated by this command:
+
+  perl -e 'printf "A\0B\0C\0"' > abc0-file
+
+=item abc_-file:
+
+The file can be generated by this command:
+
+  perl -e 'printf "A_B_C_"' > abc_-file
+
+=item tsv-file.tsv
+
+The file can be generated by this command:
+
+  perl -e 'printf "f1\tf2\nA\tB\nC\tD\n"' > tsv-file.tsv
+
+=item num8
+
+The file can be generated by this command:
+
+  perl -e 'for(1..8){print "$_\n"}' > num8
+
+=item num128
+
+The file can be generated by this command:
+
+  perl -e 'for(1..128){print "$_\n"}' > num128
+
+=item num30000
+
+The file can be generated by this command:
+
+  perl -e 'for(1..30000){print "$_\n"}' > num30000
+
+=item num1000000
+
+The file can be generated by this command:
+
+  perl -e 'for(1..1000000){print "$_\n"}' > num1000000
+
+=item num_%header
+
+The file can be generated by this command:
+
+  (echo %head1; echo %head2; \
+   perl -e 'for(1..10){print "$_\n"}') > num_%header
+
+=item fixedlen
+
+The file can be generated by this command:
+
+  perl -e 'print "HHHHAAABBBCCC"' > fixedlen
+
+=item For remote running: ssh login on 2 servers with no password in
+$SERVER1 and $SERVER2 must work.
+
+  SERVER1=server.example.com
+  SERVER2=server2.example.net
+
+So you must be able to do this without entering a password:
+
+  ssh $SERVER1 echo works
+  ssh $SERVER2 echo works
+
+It can be setup by running 'ssh-keygen -t dsa; ssh-copy-id $SERVER1'
+and using an empty passphrase, or you can use B<ssh-agent>.
+
+=back
+
+
+=head1 Input sources
+
+GNU B<parallel> reads input from input sources. These can be files, the
+command line, and stdin (standard input or a pipe).
+
+=head2 A single input source
+
+Input can be read from the command line:
+
+  parallel echo ::: A B C
+
+Output (the order may be different because the jobs are run in
+parallel):
+
+  A
+  B
+  C
+
+The input source can be a file:
+
+  parallel -a abc-file echo
+
+Output: Same as above.
+
+STDIN (standard input) can be the input source:
+
+  cat abc-file | parallel echo
+
+Output: Same as above.
+
+
+=head2 Multiple input sources
+
+GNU B<parallel> can take multiple input sources given on the command
+line. GNU B<parallel> then generates all combinations of the input
+sources:
+
+  parallel echo ::: A B C ::: D E F
+
+Output (the order may be different):
+
+  A D
+  A E
+  A F
+  B D
+  B E
+  B F
+  C D
+  C E
+  C F
+
+The input sources can be files:
+
+  parallel -a abc-file -a def-file echo
+
+Output: Same as above.
+
+STDIN (standard input) can be one of the input sources using B<->:
+
+  cat abc-file | parallel -a - -a def-file echo
+
+Output: Same as above.
+
+Instead of B<-a> files can be given after B<::::>:
+
+  cat abc-file | parallel echo :::: - def-file
+
+Output: Same as above.
+
+::: and :::: can be mixed:
+
+  parallel echo ::: A B C :::: def-file
+
+Output: Same as above.
+
+=head3 Linking arguments from input sources
+
+With B<--link> you can link the input sources and get one argument
+from each input source:
+
+  parallel --link echo ::: A B C ::: D E F
+
+Output (the order may be different):
+
+  A D
+  B E
+  C F
+
+If one of the input sources is too short, its values will wrap:
+
+  parallel --link echo ::: A B C D E ::: F G
+
+Output (the order may be different):
+
+  A F
+  B G
+  C F
+  D G
+  E F
+
+For more flexible linking you can use B<:::+> and B<::::+>. They work
+like B<:::> and B<::::> except they link the previous input source to
+this input source.
+
+This will link ABC to GHI:
+
+  parallel echo :::: abc-file :::+ G H I :::: def-file
+
+Output (the order may be different):
+
+  A G D
+  A G E
+  A G F
+  B H D
+  B H E
+  B H F
+  C I D
+  C I E
+  C I F
+
+This will link GHI to DEF:
+
+  parallel echo :::: abc-file ::: G H I ::::+ def-file
+
+Output (the order may be different):
+
+  A G D
+  A H E
+  A I F
+  B G D
+  B H E
+  B I F
+  C G D
+  C H E
+  C I F
+
+If one of the input sources is too short when using B<:::+> or
+B<::::+>, the rest will be ignored:
+
+  parallel echo ::: A B C D E :::+ F G
+
+Output (the order may be different):
+
+  A F
+  B G
+
+
+=head2 Changing the argument separator.
+
+GNU B<parallel> can use other separators than B<:::> or B<::::>. This is
+typically useful if B<:::> or B<::::> is used in the command to run:
+
+  parallel --arg-sep ,, echo ,, A B C :::: def-file
+
+Output (the order may be different):
+
+  A D
+  A E
+  A F
+  B D
+  B E
+  B F
+  C D
+  C E
+  C F
+
+Changing the argument file separator:
+
+  parallel --arg-file-sep // echo ::: A B C // def-file
+
+Output: Same as above.
+
+
+=head2 Changing the argument delimiter
+
+GNU B<parallel> will normally treat a full line as a single argument: It
+uses B<\n> as argument delimiter. This can be changed with B<-d>:
+
+  parallel -d _ echo :::: abc_-file
+
+Output (the order may be different):
+
+  A
+  B
+  C
+
+NUL can be given as B<\0>:
+
+  parallel -d '\0' echo :::: abc0-file
+
+Output: Same as above.
+
+A shorthand for B<-d '\0'> is B<-0> (this will often be used to read files
+from B<find ... -print0>):
+
+  parallel -0 echo :::: abc0-file
+
+Output: Same as above.
+
+=head2 End-of-file value for input source
+
+GNU B<parallel> can stop reading when it encounters a certain value:
+
+  parallel -E stop echo ::: A B stop C D
+
+Output:
+
+  A
+  B
+
+=head2 Skipping empty lines
+
+Using B<--no-run-if-empty> GNU B<parallel> will skip empty lines.
+
+  (echo 1; echo; echo 2) | parallel --no-run-if-empty echo
+
+Output:
+
+  1
+  2
+
+
+=head1 Building the command line
+
+=head2 No command means arguments are commands
+
+If no command is given after parallel the arguments themselves are
+treated as commands:
+
+  parallel ::: ls 'echo foo' pwd
+
+Output (the order may be different):
+
+  [list of files in current dir]
+  foo
+  [/path/to/current/working/dir]
+
+The command can be a script, a binary or a Bash function if the function is
+exported using B<export -f>:
+
+  # Only works in Bash
+  my_func() {
+    echo in my_func $1
+  }
+  export -f my_func
+  parallel my_func ::: 1 2 3
+
+Output (the order may be different):
+
+  in my_func 1
+  in my_func 2
+  in my_func 3
+
+=head2 Replacement strings
+
+=head3 The 7 predefined replacement strings
+
+GNU B<parallel> has several replacement strings. If no replacement
+strings are used the default is to append B<{}>:
+
+  parallel echo ::: A/B.C
+
+Output:
+
+  A/B.C
+
+The default replacement string is B<{}>:
+
+  parallel echo {} ::: A/B.C
+
+Output:
+
+  A/B.C
+
+The replacement string B<{.}> removes the extension:
+
+  parallel echo {.} ::: A/B.C
+
+Output:
+
+  A/B
+
+The replacement string B<{/}> removes the path:
+
+  parallel echo {/} ::: A/B.C
+
+Output:
+
+  B.C
+
+The replacement string B<{//}> keeps only the path:
+
+  parallel echo {//} ::: A/B.C
+
+Output:
+
+  A
+
+The replacement string B<{/.}> removes the path and the extension:
+
+  parallel echo {/.} ::: A/B.C
+
+Output:
+
+  B
+
+The replacement string B<{#}> gives the job number:
+
+  parallel echo {#} ::: A B C
+
+Output (the order may be different):
+
+  1
+  2
+  3
+
+The replacement string B<{%}> gives the job slot number (between 1 and
+number of jobs to run in parallel):
+
+  parallel -j 2 echo {%} ::: A B C
+
+Output (the order may be different and 1 and 2 may be swapped):
+
+  1
+  2
+  1
+
+=head3 Changing the replacement strings
+
+The replacement string B<{}> can be changed with B<-I>:
+
+  parallel -I ,, echo ,, ::: A/B.C
+
+Output:
+
+  A/B.C
+
+The replacement string B<{.}> can be changed with B<--extensionreplace>:
+
+  parallel --extensionreplace ,, echo ,, ::: A/B.C
+
+Output:
+
+  A/B
+
+The replacement string B<{/}> can be replaced with B<--basenamereplace>:
+
+  parallel --basenamereplace ,, echo ,, ::: A/B.C
+
+Output:
+
+  B.C
+
+The replacement string B<{//}> can be changed with B<--dirnamereplace>:
+
+  parallel --dirnamereplace ,, echo ,, ::: A/B.C
+
+Output:
+
+  A
+
+The replacement string B<{/.}> can be changed with B<--basenameextensionreplace>:
+
+  parallel --basenameextensionreplace ,, echo ,, ::: A/B.C
+
+Output:
+
+  B
+
+The replacement string B<{#}> can be changed with B<--seqreplace>:
+
+  parallel --seqreplace ,, echo ,, ::: A B C
+
+Output (the order may be different):
+
+  1
+  2
+  3
+
+The replacement string B<{%}> can be changed with B<--slotreplace>:
+
+  parallel -j2 --slotreplace ,, echo ,, ::: A B C
+
+Output (the order may be different and 1 and 2 may be swapped):
+
+  1
+  2
+  1
+
+=head3 Perl expression replacement string
+
+When predefined replacement strings are not flexible enough a perl
+expression can be used instead. One example is to remove two
+extensions: foo.tar.gz becomes foo
+
+  parallel echo '{= s:\.[^.]+$::;s:\.[^.]+$::; =}' ::: foo.tar.gz
+
+Output:
+
+  foo
+
+In B<{= =}> you can access all of GNU B<parallel>'s internal functions
+and variables. A few are worth mentioning.
+
+B<total_jobs()> returns the total number of jobs:
+
+  parallel echo Job {#} of {= '$_=total_jobs()' =} ::: {1..5}
+
+Output:
+
+  Job 1 of 5
+  Job 2 of 5
+  Job 3 of 5
+  Job 4 of 5
+  Job 5 of 5
+
+B<Q(...)> shell quotes the string:
+
+  parallel echo {} shell quoted is {= '$_=Q($_)' =} ::: '*/!#$'
+
+Output:
+
+  */!#$ shell quoted is \*/\!\#\$
+
+B<skip()> skips the job:
+
+  parallel echo {= 'if($_==3) { skip() }' =} ::: {1..5}
+
+Output:
+
+  1
+  2
+  4
+  5
+
+B<@arg> contains the input source variables:
+
+  parallel echo {= 'if($arg[1]==$arg[2]) { skip() }' =} \
+    ::: {1..3} ::: {1..3}
+
+Output:
+
+  1 2
+  1 3
+  2 1
+  2 3
+  3 1
+  3 2
+
+If the strings B<{=> and B<=}> cause problems they can be replaced with B<--parens>:
+
+  parallel --parens ,,,, echo ',, s:\.[^.]+$::;s:\.[^.]+$::; ,,' \
+    ::: foo.tar.gz
+
+Output:
+
+  foo
+
+To define a shorthand replacement string use B<--rpl>:
+
+  parallel --rpl '.. s:\.[^.]+$::;s:\.[^.]+$::;' echo '..' \
+    ::: foo.tar.gz
+
+Output: Same as above.
+
+If the shorthand starts with B<{> it can be used as a positional
+replacement string, too:
+
+  parallel --rpl '{..} s:\.[^.]+$::;s:\.[^.]+$::;' echo '{..}'
+    ::: foo.tar.gz
+
+Output: Same as above.
+
+If the shorthand contains matching parenthesis the replacement string
+becomes a dynamic replacement string and the string in the parenthesis
+can be accessed as $$1. If there are multiple matching parenthesis,
+the matched strings can be accessed using $$2, $$3 and so on.
+
+You can think of this as giving arguments to the replacement
+string. Here we give the argument B<.tar.gz> to the replacement string
+B<{%I<string>}> which removes I<string>:
+
+  parallel --rpl '{%(.+?)} s/$$1$//;' echo {%.tar.gz}.zip ::: foo.tar.gz
+
+Output:
+
+  foo.zip
+
+Here we give the two arguments B<tar.gz> and B<zip> to the replacement
+string B<{/I<string1>/I<string2>}> which replaces I<string1> with
+I<string2>:
+
+  parallel --rpl '{/(.+?)/(.*?)} s/$$1/$$2/;' echo {/tar.gz/zip} \
+    ::: foo.tar.gz
+
+Output:
+
+  foo.zip
+
+
+GNU B<parallel>'s 7 replacement strings are implemented as this:
+
+  --rpl '{} '
+  --rpl '{#} $_=$job->seq()'
+  --rpl '{%} $_=$job->slot()'
+  --rpl '{/} s:.*/::'
+  --rpl '{//} $Global::use{"File::Basename"} ||=
+           eval "use File::Basename; 1;"; $_ = dirname($_);'
+  --rpl '{/.} s:.*/::; s:\.[^/.]+$::;'
+  --rpl '{.} s:\.[^/.]+$::'
+
+=head3 Positional replacement strings
+
+With multiple input sources the argument from the individual input
+sources can be accessed with S<< B<{>numberB<}> >>:
+
+  parallel echo {1} and {2} ::: A B ::: C D
+
+Output (the order may be different):
+
+  A and C
+  A and D
+  B and C
+  B and D
+
+The positional replacement strings can also be modified using B</>, B<//>, B</.>, and  B<.>:
+
+  parallel echo /={1/} //={1//} /.={1/.} .={1.} ::: A/B.C D/E.F
+
+Output (the order may be different):
+
+  /=B.C //=A /.=B .=A/B
+  /=E.F //=D /.=E .=D/E
+
+If a position is negative, it will refer to the input source counted
+from behind:
+
+  parallel echo 1={1} 2={2} 3={3} -1={-1} -2={-2} -3={-3} \
+    ::: A B ::: C D ::: E F
+
+Output (the order may be different):
+
+  1=A 2=C 3=E -1=E -2=C -3=A
+  1=A 2=C 3=F -1=F -2=C -3=A
+  1=A 2=D 3=E -1=E -2=D -3=A
+  1=A 2=D 3=F -1=F -2=D -3=A
+  1=B 2=C 3=E -1=E -2=C -3=B
+  1=B 2=C 3=F -1=F -2=C -3=B
+  1=B 2=D 3=E -1=E -2=D -3=B
+  1=B 2=D 3=F -1=F -2=D -3=B
+
+
+=head3 Positional perl expression replacement string
+
+To use a perl expression as a positional replacement string simply
+prepend the perl expression with number and space:
+
+  parallel echo '{=2 s:\.[^.]+$::;s:\.[^.]+$::; =} {1}' \
+    ::: bar ::: foo.tar.gz
+
+Output:
+
+  foo bar
+
+If a shorthand defined using B<--rpl> starts with B<{> it can be used as
+a positional replacement string, too:
+
+  parallel --rpl '{..} s:\.[^.]+$::;s:\.[^.]+$::;' echo '{2..} {1}' \
+    ::: bar ::: foo.tar.gz
+
+Output: Same as above.
+
+
+=head3 Input from columns
+
+The columns in a file can be bound to positional replacement strings
+using B<--colsep>. Here the columns are separated by TAB (\t):
+
+  parallel --colsep '\t' echo 1={1} 2={2} :::: tsv-file.tsv
+
+Output (the order may be different):
+
+  1=f1 2=f2
+  1=A 2=B
+  1=C 2=D
+
+=head3 Header defined replacement strings
+
+With B<--header> GNU B<parallel> will use the first value of the input
+source as the name of the replacement string. Only the non-modified
+version B<{}> is supported:
+
+  parallel --header : echo f1={f1} f2={f2} ::: f1 A B ::: f2 C D
+
+Output (the order may be different):
+
+  f1=A f2=C
+  f1=A f2=D
+  f1=B f2=C
+  f1=B f2=D
+
+It is useful with B<--colsep> for processing files with TAB separated values:
+
+  parallel --header : --colsep '\t' echo f1={f1} f2={f2} \
+    :::: tsv-file.tsv
+
+Output (the order may be different):
+
+  f1=A f2=B
+  f1=C f2=D
+
+=head3 More pre-defined replacement strings with --plus
+
+B<--plus> adds the replacement strings B<{+/} {+.} {+..} {+...} {..}  {...}
+{/..} {/...} {##}>. The idea being that B<{+foo}> matches the opposite of B<{foo}>
+and B<{}> = B<{+/}>/B<{/}> = B<{.}>.B<{+.}> = B<{+/}>/B<{/.}>.B<{+.}> = B<{..}>.B<{+..}> =
+B<{+/}>/B<{/..}>.B<{+..}> = B<{...}>.B<{+...}> = B<{+/}>/B<{/...}>.B<{+...}>.
+
+  parallel --plus echo {} ::: dir/sub/file.ex1.ex2.ex3
+  parallel --plus echo {+/}/{/} ::: dir/sub/file.ex1.ex2.ex3
+  parallel --plus echo {.}.{+.} ::: dir/sub/file.ex1.ex2.ex3
+  parallel --plus echo {+/}/{/.}.{+.} ::: dir/sub/file.ex1.ex2.ex3
+  parallel --plus echo {..}.{+..} ::: dir/sub/file.ex1.ex2.ex3
+  parallel --plus echo {+/}/{/..}.{+..} ::: dir/sub/file.ex1.ex2.ex3
+  parallel --plus echo {...}.{+...} ::: dir/sub/file.ex1.ex2.ex3
+  parallel --plus echo {+/}/{/...}.{+...} ::: dir/sub/file.ex1.ex2.ex3
+
+Output:
+
+  dir/sub/file.ex1.ex2.ex3
+
+B<{##}> is simply the number of jobs:
+
+  parallel --plus echo Job {#} of {##} ::: {1..5}
+
+Output:
+
+  Job 1 of 5
+  Job 2 of 5
+  Job 3 of 5
+  Job 4 of 5
+  Job 5 of 5
+
+=head3 Dynamic replacement strings with --plus
+
+B<--plus> also defines these dynamic replacement strings:
+
+=over 19
+
+=item B<{:-I<string>}>
+
+Default value is I<string> if the argument is empty.
+
+=item B<{:I<number>}>
+
+Substring from I<number> till end of string.
+
+=item B<{:I<number1>:I<number2>}>
+
+Substring from I<number1> to I<number2>.
+
+=item B<{#I<string>}>
+
+If the argument starts with I<string>, remove it.
+
+=item B<{%I<string>}>
+
+If the argument ends with I<string>, remove it.
+
+=item B<{/I<string1>/I<string2>}>
+
+Replace I<string1> with I<string2>.
+
+=item B<{^I<string>}>
+
+If the argument starts with I<string>, upper case it. I<string> must
+be a single letter.
+
+=item B<{^^I<string>}>
+
+If the argument contains I<string>, upper case it. I<string> must be a
+single letter.
+
+=item B<{,I<string>}>
+
+If the argument starts with I<string>, lower case it. I<string> must
+be a single letter.
+
+=item B<{,,I<string>}>
+
+If the argument contains I<string>, lower case it. I<string> must be a
+single letter.
+
+=back
+
+They are inspired from B<Bash>:
+
+  unset myvar
+  echo ${myvar:-myval}
+  parallel --plus echo {:-myval} ::: "$myvar"
+
+  myvar=abcAaAdef
+  echo ${myvar:2}
+  parallel --plus echo {:2} ::: "$myvar"
+
+  echo ${myvar:2:3}
+  parallel --plus echo {:2:3} ::: "$myvar"
+
+  echo ${myvar#bc}
+  parallel --plus echo {#bc} ::: "$myvar"
+  echo ${myvar#abc}
+  parallel --plus echo {#abc} ::: "$myvar"
+
+  echo ${myvar%de}
+  parallel --plus echo {%de} ::: "$myvar"
+  echo ${myvar%def}
+  parallel --plus echo {%def} ::: "$myvar"
+
+  echo ${myvar/def/ghi}
+  parallel --plus echo {/def/ghi} ::: "$myvar"
+
+  echo ${myvar^a}
+  parallel --plus echo {^a} ::: "$myvar"
+  echo ${myvar^^a}
+  parallel --plus echo {^^a} ::: "$myvar"
+
+  myvar=AbcAaAdef
+  echo ${myvar,A}
+  parallel --plus echo '{,A}' ::: "$myvar"
+  echo ${myvar,,A}
+  parallel --plus echo '{,,A}' ::: "$myvar"
+
+Output:
+
+  myval
+  myval
+  cAaAdef
+  cAaAdef
+  cAa
+  cAa
+  abcAaAdef
+  abcAaAdef
+  AaAdef
+  AaAdef
+  abcAaAdef
+  abcAaAdef
+  abcAaA
+  abcAaA
+  abcAaAghi
+  abcAaAghi
+  AbcAaAdef
+  AbcAaAdef
+  AbcAAAdef
+  AbcAAAdef
+  abcAaAdef
+  abcAaAdef
+  abcaaadef
+  abcaaadef
+
+
+=head2 More than one argument
+
+With B<--xargs> GNU B<parallel> will fit as many arguments as possible on a
+single line:
+
+  cat num30000 | parallel --xargs echo | wc -l
+
+Output (if you run this under Bash on GNU/Linux):
+
+  2
+
+The 30000 arguments fitted on 2 lines.
+
+The maximal length of a single line can be set with B<-s>. With a maximal
+line length of 10000 chars 17 commands will be run:
+
+  cat num30000 | parallel --xargs -s 10000 echo | wc -l
+
+Output:
+
+  17
+
+For better parallelism GNU B<parallel> can distribute the arguments
+between all the parallel jobs when end of file is met.
+
+Below GNU B<parallel> reads the last argument when generating the second
+job. When GNU B<parallel> reads the last argument, it spreads all the
+arguments for the second job over 4 jobs instead, as 4 parallel jobs
+are requested.
+
+The first job will be the same as the B<--xargs> example above, but the
+second job will be split into 4 evenly sized jobs, resulting in a
+total of 5 jobs:
+
+  cat num30000 | parallel --jobs 4 -m echo | wc -l
+
+Output (if you run this under Bash on GNU/Linux):
+
+  5
+
+This is even more visible when running 4 jobs with 10 arguments. The
+10 arguments are being spread over 4 jobs:
+
+  parallel --jobs 4 -m echo ::: 1 2 3 4 5 6 7 8 9 10
+
+Output:
+
+  1 2 3
+  4 5 6
+  7 8 9
+  10
+
+A replacement string can be part of a word. B<-m> will not repeat the context:
+
+  parallel --jobs 4 -m echo pre-{}-post ::: A B C D E F G
+
+Output (the order may be different):
+
+  pre-A B-post
+  pre-C D-post
+  pre-E F-post
+  pre-G-post
+
+To repeat the context use B<-X> which otherwise works like B<-m>:
+
+  parallel --jobs 4 -X echo pre-{}-post ::: A B C D E F G
+
+Output (the order may be different):
+
+  pre-A-post pre-B-post
+  pre-C-post pre-D-post
+  pre-E-post pre-F-post
+  pre-G-post
+
+To limit the number of arguments use B<-N>:
+
+  parallel -N3 echo ::: A B C D E F G H
+
+Output (the order may be different):
+
+  A B C
+  D E F
+  G H
+
+B<-N> also sets the positional replacement strings:
+
+  parallel -N3 echo 1={1} 2={2} 3={3} ::: A B C D E F G H
+
+Output (the order may be different):
+
+  1=A 2=B 3=C
+  1=D 2=E 3=F
+  1=G 2=H 3=
+
+B<-N0> reads 1 argument but inserts none:
+
+  parallel -N0 echo foo ::: 1 2 3
+
+Output:
+
+  foo
+  foo
+  foo
+
+=head2 Quoting
+
+Command lines that contain special characters may need to be protected from the shell.
+
+The B<perl> program B<print "@ARGV\n"> basically works like B<echo>.
+
+  perl -e 'print "@ARGV\n"' A
+
+Output:
+
+  A
+
+To run that in parallel the command needs to be quoted:
+
+  parallel perl -e 'print "@ARGV\n"' ::: This wont work
+
+Output:
+
+  [Nothing]
+
+To quote the command use B<-q>:
+
+  parallel -q perl -e 'print "@ARGV\n"' ::: This works
+
+Output (the order may be different):
+
+  This
+  works
+
+Or you can quote the critical part using B<\'>:
+
+  parallel perl -e \''print "@ARGV\n"'\' ::: This works, too
+
+Output (the order may be different):
+
+  This
+  works,
+  too
+
+GNU B<parallel> can also \-quote full lines. Simply run this:
+
+  parallel --shellquote
+  Warning: Input is read from the terminal. You either know what you
+  Warning: are doing (in which case: YOU ARE AWESOME!) or you forgot
+  Warning: ::: or :::: or to pipe data into parallel. If so
+  Warning: consider going through the tutorial: man parallel_tutorial
+  Warning: Press CTRL-D to exit.
+  perl -e 'print "@ARGV\n"'
+  [CTRL-D]
+
+Output:
+
+  perl\ -e\ \'print\ \"@ARGV\\n\"\'
+
+This can then be used as the command:
+
+  parallel perl\ -e\ \'print\ \"@ARGV\\n\"\' ::: This also works
+
+Output (the order may be different):
+
+  This
+  also
+  works
+
+
+=head2 Trimming space
+
+Space can be trimmed on the arguments using B<--trim>:
+
+  parallel --trim r echo pre-{}-post ::: ' A '
+
+Output:
+
+  pre- A-post
+
+To trim on the left side:
+
+  parallel --trim l echo pre-{}-post ::: ' A '
+
+Output:
+
+  pre-A -post
+
+To trim on the both sides:
+
+  parallel --trim lr echo pre-{}-post ::: ' A '
+
+Output:
+
+  pre-A-post
+
+
+=head2 Respecting the shell
+
+This tutorial uses Bash as the shell. GNU B<parallel> respects which
+shell you are using, so in B<zsh> you can do:
+
+  parallel echo \={} ::: zsh bash ls
+
+Output:
+
+  /usr/bin/zsh
+  /bin/bash
+  /bin/ls
+
+In B<csh> you can do:
+
+  parallel 'set a="{}"; if( { test -d "$a" } ) echo "$a is a dir"' ::: *
+
+Output:
+
+  [somedir] is a dir
+
+This also becomes useful if you use GNU B<parallel> in a shell script:
+GNU B<parallel> will use the same shell as the shell script.
+
+
+=head1 Controlling the output
+
+The output can prefixed with the argument:
+
+  parallel --tag echo foo-{} ::: A B C
+
+Output (the order may be different):
+
+  A       foo-A
+  B       foo-B
+  C       foo-C
+
+To prefix it with another string use B<--tagstring>:
+
+  parallel --tagstring {}-bar echo foo-{} ::: A B C
+
+Output (the order may be different):
+
+  A-bar   foo-A
+  B-bar   foo-B
+  C-bar   foo-C
+
+To see what commands will be run without running them use B<--dryrun>:
+
+  parallel --dryrun echo {} ::: A B C
+
+Output (the order may be different):
+
+  echo A
+  echo B
+  echo C
+
+To print the command before running them use B<--verbose>:
+
+  parallel --verbose echo {} ::: A B C
+
+Output (the order may be different):
+
+  echo A
+  echo B
+  A
+  echo C
+  B
+  C
+
+GNU B<parallel> will postpone the output until the command completes:
+
+  parallel -j2 'printf "%s-start\n%s" {} {};
+    sleep {};printf "%s\n" -middle;echo {}-end' ::: 4 2 1
+
+Output:
+
+  2-start
+  2-middle
+  2-end
+  1-start
+  1-middle
+  1-end
+  4-start
+  4-middle
+  4-end
+
+To get the output immediately use B<--ungroup>:
+
+  parallel -j2 --ungroup 'printf "%s-start\n%s" {} {};
+    sleep {};printf "%s\n" -middle;echo {}-end' ::: 4 2 1
+
+Output:
+
+  4-start
+  42-start
+  2-middle
+  2-end
+  1-start
+  1-middle
+  1-end
+  -middle
+  4-end
+
+B<--ungroup> is fast, but can cause half a line from one job to be mixed
+with half a line of another job. That has happened in the second line,
+where the line '4-middle' is mixed with '2-start'.
+
+To avoid this use B<--linebuffer>:
+
+  parallel -j2 --linebuffer 'printf "%s-start\n%s" {} {};
+    sleep {};printf "%s\n" -middle;echo {}-end' ::: 4 2 1
+
+Output:
+
+  4-start
+  2-start
+  2-middle
+  2-end
+  1-start
+  1-middle
+  1-end
+  4-middle
+  4-end
+
+To force the output in the same order as the arguments use B<--keep-order>/B<-k>:
+
+  parallel -j2 -k 'printf "%s-start\n%s" {} {};
+    sleep {};printf "%s\n" -middle;echo {}-end' ::: 4 2 1
+
+Output:
+
+  4-start
+  4-middle
+  4-end
+  2-start
+  2-middle
+  2-end
+  1-start
+  1-middle
+  1-end
+
+
+=head2 Saving output into files
+
+GNU B<parallel> can save the output of each job into files:
+
+  parallel --files echo ::: A B C
+
+Output will be similar to this:
+
+  /tmp/pAh6uWuQCg.par
+  /tmp/opjhZCzAX4.par
+  /tmp/W0AT_Rph2o.par
+
+By default GNU B<parallel> will cache the output in files in B</tmp>. This
+can be changed by setting B<$TMPDIR> or B<--tmpdir>:
+
+  parallel --tmpdir /var/tmp --files echo ::: A B C
+
+Output will be similar to this:
+
+  /var/tmp/N_vk7phQRc.par
+  /var/tmp/7zA4Ccf3wZ.par
+  /var/tmp/LIuKgF_2LP.par
+
+Or:
+
+  TMPDIR=/var/tmp parallel --files echo ::: A B C
+
+Output: Same as above.
+
+The output files can be saved in a structured way using B<--results>:
+
+  parallel --results outdir echo ::: A B C
+
+Output:
+
+  A
+  B
+  C
+
+These files were also generated containing the standard output
+(stdout), standard error (stderr), and the sequence number (seq):
+
+  outdir/1/A/seq
+  outdir/1/A/stderr
+  outdir/1/A/stdout
+  outdir/1/B/seq
+  outdir/1/B/stderr
+  outdir/1/B/stdout
+  outdir/1/C/seq
+  outdir/1/C/stderr
+  outdir/1/C/stdout
+
+B<--header :> will take the first value as name and use that in the
+directory structure. This is useful if you are using multiple input
+sources:
+
+  parallel --header : --results outdir echo ::: f1 A B ::: f2 C D
+
+Generated files:
+
+  outdir/f1/A/f2/C/seq
+  outdir/f1/A/f2/C/stderr
+  outdir/f1/A/f2/C/stdout
+  outdir/f1/A/f2/D/seq
+  outdir/f1/A/f2/D/stderr
+  outdir/f1/A/f2/D/stdout
+  outdir/f1/B/f2/C/seq
+  outdir/f1/B/f2/C/stderr
+  outdir/f1/B/f2/C/stdout
+  outdir/f1/B/f2/D/seq
+  outdir/f1/B/f2/D/stderr
+  outdir/f1/B/f2/D/stdout
+
+The directories are named after the variables and their values.
+
+=head1 Controlling the execution
+
+=head2 Number of simultaneous jobs
+
+The number of concurrent jobs is given with B<--jobs>/B<-j>:
+
+  /usr/bin/time parallel -N0 -j64 sleep 1 :::: num128
+
+With 64 jobs in parallel the 128 B<sleep>s will take 2-8 seconds to run -
+depending on how fast your machine is.
+
+By default B<--jobs> is the same as the number of CPU cores. So this:
+
+  /usr/bin/time parallel -N0 sleep 1 :::: num128
+
+should take twice the time of running 2 jobs per CPU core:
+
+  /usr/bin/time parallel -N0 --jobs 200% sleep 1 :::: num128
+
+B<--jobs 0> will run as many jobs in parallel as possible:
+
+  /usr/bin/time parallel -N0 --jobs 0 sleep 1 :::: num128
+
+which should take 1-7 seconds depending on how fast your machine is.
+
+B<--jobs> can read from a file which is re-read when a job finishes:
+
+  echo 50% > my_jobs
+  /usr/bin/time parallel -N0 --jobs my_jobs sleep 1 :::: num128 &
+  sleep 1
+  echo 0 > my_jobs
+  wait
+
+The first second only 50% of the CPU cores will run a job. Then B<0> is
+put into B<my_jobs> and then the rest of the jobs will be started in
+parallel.
+
+Instead of basing the percentage on the number of CPU cores
+GNU B<parallel> can base it on the number of CPUs:
+
+  parallel --use-cpus-instead-of-cores -N0 sleep 1 :::: num8
+
+=head2 Shuffle job order
+
+If you have many jobs (e.g. by multiple combinations of input
+sources), it can be handy to shuffle the jobs, so you get different
+values run. Use B<--shuf> for that:
+
+  parallel --shuf echo ::: 1 2 3 ::: a b c ::: A B C
+
+Output:
+
+  All combinations but different order for each run.
+
+=head2 Interactivity
+
+GNU B<parallel> can ask the user if a command should be run using B<--interactive>:
+
+  parallel --interactive echo ::: 1 2 3
+
+Output:
+
+  echo 1 ?...y
+  echo 2 ?...n
+  1
+  echo 3 ?...y
+  3
+
+GNU B<parallel> can be used to put arguments on the command line for an
+interactive command such as B<emacs> to edit one file at a time:
+
+  parallel --tty emacs ::: 1 2 3
+
+Or give multiple argument in one go to open multiple files:
+
+  parallel -X --tty vi ::: 1 2 3
+
+=head2 A terminal for every job
+
+Using B<--tmux> GNU B<parallel> can start a terminal for every job run:
+
+  seq 10 20 | parallel --tmux 'echo start {}; sleep {}; echo done {}'
+
+This will tell you to run something similar to:
+
+  tmux -S /tmp/tmsrPrO0 attach
+
+Using normal B<tmux> keystrokes (CTRL-b n or CTRL-b p) you can cycle
+between windows of the running jobs. When a job is finished it will
+pause for 10 seconds before closing the window.
+
+=head2 Timing
+
+Some jobs do heavy I/O when they start. To avoid a thundering herd GNU
+B<parallel> can delay starting new jobs. B<--delay> I<X> will make
+sure there is at least I<X> seconds between each start:
+
+  parallel --delay 2.5 echo Starting {}\;date ::: 1 2 3
+
+Output:
+
+  Starting 1
+  Thu Aug 15 16:24:33 CEST 2013
+  Starting 2
+  Thu Aug 15 16:24:35 CEST 2013
+  Starting 3
+  Thu Aug 15 16:24:38 CEST 2013
+
+
+If jobs taking more than a certain amount of time are known to fail,
+they can be stopped with B<--timeout>. The accuracy of B<--timeout> is
+2 seconds:
+
+  parallel --timeout 4.1 sleep {}\; echo {} ::: 2 4 6 8
+
+Output:
+
+  2
+  4
+
+GNU B<parallel> can compute the median runtime for jobs and kill those
+that take more than 200% of the median runtime:
+
+  parallel --timeout 200% sleep {}\; echo {} ::: 2.1 2.2 3 7 2.3
+
+Output:
+
+  2.1
+  2.2
+  3
+  2.3
+
+=head2 Progress information
+
+Based on the runtime of completed jobs GNU B<parallel> can estimate the
+total runtime:
+
+  parallel --eta sleep ::: 1 3 2 2 1 3 3 2 1
+
+Output:
+
+  Computers / CPU cores / Max jobs to run
+  1:local / 2 / 2
+
+  Computer:jobs running/jobs completed/%of started jobs/
+    Average seconds to complete
+  ETA: 2s 0left 1.11avg  local:0/9/100%/1.1s
+
+GNU B<parallel> can give progress information with B<--progress>:
+
+  parallel --progress sleep ::: 1 3 2 2 1 3 3 2 1
+
+Output:
+
+  Computers / CPU cores / Max jobs to run
+  1:local / 2 / 2
+
+  Computer:jobs running/jobs completed/%of started jobs/
+    Average seconds to complete
+  local:0/9/100%/1.1s
+
+A progress bar can be shown with B<--bar>:
+
+  parallel --bar sleep ::: 1 3 2 2 1 3 3 2 1
+
+And a graphic bar can be shown with B<--bar> and B<zenity>:
+
+  seq 1000 | parallel -j10 --bar '(echo -n {};sleep 0.1)' \
+    2> >(perl -pe 'BEGIN{$/="\r";$|=1};s/\r/\n/g' |
+         zenity --progress --auto-kill --auto-close)
+
+A logfile of the jobs completed so far can be generated with B<--joblog>:
+
+  parallel --joblog /tmp/log exit  ::: 1 2 3 0
+  cat /tmp/log
+
+Output:
+
+  Seq Host Starttime      Runtime Send Receive Exitval Signal Command
+  1   :    1376577364.974 0.008   0    0       1       0      exit 1
+  2   :    1376577364.982 0.013   0    0       2       0      exit 2
+  3   :    1376577364.990 0.013   0    0       3       0      exit 3
+  4   :    1376577365.003 0.003   0    0       0       0      exit 0
+
+The log contains the job sequence, which host the job was run on, the
+start time and run time, how much data was transferred, the exit
+value, the signal that killed the job, and finally the command being
+run.
+
+With a joblog GNU B<parallel> can be stopped and later pickup where it
+left off. It it important that the input of the completed jobs is
+unchanged.
+
+  parallel --joblog /tmp/log exit  ::: 1 2 3 0
+  cat /tmp/log
+  parallel --resume --joblog /tmp/log exit  ::: 1 2 3 0 0 0
+  cat /tmp/log
+
+Output:
+
+  Seq Host Starttime      Runtime Send Receive Exitval Signal Command
+  1   :    1376580069.544 0.008   0    0       1       0      exit 1
+  2   :    1376580069.552 0.009   0    0       2       0      exit 2
+  3   :    1376580069.560 0.012   0    0       3       0      exit 3
+  4   :    1376580069.571 0.005   0    0       0       0      exit 0
+
+  Seq Host Starttime      Runtime Send Receive Exitval Signal Command
+  1   :    1376580069.544 0.008   0    0       1       0      exit 1
+  2   :    1376580069.552 0.009   0    0       2       0      exit 2
+  3   :    1376580069.560 0.012   0    0       3       0      exit 3
+  4   :    1376580069.571 0.005   0    0       0       0      exit 0
+  5   :    1376580070.028 0.009   0    0       0       0      exit 0
+  6   :    1376580070.038 0.007   0    0       0       0      exit 0
+
+Note how the start time of the last 2 jobs is clearly different from the second run.
+
+With B<--resume-failed> GNU B<parallel> will re-run the jobs that failed:
+
+  parallel --resume-failed --joblog /tmp/log exit  ::: 1 2 3 0 0 0
+  cat /tmp/log
+
+Output:
+
+  Seq Host Starttime      Runtime Send Receive Exitval Signal Command
+  1   :    1376580069.544 0.008   0    0       1       0      exit 1
+  2   :    1376580069.552 0.009   0    0       2       0      exit 2
+  3   :    1376580069.560 0.012   0    0       3       0      exit 3
+  4   :    1376580069.571 0.005   0    0       0       0      exit 0
+  5   :    1376580070.028 0.009   0    0       0       0      exit 0
+  6   :    1376580070.038 0.007   0    0       0       0      exit 0
+  1   :    1376580154.433 0.010   0    0       1       0      exit 1
+  2   :    1376580154.444 0.022   0    0       2       0      exit 2
+  3   :    1376580154.466 0.005   0    0       3       0      exit 3
+
+Note how seq 1 2 3 have been repeated because they had exit value
+different from 0.
+
+B<--retry-failed> does almost the same as B<--resume-failed>. Where
+B<--resume-failed> reads the commands from the command line (and
+ignores the commands in the joblog), B<--retry-failed> ignores the
+command line and reruns the commands mentioned in the joblog.
+
+  parallel --retry-failed --joblog /tmp/log
+  cat /tmp/log
+
+Output:
+
+  Seq Host Starttime      Runtime Send Receive Exitval Signal Command
+  1   :    1376580069.544 0.008   0    0       1       0      exit 1
+  2   :    1376580069.552 0.009   0    0       2       0      exit 2
+  3   :    1376580069.560 0.012   0    0       3       0      exit 3
+  4   :    1376580069.571 0.005   0    0       0       0      exit 0
+  5   :    1376580070.028 0.009   0    0       0       0      exit 0
+  6   :    1376580070.038 0.007   0    0       0       0      exit 0
+  1   :    1376580154.433 0.010   0    0       1       0      exit 1
+  2   :    1376580154.444 0.022   0    0       2       0      exit 2
+  3   :    1376580154.466 0.005   0    0       3       0      exit 3
+  1   :    1376580164.633 0.010   0    0       1       0      exit 1
+  2   :    1376580164.644 0.022   0    0       2       0      exit 2
+  3   :    1376580164.666 0.005   0    0       3       0      exit 3
+
+
+=head2 Termination
+
+=head3 Unconditional termination
+
+By default GNU B<parallel> will wait for all jobs to finish before exiting.
+
+If you send GNU B<parallel> the B<TERM> signal, GNU B<parallel> will
+stop spawning new jobs and wait for the remaining jobs to finish. If
+you send GNU B<parallel> the B<TERM> signal again, GNU B<parallel>
+will kill all running jobs and exit.
+
+=head3 Termination dependent on job status
+
+For certain jobs there is no need to continue if one of the jobs fails
+and has an exit code different from 0. GNU B<parallel> will stop spawning new jobs
+with B<--halt soon,fail=1>:
+
+  parallel -j2 --halt soon,fail=1 echo {}\; exit {} ::: 0 0 1 2 3
+
+Output:
+
+  0
+  0
+  1
+  parallel: This job failed:
+  echo 1; exit 1
+  parallel: Starting no more jobs. Waiting for 1 jobs to finish.
+  2
+
+With B<--halt now,fail=1> the running jobs will be killed immediately:
+
+  parallel -j2 --halt now,fail=1 echo {}\; exit {} ::: 0 0 1 2 3
+
+Output:
+
+  0
+  0
+  1
+  parallel: This job failed:
+  echo 1; exit 1
+
+If B<--halt> is given a percentage this percentage of the jobs must fail
+before GNU B<parallel> stops spawning more jobs:
+
+  parallel -j2 --halt soon,fail=20% echo {}\; exit {} \
+    ::: 0 1 2 3 4 5 6 7 8 9
+
+Output:
+
+  0
+  1
+  parallel: This job failed:
+  echo 1; exit 1
+  2
+  parallel: This job failed:
+  echo 2; exit 2
+  parallel: Starting no more jobs. Waiting for 1 jobs to finish.
+  3
+  parallel: This job failed:
+  echo 3; exit 3
+
+If you are looking for success instead of failures, you can use
+B<success>. This will finish as soon as the first job succeeds:
+
+  parallel -j2 --halt now,success=1 echo {}\; exit {} ::: 1 2 3 0 4 5 6
+
+Output:
+
+  1
+  2
+  3
+  0
+  parallel: This job succeeded:
+  echo 0; exit 0
+
+GNU B<parallel> can retry the command with B<--retries>. This is useful if a
+command fails for unknown reasons now and then.
+
+  parallel -k --retries 3 \
+    'echo tried {} >>/tmp/runs; echo completed {}; exit {}' ::: 1 2 0
+  cat /tmp/runs
+
+Output:
+
+  completed 1
+  completed 2
+  completed 0
+
+  tried 1
+  tried 2
+  tried 1
+  tried 2
+  tried 1
+  tried 2
+  tried 0
+
+Note how job 1 and 2 were tried 3 times, but 0 was not retried because it had exit code 0.
+
+=head3 Termination signals (advanced)
+
+Using B<--termseq> you can control which signals are sent when killing
+children. Normally children will be killed by sending them B<SIGTERM>,
+waiting 200 ms, then another B<SIGTERM>, waiting 100 ms, then another
+B<SIGTERM>, waiting 50 ms, then a B<SIGKILL>, finally waiting 25 ms
+before giving up. It looks like this:
+
+  show_signals() {
+    perl -e 'for(keys %SIG) {
+        $SIG{$_} = eval "sub { print \"Got $_\\n\"; }";
+      }
+      while(1){sleep 1}'
+  }
+  export -f show_signals
+  echo | parallel --termseq TERM,200,TERM,100,TERM,50,KILL,25 \
+    -u --timeout 1 show_signals
+
+Output:
+
+  Got TERM
+  Got TERM
+  Got TERM
+
+Or just:
+
+  echo | parallel -u --timeout 1 show_signals
+
+Output: Same as above.
+
+You can change this to B<SIGINT>, B<SIGTERM>, B<SIGKILL>:
+
+  echo | parallel --termseq INT,200,TERM,100,KILL,25 \
+    -u --timeout 1 show_signals
+
+Output:
+
+  Got INT
+  Got TERM
+
+The B<SIGKILL> does not show because it cannot be caught, and thus the
+child dies.
+
+
+=head2 Limiting the resources
+
+To avoid overloading systems GNU B<parallel> can look at the system load
+before starting another job:
+
+  parallel --load 100% echo load is less than {} job per cpu ::: 1
+
+Output:
+
+  [when then load is less than the number of cpu cores]
+  load is less than 1 job per cpu
+
+GNU B<parallel> can also check if the system is swapping.
+
+  parallel --noswap echo the system is not swapping ::: now
+
+Output:
+
+  [when then system is not swapping]
+  the system is not swapping now
+
+Some jobs need a lot of memory, and should only be started when there
+is enough memory free. Using B<--memfree> GNU B<parallel> can check if
+there is enough memory free. Additionally, GNU B<parallel> will kill
+off the youngest job if the memory free falls below 50% of the
+size. The killed job will put back on the queue and retried later.
+
+  parallel --memfree 1G echo will run if more than 1 GB is ::: free
+
+GNU B<parallel> can run the jobs with a nice value. This will work both
+locally and remotely.
+
+  parallel --nice 17 echo this is being run with nice -n ::: 17
+
+Output:
+
+  this is being run with nice -n 17
+
+=head1 Remote execution
+
+GNU B<parallel> can run jobs on remote servers. It uses B<ssh> to
+communicate with the remote machines.
+
+=head2 Sshlogin
+
+The most basic sshlogin is B<-S> I<host>:
+
+  parallel -S $SERVER1 echo running on ::: $SERVER1
+
+Output:
+
+  running on [$SERVER1]
+
+To use a different username prepend the server with I<username@>:
+
+  parallel -S username@$SERVER1 echo running on ::: username@$SERVER1
+
+Output:
+
+  running on [username@$SERVER1]
+
+The special sshlogin B<:> is the local machine:
+
+  parallel -S : echo running on ::: the_local_machine
+
+Output:
+
+  running on the_local_machine
+
+If B<ssh> is not in $PATH it can be prepended to $SERVER1:
+
+  parallel -S '/usr/bin/ssh '$SERVER1 echo custom ::: ssh
+
+Output:
+
+  custom ssh
+
+The B<ssh> command can also be given using B<--ssh>:
+
+  parallel --ssh /usr/bin/ssh -S $SERVER1 echo custom ::: ssh
+
+or by setting B<$PARALLEL_SSH>:
+
+  export PARALLEL_SSH=/usr/bin/ssh
+  parallel -S $SERVER1 echo custom ::: ssh
+
+Several servers can be given using multiple B<-S>:
+
+  parallel -S $SERVER1 -S $SERVER2 echo ::: running on more hosts
+
+Output (the order may be different):
+
+  running
+  on
+  more
+  hosts
+
+Or they can be separated by B<,>:
+
+  parallel -S $SERVER1,$SERVER2 echo ::: running on more hosts
+
+Output: Same as above.
+
+Or newline:
+
+  # This gives a \n between $SERVER1 and $SERVER2
+  SERVERS="`echo $SERVER1; echo $SERVER2`"
+  parallel -S "$SERVERS" echo ::: running on more hosts
+
+They can also be read from a file (replace I<user@> with the user on B<$SERVER2>):
+
+  echo $SERVER1 > nodefile
+  # Force 4 cores, special ssh-command, username
+  echo 4//usr/bin/ssh user@$SERVER2 >> nodefile
+  parallel --sshloginfile nodefile echo ::: running on more hosts
+
+Output: Same as above.
+
+Every time a job finished, the B<--sshloginfile> will be re-read, so
+it is possible to both add and remove hosts while running.
+
+The special B<--sshloginfile ..> reads from B<~/.parallel/sshloginfile>.
+
+To force GNU B<parallel> to treat a server having a given number of CPU
+cores prepend the number of core followed by B</> to the sshlogin:
+
+  parallel -S 4/$SERVER1 echo force {} cpus on server ::: 4
+
+Output:
+
+  force 4 cpus on server
+
+Servers can be put into groups by prepending I<@groupname> to the
+server and the group can then be selected by appending I<@groupname> to
+the argument if using B<--hostgroup>:
+
+  parallel --hostgroup -S @grp1/$SERVER1 -S @grp2/$SERVER2 echo {} \
+    ::: run_on_grp1@grp1 run_on_grp2@grp2
+
+Output:
+
+  run_on_grp1
+  run_on_grp2
+
+A host can be in multiple groups by separating the groups with B<+>, and
+you can force GNU B<parallel> to limit the groups on which the command
+can be run with B<-S> I<@groupname>:
+
+  parallel -S @grp1 -S @grp1+grp2/$SERVER1 -S @grp2/SERVER2 echo {} \
+    ::: run_on_grp1 also_grp1
+
+Output:
+
+  run_on_grp1
+  also_grp1
+
+=head2 Transferring files
+
+GNU B<parallel> can transfer the files to be processed to the remote
+host. It does that using rsync.
+
+  echo This is input_file > input_file
+  parallel -S $SERVER1 --transferfile {} cat ::: input_file
+
+Output:
+
+  This is input_file
+
+If the files are processed into another file, the resulting file can be
+transferred back:
+
+  echo This is input_file > input_file
+  parallel -S $SERVER1 --transferfile {} --return {}.out \
+    cat {} ">"{}.out ::: input_file
+  cat input_file.out
+
+Output: Same as above.
+
+To remove the input and output file on the remote server use B<--cleanup>:
+
+  echo This is input_file > input_file
+  parallel -S $SERVER1 --transferfile {} --return {}.out --cleanup \
+    cat {} ">"{}.out ::: input_file
+  cat input_file.out
+
+Output: Same as above.
+
+There is a shorthand for B<--transferfile {} --return --cleanup> called B<--trc>:
+
+  echo This is input_file > input_file
+  parallel -S $SERVER1 --trc {}.out cat {} ">"{}.out ::: input_file
+  cat input_file.out
+
+Output: Same as above.
+
+Some jobs need a common database for all jobs. GNU B<parallel> can
+transfer that using B<--basefile> which will transfer the file before the
+first job:
+
+  echo common data > common_file
+  parallel --basefile common_file -S $SERVER1 \
+    cat common_file\; echo {} ::: foo
+
+Output:
+
+  common data
+  foo
+
+To remove it from the remote host after the last job use B<--cleanup>.
+
+
+=head2 Working dir
+
+The default working dir on the remote machines is the login dir. This
+can be changed with B<--workdir> I<mydir>.
+
+Files transferred using B<--transferfile> and B<--return> will be relative
+to I<mydir> on remote computers, and the command will be executed in
+the dir I<mydir>.
+
+The special I<mydir> value B<...> will create working dirs under
+B<~/.parallel/tmp> on the remote computers. If B<--cleanup> is given
+these dirs will be removed.
+
+The special I<mydir> value B<.> uses the current working dir.  If the
+current working dir is beneath your home dir, the value B<.> is
+treated as the relative path to your home dir. This means that if your
+home dir is different on remote computers (e.g. if your login is
+different) the relative path will still be relative to your home dir.
+
+  parallel -S $SERVER1 pwd ::: ""
+  parallel --workdir . -S $SERVER1 pwd ::: ""
+  parallel --workdir ... -S $SERVER1 pwd ::: ""
+
+Output:
+
+  [the login dir on $SERVER1]
+  [current dir relative on $SERVER1]
+  [a dir in ~/.parallel/tmp/...]
+
+
+=head2 Avoid overloading sshd
+
+If many jobs are started on the same server, B<sshd> can be
+overloaded. GNU B<parallel> can insert a delay between each job run on
+the same server:
+
+  parallel -S $SERVER1 --sshdelay 0.2 echo ::: 1 2 3
+
+Output (the order may be different):
+
+  1
+  2
+  3
+
+B<sshd> will be less overloaded if using B<--controlmaster>, which will
+multiplex ssh connections:
+
+  parallel --controlmaster -S $SERVER1 echo ::: 1 2 3
+
+Output: Same as above.
+
+=head2 Ignore hosts that are down
+
+In clusters with many hosts a few of them are often down. GNU B<parallel>
+can ignore those hosts. In this case the host 173.194.32.46 is down:
+
+  parallel --filter-hosts -S 173.194.32.46,$SERVER1 echo ::: bar
+
+Output:
+
+  bar
+
+=head2 Running the same commands on all hosts
+
+GNU B<parallel> can run the same command on all the hosts:
+
+  parallel --onall -S $SERVER1,$SERVER2 echo ::: foo bar
+
+Output (the order may be different):
+
+  foo
+  bar
+  foo
+  bar
+
+Often you will just want to run a single command on all hosts with out
+arguments. B<--nonall> is a no argument B<--onall>:
+
+  parallel --nonall -S $SERVER1,$SERVER2 echo foo bar
+
+Output:
+
+  foo bar
+  foo bar
+
+When B<--tag> is used with B<--nonall> and B<--onall> the B<--tagstring> is the host:
+
+  parallel --nonall --tag -S $SERVER1,$SERVER2 echo foo bar
+
+Output (the order may be different):
+
+  $SERVER1 foo bar
+  $SERVER2 foo bar
+
+B<--jobs> sets the number of servers to log in to in parallel.
+
+=head2 Transferring environment variables and functions
+
+B<env_parallel> is a shell function that transfers all aliases,
+functions, variables, and arrays. You active it by running:
+
+  source `which env_parallel.bash`
+
+Replace B<bash> with the shell you use.
+
+Now you can use B<env_parallel> instead of B<parallel> and still have
+your environment:
+
+  alias myecho=echo
+  myvar="Joe's var is"
+  env_parallel -S $SERVER1 'myecho $myvar' ::: green
+
+Output:
+
+  Joe's var is green
+
+The disadvantage is that if your environment is huge B<env_parallel>
+will fail.
+
+When B<env_parallel> fails, you can still use B<--env> to tell GNU
+B<parallel> to transfer an environment variable to the remote system.
+
+  MYVAR='foo bar'
+  export MYVAR
+  parallel --env MYVAR -S $SERVER1 echo '$MYVAR' ::: baz
+
+Output:
+
+  foo bar baz
+
+This works for functions, too, if your shell is Bash:
+
+  # This only works in Bash
+  my_func() {
+    echo in my_func $1
+  }
+  export -f my_func
+  parallel --env my_func -S $SERVER1 my_func ::: baz
+
+Output:
+
+  in my_func baz
+
+GNU B<parallel> can copy all user defined variables and functions to
+the remote system. It just needs to record which ones to ignore in
+B<~/.parallel/ignored_vars>. Do that by running this once:
+
+  parallel --record-env
+  cat ~/.parallel/ignored_vars
+
+Output:
+
+  [list of variables to ignore - including $PATH and $HOME]
+
+Now all other variables and functions defined will be copied when
+using B<--env _>.
+
+  # The function is only copied if using Bash
+  my_func2() {
+    echo in my_func2 $VAR $1
+  }
+  export -f my_func2
+  VAR=foo
+  export VAR
+
+  parallel --env _ -S $SERVER1 'echo $VAR; my_func2' ::: bar
+
+Output:
+
+  foo
+  in my_func2 foo bar
+
+If you use B<env_parallel> the variables, functions, and aliases do
+not even need to be exported to be copied:
+
+  NOT='not exported var'
+  alias myecho=echo
+  not_ex() {
+    myecho in not_exported_func $NOT $1
+  }
+  env_parallel --env _ -S $SERVER1 'echo $NOT; not_ex' ::: bar
+
+Output:
+
+  not exported var
+  in not_exported_func not exported var bar
+
+
+=head2 Showing what is actually run
+
+B<--verbose> will show the command that would be run on the local
+machine.
+
+When using B<--cat>, B<--pipepart>, or when a job is run on a remote
+machine, the command is wrapped with helper scripts. B<-vv> shows all
+of this.
+
+  parallel -vv --pipepart --block 1M wc :::: num30000
+
+Output:
+
+  <num30000 perl -e 'while(@ARGV) { sysseek(STDIN,shift,0) || die;
+  $left = shift; while($read = sysread(STDIN,$buf, ($left > 131072
+  ? 131072 : $left))){ $left -= $read; syswrite(STDOUT,$buf); } }'
+  0 0 0 168894 | (wc)
+    30000   30000  168894
+
+When the command gets more complex, the output is so hard to read,
+that it is only useful for debugging:
+
+  my_func3() {
+    echo in my_func $1 > $1.out
+  }
+  export -f my_func3
+  parallel -vv --workdir ... --nice 17 --env _ --trc {}.out \
+    -S $SERVER1 my_func3 {} ::: abc-file
+
+Output will be similar to:
+
+
+  ( ssh server -- mkdir -p ./.parallel/tmp/aspire-1928520-1;rsync
+  --protocol 30 -rlDzR -essh ./abc-file 
+  server:./.parallel/tmp/aspire-1928520-1 );ssh server -- exec perl -e 
+  \''@GNU_Parallel=("use","IPC::Open3;","use","MIME::Base64");
+  eval"@GNU_Parallel";my$eval=decode_base64(join"",@ARGV);eval$eval;'\'
+  c3lzdGVtKCJta2RpciIsIi1wIiwiLS0iLCIucGFyYWxsZWwvdG1wL2FzcGlyZS0xOTI4N
+  TsgY2hkaXIgIi5wYXJhbGxlbC90bXAvYXNwaXJlLTE5Mjg1MjAtMSIgfHxwcmludChTVE
+  BhcmFsbGVsOiBDYW5ub3QgY2hkaXIgdG8gLnBhcmFsbGVsL3RtcC9hc3BpcmUtMTkyODU
+  iKSAmJiBleGl0IDI1NTskRU5WeyJPTERQV0QifT0iL2hvbWUvdGFuZ2UvcHJpdmF0L3Bh
+  IjskRU5WeyJQQVJBTExFTF9QSUQifT0iMTkyODUyMCI7JEVOVnsiUEFSQUxMRUxfU0VRI
+  0BiYXNoX2Z1bmN0aW9ucz1xdyhteV9mdW5jMyk7IGlmKCRFTlZ7IlNIRUxMIn09fi9jc2
+  ByaW50IFNUREVSUiAiQ1NIL1RDU0ggRE8gTk9UIFNVUFBPUlQgbmV3bGluZXMgSU4gVkF
+  TL0ZVTkNUSU9OUy4gVW5zZXQgQGJhc2hfZnVuY3Rpb25zXG4iOyBleGVjICJmYWxzZSI7
+  YXNoZnVuYyA9ICJteV9mdW5jMygpIHsgIGVjaG8gaW4gbXlfZnVuYyBcJDEgPiBcJDEub
+  Xhwb3J0IC1mIG15X2Z1bmMzID4vZGV2L251bGw7IjtAQVJHVj0ibXlfZnVuYzMgYWJjLW
+  RzaGVsbD0iJEVOVntTSEVMTH0iOyR0bXBkaXI9Ii90bXAiOyRuaWNlPTE3O2RveyRFTlZ
+  MRUxfVE1QfT0kdG1wZGlyLiIvcGFyIi5qb2luIiIsbWFweygwLi45LCJhIi4uInoiLCJB
+  KVtyYW5kKDYyKV19KDEuLjUpO313aGlsZSgtZSRFTlZ7UEFSQUxMRUxfVE1QfSk7JFNJ
+  fT1zdWJ7JGRvbmU9MTt9OyRwaWQ9Zm9yazt1bmxlc3MoJHBpZCl7c2V0cGdycDtldmFse
+  W9yaXR5KDAsMCwkbmljZSl9O2V4ZWMkc2hlbGwsIi1jIiwoJGJhc2hmdW5jLiJAQVJHVi
+  JleGVjOiQhXG4iO31kb3skcz0kczwxPzAuMDAxKyRzKjEuMDM6JHM7c2VsZWN0KHVuZGV
+  mLHVuZGVmLCRzKTt9dW50aWwoJGRvbmV8fGdldHBwaWQ9PTEpO2tpbGwoU0lHSFVQLC0k
+  dW5sZXNzJGRvbmU7d2FpdDtleGl0KCQ/JjEyNz8xMjgrKCQ/JjEyNyk6MSskPz4+OCk=;
+  _EXIT_status=$?; mkdir -p ./.; rsync --protocol 30 --rsync-path=cd\
+  ./.parallel/tmp/aspire-1928520-1/./.\;\ rsync -rlDzR -essh
+  server:./abc-file.out ./.;ssh server -- \(rm\ -f\
+  ./.parallel/tmp/aspire-1928520-1/abc-file\;\ sh\ -c\ \'rmdir\
+  ./.parallel/tmp/aspire-1928520-1/\ ./.parallel/tmp/\ ./.parallel/\
+  2\>/dev/null\'\;rm\ -rf\ ./.parallel/tmp/aspire-1928520-1\;\);ssh
+  server -- \(rm\ -f\ ./.parallel/tmp/aspire-1928520-1/abc-file.out\;\
+  sh\ -c\ \'rmdir\ ./.parallel/tmp/aspire-1928520-1/\ ./.parallel/tmp/\
+  ./.parallel/\ 2\>/dev/null\'\;rm\ -rf\ 
+  ./.parallel/tmp/aspire-1928520-1\;\);ssh server -- rm -rf 
+  .parallel/tmp/aspire-1928520-1; exit $_EXIT_status;
+
+=head1 Saving output to shell variables (advanced)
+
+GNU B<parset> will set shell variables to the output of GNU
+B<parallel>. GNU B<parset> has one important limitation: It cannot be
+part of a pipe. In particular this means it cannot read anything from
+standard input (stdin) or pipe output to another program.
+
+To use GNU B<parset> prepend command with destination variables:
+
+  parset myvar1,myvar2 echo ::: a b
+  echo $myvar1
+  echo $myvar2
+
+Output:
+
+  a
+  b
+
+If you only give a single variable, it will be treated as an array:
+
+  parset myarray seq {} 5 ::: 1 2 3
+  echo "${myarray[1]}"
+
+Output:
+
+  2
+  3
+  4
+  5
+
+The commands to run can be an array:
+
+  cmd=("echo '<<joe  \"double  space\"  cartoon>>'" "pwd")
+  parset data ::: "${cmd[@]}"
+  echo "${data[0]}"
+  echo "${data[1]}"
+
+Output:
+
+  <<joe  "double  space"  cartoon>>
+  [current dir]
+
+
+=head1 Saving to an SQL base (advanced)
+
+GNU B<parallel> can save into an SQL base. Point GNU B<parallel> to a
+table and it will put the joblog there together with the variables and
+the output each in their own column.
+
+=head2 CSV as SQL base
+
+The simplest is to use a CSV file as the storage table:
+
+  parallel --sqlandworker csv:///%2Ftmp/log.csv \
+    seq ::: 10 ::: 12 13 14
+  cat /tmp/log.csv
+
+Note how '/' in the path must be written as %2F.
+
+Output will be similar to:
+
+  Seq,Host,Starttime,JobRuntime,Send,Receive,Exitval,_Signal,
+    Command,V1,V2,Stdout,Stderr
+  1,:,1458254498.254,0.069,0,9,0,0,"seq 10 12",10,12,"10
+  11
+  12
+  ",
+  2,:,1458254498.278,0.080,0,12,0,0,"seq 10 13",10,13,"10
+  11
+  12
+  13
+  ",
+  3,:,1458254498.301,0.083,0,15,0,0,"seq 10 14",10,14,"10
+  11
+  12
+  13
+  14
+  ",
+
+A proper CSV reader (like LibreOffice or R's read.csv) will read this
+format correctly - even with fields containing newlines as above.
+
+If the output is big you may want to put it into files using B<--results>:
+
+  parallel --results outdir --sqlandworker csv:///%2Ftmp/log2.csv \
+    seq ::: 10 ::: 12 13 14
+  cat /tmp/log2.csv
+
+Output will be similar to:
+
+  Seq,Host,Starttime,JobRuntime,Send,Receive,Exitval,_Signal,
+    Command,V1,V2,Stdout,Stderr
+  1,:,1458824738.287,0.029,0,9,0,0,
+    "seq 10 12",10,12,outdir/1/10/2/12/stdout,outdir/1/10/2/12/stderr
+  2,:,1458824738.298,0.025,0,12,0,0,
+    "seq 10 13",10,13,outdir/1/10/2/13/stdout,outdir/1/10/2/13/stderr
+  3,:,1458824738.309,0.026,0,15,0,0,
+    "seq 10 14",10,14,outdir/1/10/2/14/stdout,outdir/1/10/2/14/stderr
+
+
+=head2 DBURL as table
+
+The CSV file is an example of a DBURL.
+
+GNU B<parallel> uses a DBURL to address the table. A DBURL has this format:
+
+  vendor://[[user][:password]@][host][:port]/[database[/table]
+
+Example:
+
+  mysql://scott:tiger@my.example.com/mydatabase/mytable
+  postgresql://scott:tiger@pg.example.com/mydatabase/mytable
+  sqlite3:///%2Ftmp%2Fmydatabase/mytable
+  csv:///%2Ftmp/log.csv
+
+To refer to B</tmp/mydatabase> with B<sqlite> or B<csv> you need to
+encode the B</> as B<%2F>.
+
+Run a job using B<sqlite> on B<mytable> in B</tmp/mydatabase>:
+
+  DBURL=sqlite3:///%2Ftmp%2Fmydatabase
+  DBURLTABLE=$DBURL/mytable
+  parallel --sqlandworker $DBURLTABLE echo ::: foo bar ::: baz quuz
+
+To see the result:
+
+  sql $DBURL 'SELECT * FROM mytable ORDER BY Seq;'
+
+Output will be similar to:
+
+  Seq|Host|Starttime|JobRuntime|Send|Receive|Exitval|_Signal|
+    Command|V1|V2|Stdout|Stderr
+  1|:|1451619638.903|0.806||8|0|0|echo foo baz|foo|baz|foo baz
+  |
+  2|:|1451619639.265|1.54||9|0|0|echo foo quuz|foo|quuz|foo quuz
+  |
+  3|:|1451619640.378|1.43||8|0|0|echo bar baz|bar|baz|bar baz
+  |
+  4|:|1451619641.473|0.958||9|0|0|echo bar quuz|bar|quuz|bar quuz
+  |
+
+The first columns are well known from B<--joblog>. B<V1> and B<V2> are
+data from the input sources. B<Stdout> and B<Stderr> are standard
+output and standard error, respectively.
+
+=head2 Using multiple workers
+
+Using an SQL base as storage costs overhead in the order of 1 second
+per job.
+
+One of the situations where it makes sense is if you have multiple
+workers.
+
+You can then have a single master machine that submits jobs to the SQL
+base (but does not do any of the work):
+
+  parallel --sqlmaster $DBURLTABLE echo ::: foo bar ::: baz quuz
+
+On the worker machines you run exactly the same command except you
+replace B<--sqlmaster> with B<--sqlworker>.
+
+  parallel --sqlworker $DBURLTABLE echo ::: foo bar ::: baz quuz
+
+To run a master and a worker on the same machine use B<--sqlandworker>
+as shown earlier.
+
+
+=head1 --pipe
+
+The B<--pipe> functionality puts GNU B<parallel> in a different mode:
+Instead of treating the data on stdin (standard input) as arguments
+for a command to run, the data will be sent to stdin (standard input)
+of the command.
+
+The typical situation is:
+
+  command_A | command_B | command_C
+
+where command_B is slow, and you want to speed up command_B.
+
+=head2 Chunk size
+
+By default GNU B<parallel> will start an instance of command_B, read a
+chunk of 1 MB, and pass that to the instance. Then start another
+instance, read another chunk, and pass that to the second instance.
+
+  cat num1000000 | parallel --pipe wc
+
+Output (the order may be different):
+
+  165668  165668 1048571
+  149797  149797 1048579
+  149796  149796 1048572
+  149797  149797 1048579
+  149797  149797 1048579
+  149796  149796 1048572
+   85349   85349  597444
+
+The size of the chunk is not exactly 1 MB because GNU B<parallel> only
+passes full lines - never half a line, thus the blocksize is only
+1 MB on average. You can change the block size to 2 MB with B<--block>:
+
+  cat num1000000 | parallel --pipe --block 2M wc
+
+Output (the order may be different):
+
+  315465  315465 2097150
+  299593  299593 2097151
+  299593  299593 2097151
+   85349   85349  597444
+
+GNU B<parallel> treats each line as a record. If the order of records
+is unimportant (e.g. you need all lines processed, but you do not care
+which is processed first), then you can use B<--roundrobin>. Without
+B<--roundrobin> GNU B<parallel> will start a command per block; with
+B<--roundrobin> only the requested number of jobs will be started
+(B<--jobs>). The records will then be distributed between the running
+jobs:
+
+  cat num1000000 | parallel --pipe -j4 --roundrobin wc
+
+Output will be similar to:
+
+  149797  149797 1048579
+  299593  299593 2097151
+  315465  315465 2097150
+  235145  235145 1646016
+
+One of the 4 instances got a single record, 2 instances got 2 full
+records each, and one instance got 1 full and 1 partial record.
+
+=head2 Records
+
+GNU B<parallel> sees the input as records. The default record is a single
+line.
+
+Using B<-N140000> GNU B<parallel> will read 140000 records at a time:
+
+  cat num1000000 | parallel --pipe -N140000 wc
+
+Output (the order may be different):
+
+  140000  140000  868895
+  140000  140000  980000
+  140000  140000  980000
+  140000  140000  980000
+  140000  140000  980000
+  140000  140000  980000
+  140000  140000  980000
+   20000   20000  140001
+
+Note how that the last job could not get the full 140000 lines, but
+only 20000 lines.
+
+If a record is 75 lines B<-L> can be used:
+
+  cat num1000000 | parallel --pipe -L75 wc
+
+Output (the order may be different):
+
+  165600  165600 1048095
+  149850  149850 1048950
+  149775  149775 1048425
+  149775  149775 1048425
+  149850  149850 1048950
+  149775  149775 1048425
+   85350   85350  597450
+      25      25     176
+
+Note how GNU B<parallel> still reads a block of around 1 MB; but
+instead of passing full lines to B<wc> it passes full 75 lines at a
+time. This of course does not hold for the last job (which in this
+case got 25 lines).
+
+=head2 Fixed length records
+
+Fixed length records can be processed by setting B<--recend ''> and
+B<--block I<recordsize>>. A header of size I<n> can be processed with
+B<--header .{I<n>}>.
+
+Here is how to process a file with a 4-byte header and a 3-byte record
+size:
+
+  cat fixedlen | parallel --pipe --header .{4} --block 3 --recend '' \
+    'echo start; cat; echo'
+
+Output:
+
+  start
+  HHHHAAA
+  start
+  HHHHCCC
+  start
+  HHHHBBB
+
+It may be more efficient to increase B<--block> to a multiplum of the
+record size.
+
+=head2 Record separators
+
+GNU B<parallel> uses separators to determine where two records split.
+
+B<--recstart> gives the string that starts a record; B<--recend> gives the
+string that ends a record. The default is B<--recend '\n'> (newline).
+
+If both B<--recend> and B<--recstart> are given, then the record will only
+split if the recend string is immediately followed by the recstart
+string.
+
+Here the B<--recend> is set to B<', '>:
+
+  echo /foo, bar/, /baz, qux/, | \
+    parallel -kN1 --recend ', ' --pipe echo JOB{#}\;cat\;echo END
+
+Output:
+
+  JOB1
+  /foo, END
+  JOB2
+  bar/, END
+  JOB3
+  /baz, END
+  JOB4
+  qux/,
+  END
+
+Here the B<--recstart> is set to B</>:
+
+  echo /foo, bar/, /baz, qux/, | \
+    parallel -kN1 --recstart / --pipe echo JOB{#}\;cat\;echo END
+
+Output:
+
+  JOB1
+  /foo, barEND
+  JOB2
+  /, END
+  JOB3
+  /baz, quxEND
+  JOB4
+  /,
+  END
+
+Here both B<--recend> and B<--recstart> are set:
+
+  echo /foo, bar/, /baz, qux/, | \
+    parallel -kN1 --recend ', ' --recstart / --pipe \
+    echo JOB{#}\;cat\;echo END
+
+Output:
+
+  JOB1
+  /foo, bar/, END
+  JOB2
+  /baz, qux/,
+  END
+
+Note the difference between setting one string and setting both strings.
+
+With B<--regexp> the B<--recend> and B<--recstart> will be treated as
+a regular expression:
+
+  echo foo,bar,_baz,__qux, | \
+    parallel -kN1 --regexp --recend ,_+ --pipe \
+    echo JOB{#}\;cat\;echo END
+
+Output:
+
+  JOB1
+  foo,bar,_END
+  JOB2
+  baz,__END
+  JOB3
+  qux,
+  END
+
+GNU B<parallel> can remove the record separators with
+B<--remove-rec-sep>/B<--rrs>:
+
+  echo foo,bar,_baz,__qux, | \
+    parallel -kN1 --rrs --regexp --recend ,_+ --pipe \
+    echo JOB{#}\;cat\;echo END
+
+Output:
+
+  JOB1
+  foo,barEND
+  JOB2
+  bazEND
+  JOB3
+  qux,
+  END
+
+=head2 Header
+
+If the input data has a header, the header can be repeated for each
+job by matching the header with B<--header>. If headers start with
+B<%> you can do this:
+
+  cat num_%header | \
+    parallel --header '(%.*\n)*' --pipe -N3 echo JOB{#}\;cat
+
+Output (the order may be different):
+
+  JOB1
+  %head1
+  %head2
+  1
+  2
+  3
+  JOB2
+  %head1
+  %head2
+  4
+  5
+  6
+  JOB3
+  %head1
+  %head2
+  7
+  8
+  9
+  JOB4
+  %head1
+  %head2
+  10
+
+If the header is 2 lines, B<--header> 2 will work:
+
+  cat num_%header | parallel --header 2 --pipe -N3 echo JOB{#}\;cat
+
+Output: Same as above.
+
+=head2 --pipepart
+
+B<--pipe> is not very efficient. It maxes out at around 500
+MB/s. B<--pipepart> can easily deliver 5 GB/s. But there are a few
+limitations. The input has to be a normal file (not a pipe) given by
+B<-a> or B<::::> and B<-L>/B<-l>/B<-N> do not work. B<--recend> and
+B<--recstart>, however, I<do> work, and records can often be split on
+that alone.
+
+  parallel --pipepart -a num1000000 --block 3m wc
+
+Output (the order may be different):
+
+ 444443  444444 3000002
+ 428572  428572 3000004
+ 126985  126984  888890
+
+
+=head1 Shebang
+
+=head2 Input data and parallel command in the same file
+
+GNU B<parallel> is often called as this:
+
+  cat input_file | parallel command
+
+With B<--shebang> the I<input_file> and B<parallel> can be combined into the same script.
+
+UNIX shell scripts start with a shebang line like this:
+
+  #!/bin/bash
+
+GNU B<parallel> can do that, too. With B<--shebang> the arguments can be
+listed in the file. The B<parallel> command is the first line of the
+script:
+
+  #!/usr/bin/parallel --shebang -r echo
+
+  foo
+  bar
+  baz
+
+Output (the order may be different):
+
+  foo
+  bar
+  baz
+
+=head2 Parallelizing existing scripts
+
+GNU B<parallel> is often called as this:
+
+  cat input_file | parallel command
+  parallel command ::: foo bar
+
+If B<command> is a script, B<parallel> can be combined into a single
+file so this will run the script in parallel:
+
+  cat input_file | command
+  command foo bar
+
+This B<perl> script B<perl_echo> works like B<echo>:
+
+  #!/usr/bin/perl
+
+  print "@ARGV\n"
+
+It can be called as this:
+
+  parallel perl_echo ::: foo bar
+
+By changing the B<#!>-line it can be run in parallel:
+
+  #!/usr/bin/parallel --shebang-wrap /usr/bin/perl
+
+  print "@ARGV\n"
+
+Thus this will work:
+
+  perl_echo foo bar
+
+Output (the order may be different):
+
+  foo
+  bar
+
+This technique can be used for:
+
+=over 9
+
+=item Perl:
+
+  #!/usr/bin/parallel --shebang-wrap /usr/bin/perl
+  
+  print "Arguments @ARGV\n";
+
+
+=item Python:
+
+  #!/usr/bin/parallel --shebang-wrap /usr/bin/python
+  
+  import sys
+  print 'Arguments', str(sys.argv)
+
+
+=item Bash/sh/zsh/Korn shell:
+
+  #!/usr/bin/parallel --shebang-wrap /bin/bash
+  
+  echo Arguments "$@"
+
+
+=item csh:
+
+  #!/usr/bin/parallel --shebang-wrap /bin/csh
+  
+  echo Arguments "$argv"
+
+
+=item Tcl:
+
+  #!/usr/bin/parallel --shebang-wrap /usr/bin/tclsh
+  
+  puts "Arguments $argv"
+
+
+=item R:
+
+  #!/usr/bin/parallel --shebang-wrap /usr/bin/Rscript --vanilla --slave
+  
+  args <- commandArgs(trailingOnly = TRUE)
+  print(paste("Arguments ",args))
+
+
+=item GNUplot:
+
+  #!/usr/bin/parallel --shebang-wrap ARG={} /usr/bin/gnuplot
+  
+  print "Arguments ", system('echo $ARG')
+
+
+=item Ruby:
+
+  #!/usr/bin/parallel --shebang-wrap /usr/bin/ruby
+  
+  print "Arguments "
+  puts ARGV
+
+
+=item Octave:
+
+  #!/usr/bin/parallel --shebang-wrap /usr/bin/octave
+  
+  printf ("Arguments");
+  arg_list = argv ();
+  for i = 1:nargin
+    printf (" %s", arg_list{i});
+  endfor
+  printf ("\n");
+
+=item Common LISP:
+
+  #!/usr/bin/parallel --shebang-wrap /usr/bin/clisp
+  
+  (format t "~&~S~&" 'Arguments)
+  (format t "~&~S~&" *args*)
+
+=item PHP:
+
+  #!/usr/bin/parallel --shebang-wrap /usr/bin/php
+  <?php
+  echo "Arguments";
+  foreach(array_slice($argv,1) as $v)
+  {
+    echo " $v";
+  }
+  echo "\n";
+  ?>
+
+=item Node.js:
+
+  #!/usr/bin/parallel --shebang-wrap /usr/bin/node
+
+  var myArgs = process.argv.slice(2);
+  console.log('Arguments ', myArgs);
+
+=item LUA:
+
+  #!/usr/bin/parallel --shebang-wrap /usr/bin/lua
+  
+  io.write "Arguments"
+  for a = 1, #arg do
+    io.write(" ")
+    io.write(arg[a])
+  end
+  print("")
+
+=item C#:
+
+  #!/usr/bin/parallel --shebang-wrap ARGV={} /usr/bin/csharp
+  
+  var argv = Environment.GetEnvironmentVariable("ARGV");
+  print("Arguments "+argv);
+
+=back
+
+=head1 Semaphore
+
+GNU B<parallel> can work as a counting semaphore. This is slower and less
+efficient than its normal mode.
+
+A counting semaphore is like a row of toilets. People needing a toilet
+can use any toilet, but if there are more people than toilets, they
+will have to wait for one of the toilets to become available.
+
+An alias for B<parallel --semaphore> is B<sem>.
+
+B<sem> will follow a person to the toilets, wait until a toilet is
+available, leave the person in the toilet and exit.
+
+B<sem --fg> will follow a person to the toilets, wait until a toilet is
+available, stay with the person in the toilet and exit when the person
+exits.
+
+B<sem --wait> will wait for all persons to leave the toilets.
+
+B<sem> does not have a queue discipline, so the next person is chosen
+randomly.
+
+B<-j> sets the number of toilets.
+
+=head2 Mutex
+
+The default is to have only one toilet (this is called a mutex). The
+program is started in the background and B<sem> exits immediately. Use
+B<--wait> to wait for all B<sem>s to finish:
+
+  sem 'sleep 1; echo The first finished' &&
+    echo The first is now running in the background &&
+    sem 'sleep 1; echo The second finished' &&
+    echo The second is now running in the background
+  sem --wait
+
+Output:
+
+  The first is now running in the background
+  The first finished
+  The second is now running in the background
+  The second finished
+
+The command can be run in the foreground with B<--fg>, which will only
+exit when the command completes:
+
+  sem --fg 'sleep 1; echo The first finished' &&
+    echo The first finished running in the foreground &&
+    sem --fg 'sleep 1; echo The second finished' &&
+    echo The second finished running in the foreground
+  sem --wait
+
+The difference between this and just running the command, is that a
+mutex is set, so if other B<sem>s were running in the background only one
+would run at a time.
+
+To control which semaphore is used, use
+B<--semaphorename>/B<--id>. Run this in one terminal:
+
+  sem --id my_id -u 'echo First started; sleep 10; echo First done'
+
+and simultaneously this in another terminal:
+
+  sem --id my_id -u 'echo Second started; sleep 10; echo Second done'
+
+Note how the second will only be started when the first has finished.
+
+=head2 Counting semaphore
+
+A mutex is like having a single toilet: When it is in use everyone
+else will have to wait. A counting semaphore is like having multiple
+toilets: Several people can use the toilets, but when they all are in
+use, everyone else will have to wait.
+
+B<sem> can emulate a counting semaphore. Use B<--jobs> to set the
+number of toilets like this:
+
+  sem --jobs 3 --id my_id -u 'echo Start 1; sleep 5; echo 1 done' &&
+  sem --jobs 3 --id my_id -u 'echo Start 2; sleep 6; echo 2 done' &&
+  sem --jobs 3 --id my_id -u 'echo Start 3; sleep 7; echo 3 done' &&
+  sem --jobs 3 --id my_id -u 'echo Start 4; sleep 8; echo 4 done' &&
+  sem --wait --id my_id
+
+Output:
+
+  Start 1
+  Start 2
+  Start 3
+  1 done
+  Start 4
+  2 done
+  3 done
+  4 done
+
+=head2 Timeout
+
+With B<--semaphoretimeout> you can force running the command anyway after
+a period (positive number) or give up (negative number):
+
+  sem --id foo -u 'echo Slow started; sleep 5; echo Slow ended' &&
+  sem --id foo --semaphoretimeout 1 'echo Forced running after 1 sec' &&
+  sem --id foo --semaphoretimeout -2 'echo Give up after 2 secs'
+  sem --id foo --wait
+
+Output:
+
+  Slow started
+  parallel: Warning: Semaphore timed out. Stealing the semaphore.
+  Forced running after 1 sec
+  parallel: Warning: Semaphore timed out. Exiting.
+  Slow ended
+
+Note how the 'Give up' was not run.
+
+=head1 Informational
+
+GNU B<parallel> has some options to give short information about the
+configuration.
+
+B<--help> will print a summary of the most important options:
+
+  parallel --help
+
+Output:
+
+  Usage:
+  
+  parallel [options] [command [arguments]] < list_of_arguments
+  parallel [options] [command [arguments]] (::: arguments|:::: argfile(s))...
+  cat ... | parallel --pipe [options] [command [arguments]]
+  
+  -j n            Run n jobs in parallel
+  -k              Keep same order
+  -X              Multiple arguments with context replace
+  --colsep regexp Split input on regexp for positional replacements
+  {} {.} {/} {/.} {#} {%} {= perl code =} Replacement strings
+  {3} {3.} {3/} {3/.} {=3 perl code =}    Positional replacement strings
+  With --plus:    {} = {+/}/{/} = {.}.{+.} = {+/}/{/.}.{+.} = {..}.{+..} =
+                  {+/}/{/..}.{+..} = {...}.{+...} = {+/}/{/...}.{+...}
+  
+  -S sshlogin     Example: foo@server.example.com
+  --slf ..        Use ~/.parallel/sshloginfile as the list of sshlogins
+  --trc {}.bar    Shorthand for --transfer --return {}.bar --cleanup
+  --onall         Run the given command with argument on all sshlogins
+  --nonall        Run the given command with no arguments on all sshlogins
+  
+  --pipe          Split stdin (standard input) to multiple jobs.
+  --recend str    Record end separator for --pipe.
+  --recstart str  Record start separator for --pipe.
+  
+  See 'man parallel' for details
+  
+  Academic tradition requires you to cite works you base your article on.
+  When using programs that use GNU Parallel to process data for publication
+  please cite:
+  
+    O. Tange (2011): GNU Parallel - The Command-Line Power Tool,
+    ;login: The USENIX Magazine, February 2011:42-47.
+  
+  This helps funding further development; AND IT WON'T COST YOU A CENT.
+  If you pay 10000 EUR you should feel free to use GNU Parallel without citing.
+
+When asking for help, always report the full output of this:
+
+  parallel --version
+
+Output:
+
+  GNU parallel 20210122
+  Copyright (C) 2007-2022 Ole Tange, http://ole.tange.dk and Free Software
+  Foundation, Inc.
+  License GPLv3+: GNU GPL version 3 or later <https://gnu.org/licenses/gpl.html>
+  This is free software: you are free to change and redistribute it.
+  GNU parallel comes with no warranty.
+  
+  Web site: https://www.gnu.org/software/parallel
+  
+  When using programs that use GNU Parallel to process data for publication
+  please cite as described in 'parallel --citation'.
+
+In scripts B<--minversion> can be used to ensure the user has at least
+this version:
+
+  parallel --minversion 20130722 && \
+    echo Your version is at least 20130722.
+
+Output:
+
+  20160322
+  Your version is at least 20130722.
+
+If you are using GNU B<parallel> for research the BibTeX citation can be
+generated using B<--citation>:
+
+  parallel --citation
+
+Output:
+
+  Academic tradition requires you to cite works you base your article on.
+  When using programs that use GNU Parallel to process data for publication
+  please cite:
+  
+  @article{Tange2011a,
+    title = {GNU Parallel - The Command-Line Power Tool},
+    author = {O. Tange},
+    address = {Frederiksberg, Denmark},
+    journal = {;login: The USENIX Magazine},
+    month = {Feb},
+    number = {1},
+    volume = {36},
+    url = {https://www.gnu.org/s/parallel},
+    year = {2011},
+    pages = {42-47},
+    doi = {10.5281/zenodo.16303}
+  }
+  
+  (Feel free to use \nocite{Tange2011a})
+  
+  This helps funding further development; AND IT WON'T COST YOU A CENT.
+  If you pay 10000 EUR you should feel free to use GNU Parallel without citing.
+  
+  If you send a copy of your published article to tange@gnu.org, it will be
+  mentioned in the release notes of next version of GNU Parallel.
+  
+With B<--max-line-length-allowed> GNU B<parallel> will report the maximal
+size of the command line:
+
+  parallel --max-line-length-allowed
+
+Output (may vary on different systems):
+
+  131071
+
+B<--number-of-cpus> and B<--number-of-cores> run system specific code to
+determine the number of CPUs and CPU cores on the system. On
+unsupported platforms they will return 1:
+
+  parallel --number-of-cpus
+  parallel --number-of-cores
+
+Output (may vary on different systems):
+
+  4
+  64
+
+=head1 Profiles
+
+The defaults for GNU B<parallel> can be changed systemwide by putting the
+command line options in B</etc/parallel/config>. They can be changed for
+a user by putting them in B<~/.parallel/config>.
+
+Profiles work the same way, but have to be referred to with B<--profile>:
+
+  echo '--nice 17' > ~/.parallel/nicetimeout
+  echo '--timeout 300%' >> ~/.parallel/nicetimeout
+  parallel --profile nicetimeout echo ::: A B C
+
+Output:
+
+  A
+  B
+  C
+
+Profiles can be combined:
+
+  echo '-vv --dry-run' > ~/.parallel/dryverbose
+  parallel --profile dryverbose --profile nicetimeout echo ::: A B C
+
+Output:
+
+  echo A
+  echo B
+  echo C
+
+
+=head1 Spread the word
+
+I hope you have learned something from this tutorial.
+
+If you like GNU B<parallel>:
+
+=over 2
+
+=item *
+
+(Re-)walk through the tutorial if you have not done so in the past year
+(https://www.gnu.org/software/parallel/parallel_tutorial.html)
+
+=item *
+
+Give a demo at your local user group/your team/your colleagues
+
+=item *
+
+Post the intro videos and the tutorial on Reddit, Mastodon, Diaspora*,
+forums, blogs, Identi.ca, Google+, Twitter, Facebook, Linkedin, and
+mailing lists
+
+=item *
+
+Request or write a review for your favourite blog or magazine
+(especially if you do something cool with GNU B<parallel>)
+
+=item *
+
+Invite me for your next conference
+
+=back
+
+If you use GNU B<parallel> for research:
+
+=over 2
+
+=item *
+
+Please cite GNU B<parallel> in you publications (use B<--citation>)
+
+=back
+
+If GNU B<parallel> saves you money:
+
+=over 2
+
+=item *
+
+(Have your company) donate to FSF or become a member
+https://my.fsf.org/donate/
+
+=back
+
+(C) 2013-2022 Ole Tange, GFDLv1.3+ (See
+LICENSES/GFDL-1.3-or-later.txt)
+
+
+=cut
diff --git a/src/parcat b/src/parcat
new file mode 100755
index 0000000..285efce
--- /dev/null
+++ b/src/parcat
@@ -0,0 +1,194 @@
+#!/usr/bin/perl
+
+# Copyright (C) 2016-2022 Ole Tange, http://ole.tange.dk and Free
+# Software Foundation, Inc.
+#
+# This program is free software; you can redistribute it and/or modify
+# it under the terms of the GNU General Public License as published by
+# the Free Software Foundation; either version 3 of the License, or
+# (at your option) any later version.
+#
+# This program is distributed in the hope that it will be useful, but
+# WITHOUT ANY WARRANTY; without even the implied warranty of
+# MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the GNU
+# General Public License for more details.
+#
+# You should have received a copy of the GNU General Public License
+# along with this program; if not, see <https://www.gnu.org/licenses/>
+# or write to the Free Software Foundation, Inc., 51 Franklin St,
+# Fifth Floor, Boston, MA 02110-1301 USA
+#
+# SPDX-FileCopyrightText: 2021-2022 Ole Tange, http://ole.tange.dk and Free Software and Foundation, Inc.
+# SPDX-License-Identifier: GPL-3.0-or-later
+
+use Symbol qw(gensym);
+use IPC::Open3;
+use POSIX qw(:errno_h);
+use IO::Select;
+use strict;
+use threads;
+use threads::shared;
+use Thread::Queue;
+
+
+my $opened :shared;
+my $q = Thread::Queue->new();
+my $okq = Thread::Queue->new();
+my @producers;
+
+if(not @ARGV) {
+    if(-t *STDIN) {
+	print "Usage:\n";
+	print "  parcat file(s)\n";
+	print "  cat argfile | parcat\n";
+    } else {
+	# Read arguments from stdin
+	chomp(@ARGV = <STDIN>);
+    }
+}
+
+my $files_to_open = 0;
+# Default: fd = stdout
+my $fd = 1;
+for (@ARGV) {
+    # --rm = remove file when opened
+    /^--rm$/ and do { $opt::rm = 1; next; };
+    # -1 = output to fd 1, -2 = output to fd 2
+    /^-(\d+)$/ and do { $fd = $1; next; };
+    push @producers, threads->create('producer', $_, $fd);
+    $files_to_open++;
+}
+
+sub producer {
+    # Open a file/fifo, set non blocking, enqueue fileno of the file handle
+    my $file = shift;
+    my $output_fd = shift;
+    open(my $fh, "<", $file) || do {
+	print STDERR "parcat: Cannot open $file\n";
+	exit(1);
+    };
+    # Remove file when it has been opened
+    if($opt::rm) {
+	unlink $file;
+    }
+    set_fh_non_blocking($fh);
+    $opened++;
+    # Pass the fileno to parent
+    $q->enqueue(fileno($fh),$output_fd);
+    # Get an OK that the $fh is opened and we can release the $fh
+    while(1) {
+	my $ok = $okq->dequeue();
+	if($ok == fileno($fh)) { last; }
+	# Not ours - very unlikely to happen
+	$okq->enqueue($ok);
+    }
+    return;
+}
+
+my $s = IO::Select->new();
+my %buffer;
+
+sub add_file {
+    my $infd = shift;
+    my $outfd = shift;
+    open(my $infh, "<&=", $infd) || die;
+    open(my $outfh, ">&=", $outfd) || die;
+    $s->add($infh);
+    # Tell the producer now opened here and can be released
+    $okq->enqueue($infd);
+    # Initialize the buffer
+    @{$buffer{$infh}{$outfd}} = ();
+    $Global::fh{$outfd} = $outfh;
+}
+
+sub add_files {
+    # Non-blocking dequeue
+    my ($infd,$outfd);
+    do {
+	($infd,$outfd) = $q->dequeue_nb(2);
+	if(defined($outfd)) {
+	    add_file($infd,$outfd);
+	}
+    } while(defined($outfd));
+}
+
+sub add_files_block {
+    # Blocking dequeue
+    my ($infd,$outfd) = $q->dequeue(2);
+    add_file($infd,$outfd);
+}
+
+
+my $fd;
+my (@ready,$infh,$rv,$buf);
+do {
+    # Wait until at least one file is opened
+    add_files_block();
+    while($q->pending or keys %buffer) {
+	add_files();
+	while(keys %buffer) {
+	    @ready = $s->can_read(0.01);
+	    if(not @ready) {
+		add_files();
+	    }
+	    for $infh (@ready) {
+		# There is only one key, namely the output file descriptor
+		for my $outfd (keys %{$buffer{$infh}}) {
+		    $rv = sysread($infh, $buf, 65536);
+		    if (!$rv) {
+			if($! == EAGAIN) {
+			    # Would block: Nothing read
+			    next;
+			} else {
+			    # Nothing read, but would not block:
+			    # This file is done
+			    $s->remove($infh);
+			    for(@{$buffer{$infh}{$outfd}}) {
+				syswrite($Global::fh{$outfd},$_);
+			    }
+			    delete $buffer{$infh};
+			    # Closing the $infh causes it to block
+			    # close $infh;
+			    add_files();
+			    next;
+			}
+		    }
+		    # Something read.
+		    # Find \n or \r for full line
+		    my $i = (rindex($buf,"\n")+1);
+		    if($i) {
+			# Print full line
+			for(@{$buffer{$infh}{$outfd}}, substr($buf,0,$i)) {
+			    syswrite($Global::fh{$outfd},$_);
+			}
+			# @buffer = remaining half line
+			$buffer{$infh}{$outfd} = [substr($buf,$i,$rv-$i)];
+		    } else {
+			# Something read, but not a full line
+			push @{$buffer{$infh}{$outfd}}, $buf;
+		    }
+		    redo;
+		}
+	    }
+	}
+    }
+} while($opened < $files_to_open);
+
+
+for (@producers) {
+    $_->join();
+}
+
+sub set_fh_non_blocking {
+    # Set filehandle as non-blocking
+    # Inputs:
+    #   $fh = filehandle to be blocking
+    # Returns:
+    #   N/A
+    my $fh = shift;
+    $Global::use{"Fcntl"} ||= eval "use Fcntl qw(:DEFAULT :flock); 1;";
+    my $flags;
+    fcntl($fh, &F_GETFL, $flags) || die $!; # Get the current flags on the filehandle
+    $flags |= &O_NONBLOCK; # Add non-blocking to the flags
+    fcntl($fh, &F_SETFL, $flags) || die $!; # Set the flags on the filehandle
+}
diff --git a/src/parcat.pod b/src/parcat.pod
new file mode 100644
index 0000000..2516e0b
--- /dev/null
+++ b/src/parcat.pod
@@ -0,0 +1,191 @@
+#!/usr/bin/perl
+
+# SPDX-FileCopyrightText: 2021-2022 Ole Tange, http://ole.tange.dk and Free Software and Foundation, Inc.
+# SPDX-License-Identifier: GFDL-1.3-or-later
+# SPDX-License-Identifier: CC-BY-SA-4.0
+
+=head1 NAME
+
+parcat - cat files or fifos in parallel
+
+=head1 SYNOPSIS
+
+B<parcat> [--rm] [-#] file(s) [-#] file(s)
+
+=head1 DESCRIPTION
+
+GNU B<parcat> reads files or fifos in parallel. It writes full lines
+so there will be no problem with mixed-half-lines which you risk if
+you use:
+
+   (cat file1 & cat file2 &) | ...
+
+It is faster than doing:
+
+   parallel -j0 --lb cat ::: file*
+
+Arguments can be given on the command line or passed in on stdin
+(standard input).
+
+=head1 OPTIONS
+
+=over 9
+
+=item -B<#>
+
+Arguments following this will be sent to the file descriptor B<#>. E.g.
+
+  parcat -1 stdout1 stdout2 -2 stderr1 stderr2
+
+will send I<stdout1> and I<stdout2> to stdout (standard output = file
+descriptor 1), and send I<stderr1> and I<stderr2> to stderr (standard
+error = file descriptor 2).
+
+=item --rm
+
+Remove files after opening. As soon as the files are opened, unlink
+the files.
+
+=back
+
+=head1 EXAMPLES
+
+=head2 Simple line buffered output
+
+B<traceroute> will often print half a line. If run in parallel, two
+instances may half-lines of their output. This can be avoided by
+saving the output to a fifo and then using B<parcat> to read the two
+fifos in parallel:
+
+  mkfifo freenetproject.org.fifo tange.dk.fifo
+  traceroute freenetproject.org > freenetproject.org.fifo &
+  traceroute tange.dk > tange.dk.fifo &
+  parcat --rm *fifo
+
+
+=head1 REPORTING BUGS
+
+GNU B<parcat> is part of GNU B<parallel>. Report bugs to
+<bug-parallel@gnu.org>.
+
+
+=head1 AUTHOR
+
+Copyright (C) 2016-2022 Ole Tange, http://ole.tange.dk and Free
+Software Foundation, Inc.
+
+=head1 LICENSE
+
+This program is free software; you can redistribute it and/or modify
+it under the terms of the GNU General Public License as published by
+the Free Software Foundation; either version 3 of the License, or
+at your option any later version.
+
+This program is distributed in the hope that it will be useful,
+but WITHOUT ANY WARRANTY; without even the implied warranty of
+MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the
+GNU General Public License for more details.
+
+You should have received a copy of the GNU General Public License
+along with this program.  If not, see <http://www.gnu.org/licenses/>.
+
+=head2 Documentation license I
+
+Permission is granted to copy, distribute and/or modify this
+documentation under the terms of the GNU Free Documentation License,
+Version 1.3 or any later version published by the Free Software
+Foundation; with no Invariant Sections, with no Front-Cover Texts, and
+with no Back-Cover Texts.  A copy of the license is included in the
+file LICENSES/GFDL-1.3-or-later.txt.
+
+=head2 Documentation license II
+
+You are free:
+
+=over 9
+
+=item B<to Share>
+
+to copy, distribute and transmit the work
+
+=item B<to Remix>
+
+to adapt the work
+
+=back
+
+Under the following conditions:
+
+=over 9
+
+=item B<Attribution>
+
+You must attribute the work in the manner specified by the author or
+licensor (but not in any way that suggests that they endorse you or
+your use of the work).
+
+=item B<Share Alike>
+
+If you alter, transform, or build upon this work, you may distribute
+the resulting work only under the same, similar or a compatible
+license.
+
+=back
+
+With the understanding that:
+
+=over 9
+
+=item B<Waiver>
+
+Any of the above conditions can be waived if you get permission from
+the copyright holder.
+
+=item B<Public Domain>
+
+Where the work or any of its elements is in the public domain under
+applicable law, that status is in no way affected by the license.
+
+=item B<Other Rights>
+
+In no way are any of the following rights affected by the license:
+
+=over 9
+
+=item *
+
+Your fair dealing or fair use rights, or other applicable
+copyright exceptions and limitations;
+
+=item *
+
+The author's moral rights;
+
+=item *
+
+Rights other persons may have either in the work itself or in
+how the work is used, such as publicity or privacy rights.
+
+=back
+
+=item B<Notice>
+
+For any reuse or distribution, you must make clear to others the
+license terms of this work.
+
+=back
+
+A copy of the full license is included in the file as
+LICENCES/CC-BY-SA-4.0.txt
+
+
+=head1 DEPENDENCIES
+
+GNU B<parcat> uses Perl.
+
+
+=head1 SEE ALSO
+
+B<cat>(1), B<parallel>(1)
+
+=cut
diff --git a/src/parset b/src/parset
new file mode 100755
index 0000000..faf6a81
--- /dev/null
+++ b/src/parset
@@ -0,0 +1,138 @@
+#!/usr/bin/env bash
+
+# Copyright (C) 2016-2022 Ole Tange, http://ole.tange.dk and Free
+# Software Foundation, Inc.
+#
+# This program is free software; you can redistribute it and/or modify
+# it under the terms of the GNU General Public License as published by
+# the Free Software Foundation; either version 3 of the License, or
+# (at your option) any later version.
+#
+# This program is distributed in the hope that it will be useful, but
+# WITHOUT ANY WARRANTY; without even the implied warranty of
+# MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the GNU
+# General Public License for more details.
+#
+# You should have received a copy of the GNU General Public License
+# along with this program; if not, see <http://www.gnu.org/licenses/>
+# or write to the Free Software Foundation, Inc., 51 Franklin St,
+# Fifth Floor, Boston, MA 02110-1301 USA
+#
+# SPDX-FileCopyrightText: 2021-2022 Ole Tange, http://ole.tange.dk and Free Software and Foundation, Inc.
+# SPDX-License-Identifier: GPL-3.0-or-later
+
+grepq() {
+    # grep -q for systems without -q
+    grep >/dev/null 2>/dev/null "$@"
+}
+
+installer() {
+    source="$1"
+    script="$2"
+    into="$3"
+    if grepq $script $into; then
+	true already installed
+    else
+	echo $source \`which $script\` >> $into
+    fi
+}
+
+while test $# -gt 0; do
+  key="$1"
+
+  case $key in
+      -i|--install)
+	  installer . env_parallel.bash  $HOME/.bashrc
+	  installer . env_parallel.sh  $HOME/.shrc
+	  installer . env_parallel.zsh   $HOME/.zshenv
+	  installer source env_parallel.ksh $HOME/.kshrc
+	  installer source env_parallel.mksh $HOME/.kshrc
+	  echo $SHELL | grepq /pdksh &&
+	      installer . env_parallel.pdksh $HOME/.profile
+	  echo $SHELL | grepq /ash &&
+	      installer . env_parallel.ash $HOME/.profile
+	  echo $SHELL | grepq /dash &&
+	      installer . env_parallel.dash $HOME/.profile
+	  installer source env_parallel.csh $HOME/.cshrc
+	  installer source env_parallel.tcsh $HOME/.tcshrc
+	  mkdir -p $HOME/.config/fish
+	  grepq env_parallel.fish $HOME/.config/fish/config.fish ||
+  	    echo '. (which env_parallel.fish)' >> $HOME/.config/fish/config.fish
+  	  echo 'Installed env_parallel in:'
+  	  echo "    " $HOME/.bashrc
+  	  echo "    " $HOME/.shrc
+  	  echo "    " $HOME/.zshenv
+  	  echo "    " $HOME/.config/fish/config.fish
+  	  echo "    " $HOME/.kshrc
+  	  echo "    " $HOME/.mkshrc
+  	  echo "    " $HOME/.profile
+  	  echo "    " $HOME/.cshrc
+  	  echo "    " $HOME/.tcshrc
+  	  exit
+      ;;
+      *)
+  	echo "Unknown option: $key"
+      ;;
+  esac
+  shift # past argument or value
+done
+
+
+cat <<'_EOS'
+
+parset only works if it is a function. The function is defined as part
+of env_parallel.
+
+Do the below and restart your shell.
+
+bash:  Put this in $HOME/.bashrc:  . `which env_parallel.bash`
+       E.g. by doing:  echo '. `which env_parallel.bash`' >> $HOME/.bashrc
+       Supports: variables, aliases, functions, arrays
+
+ksh:   Put this in $HOME/.kshrc:  source `which env_parallel.ksh`
+       E.g. by doing:  echo 'source `which env_parallel.ksh`' >> $HOME/.kshrc
+       Supports: variables, aliases, functions, arrays
+
+mksh:  Put this in $HOME/.mkshrc:  source `which env_parallel.mksh`
+       E.g. by doing:  echo 'source `which env_parallel.mksh`' >> $HOME/.mkshrc
+       Supports: variables, aliases, functions, arrays
+
+pdksh: Put this in $HOME/.profile:  source `which env_parallel.pdksh`
+       E.g. by doing:  echo '. `which env_parallel.pdksh`' >> $HOME/.profile
+       Supports: variables, aliases, functions, arrays
+
+zsh:   Put this in $HOME/.zshrc:  . `which env_parallel.zsh`
+       E.g. by doing:  echo '. `which env_parallel.zsh`' >> $HOME/.zshenv
+       Supports: variables, functions, arrays
+
+ash:   Put this in $HOME/.profile:  . `which env_parallel.ash`
+       E.g. by doing:  echo '. `which env_parallel.ash`' >> $HOME/.profile
+       Supports: variables, aliases
+
+dash:  Put this in $HOME/.profile:  . `which env_parallel.dash`
+       E.g. by doing:  echo '. `which env_parallel.dash`' >> $HOME/.profile
+       Supports: variables, aliases
+
+fish:  Unsupported
+
+csh:   Unsupported
+
+tcsh:  Unsupported
+
+To install in all shells run:
+
+  parset --install
+
+In a script you need to run this before using parset:
+
+bash:  . `which env_parallel.bash`
+ksh:   source `which env_parallel.ksh`
+mksh:  source `which env_parallel.mksh`
+pdksh: source `which env_parallel.pdksh`
+zsh:   . `which env_parallel.zsh`
+ash:   . `which env_parallel.ash`
+dash:  . `which env_parallel.dash`
+
+For details: see  man parset
+
+_EOS
diff --git a/src/parset.pod b/src/parset.pod
new file mode 100644
index 0000000..cb95ec6
--- /dev/null
+++ b/src/parset.pod
@@ -0,0 +1,327 @@
+#!/usr/bin/perl -w
+
+# SPDX-FileCopyrightText: 2021-2022 Ole Tange, http://ole.tange.dk and Free Software and Foundation, Inc.
+# SPDX-License-Identifier: GFDL-1.3-or-later
+# SPDX-License-Identifier: CC-BY-SA-4.0
+
+=encoding utf8
+
+=head1 NAME
+
+parset - set shell variables in parallel
+
+
+=head1 SYNOPSIS
+
+B<parset> I<variablename> [options for GNU Parallel]
+
+B<env_parset> I<variablename> [options for GNU Parallel]
+
+=head1 DESCRIPTION
+
+B<parset> is a shell function that puts the output from GNU
+B<parallel> into shell variables.
+
+B<env_parset> is a shell function that puts the output from
+B<env_parallel> into shell variables.
+
+The B<parset> and B<env_parset> functions are defined as part of
+B<env_parallel>.
+
+If I<variablename> is a single variable name, this will be treated as
+the destination variable. If the variable is defined as an associative
+array (using B<typeset -A myassoc>), this will be used. Otherwise the
+variable will be made into a normal array.
+
+If I<variablename> contains multiple names separated by ',' or space,
+the names will be the destination variables. The number of names must
+be at least the number of jobs.
+
+
+=head1 OPTIONS
+
+Same as GNU B<parallel>, but they are put I<after> the destination
+variable.
+
+
+=head1 SUPPORTED SHELLS
+
+=head2 Bash/Zsh/Ksh/Mksh
+
+=head3 Examples
+
+Put output into B<myarray>:
+
+  parset myarray seq 3 ::: 4 5 6
+  echo "${myarray[1]}"
+
+Put output into vars B<$seq, $pwd, $ls>:
+
+  parset "seq pwd ls" ::: "seq 10" pwd ls
+  echo "$ls"
+
+Put output into vars B<$seq, $pwd, $ls>:
+
+  into_vars=(seq pwd ls)
+  parset "${into_vars[*]}" ::: "seq 10" pwd ls
+  echo "$ls"
+
+Put output into associative array B<myassoc> (not supported for mksh):
+
+  typeset -A myassoc
+  parset myassoc seq ::: 4 5 ::: 6 7
+  echo "${myassoc[4 7]}"
+
+The commands to run can be an array:
+
+  cmd=("echo first" "echo '<<joe  \"double  space\"  cartoon>>'" "pwd")
+  parset data ::: "${cmd[@]}"
+  echo "${data[1]}"
+  echo "${data[2]}"
+
+B<parset> can read from stdin (standard input) if it is a file:
+
+  parset res echo < parallel_input_file
+
+but B<parset> can I<not> be part of a pipe. In particular this means
+it cannot read from a pipe or write to a pipe:
+
+  seq 10 | parset res echo Does not work
+
+but must instead use a tempfile:
+
+  seq 10 > parallel_input
+  parset res echo :::: parallel_input
+  echo "${res[1]}"
+  echo "${res[9]}"
+
+or a FIFO:
+
+  mkfifo input_fifo
+  seq 30 > input_fifo &
+  parset res echo :::: input_fifo
+  echo "${res[1]}"
+  echo "${res[29]}"
+
+or Bash/Zsh/Ksh process substitution:
+
+  parset res echo :::: <(seq 100)
+  echo "${res[1]}"
+  echo "${res[99]}"
+
+
+=head3 Installation
+
+Put this in the relevant B<$HOME/.bashrc> or B<$HOME/.zshenv> or B<$HOME/.kshrc>:
+
+  . `which env_parallel.bash`
+  . `which env_parallel.zsh`
+  source `which env_parallel.ksh` 
+
+E.g. by doing:
+
+  echo '. `which env_parallel.bash`' >> $HOME/.bashrc
+  echo '. `which env_parallel.zsh`' >> $HOME/.zshenv
+  echo 'source `which env_parallel.ksh`' >> $HOME/.kshrc
+
+or by doing:
+
+  env_parallel --install
+
+
+=head2 ash/dash (FreeBSD's /bin/sh)
+
+=head3 Examples
+
+ash does not support arrays.
+
+Put output into vars B<$seq, $pwd, $ls>:
+
+  parset "seq pwd ls" ::: "seq 10" pwd ls
+  echo "$ls"
+
+B<parset> can read from stdin (standard input) if it is a file:
+
+  parset res1,res2,res3 echo < parallel_input_file
+
+but B<parset> can not be part of a pipe. In particular this means it
+cannot read from a pipe or write to a pipe:
+
+  seq 3 | parset res1,res2,res3 echo Does not work
+
+but must instead use a tempfile:
+
+  seq 3 > parallel_input
+  parset res1,res2,res3 echo :::: parallel_input
+  echo "$res1"
+  echo "$res2"
+  echo "$res3"
+
+or a FIFO:
+
+  mkfifo input_fifo
+  seq 3 > input_fifo &
+  parset res1,res2,res3 echo :::: input_fifo
+  echo "$res1"
+  echo "$res2"
+  echo "$res3"
+
+=head3 Installation
+
+Put the relevant one of these into B<$HOME/.profile>:
+
+  . `which env_parallel.sh`
+  . `which env_parallel.ash`
+  . `which env_parallel.dash`
+
+E.g. by doing:
+
+  echo '. `which env_parallel.ash`' >> $HOME/.bashrc
+
+or by doing:
+
+  env_parallel --install
+
+
+=head1 EXIT STATUS
+
+Same as GNU B<parallel>.
+
+
+=head1 AUTHOR
+
+When using GNU B<parallel> for a publication please cite:
+
+O. Tange (2011): GNU Parallel - The Command-Line Power Tool, ;login:
+The USENIX Magazine, February 2011:42-47.
+
+This helps funding further development; and it won't cost you a cent.
+If you pay 10000 EUR you should feel free to use GNU Parallel without citing.
+
+Copyright (C) 2007-10-18 Ole Tange, http://ole.tange.dk
+
+Copyright (C) 2008-2010 Ole Tange, http://ole.tange.dk
+
+Copyright (C) 2010-2022 Ole Tange, http://ole.tange.dk and Free
+Software Foundation, Inc.
+
+
+=head1 LICENSE
+
+This program is free software; you can redistribute it and/or modify
+it under the terms of the GNU General Public License as published by
+the Free Software Foundation; either version 3 of the License, or
+at your option any later version.
+
+This program is distributed in the hope that it will be useful,
+but WITHOUT ANY WARRANTY; without even the implied warranty of
+MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the
+GNU General Public License for more details.
+
+You should have received a copy of the GNU General Public License
+along with this program.  If not, see <http://www.gnu.org/licenses/>.
+
+=head2 Documentation license I
+
+Permission is granted to copy, distribute and/or modify this
+documentation under the terms of the GNU Free Documentation License,
+Version 1.3 or any later version published by the Free Software
+Foundation; with no Invariant Sections, with no Front-Cover Texts, and
+with no Back-Cover Texts.  A copy of the license is included in the
+file LICENSES/GFDL-1.3-or-later.txt.
+
+=head2 Documentation license II
+
+You are free:
+
+=over 9
+
+=item B<to Share>
+
+to copy, distribute and transmit the work
+
+=item B<to Remix>
+
+to adapt the work
+
+=back
+
+Under the following conditions:
+
+=over 9
+
+=item B<Attribution>
+
+You must attribute the work in the manner specified by the author or
+licensor (but not in any way that suggests that they endorse you or
+your use of the work).
+
+=item B<Share Alike>
+
+If you alter, transform, or build upon this work, you may distribute
+the resulting work only under the same, similar or a compatible
+license.
+
+=back
+
+With the understanding that:
+
+=over 9
+
+=item B<Waiver>
+
+Any of the above conditions can be waived if you get permission from
+the copyright holder.
+
+=item B<Public Domain>
+
+Where the work or any of its elements is in the public domain under
+applicable law, that status is in no way affected by the license.
+
+=item B<Other Rights>
+
+In no way are any of the following rights affected by the license:
+
+=over 2
+
+=item *
+
+Your fair dealing or fair use rights, or other applicable
+copyright exceptions and limitations;
+
+=item *
+
+The author's moral rights;
+
+=item *
+
+Rights other persons may have either in the work itself or in
+how the work is used, such as publicity or privacy rights.
+
+=back
+
+=back
+
+=over 9
+
+=item B<Notice>
+
+For any reuse or distribution, you must make clear to others the
+license terms of this work.
+
+=back
+
+A copy of the full license is included in the file as
+LICENCES/CC-BY-SA-4.0.txt
+
+=head1 DEPENDENCIES
+
+B<parset> uses GNU B<parallel>.
+
+
+=head1 SEE ALSO
+
+B<parallel>(1), B<env_parallel>(1), B<bash>(1).
+
+
+=cut
diff --git a/src/parsort b/src/parsort
new file mode 100755
index 0000000..64c64c0
--- /dev/null
+++ b/src/parsort
@@ -0,0 +1,423 @@
+#!/usr/bin/perl
+
+# SPDX-FileCopyrightText: 2021-2022 Ole Tange, http://ole.tange.dk and Free Software and Foundation, Inc.
+# SPDX-License-Identifier: GPL-3.0-or-later
+
+=pod
+
+=head1 NAME
+
+parsort - Sort (big files) in parallel
+
+
+=head1 SYNOPSIS
+
+B<parsort> I<options for sort>
+
+
+=head1 DESCRIPTION
+
+B<parsort> uses GNU B<sort> to sort in parallel. It works just like
+B<sort> but faster on inputs with more than 1 M lines, if you have a
+multicore machine.
+
+Hopefully these ideas will make it into GNU B<sort> in the future.
+
+
+=head1 EXAMPLE
+
+Sort files:
+
+  parsort *.txt > sorted.txt
+
+Sort stdin (standard input) numerically:
+
+  cat numbers | parsort -n > sorted.txt
+
+
+=head1 PERFORMANCE
+
+B<parsort> is faster on a file than on stdin (standard input), because
+different parts of a file can be read in parallel.
+
+On a 48 core machine you should see a speedup of 3x over B<sort>.
+
+
+=head1 AUTHOR
+
+Copyright (C) 2020-2022 Ole Tange,
+http://ole.tange.dk and Free Software Foundation, Inc.
+
+
+=head1 LICENSE
+
+Copyright (C) 2012 Free Software Foundation, Inc.
+
+This program is free software; you can redistribute it and/or modify
+it under the terms of the GNU General Public License as published by
+the Free Software Foundation; either version 3 of the License, or
+at your option any later version.
+
+This program is distributed in the hope that it will be useful,
+but WITHOUT ANY WARRANTY; without even the implied warranty of
+MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the
+GNU General Public License for more details.
+
+You should have received a copy of the GNU General Public License
+along with this program.  If not, see <http://www.gnu.org/licenses/>.
+
+
+=head1 DEPENDENCIES
+
+B<parsort> uses B<sort>, B<bash>, and B<parallel>.
+
+
+=head1 SEE ALSO
+
+B<sort>
+
+
+=cut
+
+use strict;
+use Getopt::Long;
+use POSIX qw(mkfifo);
+
+Getopt::Long::Configure("bundling","require_order");
+
+my @ARGV_before = @ARGV;
+
+GetOptions(
+    "debug|D" => \$opt::D,
+    "version" => \$opt::version,
+    "verbose|v" => \$opt::verbose,
+    "b|ignore-leading-blanks" => \$opt::ignore_leading_blanks,
+    "d|dictionary-order" => \$opt::dictionary_order,
+    "f|ignore-case" => \$opt::ignore_case,
+    "g|general-numeric-sort" => \$opt::general_numeric_sort,
+    "i|ignore-nonprinting" => \$opt::ignore_nonprinting,
+    "M|month-sort" => \$opt::month_sort,
+    "h|human-numeric-sort" => \$opt::human_numeric_sort,
+    "n|numeric-sort" => \$opt::numeric_sort,
+    "N|numascii" => \$opt::numascii,
+    "r|reverse" => \$opt::reverse,
+    "R|random-sort" => \$opt::random_sort,
+    "sort=s" => \$opt::sort,
+    "V|version-sort" => \$opt::version_sort,
+    "k|key=s" => \@opt::key,
+    "t|field-separator=s" => \$opt::field_separator,
+    "z|zero-terminated" => \$opt::zero_terminated,
+    "files0-from=s" => \$opt::files0_from,
+    "random-source=s" => \$opt::dummy,
+    "batch-size=s" => \$opt::dummy,
+    "check=s" => \$opt::dummy,
+    "c" => \$opt::dummy,
+    "C" => \$opt::dummy,
+    "compress-program=s" => \$opt::dummy,
+    "T|temporary-directory=s" => \$opt::dummy,
+    "parallel=s" => \$opt::dummy,
+    "u|unique" => \$opt::dummy,
+    "S|buffer-size=s" => \$opt::dummy,
+    "s|stable" => \$opt::dummy,
+    "help" => \$opt::dummy,
+    ) || exit(255);
+$Global::progname = ($0 =~ m:(^|/)([^/]+)$:)[1];
+$Global::version = 20221122;
+if($opt::version) { version(); exit 0; }
+@Global::sortoptions = grep { ! /^-D$/ }
+    shell_quote(@ARGV_before[0..($#ARGV_before-$#ARGV-1)]);
+
+$ENV{'TMPDIR'} ||= "/tmp";
+
+sub merge {
+    # Input:
+    #   @cmd = commands to 'cat' (part of) a file
+    # 'cat a' 'cat b' 'cat c' =>
+    # sort -m <(sort -m <(cat a) <(cat b)) <(sort -m <(cat c))
+    my @cmd = @_;
+    chomp(@cmd);
+    while($#cmd > 0) {
+	my @tmp;
+	while($#cmd >= 0) {
+	    my $a = shift @cmd;
+	    my $b = shift @cmd;
+	    $a &&= "<($a)";
+	    $b &&= "<($b)";
+	    # This looks like useless use of 'cat', but contrary to
+	    # naive belief it increases performance dramatically.
+	    push @tmp, "sort -m @Global::sortoptions $a $b | cat"
+	}
+	@cmd = @tmp;
+    }
+    return @cmd;
+}
+
+sub sort_files {
+    # Input is files
+    my @files = @_;
+    # Let GNU Parallel generate the commands to read parts of files
+    # The commands split at \n (or \0)
+    # and there will be at least one for each CPU thread
+    my @subopt = $opt::zero_terminated ? qw(--recend "\0") : ();
+    open(my $par,"-|",qw(parallel), @subopt,
+	 qw(--pipepart --block -1 --dryrun -vv sort),
+	 @Global::sortoptions, '::::', @files) || die;
+    my @cmd = merge(<$par>);
+    close $par;
+    debug(@cmd);
+    # The command uses <(...) so it is incompatible with /bin/sh
+    open(my $bash,"|-","bash") || die;
+    print $bash @cmd;
+    close $bash;
+}
+
+sub sort_stdin {
+    # Input is stdin
+    # Spread the input between n processes that each sort
+    # n = number of CPU threads
+    my $numthreads = `parallel --number-of-threads`;
+    my @fifos = map { tmpfifo() } 1..$numthreads;
+    map { mkfifo($_,0600) } @fifos;
+    # This trick removes the fifo as soon as it is connected in the other end
+    # (rm fifo; ...) < fifo 
+    my @cmd = (map { "(rm $_; sort @Global::sortoptions) < $_" }
+	       map { Q($_) } @fifos);
+    @cmd = merge(@cmd);
+    if(fork) {
+    } else {
+	my @subopt = $opt::zero_terminated ? qw(--recend "\0") : ();
+	exec(qw(parallel -j), $numthreads, @subopt,
+	     # 286k is the best mean value after testing 250..350
+	     qw(--block 286k --pipe --roundrobin cat > {} :::),@fifos);
+    }
+    # The command uses <(...) so it is incompatible with /bin/sh
+    open(my $bash,"|-","bash") || die;
+    print $bash @cmd;
+    close $bash;   
+}
+
+sub tmpname {
+    # Select a name that does not exist
+    # Do not create the file as it may be used for creating a socket (by tmux)
+    # Remember the name in $Global::unlink to avoid hitting the same name twice
+    my $name = shift;
+    my($tmpname);
+    if(not -w $ENV{'TMPDIR'}) {
+	if(not -e $ENV{'TMPDIR'}) {
+	    ::error("Tmpdir '$ENV{'TMPDIR'}' does not exist.","Try 'mkdir ".
+		    Q($ENV{'TMPDIR'})."'");
+	} else {
+	    ::error("Tmpdir '$ENV{'TMPDIR'}' is not writable.","Try 'chmod +w ".
+		    Q($ENV{'TMPDIR'})."'");
+	}
+	exit(255);
+    }
+    do {
+	$tmpname = $ENV{'TMPDIR'}."/".$name.
+	    join"", map { (0..9,"a".."z","A".."Z")[rand(62)] } (1..5);
+    } while(-e $tmpname);
+    return $tmpname;
+}
+
+sub tmpfifo {
+    # Find an unused name and mkfifo on it
+    my $tmpfifo = tmpname("psort");
+    mkfifo($tmpfifo,0600);
+    return $tmpfifo;
+}
+
+sub debug {
+    # Returns: N/A
+    $opt::D or return;
+    @_ = grep { defined $_ ? $_ : "" } @_;
+    print STDERR @_[1..$#_];
+}
+
+sub version() {
+    # Returns: N/A
+    print join
+	("\n",
+	 "GNU $Global::progname $Global::version",
+	 "Copyright (C) 2020-2022 Ole Tange, http://ole.tange.dk and Free Software",
+	 "Foundation, Inc.",
+	 "License GPLv3+: GNU GPL version 3 or later <https://gnu.org/licenses/gpl.html>",
+	 "This is free software: you are free to change and redistribute it.",
+	 "GNU $Global::progname comes with no warranty.",
+	 "",
+	 "Web site: https://www.gnu.org/software/parallel\n",
+        );
+}
+
+sub shell_quote(@) {
+    # Input:
+    #   @strings = strings to be quoted
+    # Returns:
+    #   @shell_quoted_strings = string quoted as needed by the shell
+    return wantarray ? (map { Q($_) } @_) : (join" ",map { Q($_) } @_);
+}
+
+sub shell_quote_scalar_rc($) {
+    # Quote for the rc-shell
+    my $a = $_[0];
+    if(defined $a) {
+	if(($a =~ s/'/''/g)
+	   +
+	   ($a =~ s/[\n\002-\011\013-\032\\\#\?\`\(\)\{\}\[\]\^\*\<\=\>\~\|\; \"\!\$\&\'\202-\377]+/'$&'/go)) {
+	    # A string was replaced
+	    # No need to test for "" or \0
+	} elsif($a eq "") {
+	    $a = "''";
+	} elsif($a eq "\0") {
+	    $a = "";
+	}
+    }
+    return $a;
+}
+
+sub shell_quote_scalar_csh($) {
+    # Quote for (t)csh
+    my $a = $_[0];
+    if(defined $a) {
+	# $a =~ s/([\002-\011\013-\032\\\#\?\`\(\)\{\}\[\]\^\*\>\<\~\|\; \"\!\$\&\'\202-\377])/\\$1/g;
+	# This is 1% faster than the above
+	if(($a =~ s/[\002-\011\013-\032\\\#\?\`\(\)\{\}\[\]\^\*\<\=\>\~\|\; \"\!\$\&\'\202-\377]/\\$&/go)
+	   +
+	   # quote newline in csh as \\\n
+	   ($a =~ s/[\n]/"\\\n"/go)) {
+	    # A string was replaced
+	    # No need to test for "" or \0
+	} elsif($a eq "") {
+	    $a = "''";
+	} elsif($a eq "\0") {
+	    $a = "";
+	}
+    }
+    return $a;
+}
+
+sub shell_quote_scalar_default($) {
+    # Quote for other shells (Bourne compatibles)
+    # Inputs:
+    #   $string = string to be quoted
+    # Returns:
+    #   $shell_quoted = string quoted as needed by the shell
+    my $s = $_[0];
+    if($s =~ /[^-_.+a-z0-9\/]/i) {
+	$s =~ s/'/'"'"'/g; # "-quote single quotes
+	$s = "'$s'";       # '-quote entire string
+	$s =~ s/^''//;     # Remove unneeded '' at ends
+	$s =~ s/''$//;     # (faster than s/^''|''$//g)
+	return $s;
+    } elsif ($s eq "") {
+	return "''";
+    } else {
+	# No quoting needed
+	return $s;
+    }
+}
+
+sub shell_quote_scalar($) {
+    # Quote the string so the shell will not expand any special chars
+    # Inputs:
+    #   $string = string to be quoted
+    # Returns:
+    #   $shell_quoted = string quoted as needed by the shell
+
+    # Speed optimization: Choose the correct shell_quote_scalar_*
+    # and call that directly from now on
+    no warnings 'redefine';
+    if($Global::cshell) {
+	# (t)csh
+	*shell_quote_scalar = \&shell_quote_scalar_csh;
+    } elsif($Global::shell =~ m:(^|/)rc$:) {
+	# rc-shell
+	*shell_quote_scalar = \&shell_quote_scalar_rc;
+    } else {
+	# other shells
+	*shell_quote_scalar = \&shell_quote_scalar_default;
+    }
+    # The sub is now redefined. Call it
+    return shell_quote_scalar($_[0]);
+}
+
+sub Q($) {
+    # Q alias for ::shell_quote_scalar
+    my $ret = shell_quote_scalar($_[0]);
+    no warnings 'redefine';
+    *Q = \&::shell_quote_scalar;
+    return $ret;
+}
+
+
+sub status(@) {
+    my @w = @_;
+    my $fh = $Global::status_fd || *STDERR;
+    print $fh map { ($_, "\n") } @w;
+    flush $fh;
+}
+
+sub status_no_nl(@) {
+    my @w = @_;
+    my $fh = $Global::status_fd || *STDERR;
+    print $fh @w;
+    flush $fh;
+}
+
+sub warning(@) {
+    my @w = @_;
+    my $prog = $Global::progname || "parsort";
+    status_no_nl(map { ($prog, ": Warning: ", $_, "\n"); } @w);
+}
+
+{
+    my %warnings;
+    sub warning_once(@) {
+	my @w = @_;
+	my $prog = $Global::progname || "parsort";
+	$warnings{@w}++ or
+	    status_no_nl(map { ($prog, ": Warning: ", $_, "\n"); } @w);
+    }
+}
+
+sub error(@) {
+    my @w = @_;
+    my $prog = $Global::progname || "parsort";
+    status(map { ($prog.": Error: ". $_); } @w);
+}
+
+sub die_bug($) {
+    my $bugid = shift;
+    print STDERR
+	("$Global::progname: This should not happen. You have found a bug. ",
+	 "Please follow\n",
+	 "https://www.gnu.org/software/parallel/man.html#REPORTING-BUGS\n",
+	 "\n",
+	 "Include this in the report:\n",
+	 "* The version number: $Global::version\n",
+	 "* The bugid: $bugid\n",
+	 "* The command line being run\n",
+	 "* The files being read (put the files on a webserver if they are big)\n",
+	 "\n",
+	 "If you get the error on smaller/fewer files, please include those instead.\n");
+    exit(255);
+}
+
+if(@ARGV) {
+    sort_files(@ARGV);
+} elsif(length $opt::files0_from) {
+    $/="\0";
+    open(my $fh,"<",$opt::files0_from) || die;
+    my @files = <$fh>;
+    chomp(@files);
+    sort_files(@files);
+} else {
+    sort_stdin();
+}
+
+# Test
+# -z
+# OK: cat bigfile | parsort
+# OK: parsort -k4n files*.txt
+# OK: parsort files*.txt
+# OK: parsort "file with space"
+	
diff --git a/src/pod2graph b/src/pod2graph
new file mode 100755
index 0000000..a7be100
--- /dev/null
+++ b/src/pod2graph
@@ -0,0 +1,128 @@
+#!/usr/bin/perl
+
+# Copyright (C) 2007-2022 Ole Tange, http://ole.tange.dk and Free
+# Software Foundation, Inc.
+#
+# This program is free software; you can redistribute it and/or modify
+# it under the terms of the GNU General Public License as published by
+# the Free Software Foundation; either version 3 of the License, or
+# (at your option) any later version.
+#
+# This program is distributed in the hope that it will be useful, but
+# WITHOUT ANY WARRANTY; without even the implied warranty of
+# MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the GNU
+# General Public License for more details.
+#
+# You should have received a copy of the GNU General Public License
+# along with this program; if not, see <https://www.gnu.org/licenses/>
+# or write to the Free Software Foundation, Inc., 51 Franklin St,
+# Fifth Floor, Boston, MA 02110-1301 USA
+#
+# SPDX-FileCopyrightText: 2021-2022 Ole Tange, http://ole.tange.dk and Free Software and Foundation, Inc.
+# SPDX-License-Identifier: GPL-3.0-or-later
+
+# Convert .pod file containing:
+#
+#   =item --option
+#   
+#   See also: --other-option
+#
+# to a graph.pdf with link between --option and --other-option
+
+$pod=join("",<>);
+# Remove stuff before OPTIONS
+$pod=~s/^.*=head1 OPTIONS//s;
+# Remove from EXAMPLES (which is next section) and till end
+$pod=~s/=head1 EXAMPLES.*//s;
+# Remove =over / =back pairs
+$pod=~s/^.*?=over//s;
+$pod=~s/=back\s*$//s;
+$pod=~s/=over.*?=back//sg;
+
+$in_text = 0;
+$in_item = 0;
+$in_see_also = 0;
+
+for(split(/\n\n+/,$pod)) {
+    if(/^See also:\s+(\S.*)/s) {
+	# "See also" paragraph
+	$lex = "seealso";
+	$in_text = 0;
+	$in_item = 0;
+	$in_see_only = 1;
+    } elsif(/^=item\s+(B<[{]=.*?perl expression.*?=[}]>|[IB]<.*?>)(\s|$)/s) {
+	# "=item" paragraph
+	$lex = "item";
+	$in_text = 0;
+	$in_item = 1;
+	$in_see_only = 0;
+    } elsif(/\S/) {
+	# else it is just text
+	$lex = "text";
+	$in_text = 1;
+	$in_item = 0;
+	$in_see_only = 0;
+    }
+  
+    if($lex eq "seealso") {
+	# We found "See also": output edge
+	if($lastlex eq "item") {
+	    @saveditems = @items;
+	    @items = ();
+	}
+	my $to = $1;
+	# Edge from = item/item/item
+	my $from = (join "/",
+		    map {
+			s/I<(.*?)>/$1/g;
+			s/B<(.*?)>/$1/g;
+			$_ }
+		    @saveditems[0]);
+	my @to;
+	while($to =~ s/(B<[{]=.*?perl expression.*?=[}]>|[BI]<.*?>)(\s|$)//) {
+	    my $v = $1;
+	    push @to, map {
+			      s/I<(.*?)>/$1/g;
+			      s/B<(.*?)>/$1/g;
+			      $_;
+	    } $v;
+	}
+	map {
+	    if(not $seen{$from,$_}++
+	       and
+	       not $seen{$_,$from}++) {
+		push @nodelines, "\"$from\" -- \"$_\"\n"
+	    }
+	} @to;
+	
+    } elsif($lex eq "text") {
+	if($lastlex eq "item") {
+	    @saveditems = @items;
+	    @items = ();
+	}
+    } elsif($lex eq "item") {
+	push(@items,$1);
+    }	
+    $lastlex=$lex;
+}
+
+
+sub header() {
+    return q[
+	graph test123 {
+	    graph [splines=true; overlap=false;];
+	    labelloc="t";
+	    label="Related map for options for GNU Parallel\nFind the options you use and learn about the options related to it";fontsize=33;
+	    
+	    "{}"[margin=0.3;]
+		"--sshlogin"[margin=0.3;]
+		"--pipe"[margin=0.3;]
+		":::"[margin=0.3;]
+		"-X"[margin=0.3;]
+	];
+}
+
+open(GRAPHVIZ,"|-","tee foo.dot |neato -Gepsilon=.000000001 -Tpdf") || die;
+print GRAPHVIZ header(), (sort { rand()*3 -1 } @nodelines), "}";
+close GRAPHVIZ;
+
diff --git a/src/sem b/src/sem
new file mode 100755
index 0000000..e0b654e
--- /dev/null
+++ b/src/sem
@@ -0,0 +1,14979 @@
+#!/usr/bin/env perl
+
+# Copyright (C) 2007-2022 Ole Tange, http://ole.tange.dk and Free
+# Software Foundation, Inc.
+#
+# This program is free software; you can redistribute it and/or modify
+# it under the terms of the GNU General Public License as published by
+# the Free Software Foundation; either version 3 of the License, or
+# (at your option) any later version.
+#
+# This program is distributed in the hope that it will be useful, but
+# WITHOUT ANY WARRANTY; without even the implied warranty of
+# MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU
+# General Public License for more details.
+#
+# You should have received a copy of the GNU General Public License
+# along with this program; if not, see <https://www.gnu.org/licenses/>
+# or write to the Free Software Foundation, Inc., 51 Franklin St,
+# Fifth Floor, Boston, MA 02110-1301 USA
+#
+# SPDX-FileCopyrightText: 2021-2022 Ole Tange, http://ole.tange.dk and Free Software and Foundation, Inc.
+# SPDX-License-Identifier: GPL-3.0-or-later
+
+# open3 used in Job::start
+use IPC::Open3;
+use POSIX;
+# gensym used in Job::start
+use Symbol qw(gensym);
+# tempfile used in Job::start
+use File::Temp qw(tempfile tempdir);
+# mkpath used in openresultsfile
+use File::Path;
+# GetOptions used in get_options_from_array
+use Getopt::Long;
+# Used to ensure code quality
+use strict;
+use File::Basename;
+
+sub set_input_source_header($$) {
+    my ($command_ref,$input_source_fh_ref) = @_;
+    if(defined $opt::header and not $opt::pipe) {
+	# split with colsep or \t
+	# $header force $colsep = \t if undef?
+	my $delimiter = defined $opt::colsep ? $opt::colsep : "\t";
+	# regexp for {=
+	my $left = "\Q$Global::parensleft\E";
+	my $l = $Global::parensleft;
+	# regexp for =}
+	my $right = "\Q$Global::parensright\E";
+	my $r = $Global::parensright;
+	if($opt::header ne "0") {
+	    my $id = 1;
+	    for my $fh (@$input_source_fh_ref) {
+		my $line = <$fh>;
+		chomp($line);
+		$line =~ s/\r$//;
+		::debug("init", "Delimiter: '$delimiter'");
+		for my $s (split /$delimiter/o, $line) {
+		    ::debug("init", "Colname: '$s'");
+		    # Replace {colname} with {2}
+		    for(@$command_ref, @Global::ret_files,
+			@Global::transfer_files, $opt::tagstring,
+			$opt::workdir, $opt::results, $opt::retries,
+			@Global::template_contents, @Global::template_names,
+			@opt::filter) {
+			# Skip if undefined
+			$_ or next;
+		      s:\{$s(|/|//|\.|/\.)\}:\{$id$1\}:g;
+			# {=header1 ... =}  =>  {=1 ... =}
+		      s:$left $s (.*?) $right:$l$id$1$r:gx;
+		    }
+		    $Global::input_source_header{$id} = $s;
+		    $id++;
+		}
+	    }
+	}
+	# Make it possible to do:
+	# parallel --header 0 echo {file2} {file1} :::: file1 file2
+	my $id = 1;
+	for my $s (@opt::a) {
+	    # ::: are put into files and given a filehandle
+	    # ignore these and only keep the filenames.
+	    fileno $s and next;
+	    for(@$command_ref, @Global::ret_files,
+		@Global::transfer_files, $opt::tagstring,
+		$opt::workdir, $opt::results, $opt::retries,
+		@Global::template_contents, @Global::template_names,
+		@opt::filter) {
+		# Skip if undefined
+		$_ or next;
+	      s:\{$s(|/|//|\.|/\.)\}:\{$id$1\}:g;
+		# {=header1 ... =}  =>  {=1 ... =}
+	      s:$left $s (.*?) $right:$l$id$1$r:gx;
+	    }
+	    $Global::input_source_header{$id} = $s;
+	    $id++;
+	}
+    } else {
+	my $id = 1;
+	for my $fh (@$input_source_fh_ref) {
+	    $Global::input_source_header{$id} = $id;
+	    $id++;
+	}
+    }
+}
+
+sub max_jobs_running() {
+    # Compute $Global::max_jobs_running as the max number of jobs
+    # running on each sshlogin.
+    # Returns:
+    #   $Global::max_jobs_running
+    if(not $Global::max_jobs_running) {
+	for my $sshlogin (values %Global::host) {
+	    $sshlogin->max_jobs_running();
+	}
+    }
+    if(not $Global::max_jobs_running) {
+	::error("Cannot run any jobs.");
+	wait_and_exit(255);
+    }
+    return $Global::max_jobs_running;
+}
+
+sub halt() {
+    # Compute exit value,
+    # wait for children to complete
+    # and exit
+    if($opt::halt and $Global::halt_when ne "never") {
+	if(not defined $Global::halt_exitstatus) {
+	    if($Global::halt_pct) {
+		$Global::halt_exitstatus =
+		    ::ceil($Global::total_failed /
+			   ($Global::total_started || 1) * 100);
+	    } elsif($Global::halt_count) {
+		$Global::halt_exitstatus =
+		    ::min(undef_as_zero($Global::total_failed),101);
+	    }
+	}
+	wait_and_exit($Global::halt_exitstatus);
+    } else {
+	if($Global::semaphore) {
+	    # --semaphore runs a single job:
+	    # Use exit value of that
+	    wait_and_exit($Global::halt_exitstatus);
+	} else {
+	    # 0 = all jobs succeeded
+	    # 1-100 = n jobs failed
+	    # 101 = >100 jobs failed
+	    wait_and_exit(min(undef_as_zero($Global::exitstatus),101));
+	}
+    }
+}
+
+
+sub __PIPE_MODE__() {}
+
+
+sub pipepart_setup() {
+    # Compute the blocksize
+    # Generate the commands to extract the blocks
+    # Push the commands on queue
+    # Changes:
+    #   @Global::cat_prepends
+    #   $Global::JobQueue
+    if($opt::tee) {
+	# Prepend each command with
+	#   < file
+	my $cat_string = "< ".Q($opt::a[0]);
+	for(1..$Global::JobQueue->total_jobs()) {
+	    push @Global::cat_appends, $cat_string;
+	    push @Global::cat_prepends, "";
+	}
+    } else {
+	if(not $opt::blocksize) {
+	    # --blocksize with 10 jobs per jobslot
+	    $opt::blocksize = -10;
+	}
+	if($opt::roundrobin) {
+	    # --blocksize with 1 job per jobslot
+	    $opt::blocksize = -1;
+	}
+	if($opt::blocksize < 0) {
+	    my $size = 0;
+	    # Compute size of -a
+	    for(@opt::a) {
+		if(-f $_) {
+		    $size += -s $_;
+		} elsif(-b $_) {
+		    $size += size_of_block_dev($_);
+		} elsif(-e $_) {
+		    ::error("$_ is neither a file nor a block device");
+		    wait_and_exit(255);
+		} else {
+		    ::error("File not found: $_");
+		    wait_and_exit(255);
+		}
+	    }
+	    # Run in total $job_slots*(- $blocksize) jobs
+	    # Set --blocksize = size / no of proc / (- $blocksize)
+	    $Global::dummy_jobs = 1;
+	    $Global::blocksize = 1 +
+		int($size / max_jobs_running() /
+		    -multiply_binary_prefix($opt::blocksize));
+	}
+	@Global::cat_prepends = (map { pipe_part_files($_) }
+				 # ::: are put into files and given a filehandle
+				 # ignore these and only keep the filenames.
+				 grep { ! fileno $_ } @opt::a);
+	# Unget the empty arg as many times as there are parts
+	$Global::JobQueue->{'commandlinequeue'}{'arg_queue'}->unget(
+	    map { [Arg->new("\0noarg")] } @Global::cat_prepends
+	    );
+    }
+}
+
+sub pipe_tee_setup() {
+    # Create temporary fifos
+    # Run 'tee fifo1 fifo2 fifo3 ... fifoN' in the background
+    # This will spread the input to fifos
+    # Generate commands that reads from fifo1..N:
+    #	cat fifo | user_command
+    # Changes:
+    #	@Global::cat_prepends
+    my @fifos;
+    for(1..$Global::JobQueue->total_jobs()) {
+	push @fifos, tmpfifo();
+    }
+    # cat foo | tee fifo1 fifo2 fifo3 fifo4 fifo5 > /dev/null
+    if(not fork()){
+	# Test if tee supports --output-error=warn-nopipe
+	`echo | tee --output-error=warn-nopipe /dev/null >/dev/null 2>/dev/null`;
+	my $opt = $? ? "" : "--output-error=warn-nopipe";
+	::debug("init","tee $opt");
+	if($opt::dryrun) {
+	    # This is not exactly what is run, but it gives the basic idea
+	    print "mkfifo @fifos\n";
+	    print "tee $opt @fifos >/dev/null &\n";
+	} else {
+	    # Let tee inherit our stdin
+	    # and redirect stdout to null
+	    open STDOUT, ">","/dev/null";
+	    if($opt) {
+		exec "tee", $opt, @fifos;
+	    } else {
+		exec "tee", @fifos;
+	    }
+	}
+	exit(0);
+    }
+    # For each fifo
+    #	(rm fifo1; grep 1) < fifo1
+    #	(rm fifo2; grep 2) < fifo2
+    #	(rm fifo3; grep 3) < fifo3
+    # Remove the tmpfifo as soon as it is open
+    @Global::cat_prepends = map { "(rm $_;" } @fifos;
+    @Global::cat_appends = map { ") < $_" } @fifos;
+}
+
+
+sub parcat_script() {
+    # TODO if script fails: Use parallel -j0 --plain --lb cat ::: fifos
+    my $script = q'{
+	use POSIX qw(:errno_h);
+	use IO::Select;
+	use strict;
+	use threads;
+	use Thread::Queue;
+	use Fcntl qw(:DEFAULT :flock);
+
+	my $opened :shared;
+	my $q = Thread::Queue->new();
+	my $okq = Thread::Queue->new();
+	my @producers;
+
+	if(not @ARGV) {
+	    if(-t *STDIN) {
+		print "Usage:\n";
+		print "  parcat file(s)\n";
+		print "  cat argfile | parcat\n";
+	    } else {
+		# Read arguments from stdin
+		chomp(@ARGV = <STDIN>);
+	    }
+	}
+	my $files_to_open = 0;
+	# Default: fd = stdout
+	my $fd = 1;
+	for (@ARGV) {
+	    # --rm = remove file when opened
+	    /^--rm$/ and do { $opt::rm = 1; next; };
+	    # -1 = output to fd 1, -2 = output to fd 2
+	    /^-(\d+)$/ and do { $fd = $1; next; };
+	    push @producers, threads->create("producer", $_, $fd);
+	    $files_to_open++;
+	}
+
+	sub producer {
+	    # Open a file/fifo, set non blocking, enqueue fileno of the file handle
+	    my $file = shift;
+	    my $output_fd = shift;
+	    open(my $fh, "<", $file) || do {
+		print STDERR "parcat: Cannot open $file\n";
+		exit(1);
+	    };
+	    # Remove file when it has been opened
+	    if($opt::rm) {
+		unlink $file;
+	    }
+	    set_fh_non_blocking($fh);
+	    $opened++;
+	    # Pass the fileno to parent
+	    $q->enqueue(fileno($fh),$output_fd);
+	    # Get an OK that the $fh is opened and we can release the $fh
+	    while(1) {
+		my $ok = $okq->dequeue();
+		if($ok == fileno($fh)) { last; }
+		# Not ours - very unlikely to happen
+		$okq->enqueue($ok);
+	    }
+	    return;
+	}
+
+	my $s = IO::Select->new();
+	my %buffer;
+
+	sub add_file {
+	    my $infd = shift;
+	    my $outfd = shift;
+	    open(my $infh, "<&=", $infd) || die;
+	    open(my $outfh, ">&=", $outfd) || die;
+	    $s->add($infh);
+	    # Tell the producer now opened here and can be released
+	    $okq->enqueue($infd);
+	    # Initialize the buffer
+	    @{$buffer{$infh}{$outfd}} = ();
+	    $Global::fh{$outfd} = $outfh;
+	}
+
+	sub add_files {
+	    # Non-blocking dequeue
+	    my ($infd,$outfd);
+	    do {
+		($infd,$outfd) = $q->dequeue_nb(2);
+		if(defined($outfd)) {
+		    add_file($infd,$outfd);
+		}
+	    } while(defined($outfd));
+	}
+
+	sub add_files_block {
+	    # Blocking dequeue
+	    my ($infd,$outfd) = $q->dequeue(2);
+	    add_file($infd,$outfd);
+	}
+
+
+	my $fd;
+	my (@ready,$infh,$rv,$buf);
+	do {
+	    # Wait until at least one file is opened
+	    add_files_block();
+	    while($q->pending or keys %buffer) {
+		add_files();
+		while(keys %buffer) {
+		    @ready = $s->can_read(0.01);
+		    if(not @ready) {
+			add_files();
+		    }
+		    for $infh (@ready) {
+			# There is only one key, namely the output file descriptor
+			for my $outfd (keys %{$buffer{$infh}}) {
+			    # TODO test if 60800 is optimal (2^17 is used elsewhere)
+			    $rv = sysread($infh, $buf, 60800);
+			    if (!$rv) {
+				if($! == EAGAIN) {
+				    # Would block: Nothing read
+				    next;
+				} else {
+				    # Nothing read, but would not block:
+				    # This file is done
+				    $s->remove($infh);
+				    for(@{$buffer{$infh}{$outfd}}) {
+					syswrite($Global::fh{$outfd},$_);
+				    }
+				    delete $buffer{$infh};
+				    # Closing the $infh causes it to block
+				    # close $infh;
+				    add_files();
+				    next;
+				}
+			    }
+			    # Something read.
+			    # Find \n or \r for full line
+			    my $i = (rindex($buf,"\n")+1);
+			    if($i) {
+				# Print full line
+				for(@{$buffer{$infh}{$outfd}}, substr($buf,0,$i)) {
+				    syswrite($Global::fh{$outfd},$_);
+				}
+				# @buffer = remaining half line
+				$buffer{$infh}{$outfd} = [substr($buf,$i,$rv-$i)];
+			    } else {
+				# Something read, but not a full line
+				push @{$buffer{$infh}{$outfd}}, $buf;
+			    }
+			    redo;
+			}
+		    }
+		}
+	    }
+	} while($opened < $files_to_open);
+
+	for (@producers) {
+	    $_->join();
+	}
+
+	sub set_fh_non_blocking {
+	    # Set filehandle as non-blocking
+	    # Inputs:
+	    #	$fh = filehandle to be blocking
+	    # Returns:
+	    #	N/A
+	    my $fh = shift;
+	    my $flags;
+	    fcntl($fh, &F_GETFL, $flags) || die $!; # Get the current flags on the filehandle
+	    $flags |= &O_NONBLOCK; # Add non-blocking to the flags
+	    fcntl($fh, &F_SETFL, $flags) || die $!; # Set the flags on the filehandle
+	}
+    }';
+    return ::spacefree(3, $script);
+}
+
+sub sharder_script() {
+    my $script = q{
+	use B;
+	# Column separator
+	my $sep = shift;
+	# Which columns to shard on (count from 1)
+	my $col = shift;
+	# Which columns to shard on (count from 0)
+	my $col0 = $col - 1;
+	# Perl expression
+	my $perlexpr = shift;
+	my $bins = @ARGV;
+	# Open fifos for writing, fh{0..$bins}
+	my $t = 0;
+	my %fh;
+	for(@ARGV) {
+	    open $fh{$t++}, ">", $_;
+	    # open blocks until it is opened by reader
+	    # so unlink only happens when it is ready
+	    unlink $_;
+	}
+	if($perlexpr) {
+	    my $subref = eval("sub { no strict; no warnings; $perlexpr }");
+	    while(<STDIN>) {
+		# Split into $col columns (no need to split into more)
+		@F = split $sep, $_, $col+1;
+		{
+		    local $_ = $F[$col0];
+		    &$subref();
+		    $fh = $fh{ hex(B::hash($_))%$bins };
+		}
+		print $fh $_;
+	    }
+	} else {
+	    while(<STDIN>) {
+		# Split into $col columns (no need to split into more)
+		@F = split $sep, $_, $col+1;
+		$fh = $fh{ hex(B::hash($F[$col0]))%$bins };
+		print $fh $_;
+	    }
+	}
+	# Close all open fifos
+	close values %fh;
+    };
+    return ::spacefree(1, $script);
+}
+
+sub binner_script() {
+    my $script = q{
+	use B;
+	# Column separator
+	my $sep = shift;
+	# Which columns to shard on (count from 1)
+	my $col = shift;
+	# Which columns to shard on (count from 0)
+	my $col0 = $col - 1;
+	# Perl expression
+	my $perlexpr = shift;
+	my $bins = @ARGV;
+	# Open fifos for writing, fh{0..$bins}
+	my $t = 0;
+	my %fh;
+	# Let the last output fifo be the 0'th
+	open $fh{$t++}, ">", pop @ARGV;
+	for(@ARGV) {
+	    open $fh{$t++}, ">", $_;
+	    # open blocks until it is opened by reader
+	    # so unlink only happens when it is ready
+	    unlink $_;
+	}
+	if($perlexpr) {
+	    my $subref = eval("sub { no strict; no warnings; $perlexpr }");
+	    while(<STDIN>) {
+		# Split into $col columns (no need to split into more)
+		@F = split $sep, $_, $col+1;
+		{
+		    local $_ = $F[$col0];
+		    &$subref();
+		    $fh = $fh{ $_%$bins };
+		}
+		print $fh $_;
+	    }
+	} else {
+	    while(<STDIN>) {
+		# Split into $col columns (no need to split into more)
+		@F = split $sep, $_, $col+1;
+		$fh = $fh{ $F[$col0]%$bins };
+		print $fh $_;
+	    }
+	}
+	# Close all open fifos
+	close values %fh;
+    };
+    return ::spacefree(1, $script);
+}
+
+sub pipe_shard_setup() {
+    # Create temporary fifos
+    # Run 'shard.pl sep col fifo1 fifo2 fifo3 ... fifoN' in the background
+    # This will spread the input to fifos
+    # Generate commands that reads from fifo1..N:
+    #	cat fifo | user_command
+    # Changes:
+    #	@Global::cat_prepends
+    my @shardfifos;
+    my @parcatfifos;
+    # TODO $opt::jobs should be evaluated (100%)
+    # TODO $opt::jobs should be number of total_jobs if there are arguments
+    max_jobs_running();
+    my $njobs = $Global::max_jobs_running;
+    for my $m (0..$njobs-1) {
+	for my $n (0..$njobs-1) {
+	    # sharding to A B C D
+	    # parcatting all As together
+	    $parcatfifos[$n][$m] = $shardfifos[$m][$n] = tmpfifo();
+	}
+    }
+    my $shardbin = ($opt::shard || $opt::bin);
+    my $script;
+    if($opt::bin) {
+	$script = binner_script();
+    } else {
+	$script = sharder_script();
+    }
+
+    # cat foo | sharder sep col fifo1 fifo2 fifo3 ... fifoN
+
+    if($shardbin =~ /^[a-z_][a-z_0-9]*(\s|$)/i) {
+	# Group by column name
+	# (Yes, this will also wrongly match a perlexpr like: chop)
+	my($read,$char,@line);
+	# A full line, but nothing more (the rest must be read by the child)
+	# $Global::header used to prepend block to each job
+	do {
+	    $read = sysread(STDIN,$char,1);
+	    push @line, $char;
+	} while($read and $char ne "\n");
+	$Global::header = join "", @line;
+    }
+    my ($col, $perlexpr, $subref) =
+	column_perlexpr($shardbin, $Global::header, $opt::colsep);
+    if(not fork()) {
+	# Let the sharder inherit our stdin
+	# and redirect stdout to null
+	open STDOUT, ">","/dev/null";
+	# The PERL_HASH_SEED must be the same for all sharders
+	# so B::hash will return the same value for any given input
+	$ENV{'PERL_HASH_SEED'} = $$;
+	exec qw(parallel --block 100k -q --pipe -j), $njobs,
+	    qw(--roundrobin -u perl -e), $script, ($opt::colsep || ","),
+	    $col, $perlexpr, '{}', (map { (':::+', @{$_}) } @parcatfifos);
+    }
+    # For each fifo
+    #	(rm fifo1; grep 1) < fifo1
+    #	(rm fifo2; grep 2) < fifo2
+    #	(rm fifo3; grep 3) < fifo3
+    my $parcat = Q(parcat_script());
+    if(not $parcat) {
+	::error("'parcat' must be in path.");
+	::wait_and_exit(255);
+    }
+    @Global::cat_prepends = map { "perl -e $parcat @$_ | " } @parcatfifos;
+}
+
+sub pipe_part_files(@) {
+    # Given the bigfile
+    # find header and split positions
+    # make commands that 'cat's the partial file
+    # Input:
+    #	$file = the file to read
+    # Returns:
+    #	@commands that will cat_partial each part
+    my ($file) = @_;
+    my $buf = "";
+    if(not -f $file and not -b $file) {
+	::error("--pipepart only works on seekable files, not streams/pipes.",
+		"$file is not a seekable file.");
+	::wait_and_exit(255);
+    }
+
+    my $fh = open_or_exit($file);
+    my $firstlinelen = 0;
+    if($opt::skip_first_line) {
+	my $newline;
+	# Read a full line one byte at a time
+	while($firstlinelen += sysread($fh,$newline,1,0)) {
+	    $newline eq "\n" and last;
+	}
+    }
+    my $header = find_header(\$buf,$fh);
+    # find positions
+    my @pos = find_split_positions($file,int($Global::blocksize),
+				   $header,$firstlinelen);
+    # Make @cat_prepends
+    my @cat_prepends = ();
+    for(my $i=0; $i<$#pos; $i++) {
+	push(@cat_prepends,
+	     cat_partial($file, $firstlinelen, $firstlinelen+length($header),
+			 $pos[$i], $pos[$i+1]));
+    }
+    return @cat_prepends;
+}
+
+sub find_header($$) {
+    # Compute the header based on $opt::header
+    # Input:
+    #	$buf_ref = reference to read-in buffer
+    #	$fh = filehandle to read from
+    # Uses:
+    #	$opt::header
+    #	$Global::blocksize
+    #	$Global::header
+    # Returns:
+    #	$header string
+    my ($buf_ref, $fh) = @_;
+    my $header = "";
+    # $Global::header may be set in group_by_loop()
+    if($Global::header) { return $Global::header }
+    if($opt::header) {
+	if($opt::header eq ":") { $opt::header = "(.*\n)"; }
+	# Number = number of lines
+	$opt::header =~ s/^(\d+)$/"(.*\n)"x$1/e;
+	while(sysread($fh,$$buf_ref,int($Global::blocksize),length $$buf_ref)) {
+	    if($$buf_ref =~ s/^($opt::header)//) {
+		$header = $1;
+		last;
+	    }
+	}
+    }
+    return $header;
+}
+
+sub find_split_positions($$$) {
+    # Find positions in bigfile where recend is followed by recstart
+    # Input:
+    #	$file = the file to read
+    #	$block = (minimal) --block-size of each chunk
+    #	$header = header to be skipped
+    # Uses:
+    #	$opt::recstart
+    #	$opt::recend
+    # Returns:
+    #	@positions of block start/end
+    my($file, $block, $header, $firstlinelen) = @_;
+    my $skiplen = $firstlinelen + length $header;
+    my $size = -s $file;
+    if(-b $file) {
+	# $file is a blockdevice
+	$size = size_of_block_dev($file);
+    }
+    $block = int $block;
+    if($opt::groupby) {
+	return split_positions_for_group_by($file,$size,$block,
+					    $header,$firstlinelen);
+    }
+    # The optimal dd blocksize for mint, redhat, solaris, openbsd = 2^17..2^20
+    # The optimal dd blocksize for freebsd = 2^15..2^17
+    # The optimal dd blocksize for ubuntu (AMD6376) = 2^16
+    my $dd_block_size = 131072; # 2^17
+    my @pos;
+    my ($recstart,$recend) = recstartrecend();
+    my $recendrecstart = $recend.$recstart;
+    my $fh = ::open_or_exit($file);
+    push(@pos,$skiplen);
+    for(my $pos = $block+$skiplen; $pos < $size; $pos += $block) {
+	my $buf;
+	if($recendrecstart eq "") {
+	    # records ends anywhere
+	    push(@pos,$pos);
+	} else {
+	    # Seek the the block start
+	    if(not sysseek($fh, $pos, 0)) {
+		::error("Cannot seek to $pos in $file");
+		edit(255);
+	    }
+	    while(sysread($fh,$buf,$dd_block_size,length $buf)) {
+		if($opt::regexp) {
+		    # If match /$recend$recstart/ => Record position
+		    if($buf =~ m:^(.*$recend)$recstart:os) {
+			# Start looking for next record _after_ this match
+			$pos += length($1);
+			push(@pos,$pos);
+			last;
+		    }
+		} else {
+		    # If match $recend$recstart => Record position
+		    # TODO optimize to only look at the appended
+		    #	$dd_block_size + len $recendrecstart
+		    # TODO increase $dd_block_size to optimize for longer records
+		    my $i = index64(\$buf,$recendrecstart);
+		    if($i != -1) {
+			# Start looking for next record _after_ this match
+			$pos += $i + length($recend);
+			push(@pos,$pos);
+			last;
+		    }
+		}
+	    }
+	}
+    }
+    if($pos[$#pos] != $size) {
+	# Last splitpoint was not at end of the file: add $size as the last
+	push @pos, $size;
+    }
+    close $fh;
+    return @pos;
+}
+
+sub split_positions_for_group_by($$$$) {
+    my($fh);
+    sub value_at($) {
+	my $pos = shift;
+	if($pos != 0) {
+	    seek($fh, $pos-1, 0) || die;
+	    # Read half line
+	    <$fh>;
+	}
+	# Read full line
+	my $linepos = tell($fh);
+	$_ = <$fh>;
+	if(defined $_) {
+	    # Not end of file
+	    my @F;
+	    if(defined $group_by::col) {
+		$opt::colsep ||= "\t";
+		@F = split /$opt::colsep/, $_;
+		$_ = $F[$group_by::col];
+	    }
+	    eval $group_by::perlexpr;
+	}
+	return ($_,$linepos);
+    }
+
+    sub binary_search_end($$$) {
+	my ($s,$spos,$epos) = @_;
+	# value_at($spos) == $s
+	# value_at($epos) != $s
+	my $posdif = $epos - $spos;
+	my ($v,$vpos);
+	while($posdif) {
+	    ($v,$vpos) = value_at($spos+$posdif);
+	    if($v eq $s) {
+		$spos = $vpos;
+		$posdif = $epos - $spos;
+	    } else {
+		$epos = $vpos;
+	    }
+	    $posdif = int($posdif/2);
+	}
+	return($v,$vpos);
+    }
+
+    sub binary_search_start($$$) {
+	my ($s,$spos,$epos) = @_;
+	# value_at($spos) != $s
+	# value_at($epos) == $s
+	my $posdif = $epos - $spos;
+	my ($v,$vpos);
+	while($posdif) {
+	    ($v,$vpos) = value_at($spos+$posdif);
+	    if($v eq $s) {
+		$epos = $vpos;
+	    } else {
+		$spos = $vpos;
+		$posdif = $epos - $spos;
+	    }
+	    $posdif = int($posdif/2);
+	}
+	return($v,$vpos);
+    }
+
+    my ($file,$size,$block,$header,$firstlinelen) = @_;
+    my ($a,$b,$c,$apos,$bpos,$cpos);
+    my @pos;
+    $fh = open_or_exit($file);
+    # Set $Global::group_by_column $Global::group_by_perlexpr
+    group_by_loop($fh,$opt::recsep);
+    # $xpos = linestart, $x = value at $xpos, $apos < $bpos < $cpos
+    $apos = $firstlinelen + length $header;
+    for(($a,$apos) = value_at($apos); $apos < $size;) {
+	push @pos, $apos;
+	$bpos = $apos + $block;
+	($b,$bpos) = value_at($bpos);
+	if(eof($fh)) {
+	    push @pos, $size; last;
+	}
+	$cpos = $bpos + $block;
+	($c,$cpos) = value_at($cpos);
+	if($a eq $b) {
+	    while($b eq $c) {
+		# Move bpos, cpos a block forward until $a == $b != $c
+		$bpos = $cpos;
+		$cpos += $block;
+		($c,$cpos) = value_at($cpos);
+		if($cpos >= $size) {
+		    $cpos = $size;
+		    last;
+		}
+	    }
+	    # $a == $b != $c
+	    # Binary search for $b ending between ($bpos,$cpos)
+	    ($b,$bpos) = binary_search_end($b,$bpos,$cpos);
+	} else {
+	    if($b eq $c) {
+		# $a != $b == $c
+		# Binary search for $b starting between ($apos,$bpos)
+		($b,$bpos) = binary_search_start($b,$apos,$bpos);
+	    } else {
+		# $a != $b != $c
+		# Binary search for $b ending between ($bpos,$cpos)
+		($b,$bpos) = binary_search_end($b,$bpos,$cpos);
+	    }
+	}
+	($a,$apos) = ($b,$bpos);
+    }
+    if($pos[$#pos] != $size) {
+	# Last splitpoint was not at end of the file: add it
+	push @pos, $size;
+    }
+    return @pos;
+}
+
+sub cat_partial($@) {
+    # Efficient command to copy from byte X to byte Y
+    # Input:
+    #	$file = the file to read
+    #	($start, $end, [$start2, $end2, ...]) = start byte, end byte
+    # Returns:
+    #	Efficient command to copy $start..$end, $start2..$end2, ... to stdout
+    my($file, @start_end) = @_;
+    my($start, $i);
+    # Convert (start,end) to (start,len)
+    my @start_len = map {
+	if(++$i % 2) { $start = $_; } else { $_-$start }
+    } @start_end;
+    # The optimal block size differs
+    # It has been measured on:
+    # AMD 6376: n*4k-1; small n
+    # AMD Neo N36L: 44k-200k
+    # Intel i7-3632QM: 55k-
+    # ARM Cortex A53: 4k-28k
+    # Intel i5-2410M: 36k-46k
+    #
+    # I choose 2^15-1 = 32767
+    # q{
+    #	expseq() {
+    #	    perl -E '
+    #		$last = pop @ARGV;
+    #	    $first = shift || 1;
+    #	    $inc = shift || 1.03;
+    #	    for($i=$first; $i<=$last;$i*=$inc) { say int $i }
+    #	    ' "$@"
+    #	}
+    #
+    #	seq 111111111 > big;
+    #	f() { ppar --test $1 -a big --pipepart --block -1 'md5sum > /dev/null'; }
+    #	export -f f;
+    #	expseq 1000 1.001 300000 | shuf | parallel -j1 --jl jl-md5sum f;
+    # };
+    my $script = spacefree
+	(0,
+	 q{
+	     while(@ARGV) {
+		 sysseek(STDIN,shift,0) || die;
+		 $left = shift;
+		 while($read =
+		       sysread(STDIN,$buf, $left > 32767 ? 32767 : $left)){
+		     $left -= $read;
+		     syswrite(STDOUT,$buf);
+		 }
+	     }
+	 });
+    return "<". Q($file) .
+	" perl -e '$script' @start_len |";
+}
+
+sub column_perlexpr($$$) {
+    # Compute the column number (if any), perlexpression from combined
+    # string (such as --shard key, --groupby key, {=n perlexpr=}
+    # Input:
+    #	$column_perlexpr = string with column and perl expression
+    #	$header = header from input file (if column is column name)
+    #	$colsep = column separator regexp
+    # Returns:
+    #	$col = column number
+    #	$perlexpr = perl expression
+    #	$subref = compiled perl expression as sub reference
+    my ($column_perlexpr, $header, $colsep) = @_;
+    my ($col, $perlexpr, $subref);
+    if($column_perlexpr =~ /^[-a-z0-9_]+(\s|$)/i) {
+	# Column name/number (possibly prefix)
+	if($column_perlexpr =~ s/^(-?\d+)(\s|$)//) {
+	    # Column number (possibly prefix)
+	    $col = $1;
+	} elsif($column_perlexpr =~ s/^([a-z0-9_]+)(\s+|$)//i) {
+	    # Column name (possibly prefix)
+	    my $colname = $1;
+	    # Split on --copsep pattern
+	    my @headers = split /$colsep/, $header;
+	    my %headers;
+	    @headers{@headers} = (1..($#headers+1));
+	    $col = $headers{$colname};
+	    if(not defined $col) {
+		::error("Column '$colname' $colsep not found in header",keys %headers);
+		::wait_and_exit(255);
+	    }
+	}
+    }
+    # What is left of $column_perlexpr is $perlexpr (possibly empty)
+    $perlexpr = $column_perlexpr;
+    $subref = eval("sub { no strict; no warnings; $perlexpr }");
+    return($col, $perlexpr, $subref);
+}
+
+sub group_by_loop($$) {
+    # Generate perl code for group-by loop
+    # Insert a $recsep when the column value changes
+    # The column value can be computed with $perlexpr
+    my($fh,$recsep) = @_;
+    my $groupby = $opt::groupby;
+    if($groupby =~ /^[a-z_][a-z_0-9]*(\s|$)/i) {
+	# Group by column name
+	# (Yes, this will also wrongly match a perlexpr like: chop)
+	my($read,$char,@line);
+	# Read a full line, but nothing more
+	# (the rest must be read by the child)
+	# $Global::header used to prepend block to each job
+	do {
+	    $read = sysread($fh,$char,1);
+	    push @line, $char;
+	} while($read and $char ne "\n");
+	$Global::header = join "", @line;
+    }
+    $opt::colsep ||= "\t";
+    ($group_by::col, $group_by::perlexpr, $group_by::subref) =
+	column_perlexpr($groupby, $Global::header, $opt::colsep);
+    # Numbered 0..n-1 due to being used by $F[n]
+    if($group_by::col) { $group_by::col--; }
+
+    my $loop = ::spacefree(0,q{
+	BEGIN{ $last = "RECSEP"; }
+	{
+	    local $_=COLVALUE;
+	    PERLEXPR;
+	    if(($last) ne $_) {
+		print "RECSEP";
+		$last = $_;
+	    }
+	}
+			   });
+    if(defined $group_by::col) {
+	$loop =~ s/COLVALUE/\$F[$group_by::col]/g;
+    } else {
+	$loop =~ s/COLVALUE/\$_/g;
+    }
+    $loop =~ s/PERLEXPR/$group_by::perlexpr/g;
+    $loop =~ s/RECSEP/$recsep/g;
+    return $loop;
+}
+
+sub pipe_group_by_setup() {
+    # Record separator with 119 bit random value
+    $opt::recend = '';
+    $opt::recstart =
+	join "", map { (0..9,"a".."z","A".."Z")[rand(62)] } (1..20);
+    $opt::remove_rec_sep = 1;
+    my @filter;
+    push @filter, "perl";
+    if($opt::groupby =~ /^[a-z0-9_]+(\s|$)/i) {
+	# This is column number/name
+	# Use -a (auto-split)
+	push @filter, "-a";
+	$opt::colsep ||= "\t";
+	my $sep = $opt::colsep;
+	$sep =~ s/\t/\\t/g;
+	$sep =~ s/\"/\\"/g;
+	# man perlrun: -Fpattern [...] You can't use literal whitespace
+	$sep =~ s/ /\\040{1}/g;
+	push @filter, "-F$sep";
+    }
+    push @filter, "-pe";
+    push @filter, group_by_loop(*STDIN,$opt::recstart);
+    ::debug("init", "@filter\n");
+    open(STDIN, '-|', @filter) || die ("Cannot start @filter");
+    if(which("mbuffer")) {
+	# You get a speed up of 30% by going through mbuffer
+	open(STDIN, '-|', "mbuffer", "-q","-m6M","-b5") ||
+	    die ("Cannot start mbuffer");
+    }
+}
+
+sub spreadstdin() {
+    # read a record
+    # Spawn a job and print the record to it.
+    # Uses:
+    #	$Global::blocksize
+    #	STDIN
+    #	$opt::r
+    #	$Global::max_lines
+    #	$Global::max_number_of_args
+    #	$opt::regexp
+    #	$Global::start_no_new_jobs
+    #	$opt::roundrobin
+    #	%Global::running
+    # Returns: N/A
+
+    my $buf = "";
+    my ($recstart,$recend) = recstartrecend();
+    my $recendrecstart = $recend.$recstart;
+    my $chunk_number = 1;
+    my $one_time_through;
+    my $two_gb = 2**31-1;
+    my $blocksize = int($Global::blocksize);
+    my $in = *STDIN;
+    my $timeout = $Global::blocktimeout;
+
+    if($opt::skip_first_line) {
+	my $newline;
+	# Read a full line one byte at a time
+	while(sysread($in,$newline,1,0)) {
+	    $newline eq "\n" and last;
+	}
+    }
+    my $header = find_header(\$buf,$in);
+    my $anything_written;
+    my $eof;
+    my $garbage_read;
+
+    sub read_block() {
+	# Read a --blocksize from STDIN
+	# possibly interrupted by --blocktimeout
+	# Add up to the next full block
+	my $readsize = $blocksize - (length $buf) % $blocksize;
+	my ($nread,$alarm);
+	eval {
+	    local $SIG{ALRM} = sub { die "alarm\n" }; # NB: \n required
+	    # --blocktimeout (or 0 if not set)
+	    alarm $timeout;
+	    if($] >= 5.026) {
+		do {
+		    $nread = sysread $in, $buf, $readsize, length $buf;
+		    $readsize -= $nread;
+		} while($readsize and $nread);
+	    } else {
+		# Less efficient reading, but 32-bit sysread compatible
+		do {
+		    $nread = sysread($in,substr($buf,length $buf,0),$readsize,0);
+		    $readsize -= $nread;
+		} while($readsize and $nread);
+	    }
+	    alarm 0;
+	};
+	if ($@) {
+	    die unless $@ eq "alarm\n";	  # propagate unexpected errors
+	    $alarm = 1;
+	} else {
+	    $alarm = 0;
+	}
+	$eof = not ($nread or $alarm);
+    }
+
+    sub pass_n_line_records() {
+	# Pass records of N lines
+	my $n_lines = $buf =~ tr/\n/\n/;
+	my $last_newline_pos = rindex64(\$buf,"\n");
+	# Go backwards until there are full n-line records
+	while($n_lines % $Global::max_lines) {
+	    $n_lines--;
+	    $last_newline_pos = rindex64(\$buf,"\n",$last_newline_pos-1);
+	}
+	# Chop at $last_newline_pos as that is where n-line record ends
+	$anything_written +=
+	    write_record_to_pipe($chunk_number++,\$header,\$buf,
+				 $recstart,$recend,$last_newline_pos+1);
+	shorten(\$buf,$last_newline_pos+1);
+    }
+
+    sub pass_n_regexps() {
+	# Pass records of N regexps
+	# -N => (start..*?end){n}
+	# -L -N => (start..*?end){n*l}
+	if(not $garbage_read) {
+	    $garbage_read = 1;
+	    if($buf !~ /^$recstart/o) {
+		# Buf does not start with $recstart => There is garbage.
+		# Make a single record of the garbage
+		if($buf =~
+		   /(?s:^)(
+		   (?:(?:(?!$recend$recstart)(?s:.))*?$recend)
+		   )
+		   # Followed by recstart
+		   (?=$recstart)/mox and length $1 > 0) {
+		    $anything_written +=
+			write_record_to_pipe($chunk_number++,\$header,\$buf,
+					     $recstart,$recend,length $1);
+		    shorten(\$buf,length $1);
+		}
+	    }
+	}
+
+	my $n_records =
+	    $Global::max_number_of_args * ($Global::max_lines || 1);
+	# (?!negative lookahead) is needed to avoid backtracking
+	# See: https://unix.stackexchange.com/questions/439356/
+	# (?s:.) = (.|[\n]) but faster
+	while($buf =~
+	      /(?s:^)(
+	      # n more times recstart.*recend
+	      (?:$recstart(?:(?!$recend$recstart)(?s:.))*?$recend){$n_records}
+	      )
+	      # Followed by recstart
+	      (?=$recstart)/mox and length $1 > 0) {
+	    $anything_written +=
+		write_record_to_pipe($chunk_number++,\$header,\$buf,
+				     $recstart,$recend,length $1);
+	    shorten(\$buf,length $1);
+	}
+    }
+
+    sub pass_regexp() {
+	# Find the last recend-recstart in $buf
+	$eof and return;
+	# (?s:.) = (.|[\n]) but faster
+	if($buf =~ /^((?s:.)*$recend)$recstart(?s:.)*?$/mox) {
+	    $anything_written +=
+		write_record_to_pipe($chunk_number++,\$header,\$buf,
+				     $recstart,$recend,length $1);
+	    shorten(\$buf,length $1);
+	}
+    }
+
+    sub pass_csv_record() {
+	# Pass CVS record
+	# We define a CSV record as an even number of " + end of line
+	# This works if you use " as quoting character
+	my $last_newline_pos = length $buf;
+	# Go backwards from the last \n and search for a position
+	# where there is an even number of "
+	do {
+	    # find last EOL
+	    $last_newline_pos = rindex64(\$buf,"\n",$last_newline_pos-1);
+	    # While uneven "
+	} while((substr($buf,0,$last_newline_pos) =~ y/"/"/)%2
+		and $last_newline_pos >= 0);
+	# Chop at $last_newline_pos as that is where CSV record ends
+	$anything_written +=
+	    write_record_to_pipe($chunk_number++,\$header,\$buf,
+				 $recstart,$recend,$last_newline_pos+1);
+	shorten(\$buf,$last_newline_pos+1);
+    }
+
+    sub pass_n() {
+	# Pass n records of --recend/--recstart
+	# -N => (start..*?end){n}
+	my $i = 0;
+	my $read_n_lines =
+	    $Global::max_number_of_args * ($Global::max_lines || 1);
+	    while(($i = nindex(\$buf,$recendrecstart,$read_n_lines)) != -1
+		  and
+		  length $buf) {
+		$i += length $recend; # find the actual splitting location
+		$anything_written +=
+		    write_record_to_pipe($chunk_number++,\$header,\$buf,
+					 $recstart,$recend,$i);
+		shorten(\$buf,$i);
+	    }
+    }
+
+    sub pass() {
+	# Pass records of --recend/--recstart
+	# Split record at fixed string
+	# Find the last recend+recstart in $buf
+	$eof and return;
+	my $i = rindex64(\$buf,$recendrecstart);
+	if($i != -1) {
+	    $i += length $recend; # find the actual splitting location
+	    $anything_written +=
+		write_record_to_pipe($chunk_number++,\$header,\$buf,
+				     $recstart,$recend,$i);
+	    shorten(\$buf,$i);
+	}
+    }
+
+    sub increase_blocksize_maybe() {
+	if(not $anything_written
+	   and not $opt::blocktimeout
+	   and not $Global::no_autoexpand_block) {
+	    # Nothing was written - maybe the block size < record size?
+	    # Increase blocksize exponentially up to 2GB-1 (2GB causes problems)
+	    if($blocksize < $two_gb) {
+		my $old_blocksize = $blocksize;
+		$blocksize = ::min(ceil($blocksize * 1.3 + 1), $two_gb);
+		::warning("A record was longer than $old_blocksize. " .
+			  "Increasing to --blocksize $blocksize.");
+	    }
+	}
+    }
+
+    while(1) {
+	$anything_written = 0;
+	read_block();
+	if($opt::r) {
+	    # Remove empty lines
+	    $buf =~ s/^\s*\n//gm;
+	    if(length $buf == 0) {
+		if($eof) {
+		    last;
+		} else {
+		    next;
+		}
+	    }
+	}
+	if($Global::max_lines and not $Global::max_number_of_args) {
+	    # Pass n-line records
+	    pass_n_line_records();
+	} elsif($opt::csv) {
+	    # Pass a full CSV record
+	    pass_csv_record();
+	} elsif($opt::regexp) {
+	    # Split record at regexp
+	    if($Global::max_number_of_args) {
+		pass_n_regexps();
+	    } else {
+		pass_regexp();
+	    }
+	} else {
+	    # Pass normal --recend/--recstart record
+	    if($Global::max_number_of_args) {
+		pass_n();
+	    } else {
+		pass();
+	    }
+	}
+	$eof and last;
+	increase_blocksize_maybe();
+	::debug("init", "Round\n");
+    }
+    ::debug("init", "Done reading input\n");
+
+    # If there is anything left in the buffer write it
+    write_record_to_pipe($chunk_number++, \$header, \$buf, $recstart,
+			 $recend, length $buf);
+
+    if($opt::retries) {
+	$Global::no_more_input = 1;
+	# We need to start no more jobs: At most we need to retry some
+	# of the already running.
+	my @running = values %Global::running;
+	# Stop any virgins.
+	for my $job (@running) {
+	    if(defined $job and $job->virgin()) {
+		close $job->fh(0,"w");
+	    }
+	}
+	# Wait for running jobs to be done
+	my $sleep = 1;
+	while($Global::total_running > 0) {
+	    $sleep = ::reap_usleep($sleep);
+	    start_more_jobs();
+	}
+    }
+    $Global::start_no_new_jobs ||= 1;
+    if($opt::roundrobin) {
+	# Flush blocks to roundrobin procs
+	my $sleep = 1;
+	while(%Global::running) {
+	    my $something_written = 0;
+	    for my $job (values %Global::running) {
+		if($job->block_length()) {
+		    $something_written += $job->non_blocking_write();
+		} else {
+		    close $job->fh(0,"w");
+		}
+	    }
+	    if($something_written) {
+		$sleep = $sleep/2+0.001;
+	    }
+	    $sleep = ::reap_usleep($sleep);
+	}
+    }
+}
+
+sub recstartrecend() {
+    # Uses:
+    #	$opt::recstart
+    #	$opt::recend
+    # Returns:
+    #	$recstart,$recend with default values and regexp conversion
+    my($recstart,$recend);
+    if(defined($opt::recstart) and defined($opt::recend)) {
+	# If both --recstart and --recend is given then both must match
+	$recstart = $opt::recstart;
+	$recend = $opt::recend;
+    } elsif(defined($opt::recstart)) {
+	# If --recstart is given it must match start of record
+	$recstart = $opt::recstart;
+	$recend = "";
+    } elsif(defined($opt::recend)) {
+	# If --recend is given then it must match end of record
+	$recstart = "";
+	$recend = $opt::recend;
+	if($opt::regexp and $recend eq '') {
+	    # --regexp --recend ''
+	    $recend = '(?s:.)';
+	}
+    }
+
+    if($opt::regexp) {
+	# Do not allow /x comments - to avoid having to quote space
+	$recstart = "(?-x:".$recstart.")";
+	$recend = "(?-x:".$recend.")";
+	# If $recstart/$recend contains '|'
+	# the | should only apply to the regexp
+	$recstart = "(?:".$recstart.")";
+	$recend = "(?:".$recend.")";
+    } else {
+	# $recstart/$recend = printf strings (\n)
+	$recstart =~ s/\\([0rnt\'\"\\])/"qq|\\$1|"/gee;
+	$recend =~ s/\\([0rnt\'\"\\])/"qq|\\$1|"/gee;
+    }
+    return ($recstart,$recend);
+}
+
+sub nindex($$) {
+    # See if string is in buffer N times
+    # Returns:
+    #	the position where the Nth copy is found
+    my ($buf_ref, $str, $n) = @_;
+    my $i = 0;
+    for(1..$n) {
+	$i = index64($buf_ref,$str,$i+1);
+	if($i == -1) { last }
+    }
+    return $i;
+}
+
+{
+    my @robin_queue;
+    my $sleep = 1;
+
+    sub round_robin_write($$$$$) {
+	# Input:
+	#   $header_ref = ref to $header string
+	#   $block_ref = ref to $block to be written
+	#   $recstart = record start string
+	#   $recend = record end string
+	#   $endpos = end position of $block
+	# Uses:
+	#   %Global::running
+	# Returns:
+	#   $something_written = amount of bytes written
+	my ($header_ref,$buffer_ref,$recstart,$recend,$endpos) = @_;
+	my $written = 0;
+	my $block_passed = 0;
+	while(not $block_passed) {
+	    # Continue flushing existing buffers
+	    # until one is empty and a new block is passed
+	    if(@robin_queue) {
+		# Rotate queue once so new blocks get a fair chance
+		# to be given to another slot
+		push @robin_queue, shift @robin_queue;
+	    } else {
+		# Make a queue to spread the blocks evenly
+		push @robin_queue, (sort { $a->seq() <=> $b->seq() }
+				    values %Global::running);
+	    }
+	    do {
+		$written = 0;
+		for my $job (@robin_queue) {
+		    if($job->block_length() > 0) {
+			$written += $job->non_blocking_write();
+		    } else {
+			$job->set_block($header_ref, $buffer_ref,
+					$endpos, $recstart, $recend);
+			$block_passed = 1;
+			$written += $job->non_blocking_write();
+			last;
+		    }
+		}
+		if($written) {
+		    $sleep = $sleep/1.5+0.001;
+		}
+		# Don't sleep if something is written
+	    } while($written and not $block_passed);
+	    $sleep = ::reap_usleep($sleep);
+	}
+	return $written;
+    }
+}
+
+sub index64($$$) {
+    # Do index on strings > 2GB.
+    # index in Perl < v5.22 does not work for > 2GB
+    # Input:
+    #	as index except STR which must be passed as a reference
+    # Output:
+    #	as index
+    my $ref = shift;
+    my $match = shift;
+    my $pos = shift || 0;
+    my $block_size = 2**31-1;
+    my $strlen = length($$ref);
+    # No point in doing extra work if we don't need to.
+    if($strlen < $block_size or $] > 5.022) {
+	return index($$ref, $match, $pos);
+    }
+
+    my $matchlen = length($match);
+    my $ret;
+    my $offset = $pos;
+    while($offset < $strlen) {
+	$ret = index(
+	    substr($$ref, $offset, $block_size),
+	    $match, $pos-$offset);
+	if($ret != -1) {
+	    return $ret + $offset;
+	}
+	$offset += ($block_size - $matchlen - 1);
+    }
+    return -1;
+}
+
+sub rindex64($@) {
+    # Do rindex on strings > 2GB.
+    # rindex in Perl < v5.22 does not work for > 2GB
+    # Input:
+    #	as rindex except STR which must be passed as a reference
+    # Output:
+    #	as rindex
+    my $ref = shift;
+    my $match = shift;
+    my $pos = shift;
+    my $block_size = 2**31-1;
+    my $strlen = length($$ref);
+    # Default: search from end
+    $pos = defined $pos ? $pos : $strlen;
+    # No point in doing extra work if we don't need to.
+    if($strlen < $block_size or $] > 5.022) {
+	return rindex($$ref, $match, $pos);
+    }
+
+    my $matchlen = length($match);
+    my $ret;
+    my $offset = $pos - $block_size + $matchlen;
+    if($offset < 0) {
+	# The offset is less than a $block_size
+	# Set the $offset to 0 and
+	# Adjust block_size accordingly
+	$block_size = $block_size + $offset;
+	$offset = 0;
+    }
+    while($offset >= 0) {
+	$ret = rindex(
+	    substr($$ref, $offset, $block_size),
+	    $match);
+	if($ret != -1) {
+	    return $ret + $offset;
+	}
+	$offset -= ($block_size - $matchlen - 1);
+    }
+    return -1;
+}
+
+sub shorten($$) {
+    # Do: substr($buf,0,$i) = "";
+    # Some Perl versions do not support $i > 2GB, so do this in 2GB chunks
+    # Input:
+    #	$buf_ref = \$buf
+    #	$i = position to shorten to
+    # Returns: N/A
+    my ($buf_ref, $i) = @_;
+    my $two_gb = 2**31-1;
+    while($i > $two_gb) {
+	substr($$buf_ref,0,$two_gb) = "";
+	$i -= $two_gb;
+    }
+    substr($$buf_ref,0,$i) = "";
+}
+
+sub write_record_to_pipe($$$$$$) {
+    # Fork then
+    # Write record from pos 0 .. $endpos to pipe
+    # Input:
+    #	$chunk_number = sequence number - to see if already run
+    #	$header_ref = reference to header string to prepend
+    #	$buffer_ref = reference to record to write
+    #	$recstart = start string of record
+    #	$recend = end string of record
+    #	$endpos = position in $buffer_ref where record ends
+    # Uses:
+    #	$Global::job_already_run
+    #	$opt::roundrobin
+    #	@Global::virgin_jobs
+    # Returns:
+    #	Number of chunks written (0 or 1)
+    my ($chunk_number, $header_ref, $buffer_ref,
+	$recstart, $recend, $endpos) = @_;
+    if($endpos == 0) { return 0; }
+    if(vec($Global::job_already_run,$chunk_number,1)) { return 1; }
+    if($opt::roundrobin) {
+	# Write the block to one of the already running jobs
+	return round_robin_write($header_ref, $buffer_ref,
+				 $recstart, $recend, $endpos);
+    }
+    # If no virgin found, backoff
+    my $sleep = 0.0001; # 0.01 ms - better performance on highend
+    while(not @Global::virgin_jobs) {
+	::debug("pipe", "No virgin jobs");
+	$sleep = ::reap_usleep($sleep);
+	# Jobs may not be started because of loadavg
+	# or too little time between each ssh login
+	# or retrying failed jobs.
+	start_more_jobs();
+    }
+    my $job = shift @Global::virgin_jobs;
+    $job->set_block($header_ref, $buffer_ref, $endpos, $recstart, $recend);
+    $job->write_block();
+    return 1;
+}
+
+
+sub __SEM_MODE__() {}
+
+
+sub acquire_semaphore() {
+    # Acquires semaphore. If needed: spawns to the background
+    # Uses:
+    #	@Global::host
+    # Returns:
+    #	The semaphore to be released when jobs is complete
+    $Global::host{':'} = SSHLogin->new(":");
+    my $sem = Semaphore->new($Semaphore::name,
+			     $Global::host{':'}->max_jobs_running());
+    $sem->acquire();
+    if($Semaphore::fg) {
+	# skip
+    } else {
+	if(fork()) {
+	    exit(0);
+	} else {
+	    # If run in the background, the PID will change
+	    $sem->pid_change();
+	}
+    }
+    return $sem;
+}
+
+
+sub __PARSE_OPTIONS__() {}
+
+sub shell_completion() {
+    if($opt::shellcompletion eq "zsh") {
+	# if shell == zsh
+	zsh_competion();
+    } elsif($opt::shellcompletion eq "bash") {
+	# if shell == bash
+	bash_competion();
+    } elsif($opt::shellcompletion eq "auto") {
+	if($Global::shell =~ m:/zsh$|^zsh$:) {
+	    # if shell == zsh
+	    zsh_competion();
+	} elsif($Global::shell =~ m:/bash$|^bash$:) {
+	    # if shell == bash
+	    bash_competion();
+	} else {
+	    ::error("--shellcompletion is not implemented for ".
+		    "'$Global::shell'.");
+	    wait_and_exit(255);
+	}
+    } else {
+	::error("--shellcompletion is not implemented for ".
+		"'$opt::shellcompletion'.");
+	wait_and_exit(255);
+    }
+}
+
+sub bash_competion() {
+    # Print:
+    #   complete -F _comp_parallel parallel;
+    #   _comp_parallel() {
+    #     COMPREPLY=($(compgen -W "--options" --
+    #                    "${COMP_WORDS[$COMP_CWORD]}"));
+    #   };
+    my @bash_completion =
+	("complete -F _comp_parallel parallel;",
+	 '_comp_parallel() { COMPREPLY=($(compgen -W "');
+    my @och = options_completion_hash();
+    while(@och) {
+	$_ = shift @och;
+	# Split input like:
+	# "joblog|jl=s[Logfile for executed jobs]:logfile:_files"
+	if(/^(.*?)(\[.*?])?(:[^:]*)?(:.*)?$/) {
+	    my $opt = $1;
+	    my $desc = $2;
+	    my $argdesc = $3;
+	    my $func = $4;
+	    # opt=s => opt
+	    $opt =~ s/[:=].$//;
+	    if($opt =~ /^_/) {
+		# internal options start with --_
+		# skip
+	    } else {
+		push @bash_completion,
+		    (map { (length $_ == 1) ? "-$_ " : "--$_ " }
+		     split /\|/, $opt);
+	    }
+	}
+	shift @och;
+    }
+    push @bash_completion,'" -- "${COMP_WORDS[$COMP_CWORD]}")); };'."\n";
+    print @bash_completion;
+}
+
+sub zsh_competion() {
+    my @zsh_completion =
+	("compdef _comp_parallel parallel; ",
+	 "setopt localoptions extended_glob; ",
+	 "local -a _comp_priv_prefix; ",
+	 "_comp_parallel() { ",
+	 "_arguments ");
+    my @och = options_completion_hash();
+    while(@och) {
+	$_ = shift @och;
+	# Split input like:
+	# "joblog|jl=s[Logfile for executed jobs]:logfile:_files"
+	if(/^(.*?)(\[.*?])?(:[^:]*)?(:.*)?$/) {
+	    my $opt = $1;
+	    my $desc = $2;
+	    my $argdesc = $3;
+	    my $func = $4;
+	    # opt=s => opt
+	    $opt =~ s/[:=].$//;
+	    if($opt =~ /^_/) {
+		# internal options start with --_
+		# skip
+	    } else {
+		# {-o,--option}
+		my $zsh_opt = join(",",
+				   (map { (length $_ == 1) ? "-$_" : "--$_" }
+				    split /\|/, $opt));
+		if($zsh_opt =~ /,/) { $zsh_opt = "{$zsh_opt}"; }
+		$desc =~ s/'/'"'"'/g;
+		$argdesc =~ s/'/'"'"'/g;
+		$func =~ s/'/'"'"'/g;
+		push @zsh_completion, $zsh_opt."'".$desc.$argdesc.$func."' ";
+	    }
+	}
+	shift @och;
+    }
+    push @zsh_completion,
+	q{'(-)1:command: _command_names -e' },
+	q{'*::arguments:{ _comp_priv_prefix=( '$words[1]' -n ${(kv)opt_args[(I)(-[ugHEP]|--(user|group|set-home|preserve-env|preserve-groups))]} ) ; _normal }'},
+	"};\n";
+    print @zsh_completion;
+}
+
+sub options_hash() {
+    # Returns:
+    #	%hash = for GetOptions
+    my %och = options_completion_hash();
+    my %oh;
+    my ($k,$v);
+    while(($k,$v) = each %och) {
+	$k =~ s/\[.*//;
+	$oh{$k} = $v;
+    }
+    return %oh;
+}
+
+sub options_completion_hash() {
+    # Returns:
+    #	%hash = for GetOptions and shell completion
+    return
+	("debug|D=s" => \$opt::D,
+	 "xargs[Insert as many arguments as the command line length permits]"
+	 => \$opt::xargs,
+	 "m[Multiple arguments]" => \$opt::m,
+	 ("X[Insert as many arguments with context as the command line ".
+	 "length permits]"
+	 => \$opt::X),
+	 "v[Verbose]" => \@opt::v,
+	 "sql=s[Use --sql-master instead (obsolete)]:DBURL" => \$opt::retired,
+	 ("sql-master|sqlmaster=s".
+	  "[Submit jobs via SQL server. DBURL must point to a table, which ".
+	  "will contain --joblog, the values, and output]:DBURL"
+	  => \$opt::sqlmaster),
+	 ("sql-worker|sqlworker=s".
+	  "[Execute jobs via SQL server. Read the input sources variables ".
+	  "from the table pointed to by DBURL.]:DBURL"
+	  => \$opt::sqlworker),
+	 ("sql-and-worker|sqlandworker=s".
+	  "[--sql-master DBURL --sql-worker DBURL]:DBURL"
+	  => \$opt::sqlandworker),
+	 ("joblog|jl=s[Logfile for executed jobs]:logfile:_files"
+	  => \$opt::joblog),
+	 ("results|result|res=s[Save the output into files]:name:_files"
+	  => \$opt::results),
+	 "resume[Resumes from the last unfinished job]" => \$opt::resume,
+	 ("resume-failed|resumefailed".
+	  "[Retry all failed and resume from the last unfinished job]"
+	  => \$opt::resume_failed),
+	 ("retry-failed|retryfailed[Retry all failed jobs in joblog]"
+	  => \$opt::retry_failed),
+	 "silent[Silent]" => \$opt::silent,
+	 ("keep-order|keeporder|k".
+	  "[Keep sequence of output same as the order of input]"
+	  => \$opt::keeporder),
+	 ("no-keep-order|nokeeporder|nok|no-k".
+	  "[Overrides an earlier --keep-order (e.g. if set in ".
+	  "~/.parallel/config)]"
+	  => \$opt::nokeeporder),
+	 "group[Group output]" => \$opt::group,
+	 "g" => \$opt::retired,
+	 ("ungroup|u".
+	  "[Output is printed as soon as possible and bypasses GNU parallel ".
+	  "internal processing]"
+	  => \$opt::ungroup),
+	 ("latest-line|latestline|ll".
+	  "[Print latest line of each job]"
+	  => \$opt::latestline),
+	 ("line-buffer|line-buffered|linebuffer|linebuffered|lb".
+	  "[Buffer output on line basis]"
+	  => \$opt::linebuffer),
+	 ("tmux".
+	  "[Use tmux for output. Start a tmux session and run each job in a ".
+	  "window in that session. No other output will be produced]"
+	  => \$opt::tmux),
+	 ("tmux-pane|tmuxpane".
+	  "[Use tmux for output but put output into panes in the first ".
+	  "window.  Useful if you want to monitor the progress of less than ".
+	  "100 concurrent jobs]"
+	  => \$opt::tmuxpane),
+	 "null|0[Use NUL as delimiter]" => \$opt::null,
+	 "quote|q[Quote command]" => \$opt::quote,
+	 # Replacement strings
+	 ("parens=s[Use parensstring instead of {==}]:parensstring"
+	  => \$opt::parens),
+	 ('rpl=s[Define replacement string]:"tag perl expression"'
+	  => \@opt::rpl),
+	 "plus[Add more replacement strings]" => \$opt::plus,
+	 ("I=s".
+	  "[Use the replacement string replace-str instead of {}]:replace-str"
+	  => \$opt::I),
+	 ("extensionreplace|er=s".
+	  "[Use the replacement string replace-str instead of {.} for input ".
+	  "line without extension]:replace-str"
+	  => \$opt::U),
+	 "U=s" => \$opt::retired,
+	 ("basenamereplace|bnr=s".
+	  "[Use the replacement string replace-str instead of {/} for ".
+	  "basename of input line]:replace-str"
+	  => \$opt::basenamereplace),
+	 ("dirnamereplace|dnr=s".
+	  "[Use the replacement string replace-str instead of {//} for ".
+	  "dirname of input line]:replace-str"
+	  => \$opt::dirnamereplace),
+	 ("basenameextensionreplace|bner=s".
+	  "[Use the replacement string replace-str instead of {/.} for ".
+	  "basename of input line without extension]:replace-str"
+	  => \$opt::basenameextensionreplace),
+	 ("seqreplace=s".
+	  "[Use the replacement string replace-str instead of {#} for job ".
+	  "sequence number]:replace-str"
+	  => \$opt::seqreplace),
+	 ("slotreplace=s".
+	  "[Use the replacement string replace-str instead of {%} for job ".
+	  "slot number]:replace-str"
+	  => \$opt::slotreplace),
+	 ("jobs|j=s".
+	  "[(Add +N to/Subtract -N from/Multiply N%) the number of CPU ".
+	  "threads or read parameter from file]:_files"
+	  => \$opt::jobs),
+	 ("delay=s".
+	  "[Delay starting next job by duration]:duration" => \$opt::delay),
+	 ("ssh-delay|sshdelay=f".
+	  "[Delay starting next ssh by duration]:duration"
+	  => \$opt::sshdelay),
+	 ("load=s".
+	  "[Only start jobs if load is less than max-load]:max-load"
+	  => \$opt::load),
+	 "noswap[Do not start job is computer is swapping]" => \$opt::noswap,
+	 ("max-line-length-allowed|maxlinelengthallowed".
+	  "[Print maximal command line length]"
+	  => \$opt::max_line_length_allowed),
+	 ("number-of-cpus|numberofcpus".
+	  "[Print the number of physical CPU cores and exit (obsolete)]"
+	  => \$opt::number_of_cpus),
+	 ("number-of-sockets|numberofsockets".
+	  "[Print the number of CPU sockets and exit]"
+	  => \$opt::number_of_sockets),
+	 ("number-of-cores|numberofcores".
+	  "[Print the number of physical CPU cores and exit]"
+	  => \$opt::number_of_cores),
+	 ("number-of-threads|numberofthreads".
+	  "[Print the number of hyperthreaded CPU cores and exit]"
+	  => \$opt::number_of_threads),
+	 ("use-sockets-instead-of-threads|usesocketsinsteadofthreads".
+	  "[Determine how GNU Parallel counts the number of CPUs]"
+	  => \$opt::use_sockets_instead_of_threads),
+	 ("use-cores-instead-of-threads|usecoresinsteadofthreads".
+	  "[Determine how GNU Parallel counts the number of CPUs]"
+	  => \$opt::use_cores_instead_of_threads),
+	 ("use-cpus-instead-of-cores|usecpusinsteadofcores".
+	  "[Determine how GNU Parallel counts the number of CPUs]"
+	  => \$opt::use_cpus_instead_of_cores),
+	 ("shell-quote|shellquote|shell_quote".
+	  "[Does not run the command but quotes it. Useful for making ".
+	  "quoted composed commands for GNU parallel]"
+	  => \@opt::shellquote),
+	 ('nice=i[Run the command at this niceness]:niceness:($(seq -20 19))'
+	  => \$opt::nice),
+	 "tag[Tag lines with arguments]" => \$opt::tag,
+	 ("tag-string|tagstring=s".
+	  "[Tag lines with a string]:str" => \$opt::tagstring),
+	 "ctag[Color tag]:str" => \$opt::ctag,
+	 "ctag-string|ctagstring=s[Colour tagstring]:str" => \$opt::ctagstring,
+	 "color|colour[Colourize output]" => \$opt::color,
+	 ("color-failed|colour-failed|colorfailed|colourfailed|".
+	  "color-fail|colour-fail|colorfail|colourfail|cf".
+	  "[Colour failed jobs red]"
+	  => \$opt::colorfailed),
+	 ("onall[Run all the jobs on all computers given with --sshlogin]"
+	  => \$opt::onall),
+	 "nonall[--onall with no arguments]" => \$opt::nonall,
+	 ("filter-hosts|filterhosts|filter-host[Remove down hosts]"
+	  => \$opt::filter_hosts),
+	 ('sshlogin|S=s'.
+	  '[Distribute jobs to remote computers]'.
+	  ':[@hostgroups/][ncpus/]sshlogin'.
+	  '[,[@hostgroups/][ncpus/]sshlogin[,...]] or @hostgroup'.
+	  ':_users') => \@opt::sshlogin,
+	 ("sshloginfile|slf=s".
+	  "[File with sshlogins on separate lines. Lines starting with '#' ".
+	  "are ignored.]:filename:_files"
+	  => \@opt::sshloginfile),
+	 ("controlmaster|M".
+	  "[Use ssh's ControlMaster to make ssh connections faster]"
+	  => \$opt::controlmaster),
+	 ("ssh=s".
+	  "[Use this command instead of ssh for remote access]:sshcommand"
+	  => \$opt::ssh),
+	 ("transfer-file|transferfile|transfer-files|transferfiles|tf=s".
+	  "[Transfer filename to remote computers]:filename:_files"
+	  => \@opt::transfer_files),
+	 ("return=s[Transfer files from remote computers]:filename:_files"
+	  => \@opt::return),
+	 ("trc=s[--transfer --return filename --cleanup]:filename:_files"
+	  => \@opt::trc),
+	 "transfer[Transfer files to remote computers]" => \$opt::transfer,
+	 "cleanup[Remove transferred files]" => \$opt::cleanup,
+	 ("basefile|bf=s".
+	  "[Transfer file to each sshlogin before first job is started]".
+	  ":file:_files"
+	  => \@opt::basefile),
+	 ("template|tmpl=s".
+	  "[Replace replacement strings in file and save it in repl]".
+	  ":file=repl:_files"
+	  => \%opt::template),
+	 "B=s" => \$opt::retired,
+	 "ctrl-c|ctrlc" => \$opt::retired,
+	 "no-ctrl-c|no-ctrlc|noctrlc" => \$opt::retired,
+	 ("work-dir|workdir|wd=s".
+	  "[Jobs will be run in the dir mydir. (default: the current dir ".
+	  "for the local machine, the login dir for remote computers)]".
+	  ":mydir:_cd"
+	  => \$opt::workdir),
+	 "W=s" => \$opt::retired,
+	 ("rsync-opts|rsyncopts=s[Options to pass on to rsync]:options"
+	  => \$opt::rsync_opts),
+	 ("tmpdir|tempdir=s[Directory for temporary files]:dirname:_cd"
+	  => \$opt::tmpdir),
+	 ("use-compress-program|compress-program|".
+	  "usecompressprogram|compressprogram=s".
+	  "[Use prg for compressing temporary files]:prg:_commands"
+	  => \$opt::compress_program),
+	 ("use-decompress-program|decompress-program|".
+	  "usedecompressprogram|decompressprogram=s".
+	  "[Use prg for decompressing temporary files]:prg:_commands"
+	  => \$opt::decompress_program),
+	 "compress[Compress temporary files]" => \$opt::compress,
+	 "open-tty|o[Open terminal tty]" => \$opt::open_tty,
+	 "tty[Open terminal tty]" => \$opt::tty,
+	 "T" => \$opt::retired,
+	 "H=i" => \$opt::retired,
+	 ("dry-run|dryrun|dr".
+	  "[Print the job to run on stdout (standard output), but do not ".
+	  "run the job]"
+	  => \$opt::dryrun),
+	 "progress[Show progress of computations]" => \$opt::progress,
+	 ("eta[Show the estimated number of seconds before finishing]"
+	  => \$opt::eta),
+	 "bar[Show progress as a progress bar]" => \$opt::bar,
+	 ("total-jobs|totaljobs|total=s".
+	  "[Set total number of jobs]" => \$opt::totaljobs),
+	 "shuf[Shuffle jobs]" => \$opt::shuf,
+	 ("arg-sep|argsep=s".
+	  "[Use sep-str instead of ::: as separator string]:sep-str"
+	  => \$opt::arg_sep),
+	 ("arg-file-sep|argfilesep=s".
+	  "[Use sep-str instead of :::: as separator string ".
+	  "between command and argument files]:sep-str"
+	  => \$opt::arg_file_sep),
+	 ('trim=s[Trim white space in input]:trim_method:'.
+	  '((n\:"No trim" l\:"Left\ trim" r\:"Right trim" '.
+	  'lr\:"Both trim" rl\:"Both trim"))'
+	  => \$opt::trim),
+	 "env=s[Copy environment variable var]:var:_vars" => \@opt::env,
+	 "recordenv|record-env[Record environment]" => \$opt::record_env,
+	 ('session'.
+	  '[Record names in current environment in $PARALLEL_IGNORED_NAMES '.
+	  'and exit. Only used with env_parallel. '.
+	  'Aliases, functions, and variables with names i]'
+	  => \$opt::session),
+	 ('plain[Ignore --profile, $PARALLEL, and ~/.parallel/config]'
+	  => \$opt::plain),
+	 ("profile|J=s".
+	  "[Use profile profilename for options]:profilename:_files"
+	  => \@opt::profile),
+	 "tollef" => \$opt::tollef,
+	 "gnu[Behave like GNU parallel]" => \$opt::gnu,
+	 "link|xapply[Link input sources]" => \$opt::link,
+	 "linkinputsource|xapplyinputsource=i" => \@opt::linkinputsource,
+	 # Before changing these lines, please read
+	 # https://www.gnu.org/software/parallel/parallel_design.html#citation-notice
+	 # https://git.savannah.gnu.org/cgit/parallel.git/tree/doc/citation-notice-faq.txt
+	 # You accept to be put in a public hall of shame by removing
+	 # these lines.
+	 ("bibtex|citation".
+	  "[Print the citation notice and BibTeX entry for GNU parallel, ".
+	  "silence citation notice for all future runs, and exit. ".
+	  "It will not run any commands]"
+	  => \$opt::citation),
+	 "will-cite|willcite|nn|nonotice|no-notice" => \$opt::willcite,
+	 # Termination and retries
+	 ('halt-on-error|haltonerror|halt=s'.
+	  '[When should GNU parallel terminate]'.
+	  ':when:((now\:"kill all running jobs and halt immediately" '.
+	  'soon\:"wait for all running jobs to complete, start no new jobs"))'
+	  => \$opt::halt),
+	 'limit=s[Dynamic job limit]:"command args"' => \$opt::limit,
+	 ("memfree=s".
+	  "[Minimum memory free when starting another job]:size"
+	  => \$opt::memfree),
+	 ("memsuspend=s".
+	  "[Suspend jobs when there is less memory available]:size"
+	  => \$opt::memsuspend),
+	 "retries=s[Try failing jobs n times]:n" => \$opt::retries,
+	 ("timeout=s".
+	  "[Time out for command. If the command runs for longer than ".
+	  "duration seconds it will get killed as per --term-seq]:duration"
+	  => \$opt::timeout),
+	 ("term-seq|termseq=s".
+	  "[Termination sequence]:sequence" => \$opt::termseq),
+	 # xargs-compatibility - implemented, man, testsuite
+	 ("max-procs|maxprocs|P=s".
+	  "[Add N to/Subtract N from/Multiply N% with/ the number of CPU ".
+	  "threads or read parameter from file]:+N/-N/N%/N/procfile:_files"
+	  => \$opt::jobs),
+	 ("delimiter|d=s[Input items are terminated by delim]:delim"
+	  => \$opt::d),
+	 ("max-chars|maxchars|s=s[Limit length of command]:max-chars"
+	  => \$opt::max_chars),
+	 ("arg-file|argfile|a=s".
+	  "[Use input-file as input source]:input-file:_files" => \@opt::a),
+	 "no-run-if-empty|norunifempty|r[Do not run empty input]" => \$opt::r,
+	 ("replace|i:s".
+	  "[This option is deprecated; use -I instead]:replace-str"
+	  => \$opt::i),
+	 "E=s" => \$opt::eof,
+	 ("eof|e:s[Set the end of file string to eof-str]:eof-str"
+	  => \$opt::eof),
+	 ("process-slot-var|processslotvar=s".
+	  "[Set this variable to job slot number]:varname"
+	  => \$opt::process_slot_var),
+	 ("max-args|maxargs|n=s".
+	  "[Use at most max-args arguments per command line]:max-args"
+	  => \$opt::max_args),
+	 ("max-replace-args|maxreplaceargs|N=s".
+	  "[Use at most max-args arguments per command line]:max-args"
+	  => \$opt::max_replace_args),
+	 "col-sep|colsep|C=s[Column separator]:regexp" => \$opt::colsep,
+	 "csv[Treat input as CSV-format]"=> \$opt::csv,
+	 ("help|h[Print a summary of the options to GNU parallel and exit]"
+	  => \$opt::help),
+	 ("L=s[When used with --pipe: Read records of recsize]:recsize"
+	  => \$opt::L),
+	 ("max-lines|maxlines|l:f".
+	  "[When used with --pipe: Read records of recsize lines]:recsize"
+	  => \$opt::max_lines),
+	 "interactive|p[Ask user before running a job]" => \$opt::interactive,
+	 ("verbose|t[Print the job to be run on stderr (standard error)]"
+	  => \$opt::verbose),
+	 ("version|V[Print the version GNU parallel and exit]"
+	  => \$opt::version),
+	 ('min-version|minversion=i'.
+	  '[Print the version GNU parallel and exit]'.
+	  ':version:($(parallel --minversion 0))'
+	  => \$opt::minversion),
+	 ("show-limits|showlimits".
+	  "[Display limits given by the operating system]"
+	  => \$opt::show_limits),
+	 ("exit|x[Exit if the size (see the -s option) is exceeded]"
+	  => \$opt::x),
+	 # Semaphore
+	 "semaphore[Work as a counting semaphore]" => \$opt::semaphore,
+	 ("semaphore-timeout|semaphoretimeout|st=s".
+	  "[If secs > 0: If the semaphore is not released within secs ".
+	  "seconds, take it anyway]:secs"
+	  => \$opt::semaphoretimeout),
+	 ("semaphore-name|semaphorename|id=s".
+	  "[Use name as the name of the semaphore]:name"
+	  => \$opt::semaphorename),
+	 "fg[Run command in foreground]" => \$opt::fg,
+	 "bg[Run command in background]" => \$opt::bg,
+	 "wait[Wait for all commands to complete]" => \$opt::wait,
+	 # Shebang #!/usr/bin/parallel --shebang
+	 ("shebang|hashbang".
+	  "[GNU parallel can be called as a shebang (#!) command as the ".
+	  "first line of a script. The content of the file will be treated ".
+	  "as inputsource]"
+	  => \$opt::shebang),
+	 ("_pipe-means-argfiles[internal]"
+	  => \$opt::_pipe_means_argfiles),
+	 "Y" => \$opt::retired,
+	 ("skip-first-line|skipfirstline".
+	  "[Do not use the first line of input]"
+	  => \$opt::skip_first_line),
+	 "bug" => \$opt::bug,
+	 # --pipe
+	 ("pipe|spreadstdin".
+	  "[Spread input to jobs on stdin (standard input)]" => \$opt::pipe),
+	 ("round-robin|roundrobin|round".
+	  "[Distribute chunks of standard input in a round robin fashion]"
+	  => \$opt::roundrobin),
+	 "recstart=s" => \$opt::recstart,
+	 ("recend=s".
+	  "[Split record between endstring and startstring]:endstring"
+	  => \$opt::recend),
+	 ("regexp|regex".
+	  "[Interpret --recstart and --recend as regular expressions]"
+	  => \$opt::regexp),
+	 ("remove-rec-sep|removerecsep|rrs".
+	  "[Remove record separator]" => \$opt::remove_rec_sep),
+	 ("output-as-files|outputasfiles|files[Save output to files]"
+	  => \$opt::files),
+	 ("block-size|blocksize|block=s".
+	  "[Size of block in bytes to read at a time]:size"
+	  => \$opt::blocksize),
+	 ("block-timeout|blocktimeout|bt=s".
+	  "[Timeout for reading block when using --pipe]:duration"
+	  => \$opt::blocktimeout),
+	 "header=s[Use regexp as header]:regexp" => \$opt::header,
+	 "cat[Create a temporary file with content]" => \$opt::cat,
+	 "fifo[Create a temporary fifo with content]" => \$opt::fifo,
+	 ("pipe-part|pipepart[Pipe parts of a physical file]"
+	  => \$opt::pipepart),
+	 "tee[Pipe all data to all jobs]" => \$opt::tee,
+	 ("shard=s".
+	  "[Use shardexpr as shard key and shard input to the jobs]:shardexpr"
+	  => \$opt::shard),
+	 ("bin=s".
+	  "[Use binexpr as binning key and bin input to the jobs]:binexpr"
+	  => \$opt::bin),
+	 "group-by|groupby=s[Group input by value]:val" => \$opt::groupby,
+	 #
+	 ("hgrp|hostgrp|hostgroup|hostgroups[Enable hostgroups on arguments]"
+	  => \$opt::hostgroups),
+	 "embed[Embed GNU parallel in a shell script]" => \$opt::embed,
+	 ("filter=s[Only run jobs where filter is true]:filter"
+	  => \@opt::filter),
+	 "_parset=s[Generate shell code for parset]" => \$opt::_parset,
+	 ("shell-completion|shellcompletion=s".
+	  "[Generate shell code for shell completion]"
+	  => \$opt::shellcompletion),
+	 # Parameter for testing optimal values
+	 "_test=s" => \$opt::_test,
+	);
+}
+
+sub get_options_from_array($@) {
+    # Run GetOptions on @array
+    # Input:
+    #	$array_ref = ref to @ARGV to parse
+    #	@keep_only = Keep only these options
+    # Uses:
+    #	@ARGV
+    # Returns:
+    #	true if parsing worked
+    #	false if parsing failed
+    #	@$array_ref is changed
+    my ($array_ref, @keep_only) = @_;
+    if(not @$array_ref) {
+	# Empty array: No need to look more at that
+	return 1;
+    }
+    # A bit of shuffling of @ARGV needed as GetOptionsFromArray is not
+    # supported everywhere
+    my @save_argv;
+    my $this_is_ARGV = (\@::ARGV == $array_ref);
+    if(not $this_is_ARGV) {
+	@save_argv = @::ARGV;
+	@::ARGV = @{$array_ref};
+    }
+    # If @keep_only set: Ignore all values except @keep_only
+    my %options = options_hash();
+    if(@keep_only) {
+	my (%keep,@dummy);
+	@keep{@keep_only} = @keep_only;
+	for my $k (grep { not $keep{$_} } keys %options) {
+	    # Store the value of the option in @dummy
+	    $options{$k} = \@dummy;
+	}
+    }
+    my $retval = GetOptions(%options);
+    if(not $this_is_ARGV) {
+	@{$array_ref} = @::ARGV;
+	@::ARGV = @save_argv;
+    }
+    return $retval;
+}
+
+sub parse_parset() {
+    $Global::progname = "parset";
+    @Global::parset_vars = split /[ ,]/, $opt::_parset;
+    my $var_or_assoc = shift @Global::parset_vars;
+    # Legal names: var _v2ar arrayentry[2]
+    my @illegal = (grep { not /^[a-zA-Z_][a-zA-Z_0-9]*(\[\d+\])?$/ }
+		   @Global::parset_vars);
+    if(@illegal) {
+	::error
+	    ("@illegal is an invalid variable name.",
+	     "Variable names must be letter followed by letters or digits.",
+	     "Usage:",
+	     "  parset varname GNU Parallel options and command");
+	wait_and_exit(255);
+    }
+    if($var_or_assoc eq "assoc") {
+	my $var = shift @Global::parset_vars;
+	print "$var=(";
+	$Global::parset = "assoc";
+	$Global::parset_endstring=")\n";
+    } elsif($var_or_assoc eq "var") {
+	if($#Global::parset_vars > 0) {
+	    $Global::parset = "var";
+	} else {
+	    my $var = shift @Global::parset_vars;
+	    print "$var=(";
+	    $Global::parset = "array";
+	    $Global::parset_endstring=")\n";
+	}
+    } else {
+	::die_bug("parset: unknown '$opt::_parset'");
+    }
+}
+
+sub parse_options(@) {
+    # Returns: N/A
+    init_globals();
+    my @argv_before = @ARGV;
+    @ARGV = read_options();
+
+    # Before changing these line, please read
+    # https://www.gnu.org/software/parallel/parallel_design.html#citation-notice
+    # https://git.savannah.gnu.org/cgit/parallel.git/tree/doc/citation-notice-faq.txt
+    # You accept to be added to a public hall of shame by
+    # removing the lines.
+    if(defined $opt::citation) {
+	citation(\@argv_before,\@ARGV);
+	wait_and_exit(0);
+    }
+    # no-* overrides *
+    if($opt::nokeeporder) { $opt::keeporder = undef; }
+
+    if(@opt::v) { $Global::verbose = $#opt::v+1; } # Convert -v -v to v=2
+    if($opt::bug) { ::die_bug("test-bug"); }
+    $Global::debug = $opt::D;
+    $Global::shell = $ENV{'PARALLEL_SHELL'} || parent_shell($$)
+	|| $ENV{'SHELL'} || "/bin/sh";
+    if(not -x $Global::shell and not which($Global::shell)) {
+	::error("Shell '$Global::shell' not found.");
+	wait_and_exit(255);
+    }
+    ::debug("init","Global::shell $Global::shell\n");
+    $Global::cshell = $Global::shell =~ m:(/[-a-z]*)?csh:;
+    if(defined $opt::_parset) { parse_parset(); }
+    if(defined $opt::X) { $Global::ContextReplace = 1; }
+    if(defined $opt::silent) { $Global::verbose = 0; }
+    if(defined $opt::null) { $/ = "\0"; }
+    if(defined $opt::d) { $/ = unquote_printf($opt::d) }
+    parse_replacement_string_options();
+    $opt::tag ||= $opt::ctag;
+    $opt::tagstring ||= $opt::ctagstring;
+    if(defined $opt::ctag or defined $opt::ctagstring
+	or defined $opt::color) {
+	$Global::color = 1;
+    }
+    if($opt::linebuffer or $opt::latestline) {
+	$Global::linebuffer = 1;
+	Job::latestline_init();
+    }
+    if(defined $opt::tag and not defined $opt::tagstring) {
+	# Default = {}
+	$opt::tagstring = $Global::parensleft.$Global::parensright;
+    }
+    if(defined $opt::tagstring) {
+	$opt::tagstring = unquote_printf($opt::tagstring);
+	if($opt::tagstring =~
+	   /\Q$Global::parensleft\E.*\S+.*\Q$Global::parensright\E/
+	   and
+	   $Global::linebuffer) {
+	    # --tagstring contains {= ... =} and --linebuffer =>
+	    #	recompute replacement string for each use (do not cache)
+	    $Global::cache_replacement_eval = 0;
+	}
+    }
+    if(defined $opt::interactive) { $Global::interactive = $opt::interactive; }
+    if(defined $opt::quote) { $Global::quoting = 1; }
+    if(defined $opt::r) { $Global::ignore_empty = 1; }
+    if(defined $opt::verbose) { $Global::stderr_verbose = 1; }
+    if(defined $opt::eof) { $Global::end_of_file_string = $opt::eof; }
+    if(defined $opt::max_args) {
+	$opt::max_args = multiply_binary_prefix($opt::max_args);
+	$Global::max_number_of_args = $opt::max_args;
+    }
+    if(defined $opt::blocktimeout) {
+	$Global::blocktimeout = int(multiply_time_units($opt::blocktimeout));
+	if($Global::blocktimeout < 1) {
+	    ::error("--block-timeout must be at least 1");
+	    wait_and_exit(255);
+	}
+    }
+    if(defined $opt::timeout) {
+	$Global::timeoutq = TimeoutQueue->new($opt::timeout);
+    }
+    if(defined $opt::tmpdir) { $ENV{'TMPDIR'} = $opt::tmpdir; }
+    $ENV{'PARALLEL_RSYNC_OPTS'} = $opt::rsync_opts ||
+	$ENV{'PARALLEL_RSYNC_OPTS'} || '-rlDzR';
+    # Default: Same nice level as GNU  Parallel is started at
+    $opt::nice ||= eval { getpriority(0,0) } || 0;
+    if(defined $opt::help) { usage(); exit(0); }
+    if(defined $opt::shellcompletion) { shell_completion(); exit(0); }
+    if(defined $opt::embed) { embed(); exit(0); }
+    if(defined $opt::sqlandworker) {
+	$opt::sqlmaster = $opt::sqlworker = $opt::sqlandworker;
+    }
+    if(defined $opt::tmuxpane) { $opt::tmux = $opt::tmuxpane; }
+    if(defined $opt::colsep) { $Global::trim = 'lr'; }
+    if(defined $opt::csv) {
+	if(not $Global::use{"Text::CSV"} ||= eval "use Text::CSV; 1;") {
+	    ::error("The perl module Text::CSV is not installed.");
+	    ::error("Try installing libtext-csv-perl or perl-Text-CSV.");
+	    wait_and_exit(255);
+	}
+	$opt::colsep = defined $opt::colsep ? $opt::colsep : ",";
+	my $csv_setting = { binary => 1, sep_char => $opt::colsep };
+	my $sep = $csv_setting->{sep_char};
+	$Global::csv = Text::CSV->new($csv_setting)
+	    or die "Cannot use CSV: ".Text::CSV->error_diag ();
+    }
+    if(defined $opt::header) {
+	$opt::colsep = defined $opt::colsep ? $opt::colsep : "\t";
+    }
+    if(defined $opt::trim) { $Global::trim = $opt::trim; }
+    if(defined $opt::arg_sep) { $Global::arg_sep = $opt::arg_sep; }
+    if(defined $opt::arg_file_sep) {
+	$Global::arg_file_sep = $opt::arg_file_sep;
+    }
+    if(not defined $opt::process_slot_var) {
+	$opt::process_slot_var = 'PARALLEL_JOBSLOT0';
+    }
+    if(defined $opt::number_of_sockets) {
+	print SSHLogin::no_of_sockets(),"\n"; wait_and_exit(0);
+    }
+    if(defined $opt::number_of_cpus) {
+	print SSHLogin::no_of_cores(),"\n"; wait_and_exit(0);
+    }
+    if(defined $opt::number_of_cores) {
+	print SSHLogin::no_of_cores(),"\n"; wait_and_exit(0);
+    }
+    if(defined $opt::number_of_threads) {
+	print SSHLogin::no_of_threads(),"\n"; wait_and_exit(0);
+    }
+    if(defined $opt::max_line_length_allowed) {
+	print Limits::Command::real_max_length(),"\n"; wait_and_exit(0);
+    }
+    if(defined $opt::max_chars) {
+	$opt::max_chars = multiply_binary_prefix($opt::max_chars);
+    }
+    if(defined $opt::version) { version(); wait_and_exit(0); }
+    if(defined $opt::record_env) { record_env(); wait_and_exit(0); }
+    if(@opt::sshlogin) { @Global::sshlogin = @opt::sshlogin; }
+    if(@opt::sshloginfile) { read_sshloginfiles(@opt::sshloginfile); }
+    if(@opt::return) { push @Global::ret_files, @opt::return; }
+    if($opt::transfer) {
+	push @Global::transfer_files, $opt::i || $opt::I || "{}";
+    }
+    push @Global::transfer_files, @opt::transfer_files;
+    if(%opt::template) {
+	while (my ($source, $template_name) = each %opt::template) {
+	    if(open(my $tmpl, "<", $source)) {
+		local $/; # $/ = undef => slurp whole file
+		my $content = <$tmpl>;
+		push @Global::template_names, $template_name;
+		push @Global::template_contents, $content;
+		::debug("tmpl","Name: $template_name\n$content\n");
+	    } else {
+		::error("Cannot open '$source'.");
+		wait_and_exit(255);
+	    }
+	}
+    }
+    if(not defined $opt::recstart and
+       not defined $opt::recend) { $opt::recend = "\n"; }
+    $Global::blocksize = multiply_binary_prefix($opt::blocksize || "1M");
+    if($Global::blocksize > 2**31-1 and not $opt::pipepart) {
+	warning("--blocksize >= 2G causes problems. Using 2G-1.");
+	$Global::blocksize = 2**31-1;
+    }
+    if($^O eq "cygwin" and
+       ($opt::pipe or $opt::pipepart or $opt::roundrobin)
+       and $Global::blocksize > 65535) {
+	warning("--blocksize >= 64K causes problems on Cygwin.");
+    }
+    $opt::memfree = multiply_binary_prefix($opt::memfree);
+    $opt::memsuspend = multiply_binary_prefix($opt::memsuspend);
+    $Global::memlimit = $opt::memsuspend + $opt::memfree;
+    check_invalid_option_combinations();
+    if((defined $opt::fifo or defined $opt::cat) and not $opt::pipepart) {
+	$opt::pipe = 1;
+    }
+    if(defined $opt::minversion) {
+	print $Global::version,"\n";
+	if($Global::version < $opt::minversion) {
+	    wait_and_exit(255);
+	} else {
+	    wait_and_exit(0);
+	}
+    }
+    if(not defined $opt::delay) {
+	# Set --delay to --sshdelay if not set
+	$opt::delay = $opt::sshdelay;
+    }
+    $Global::sshdelayauto = $opt::sshdelay =~ s/auto$//;
+    $opt::sshdelay = multiply_time_units($opt::sshdelay);
+    $Global::delayauto = $opt::delay =~ s/auto$//;
+    $opt::delay = multiply_time_units($opt::delay);
+    if($opt::compress_program) {
+	$opt::compress = 1;
+	$opt::decompress_program ||= $opt::compress_program." -dc";
+    }
+
+    if(defined $opt::results) {
+	# Is the output a dir or CSV-file?
+	if($opt::results =~ /\.csv$/i) {
+	    # CSV with , as separator
+	    $Global::csvsep = ",";
+	    $Global::membuffer ||= 1;
+	} elsif($opt::results =~ /\.tsv$/i) {
+	    # CSV with TAB as separator
+	    $Global::csvsep = "\t";
+	    $Global::membuffer ||= 1;
+	} elsif($opt::results =~ /\.json$/i) {
+	    # JSON output
+	    $Global::jsonout ||= 1;
+	    $Global::membuffer ||= 1;
+	}
+    }
+    if($opt::compress) {
+	my ($compress, $decompress) = find_compression_program();
+	$opt::compress_program ||= $compress;
+	$opt::decompress_program ||= $decompress;
+	if(($opt::results and not $Global::csvsep) or $opt::files) {
+	    # No need for decompressing
+	    $opt::decompress_program = "cat >/dev/null";
+	}
+    }
+    if(defined $opt::dryrun) {
+	# Force grouping due to bug #51039: --dry-run --timeout 3600 -u breaks
+	$opt::ungroup = 0;
+	$opt::group = 1;
+    }
+    if(defined $opt::nonall) {
+	# Append a dummy empty argument if there are no arguments
+	# on the command line to avoid reading from STDIN.
+	# arg_sep = random 50 char
+	# \0noarg => nothing (not the empty string)
+	$Global::arg_sep = join "",
+	map { (0..9,"a".."z","A".."Z")[rand(62)] } (1..50);
+	push @ARGV, $Global::arg_sep, "\0noarg";
+    }
+    if(defined $opt::tee) {
+	if(not defined $opt::jobs) {
+	    $opt::jobs = 0;
+	}
+    }
+    if(defined $opt::tty) {
+	# Defaults for --tty: -j1 -u
+	# Can be overridden with -jXXX -g
+	if(not defined $opt::jobs) {
+	    $opt::jobs = 1;
+	}
+	if(not defined $opt::group) {
+	    $opt::ungroup = 1;
+	}
+    }
+    if(@opt::trc) {
+	push @Global::ret_files, @opt::trc;
+	if(not @Global::transfer_files) {
+	    # Defaults to --transferfile {}
+	    push @Global::transfer_files, $opt::i || $opt::I || "{}";
+	}
+	$opt::cleanup = 1;
+    }
+    if(defined $opt::max_lines) {
+	if($opt::max_lines eq "-0") {
+	    # -l -0 (swallowed -0)
+	    $opt::max_lines = 1;
+	    $opt::null = 1;
+	    $/ = "\0";
+	} else {
+	    $opt::max_lines = multiply_binary_prefix($opt::max_lines);
+	    if ($opt::max_lines == 0) {
+		# If not given (or if 0 is given) => 1
+		$opt::max_lines = 1;
+	    }
+	}
+
+	$Global::max_lines = $opt::max_lines;
+	if(not $opt::pipe) {
+	    # --pipe -L means length of record - not max_number_of_args
+	    $Global::max_number_of_args ||= $Global::max_lines;
+	}
+    }
+
+    # Read more than one arg at a time (-L, -N)
+    if(defined $opt::L) {
+	$opt::L = multiply_binary_prefix($opt::L);
+	$Global::max_lines = $opt::L;
+	if(not $opt::pipe) {
+	    # --pipe -L means length of record - not max_number_of_args
+	    $Global::max_number_of_args ||= $Global::max_lines;
+	}
+    }
+    if(defined $opt::max_replace_args) {
+	$opt::max_replace_args =
+	    multiply_binary_prefix($opt::max_replace_args);
+	$Global::max_number_of_args = $opt::max_replace_args;
+	$Global::ContextReplace = 1;
+    }
+    if((defined $opt::L or defined $opt::max_replace_args)
+       and
+       not ($opt::xargs or $opt::m)) {
+	$Global::ContextReplace = 1;
+    }
+    if(grep /^$Global::arg_sep\+?$|^$Global::arg_file_sep\+?$/o, @ARGV) {
+	# Deal with ::: :::+ :::: and ::::+
+	@ARGV = read_args_from_command_line();
+    }
+    parse_semaphore();
+
+    if(defined $opt::eta) { $opt::progress = $opt::eta; }
+    if(defined $opt::bar) { $opt::progress = $opt::bar; }
+    if(defined $opt::bar or defined $opt::latestline) {
+	my $fh = $Global::status_fd || *STDERR;
+	eval q{
+	    # Enable utf8 if possible
+	    use utf8;
+	    binmode $fh, "encoding(utf8)";
+	    *decode_utf8 = \&Encode::decode_utf8;
+	};
+	if(eval { decode_utf8("x") }) {
+	    # Great: decode works
+	} else {
+	    # UTF8-decode not supported: Dummy decode
+	    eval q{sub decode_utf8($;$) { $_[0]; }};
+	}
+    }
+
+    # Funding a free software project is hard. GNU Parallel is no
+    # exception. On top of that it seems the less visible a project
+    # is, the harder it is to get funding. And the nature of GNU
+    # Parallel is that it will never be seen by "the guy with the
+    # checkbook", but only by the people doing the actual work.
+    #
+    # This problem has been covered by others - though no solution has
+    # been found:
+    # https://www.slideshare.net/NadiaEghbal/consider-the-maintainer
+    # https://www.numfocus.org/blog/why-is-numpy-only-now-getting-funded/
+    #
+    # The FAQ tells you why the citation notice exists:
+    # https://git.savannah.gnu.org/cgit/parallel.git/tree/doc/citation-notice-faq.txt
+    #
+    # If you want GNU Parallel to be maintained in the future, and not
+    # just wither away like so many other free software tools, you
+    # need to help finance the development.
+    #
+    # The citation notice is a simple way of doing so, as citations
+    # makes it possible to me to get a job where I can maintain GNU
+    # Parallel as part of the job.
+    #
+    # This means you can help financing development
+    #
+    #	WITHOUT PAYING A SINGLE CENT!
+    #
+    # Before implementing the citation notice it was discussed with
+    # the users:
+    # https://lists.gnu.org/archive/html/parallel/2013-11/msg00006.html
+    #
+    # Having to spend 10 seconds on running 'parallel --citation' once
+    # is no doubt not an ideal solution, but no one has so far come up
+    # with an ideal solution - neither for funding GNU Parallel nor
+    # other free software.
+    #
+    # If you believe you have the perfect solution, you should try it
+    # out, and if it works, you should post it on the email
+    # list. Ideas that will cost work and which have not been tested
+    # are, however, unlikely to be prioritized.
+    #
+    # Please note that GPL version 3 gives you the right to fork GNU
+    # Parallel under a new name, but it does not give you the right to
+    # distribute modified copies with the citation notice disabled in
+    # a way where the software can be confused with GNU Parallel. To
+    # do that you need to be the owner of the GNU Parallel
+    # trademark. The xt:Commerce case shows this.
+    #
+    # Description of the xt:Commerce case in OLG Duesseldorf
+    # https://web.archive.org/web/20180715073746/http://www.inta.org/INTABulletin/Pages/GERMANYGeneralPublicLicenseDoesNotPermitUseofThird-PartyTrademarksforAdvertisingModifiedVersionsofOpen-SourceSoftware.aspx
+    #
+    # The verdict in German
+    # https://www.admody.com/urteilsdatenbank/cafe6fdaeed3/OLG-Duesseldorf_Urteil_vom_28-September-2010_Az_I-20-U-41-09
+    # https://web.archive.org/web/20180715073717/https://www.admody.com/urteilsdatenbank/cafe6fdaeed3/OLG-Duesseldorf_Urteil_vom_28-September-2010_Az_I-20-U-41-09
+    #
+    # Other free software limiting derivates by the same name:
+    # https://en.wikipedia.org/wiki/Red_Hat_Enterprise_Linux_derivatives#Legal_aspects
+    # https://tm.joomla.org/trademark-faq.html
+    # https://www.mozilla.org/en-US/foundation/trademarks/faq/
+    #
+    # Running 'parallel --citation' one single time takes less than 10
+    # seconds, and will silence the citation notice for future
+    # runs. If that is too much trouble for you, why not use one of
+    # the alternatives instead?
+    # See a list in: 'man parallel_alternatives'
+    #
+    # If you want GNU Parallel to be maintained in the future you
+    # should keep this line.
+    citation_notice();
+    # *YOU* will be harming free software by removing the notice.  You
+    # accept to be added to a public hall of shame by removing the
+    # line.  This is because _YOU_ actively make it harder to justify
+    # spending time developing GNU Parallel.
+
+    parse_halt();
+
+    if($ENV{'PARALLEL_ENV'}) {
+	# Read environment and set $Global::parallel_env
+	# Must be done before is_acceptable_command_line_length()
+	my $penv = $ENV{'PARALLEL_ENV'};
+	# unset $PARALLEL_ENV: It should not be given to children
+	# because it takes up a lot of env space
+	delete $ENV{'PARALLEL_ENV'};
+	if(-e $penv) {
+	    # This is a file/fifo: Replace envvar with content of file
+	    open(my $parallel_env, "<", $penv) ||
+		::die_bug("Cannot read parallel_env from $penv");
+	    local $/; # Put <> in slurp mode
+	    $penv = <$parallel_env>;
+	    close $parallel_env;
+	}
+	# Map \001 to \n to make it easer to quote \n in $PARALLEL_ENV
+	$penv =~ s/\001/\n/g;
+	if($penv =~ /\0/) {
+	    ::warning('\0 (NUL) in environment is not supported');
+	}
+	$Global::parallel_env = $penv;
+    }
+
+    parse_sshlogin();
+    if(defined $opt::show_limits) { show_limits(); }
+
+    if(remote_hosts() and ($opt::X or $opt::m or $opt::xargs)) {
+	# As we do not know the max line length on the remote machine
+	# long commands generated by xargs may fail
+	# If $opt::max_replace_args is set, it is probably safe
+	::warning("Using -X or -m with --sshlogin may fail.");
+    }
+
+    if(not defined $opt::jobs) { $opt::jobs = "100%"; }
+    open_joblog();
+    open_json_csv();
+    if($opt::sqlmaster or $opt::sqlworker) {
+	$Global::sql = SQL->new($opt::sqlmaster || $opt::sqlworker);
+    }
+    if($opt::sqlworker) { $Global::membuffer ||= 1; }
+    # The sqlmaster groups the arguments, so the should just read one
+    if($opt::sqlworker and not $opt::sqlmaster) {
+	$Global::max_number_of_args = 1;
+    }
+    if($Global::color or $opt::colorfailed) { Job::init_color(); }
+}
+
+sub check_invalid_option_combinations() {
+    if(defined $opt::timeout and
+       $opt::timeout !~ /^\d+(\.\d+)?%?$|^(\d+(\.\d+)?[dhms])+$/i) {
+	::error("--timeout must be seconds or percentage.");
+	wait_and_exit(255);
+    }
+    if(defined $opt::fifo and defined $opt::cat) {
+	::error("--fifo cannot be combined with --cat.");
+	::wait_and_exit(255);
+    }
+    if(defined $opt::retries and defined $opt::roundrobin) {
+	::error("--retries cannot be combined with --roundrobin.");
+	::wait_and_exit(255);
+    }
+    if(defined $opt::pipepart and
+       (defined $opt::L or defined $opt::max_lines
+	or defined $opt::max_replace_args)) {
+	::error("--pipepart is incompatible with --max-replace-args, ".
+		"--max-lines, and -L.");
+	wait_and_exit(255);
+    }
+    if(defined $opt::group and $opt::ungroup) {
+	::error("--group cannot be combined with --ungroup.");
+	::wait_and_exit(255);
+    }
+    if(defined $opt::group and $opt::linebuffer) {
+	::error("--group cannot be combined with --line-buffer.");
+	::wait_and_exit(255);
+    }
+    if(defined $opt::ungroup and $opt::linebuffer) {
+	::error("--ungroup cannot be combined with --line-buffer.");
+	::wait_and_exit(255);
+    }
+    if(defined $opt::tollef and not $opt::gnu) {
+       ::error("--tollef has been retired.",
+	       "Remove --tollef or use --gnu to override --tollef.");
+       ::wait_and_exit(255);
+    }
+    if(defined $opt::retired) {
+	    ::error("-g has been retired. Use --group.",
+		    "-B has been retired. Use --bf.",
+		    "-T has been retired. Use --tty.",
+		    "-U has been retired. Use --er.",
+		    "-W has been retired. Use --wd.",
+		    "-Y has been retired. Use --shebang.",
+		    "-H has been retired. Use --halt.",
+		    "--sql has been retired. Use --sqlmaster.",
+		    "--ctrlc has been retired.",
+		    "--noctrlc has been retired.");
+	    ::wait_and_exit(255);
+    }
+    if($opt::groupby) {
+	if(not $opt::pipe and not $opt::pipepart) {
+	    $opt::pipe = 1;
+	}
+	if($opt::remove_rec_sep) {
+	    ::error("--remove-rec-sep is not compatible with --groupby");
+	    ::wait_and_exit(255);
+	}
+	if($opt::recstart) {
+	    ::error("--recstart is not compatible with --groupby");
+	    ::wait_and_exit(255);
+	}
+	if($opt::recend ne "\n") {
+	    ::error("--recend is not compatible with --groupby");
+	    ::wait_and_exit(255);
+	}
+    }
+}
+
+sub init_globals() {
+    # Defaults:
+    $Global::version = 20221122;
+    $Global::progname = 'parallel';
+    $::name = "GNU Parallel";
+    $Global::infinity = 2**31;
+    $Global::debug = 0;
+    $Global::verbose = 0;
+    # Don't quote every part of the command line
+    $Global::quoting = 0;
+    # Quote replacement strings
+    $Global::quote_replace = 1;
+    $Global::total_completed = 0;
+    $Global::cache_replacement_eval = 1;
+    # Read only table with default --rpl values
+    %Global::replace =
+	(
+	 '{}'	=> '',
+	 '{#}'	=> '1 $_=$job->seq()',
+	 '{%}'	=> '1 $_=$job->slot()',
+	 '{/}'	=> 's:.*/::',
+	 '{//}' =>
+	 ('$Global::use{"File::Basename"} ||= eval "use File::Basename; 1;"; '.
+	  '$_ = dirname($_);'),
+	 '{/.}' => 's:.*/::; s:\.[^/.]*$::;',
+	 '{.}'	=> 's:\.[^/.]*$::',
+	);
+    %Global::plus =
+	(
+	 # {} = {+/}/{/}
+	 #    = {.}.{+.}     = {+/}/{/.}.{+.}
+	 #    = {..}.{+..}   = {+/}/{/..}.{+..}
+	 #    = {...}.{+...} = {+/}/{/...}.{+...}
+	 '{+/}' => 's:/[^/]*$:: || s:.*$::',
+	 # a.b => b; a => ''
+	 '{+.}' => 's:.*\.:: || s:.*$::',
+	 # a.b.c => b.c; a.b => ''; a => ''
+	 '{+..}' => 's:.*\.([^/.]*\.[^/.]*)$:$1: || s:.*$::',
+	 '{+...}' => 's:.*\.([^/.]*\.[^/.]*\.[^/.]*)$:$1: || s:.*$::',
+	 '{..}' => 's:\.[^/.]*\.[^/.]*$::',
+	 '{...}' => 's:\.[^/.]*\.[^/.]*\.[^/.]*$::',
+	 '{/..}' => 's:.*/::; s:\.[^/.]*\.[^/.]*$::',
+	 '{/...}' => 's:.*/::; s:\.[^/.]*\.[^/.]*\.[^/.]*$::',
+	 # n choose k = Binomial coefficient
+	 '{choose_k}' => ('for $t (2..$#arg)'.
+			  '{ if($arg[$t-1] ge $arg[$t]) { skip() } }'),
+	 # unique values: Skip job if any args are the same
+	 '{uniq}' => 'if(::uniq(@arg) != @arg) { skip(); }',
+	 # {##} = number of jobs
+	 '{##}' => '1 $_=total_jobs()',
+	 # {0%} = 0-padded jobslot
+	 '{0%}' => ('1 $f=1+int((log($Global::max_jobs_running||1)/log(10)));'.
+		    '$_=sprintf("%0${f}d",slot())'),
+	 # {0%} = 0-padded seq
+	 '{0#}' => ('1 $f=1+int((log(total_jobs())/log(10)));'.
+		    '$_=sprintf("%0${f}d",seq())'),
+
+	 ## Bash inspired replacement strings
+	 # Bash ${a:-myval}
+	 '{:-([^}]+?)}' => '$_ ||= $$1',
+	 # Bash ${a:2}
+	 '{:(\d+?)}' => 'substr($_,0,$$1) = ""',
+	 # Bash ${a:2:3}
+	 '{:(\d+?):(\d+?)}' => '$_ = substr($_,$$1,$$2);',
+	 # echo {#z.*z.} ::: z.z.z.foo => z.foo
+	 # echo {##z.*z.} ::: z.z.z.foo => foo
+	 # Bash ${a#bc}
+	 '{#([^#}][^}]*?)}' =>
+	 '$nongreedy=::make_regexp_ungreedy($$1);s/^$nongreedy(.*)/$1/;',
+	 # Bash ${a##bc}
+	 '{##([^#}][^}]*?)}' => 's/^$$1//;',
+	 # echo {%.z.*z} ::: foo.z.z.z => foo.z
+	 # echo {%%.z.*z} ::: foo.z.z.z => foo
+	 # Bash ${a%def}
+	 '{%([^}]+?)}' =>
+	 '$nongreedy=::make_regexp_ungreedy($$1);s/(.*)$nongreedy$/$1/;',
+	 # Bash ${a%%def}
+	 '{%%([^}]+?)}' => 's/$$1$//;',
+	 # Bash ${a/def/ghi} ${a/def/}
+	 '{/([^#%}/]+?)/([^}]*?)}' => 's/$$1/$$2/;',
+	 # Bash ${a/#def/ghi} ${a/#def/}
+	 '{/#([^}]+?)/([^}]*?)}' => 's/^$$1/$$2/g;',
+	 # Bash ${a/%def/ghi} ${a/%def/}
+	 '{/%([^}]+?)/([^}]*?)}' => 's/$$1$/$$2/g;',
+	 # Bash ${a//def/ghi} ${a//def/}
+	 '{//([^}]+?)/([^}]*?)}' => 's/$$1/$$2/g;',
+	 # Bash ${a^a}
+	 '{^([^}]+?)}' => 's/^($$1)/uc($1)/e;',
+	 # Bash ${a^^a}
+	 '{^^([^}]+?)}' => 's/($$1)/uc($1)/eg;',
+	 # Bash ${a,A}
+	 '{,([^}]+?)}' => 's/^($$1)/lc($1)/e;',
+	 # Bash ${a,,A}
+	 '{,,([^}]+?)}' => 's/($$1)/lc($1)/eg;',
+
+	 # {slot} = $PARALLEL_JOBSLOT
+	 '{slot}' => '1 $_="\${PARALLEL_JOBSLOT}";uq()',
+	 # {host} = ssh host
+	 '{host}' => '1 $_="\${PARALLEL_SSHHOST}";uq()',
+	 # {sshlogin} = sshlogin
+	 '{sshlogin}' => '1 $_="\${PARALLEL_SSHLOGIN}";uq()',
+	 # {hgrp} = hostgroups of the host
+	 '{hgrp}' => '1 $_="\${PARALLEL_HOSTGROUPS}";uq()',
+	 # {agrp} = hostgroups of the argument
+	 '{agrp}' => '1 $_="\${PARALLEL_ARGHOSTGROUPS}";uq()',
+	);
+    # Modifiable copy of %Global::replace
+    %Global::rpl = %Global::replace;
+    $/ = "\n";
+    $Global::ignore_empty = 0;
+    $Global::interactive = 0;
+    $Global::stderr_verbose = 0;
+    $Global::default_simultaneous_sshlogins = 9;
+    $Global::exitstatus = 0;
+    $Global::arg_sep = ":::";
+    $Global::arg_file_sep = "::::";
+    $Global::trim = 'n';
+    $Global::max_jobs_running = 0;
+    $Global::job_already_run = '';
+    $ENV{'TMPDIR'} ||= "/tmp";
+    $ENV{'PARALLEL_REMOTE_TMPDIR'} ||= "/tmp";
+    $ENV{'OLDPWD'} = $ENV{'PWD'};
+    if(not $ENV{HOME}) {
+	# $ENV{HOME} is sometimes not set if called from PHP
+	::warning("\$HOME not set. Using /tmp.");
+	$ENV{HOME} = "/tmp";
+    }
+    # no warnings to allow for undefined $XDG_*
+    no warnings 'uninitialized';
+    # If $PARALLEL_HOME is set, but does not exist, try making it.
+    if(defined $ENV{'PARALLEL_HOME'}) {
+	eval { File::Path::mkpath($ENV{'PARALLEL_HOME'}); };
+    }
+    # $xdg_config_home is needed to make env_parallel.fish stop complaining
+    my $xdg_config_home = $ENV{'XDG_CONFIG_HOME'};
+    # config_dirs = $PARALLEL_HOME, $XDG_CONFIG_HOME/parallel,
+    #	$(each XDG_CONFIG_DIRS)/parallel, $HOME/.parallel
+    # Keep only dirs that exist
+    @Global::config_dirs =
+	(grep { -d $_ }
+	 $ENV{'PARALLEL_HOME'},
+	 (map { "$_/parallel" }
+	  $xdg_config_home,
+	  split /:/, $ENV{'XDG_CONFIG_DIRS'}),
+	 $ENV{'HOME'} . "/.parallel");
+    # Use first dir as config dir
+    $Global::config_dir = $Global::config_dirs[0] ||
+	$ENV{'HOME'} . "/.parallel";
+    if($ENV{'PARALLEL_HOME'} =~ /./ and not -d $ENV{'PARALLEL_HOME'}) {
+	::warning("\$PARALLEL_HOME ($ENV{'PARALLEL_HOME'}) does not exist.");
+	::warning("Using $Global::config_dir");
+    }
+    # cache_dirs = $PARALLEL_HOME, $XDG_CACHE_HOME/parallel,
+    # Keep only dirs that exist
+    @Global::cache_dirs =
+	(grep { -d $_ }
+	 $ENV{'PARALLEL_HOME'}, $ENV{'XDG_CACHE_HOME'}."/parallel");
+    $Global::cache_dir = $Global::cache_dirs[0] ||
+	$ENV{'HOME'} . "/.parallel";
+    Job::init_color();
+}
+
+sub parse_halt() {
+    # $opt::halt flavours
+    # Uses:
+    #	$opt::halt
+    #	$Global::halt_when
+    #	$Global::halt_fail
+    #	$Global::halt_success
+    #	$Global::halt_pct
+    #	$Global::halt_count
+    if(defined $opt::halt) {
+	my %halt_expansion = (
+	    "0" => "never",
+	    "1" => "soon,fail=1",
+	    "2" => "now,fail=1",
+	    "-1" => "soon,success=1",
+	    "-2" => "now,success=1",
+	);
+	# Expand -2,-1,0,1,2 into long form
+	$opt::halt = $halt_expansion{$opt::halt} || $opt::halt;
+	# --halt 5% == --halt soon,fail=5%
+	$opt::halt =~ s/^(\d+)%$/soon,fail=$1%/;
+	# Split: soon,fail=5%
+	my ($when,$fail_success,$pct_count) = split /[,=]/, $opt::halt;
+	if(not grep { $when eq $_ } qw(never soon now)) {
+	    ::error("--halt must have 'never', 'soon', or 'now'.");
+	    ::wait_and_exit(255);
+	}
+	$Global::halt_when = $when;
+	if($when ne "never") {
+	    if($fail_success eq "fail") {
+		$Global::halt_fail = 1;
+	    } elsif($fail_success eq "success") {
+		$Global::halt_success = 1;
+	    } elsif($fail_success eq "done") {
+		$Global::halt_done = 1;
+	    } else {
+		::error("--halt $when must be followed by ,success or ,fail.");
+		::wait_and_exit(255);
+	    }
+	    if($pct_count =~ /^(\d+)%$/) {
+		$Global::halt_pct = $1/100;
+	    } elsif($pct_count =~ /^(\d+)$/) {
+		$Global::halt_count = $1;
+	    } else {
+		::error("--halt $when,$fail_success ".
+			"must be followed by ,number or ,percent%.");
+		::wait_and_exit(255);
+	    }
+	}
+    }
+}
+
+sub parse_replacement_string_options() {
+    # Deal with --rpl
+    # Uses:
+    #	%Global::rpl
+    #	$Global::parensleft
+    #	$Global::parensright
+    #	$opt::parens
+    #	$Global::parensleft
+    #	$Global::parensright
+    #	$opt::plus
+    #	%Global::plus
+    #	$opt::I
+    #	$opt::U
+    #	$opt::i
+    #	$opt::basenamereplace
+    #	$opt::dirnamereplace
+    #	$opt::seqreplace
+    #	$opt::slotreplace
+    #	$opt::basenameextensionreplace
+
+    sub rpl($$) {
+	# Modify %Global::rpl
+	# Replace $old with $new
+	my ($old,$new) =  @_;
+	if($old ne $new) {
+	    $Global::rpl{$new} = $Global::rpl{$old};
+	    delete $Global::rpl{$old};
+	}
+    }
+    my $parens = "{==}";
+    if(defined $opt::parens) { $parens = $opt::parens; }
+    my $parenslen = 0.5*length $parens;
+    $Global::parensleft = substr($parens,0,$parenslen);
+    $Global::parensright = substr($parens,$parenslen);
+    if(defined $opt::plus) { %Global::rpl = (%Global::plus,%Global::rpl); }
+    if(defined $opt::I) { rpl('{}',$opt::I); }
+    if(defined $opt::i and $opt::i) { rpl('{}',$opt::i); }
+    if(defined $opt::U) { rpl('{.}',$opt::U); }
+    if(defined $opt::basenamereplace) { rpl('{/}',$opt::basenamereplace); }
+    if(defined $opt::dirnamereplace) { rpl('{//}',$opt::dirnamereplace); }
+    if(defined $opt::seqreplace) { rpl('{#}',$opt::seqreplace); }
+    if(defined $opt::slotreplace) { rpl('{%}',$opt::slotreplace); }
+    if(defined $opt::basenameextensionreplace) {
+       rpl('{/.}',$opt::basenameextensionreplace);
+    }
+    for(@opt::rpl) {
+	# Create $Global::rpl entries for --rpl options
+	# E.g: "{..} s:\.[^.]+$:;s:\.[^.]+$:;"
+	my ($shorthand,$long) = split/\s/,$_,2;
+	$Global::rpl{$shorthand} = $long;
+    }
+}
+
+sub parse_semaphore() {
+    # Semaphore defaults
+    # Must be done before computing number of processes and max_line_length
+    # because when running as a semaphore GNU Parallel does not read args
+    # Uses:
+    #	$opt::semaphore
+    #	$Global::semaphore
+    #	$opt::semaphoretimeout
+    #	$Semaphore::timeout
+    #	$opt::semaphorename
+    #	$Semaphore::name
+    #	$opt::fg
+    #	$Semaphore::fg
+    #	$opt::wait
+    #	$Semaphore::wait
+    #	$opt::bg
+    #	@opt::a
+    #	@Global::unget_argv
+    #	$Global::default_simultaneous_sshlogins
+    #	$opt::jobs
+    #	$Global::interactive
+    $Global::semaphore ||= ($0 =~ m:(^|/)sem$:); # called as 'sem'
+    if(defined $opt::semaphore) { $Global::semaphore = 1; }
+    if(defined $opt::semaphoretimeout) { $Global::semaphore = 1; }
+    if(defined $opt::semaphorename) { $Global::semaphore = 1; }
+    if(defined $opt::fg and not $opt::tmux and not $opt::tmuxpane) {
+	$Global::semaphore = 1;
+    }
+    if(defined $opt::bg) { $Global::semaphore = 1; }
+    if(defined $opt::wait and not $opt::sqlmaster) {
+	$Global::semaphore = 1; @ARGV = "true";
+    }
+    if($Global::semaphore) {
+	if(@opt::a) {
+	    # Assign the first -a to STDIN
+	    open(STDIN,"<",shift @opt::a);
+	    if(@opt::a) {
+		# We currently have no way of dealing with more -a
+		::error("A semaphore cannot take input from more files\n");
+		::wait_and_exit(255);
+	    }
+	}
+	@opt::a = ("/dev/null");
+	# Append a dummy empty argument
+	# \0 => nothing (not the empty string)
+	push(@Global::unget_argv, [Arg->new("\0noarg")]);
+	$Semaphore::timeout = int(multiply_time_units($opt::semaphoretimeout))
+	    || 0;
+	if(defined $opt::semaphorename) {
+	    $Semaphore::name = $opt::semaphorename;
+	} else {
+	    local $/ = "\n";
+	    $Semaphore::name = `tty`;
+	    chomp $Semaphore::name;
+	}
+	$Semaphore::fg = $opt::fg;
+	$Semaphore::wait = $opt::wait;
+	$Global::default_simultaneous_sshlogins = 1;
+	if(not defined $opt::jobs) {
+	    $opt::jobs = 1;
+	}
+	if($Global::interactive and $opt::bg) {
+	    ::error("Jobs running in the ".
+		    "background cannot be interactive.");
+	    ::wait_and_exit(255);
+	}
+    }
+}
+
+sub record_env() {
+    # Record current %ENV-keys in $PARALLEL_HOME/ignored_vars
+    # Returns: N/A
+    my $ignore_filename = $Global::config_dir . "/ignored_vars";
+    if(open(my $vars_fh, ">", $ignore_filename)) {
+	print $vars_fh map { $_,"\n" } keys %ENV;
+    } else {
+	::error("Cannot write to $ignore_filename.");
+	::wait_and_exit(255);
+    }
+}
+
+sub open_joblog() {
+    # Open joblog as specified by --joblog
+    # Uses:
+    #	$opt::resume
+    #	$opt::resume_failed
+    #	$opt::joblog
+    #	$opt::results
+    #	$Global::job_already_run
+    #	%Global::fh
+    my $append = 0;
+    if(($opt::resume or $opt::resume_failed)
+       and
+       not ($opt::joblog or $opt::results)) {
+	::error("--resume and --resume-failed require --joblog or --results.");
+	::wait_and_exit(255);
+    }
+    if(defined $opt::joblog and $opt::joblog =~ s/^\+//) {
+	# --joblog +filename = append to filename
+	$append = 1;
+    }
+    if($opt::joblog
+       and
+       ($opt::sqlmaster
+	or
+	not $opt::sqlworker)) {
+	# Do not log if --sqlworker
+	if($opt::resume || $opt::resume_failed || $opt::retry_failed) {
+	    if(open(my $joblog_fh, "<", $opt::joblog)) {
+		# Read the joblog
+		# Override $/ with \n because -d might be set
+		local $/ = "\n";
+		# If there is a header: Open as append later
+		$append = <$joblog_fh>;
+		my $joblog_regexp;
+		if($opt::retry_failed) {
+		    # Make a regexp that matches commands with exit+signal=0
+		    # 4 host 1360490623.067 3.445 1023 1222 0 0 command
+		    $joblog_regexp='^(\d+)(?:\t[^\t]+){5}\t0\t0\t';
+		    my @group;
+		    while(<$joblog_fh>) {
+			if(/$joblog_regexp/o) {
+			    # This is 30% faster than set_job_already_run($1);
+			    vec($Global::job_already_run,($1||0),1) = 1;
+			    $Global::total_completed++;
+			    $group[$1-1] = "true";
+			} elsif(/(\d+)\s+\S+(\s+[-0-9.]+){6}\s+(.*)$/) {
+			    # Grab out the command
+			    $group[$1-1] = $3;
+			} else {
+			    chomp;
+			    ::error("Format of '$opt::joblog' is wrong: $_");
+			    ::wait_and_exit(255);
+			}
+		    }
+		    if(@group) {
+			my ($outfh,$name) = ::tmpfile(SUFFIX => ".arg");
+			unlink($name);
+			# Put args into argfile
+			if(grep /\0/, @group) {
+			    # force --null to deal with \n in commandlines
+			    ::warning("Command lines contain newline. ".
+				      "Forcing --null.");
+			    $opt::null = 1;
+			    $/ = "\0";
+			}
+			# Replace \0 with '\n' as used in print_joblog()
+			print $outfh (map { s/\0/\n/g; $_,$/ }
+				      map { $_ } @group);
+			seek $outfh, 0, 0;
+			exit_if_disk_full();
+			# Set filehandle to -a
+			@opt::a = ($outfh);
+		    }
+		    # Remove $command (so -a is run)
+		    @ARGV = ();
+		}
+		if($opt::resume || $opt::resume_failed) {
+		    if($opt::resume_failed) {
+			# Make a regexp that matches commands with exit+signal=0
+			# 4 host 1360490623.067 3.445 1023 1222 0 0 command
+			$joblog_regexp='^(\d+)(?:\t[^\t]+){5}\t0\t0\t';
+		    } else {
+			# Just match the job number
+			$joblog_regexp='^(\d+)';
+		    }
+		    while(<$joblog_fh>) {
+			if(/$joblog_regexp/o) {
+			    # This is 30% faster than set_job_already_run($1);
+			    vec($Global::job_already_run,($1||0),1) = 1;
+			    $Global::total_completed++;
+			} elsif(not /\d+\s+[^\s]+\s+([-0-9.]+\s+){6}/) {
+			    ::error("Format of '$opt::joblog' is wrong: $_");
+			    ::wait_and_exit(255);
+			}
+		    }
+		}
+		close $joblog_fh;
+	    }
+	    # $opt::null may be set if the commands contain \n
+	    if($opt::null) { $/ = "\0"; }
+	}
+	if($opt::dryrun) {
+	    # Do not write to joblog in a dry-run
+	    if(not open($Global::joblog, ">", "/dev/null")) {
+		::error("Cannot write to --joblog $opt::joblog.");
+		::wait_and_exit(255);
+	    }
+	} elsif($append) {
+	    # Append to joblog
+	    if(not open($Global::joblog, ">>", $opt::joblog)) {
+		::error("Cannot append to --joblog $opt::joblog.");
+		::wait_and_exit(255);
+	    }
+	} else {
+	    if($opt::joblog eq "-") {
+		# Use STDOUT as joblog
+		$Global::joblog = $Global::fh{1};
+	    } elsif(not open($Global::joblog, ">", $opt::joblog)) {
+		# Overwrite the joblog
+		::error("Cannot write to --joblog $opt::joblog.");
+		::wait_and_exit(255);
+	    }
+	    print $Global::joblog
+		join("\t", "Seq", "Host", "Starttime", "JobRuntime",
+		     "Send", "Receive", "Exitval", "Signal", "Command"
+		). "\n";
+	}
+    }
+}
+
+sub open_json_csv() {
+    if($opt::results) {
+	# Output as JSON/CSV/TSV
+	if($opt::results eq "-.csv"
+	   or
+	   $opt::results eq "-.tsv"
+	   or
+	   $opt::results eq "-.json") {
+	    # Output as JSON/CSV/TSV on stdout
+	    open $Global::csv_fh, ">&", "STDOUT" or
+		::die_bug("Can't dup STDOUT in csv: $!");
+	    # Do not print any other output to STDOUT
+	    # by forcing all other output to /dev/null
+	    open my $fd, ">", "/dev/null" or
+		::die_bug("Can't >/dev/null in csv: $!");
+	    $Global::fh{1} = $fd;
+	    $Global::fh{2} = $fd;
+	} elsif($Global::csvsep or $Global::jsonout) {
+	    if(not open($Global::csv_fh,">",$opt::results)) {
+		::error("Cannot open results file `$opt::results': ".
+			"$!.");
+		wait_and_exit(255);
+	    }
+	}
+    }
+}
+
+sub find_compression_program() {
+    # Find a fast compression program
+    # Returns:
+    #	$compress_program = compress program with options
+    #	$decompress_program = decompress program with options
+
+    # Search for these. Sorted by speed on 128 core
+
+    # seq 120000000|shuf > 1gb &
+    # apt-get update
+    # apt install make g++ htop
+    # wget -O - pi.dk/3 | bash
+    # apt install zstd clzip liblz4-tool lzop pigz pxz gzip plzip pbzip2 lzma xz-utils lzip bzip2 lbzip2 lrzip pixz
+    # git clone https://github.com/facebook/zstd.git
+    # (cd zstd/contrib/pzstd; make -j; cp pzstd /usr/local/bin)
+    # echo 'lrzip -L $((-$1))'	>/usr/local/bin/lrz
+    # chmod +x /usr/local/bin/lrz
+    # wait
+    # onethread="zstd clzip lz4 lzop gzip lzma xz bzip2"
+    # multithread="pzstd pigz pxz plzip pbzip2 lzip lbzip2 lrz pixz"
+    # parallel --shuf -j1  --joblog jl-m --arg-sep ,  parallel --compress-program \'{3}" "-{2}\' cat ::: 1gb '>'/dev/null , 1 2 3 ,  {1..3} , $multithread
+    # parallel --shuf -j50% --delay 1  --joblog jl-s --arg-sep ,  parallel --compress-program \'{3}" "-{2}\' cat ::: 1gb '>'/dev/null , 1 2 3 ,	 {1..3} , $onethread
+    # sort -nk4 jl-?
+
+    # 1-core:
+    # 2-cores: pzstd zstd lz4 lzop pigz gzip lbzip2 pbzip2 lrz bzip2 lzma pxz plzip xz lzip clzip
+    # 4-cores:
+    # 8-cores: pzstd lz4 zstd pigz lzop lbzip2 pbzip2 gzip lzip lrz plzip pxz bzip2 lzma xz clzip
+    # 16-cores: pzstd lz4 pigz lzop lbzip2 pbzip2 plzip lzip lrz pxz gzip lzma xz bzip2
+    # 32-cores: pzstd lbzip2 pbzip2 zstd pigz lz4 lzop plzip lzip lrz gzip pxz lzma bzip2 xz clzip
+    # 64-cores: pzstd lbzip2 pbzip2 pigz zstd pixz lz4 plzip lzop lzip lrz gzip pxz lzma bzip2 xz clzip
+    # 128-core: pzstd lbzip2 pbzip2 zstd pixz lz4 pigz lzop plzip lzip gzip lrz pxz bzip2 lzma xz clzip
+
+    my @prg = qw(pzstd lbzip2 pbzip2 zstd pixz lz4 pigz lzop plzip lzip gzip
+		 lrz pxz bzip2 lzma xz clzip);
+    for my $p (@prg) {
+	if(which($p)) {
+	    return ("$p -c -1","$p -dc");
+	}
+    }
+    # Fall back to cat
+    return ("cat","cat");
+}
+
+sub read_options() {
+    # Read options from command line, profile and $PARALLEL
+    # Uses:
+    #	$opt::shebang_wrap
+    #	$opt::shebang
+    #	@ARGV
+    #	$opt::plain
+    #	@opt::profile
+    #	$ENV{'HOME'}
+    #	$ENV{'PARALLEL'}
+    # Returns:
+    #	@ARGV_no_opt = @ARGV without --options
+
+    # This must be done first as this may exec myself
+    if(defined $ARGV[0] and ($ARGV[0] =~ /^--shebang/ or
+			     $ARGV[0] =~ /^--shebang-?wrap/ or
+			     $ARGV[0] =~ /^--hashbang/)) {
+	# Program is called from #! line in script
+	# remove --shebang-wrap if it is set
+	$opt::shebang_wrap = ($ARGV[0] =~ s/^--shebang-?wrap *//);
+	# remove --shebang if it is set
+	$opt::shebang = ($ARGV[0] =~ s/^--shebang *//);
+	# remove --hashbang if it is set
+	$opt::shebang .= ($ARGV[0] =~ s/^--hashbang *//);
+	if($opt::shebang) {
+	    my $argfile = Q(pop @ARGV);
+	    # exec myself to split $ARGV[0] into separate fields
+	    exec "$0 --skip-first-line -a $argfile @ARGV";
+	}
+	if($opt::shebang_wrap) {
+	    my @options;
+	    my @parser;
+	    if ($^O eq 'freebsd') {
+		# FreeBSD's #! puts different values in @ARGV than Linux' does
+		my @nooptions = @ARGV;
+		get_options_from_array(\@nooptions);
+		while($#ARGV > $#nooptions) {
+		    push @options, shift @ARGV;
+		}
+		while(@ARGV and $ARGV[0] ne ":::") {
+		    push @parser, shift @ARGV;
+		}
+		if(@ARGV and $ARGV[0] eq ":::") {
+		    shift @ARGV;
+		}
+	    } else {
+		@options = shift @ARGV;
+	    }
+	    my $script = Q(shift @ARGV);
+	    # exec myself to split $ARGV[0] into separate fields
+	    exec "$0 --_pipe-means-argfiles @options @parser $script ".
+		"::: @ARGV";
+	}
+    }
+    if($ARGV[0] =~ / --shebang(-?wrap)? /) {
+	::warning("--shebang and --shebang-wrap must be the first ".
+		  "argument.\n");
+    }
+
+    Getopt::Long::Configure("bundling","require_order");
+    my @ARGV_copy = @ARGV;
+    my @ARGV_orig = @ARGV;
+    # Check if there is a --profile to set @opt::profile
+    get_options_from_array(\@ARGV_copy,"profile|J=s","plain") || die_usage();
+    my @ARGV_profile = ();
+    my @ARGV_env = ();
+    if(not $opt::plain) {
+	# Add options from $PARALLEL_HOME/config and other profiles
+	my @config_profiles = (
+	    "/etc/parallel/config",
+	    (map { "$_/config" } @Global::config_dirs),
+	    $ENV{'HOME'}."/.parallelrc");
+	my @profiles = @config_profiles;
+	if(@opt::profile) {
+	    # --profile overrides default profiles
+	    @profiles = ();
+	    for my $profile (@opt::profile) {
+		if($profile =~ m:^\./|^/:) {
+		    # Look for ./profile in .
+		    # Look for /profile in /
+		    push @profiles, grep { -r $_ } $profile;
+		} else {
+		    # Look for the $profile in @Global::config_dirs
+		    push @profiles, grep { -r $_ }
+		    map { "$_/$profile" } @Global::config_dirs;
+		}
+	    }
+	}
+	for my $profile (@profiles) {
+	    if(-r $profile) {
+		::debug("init","Read $profile\n");
+		local $/ = "\n";
+		open (my $in_fh, "<", $profile) ||
+		    ::die_bug("read-profile: $profile");
+		while(<$in_fh>) {
+		    /^\s*\#/ and next;
+		    chomp;
+		    push @ARGV_profile, shell_words($_);
+		}
+		close $in_fh;
+	    } else {
+		if(grep /^\Q$profile\E$/, @config_profiles) {
+		    # config file is not required to exist
+		} else {
+		    ::error("$profile not readable.");
+		    wait_and_exit(255);
+		}
+	    }
+	}
+	# Add options from shell variable $PARALLEL
+	if($ENV{'PARALLEL'}) {
+	    push @ARGV_env, shell_words($ENV{'PARALLEL'});
+	}
+	# Add options from env_parallel.csh via $PARALLEL_CSH
+	if($ENV{'PARALLEL_CSH'}) {
+	    push @ARGV_env, shell_words($ENV{'PARALLEL_CSH'});
+	}
+    }
+    Getopt::Long::Configure("bundling","require_order");
+    get_options_from_array(\@ARGV_profile) || die_usage();
+    get_options_from_array(\@ARGV_env) || die_usage();
+    get_options_from_array(\@ARGV) || die_usage();
+    # What were the options given on the command line?
+    # Used to start --sqlworker
+    my $ai = arrayindex(\@ARGV_orig, \@ARGV);
+    @Global::options_in_argv = @ARGV_orig[0..$ai-1];
+    # Prepend non-options to @ARGV (such as commands like 'nice')
+    unshift @ARGV, @ARGV_profile, @ARGV_env;
+    return @ARGV;
+}
+
+sub arrayindex() {
+    # Similar to Perl's index function, but for arrays
+    # Input:
+    #	$arr_ref1 = ref to @array1 to search in
+    #	$arr_ref2 = ref to @array2 to search for
+    # Returns:
+    #	$pos = position of @array1 in @array2, -1 if not found
+    my ($arr_ref1,$arr_ref2) = @_;
+    my $array1_as_string = join "", map { "\0".$_ } @$arr_ref1;
+    my $array2_as_string = join "", map { "\0".$_ } @$arr_ref2;
+    my $i = index($array1_as_string,$array2_as_string,0);
+    if($i == -1) { return -1 }
+    my @before = split /\0/, substr($array1_as_string,0,$i);
+    return $#before;
+}
+
+sub read_args_from_command_line() {
+    # Arguments given on the command line after:
+    #	::: ($Global::arg_sep)
+    #	:::: ($Global::arg_file_sep)
+    #	:::+ ($Global::arg_sep with --link)
+    #	::::+ ($Global::arg_file_sep with --link)
+    # Removes the arguments from @ARGV and:
+    # - puts filenames into -a
+    # - puts arguments into files and add the files to -a
+    # - adds --linkinputsource with 0/1 for each -a depending on :::+/::::+
+    # Input:
+    #	@::ARGV = command option ::: arg arg arg :::: argfiles
+    # Uses:
+    #	$Global::arg_sep
+    #	$Global::arg_file_sep
+    #	$opt::_pipe_means_argfiles
+    #	$opt::pipe
+    #	@opt::a
+    # Returns:
+    #	@argv_no_argsep = @::ARGV without ::: and :::: and following args
+    my @new_argv = ();
+    for(my $arg = shift @ARGV; @ARGV; $arg = shift @ARGV) {
+	if($arg eq $Global::arg_sep
+	   or
+	   $arg eq $Global::arg_sep."+"
+	   or
+	   $arg eq $Global::arg_file_sep
+	   or
+	   $arg eq $Global::arg_file_sep."+") {
+	    my $group_sep = $arg; # This group of args is args or argfiles
+	    my @group;
+	    while(defined ($arg = shift @ARGV)) {
+		if($arg eq $Global::arg_sep
+		   or
+		   $arg eq $Global::arg_sep."+"
+		   or
+		   $arg eq $Global::arg_file_sep
+		   or
+		   $arg eq $Global::arg_file_sep."+") {
+		    # exit while loop if finding new separator
+		    last;
+		} else {
+		    # If not hitting ::: :::+ :::: or ::::+
+		    # Append it to the group
+		    push @group, $arg;
+		}
+	    }
+	    my $is_linked = ($group_sep =~ /\+$/) ? 1 : 0;
+	    my $is_file = ($group_sep eq $Global::arg_file_sep
+			   or
+			   $group_sep eq $Global::arg_file_sep."+");
+	    if($is_file) {
+		# :::: / ::::+
+		push @opt::linkinputsource, map { $is_linked } @group;
+	    } else {
+		# ::: / :::+
+		push @opt::linkinputsource, $is_linked;
+	    }
+	    if($is_file
+	       or ($opt::_pipe_means_argfiles and $opt::pipe)
+		) {
+		# Group of file names on the command line.
+		# Append args into -a
+		push @opt::a, @group;
+	    } else {
+		# Group of arguments on the command line.
+		# Put them into a file.
+		# Create argfile
+		my ($outfh,$name) = ::tmpfile(SUFFIX => ".arg");
+		unlink($name);
+		# Put args into argfile
+		print $outfh map { $_,$/ } @group;
+		seek $outfh, 0, 0;
+		exit_if_disk_full();
+		# Append filehandle to -a
+		push @opt::a, $outfh;
+	    }
+	    if(defined($arg)) {
+		# $arg is ::: :::+ :::: or ::::+
+		# so there is another group
+		redo;
+	    } else {
+		# $arg is undef -> @ARGV empty
+		last;
+	    }
+	}
+	push @new_argv, $arg;
+    }
+    # Output: @ARGV = command to run with options
+    return @new_argv;
+}
+
+sub cleanup() {
+    # Returns: N/A
+    unlink keys %Global::unlink;
+    map { rmdir $_ } keys %Global::unlink;
+    if(@opt::basefile and $opt::cleanup) { cleanup_basefile(); }
+    for(keys %Global::sshmaster) {
+	# If 'ssh -M's are running: kill them
+	kill "TERM", $_;
+    }
+}
+
+
+sub __QUOTING_ARGUMENTS_FOR_SHELL__() {}
+
+sub shell_quote(@) {
+    # Input:
+    #	@strings = strings to be quoted
+    # Returns:
+    #	@shell_quoted_strings = string quoted as needed by the shell
+    return wantarray ? (map { Q($_) } @_) : (join" ",map { Q($_) } @_);
+}
+
+sub shell_quote_scalar_rc($) {
+    # Quote for the rc-shell
+    my $a = $_[0];
+    if(defined $a) {
+	if(($a =~ s/'/''/g)
+	   +
+	   ($a =~ s/[\n\002-\011\013-\032\\\#\?\`\(\)\{\}\[\]\^\*\<\=\>\~\|\; \"\!\$\&\'\202-\377]+/'$&'/go)) {
+	    # A string was replaced
+	    # No need to test for "" or \0
+	} elsif($a eq "") {
+	    $a = "''";
+	} elsif($a eq "\0") {
+	    $a = "";
+	}
+    }
+    return $a;
+}
+
+sub shell_quote_scalar_csh($) {
+    # Quote for (t)csh
+    my $a = $_[0];
+    if(defined $a) {
+	# $a =~ s/([\002-\011\013-\032\\\#\?\`\(\)\{\}\[\]\^\*\>\<\~\|\; \"\!\$\&\'\202-\377])/\\$1/g;
+	# This is 1% faster than the above
+	if(($a =~ s/[\002-\011\013-\032\\\#\?\`\(\)\{\}\[\]\^\*\<\=\>\~\|\; \"\!\$\&\'\202-\377]/\\$&/go)
+	   +
+	   # quote newline in csh as \\\n
+	   ($a =~ s/[\n]/"\\\n"/go)) {
+	    # A string was replaced
+	    # No need to test for "" or \0
+	} elsif($a eq "") {
+	    $a = "''";
+	} elsif($a eq "\0") {
+	    $a = "";
+	}
+    }
+    return $a;
+}
+
+sub shell_quote_scalar_default($) {
+    # Quote for other shells (Bourne compatibles)
+    # Inputs:
+    #	$string = string to be quoted
+    # Returns:
+    #	$shell_quoted = string quoted as needed by the shell
+    local $_ = $_[0];
+    if(/[^-_.+a-z0-9\/]/i) {
+	s/'/'"'"'/g;	# "-quote '-quotes
+	$_ = "'$_'";	# '-quote entire string
+	s/^''//;	# Remove unneeded '' at ends
+	s/''$//;	# (faster than s/^''|''$//g)
+	return $_;
+    } elsif ($_ eq "") {
+	return "''";
+    } else {
+	# No quoting needed
+	return $_;
+    }
+}
+
+sub shell_quote_scalar($) {
+    # Quote the string so the shell will not expand any special chars
+    # Inputs:
+    #	$string = string to be quoted
+    # Returns:
+    #	$shell_quoted = string quoted as needed by the shell
+
+    # Speed optimization: Choose the correct shell_quote_scalar_*
+    # and call that directly from now on
+    no warnings 'redefine';
+    if($Global::cshell) {
+	# (t)csh
+	*shell_quote_scalar = \&shell_quote_scalar_csh;
+    } elsif($Global::shell =~ m:(^|/)rc$:) {
+	# rc-shell
+	*shell_quote_scalar = \&shell_quote_scalar_rc;
+    } else {
+	# other shells
+	*shell_quote_scalar = \&shell_quote_scalar_default;
+    }
+    # The sub is now redefined. Call it
+    return shell_quote_scalar($_[0]);
+}
+
+sub Q($) {
+    # Q alias for ::shell_quote_scalar
+    my $ret = shell_quote_scalar($_[0]);
+    no warnings 'redefine';
+    *Q = \&::shell_quote_scalar;
+    return $ret;
+}
+
+sub shell_quote_file($) {
+    # Quote the string so shell will not expand any special chars
+    # and prepend ./ if needed
+    # Input:
+    #	$filename = filename to be shell quoted
+    # Returns:
+    #	$quoted_filename = filename quoted with \ and ./ if needed
+    my $a = shift;
+    if(defined $a) {
+	if($a =~ m:^/: or $a =~ m:^\./:) {
+	    # /abs/path or ./rel/path => skip
+	} else {
+	    # rel/path => ./rel/path
+	    $a = "./".$a;
+	}
+    }
+    return Q($a);
+}
+
+sub shell_words(@) {
+    # Input:
+    #	$string = shell line
+    # Returns:
+    #	@shell_words = $string split into words as shell would do
+    $Global::use{"Text::ParseWords"} ||= eval "use Text::ParseWords; 1;";
+    return Text::ParseWords::shellwords(@_);
+}
+
+sub perl_quote_scalar($) {
+    # Quote the string so perl's eval will not expand any special chars
+    # Inputs:
+    #	$string = string to be quoted
+    # Returns:
+    #	$perl_quoted = string quoted with \ as needed by perl's eval
+    my $a = $_[0];
+    if(defined $a) {
+	$a =~ s/[\\\"\$\@]/\\$&/go;
+    }
+    return $a;
+}
+
+# -w complains about prototype
+sub pQ($) {
+    # pQ alias for ::perl_quote_scalar
+    my $ret = perl_quote_scalar($_[0]);
+    *pQ = \&::perl_quote_scalar;
+    return $ret;
+}
+
+sub unquote_printf() {
+    # Convert \t \n \r \000 \0
+    # Inputs:
+    #	$string = string with \t \n \r \num \0
+    # Returns:
+    #	$replaced = string with TAB NEWLINE CR <ascii-num> NUL
+    $_ = shift;
+    s/\\t/\t/g;
+    s/\\n/\n/g;
+    s/\\r/\r/g;
+    s/\\(\d\d\d)/eval 'sprintf "\\'.$1.'"'/ge;
+    s/\\(\d)/eval 'sprintf "\\'.$1.'"'/ge;
+    return $_;
+}
+
+
+sub __FILEHANDLES__() {}
+
+
+sub save_stdin_stdout_stderr() {
+    # Remember the original STDIN, STDOUT and STDERR
+    # and file descriptors opened by the shell (e.g. 3>/tmp/foo)
+    # Uses:
+    #	%Global::fh
+    #	$Global::original_stderr
+    #	$Global::original_stdin
+    # Returns: N/A
+
+    # TODO Disabled until we have an open3 that will take n filehandles
+    # for my $fdno (1..61) {
+    # # /dev/fd/62 and above are used by bash for <(cmd)
+    # # Find file descriptors that are already opened (by the shell)
+    # Only focus on stdout+stderr for now
+    for my $fdno (1..2) {
+	my $fh;
+	# 2-argument-open is used to be compatible with old perl 5.8.0
+	# bug #43570: Perl 5.8.0 creates 61 files
+	if(open($fh,">&=$fdno")) {
+	    $Global::fh{$fdno}=$fh;
+	}
+    }
+    open $Global::original_stderr, ">&", "STDERR" or
+	::die_bug("Can't dup STDERR: $!");
+    open $Global::status_fd, ">&", "STDERR" or
+	::die_bug("Can't dup STDERR: $!");
+    open $Global::original_stdin, "<&", "STDIN" or
+	::die_bug("Can't dup STDIN: $!");
+}
+
+sub enough_file_handles() {
+    # Check that we have enough filehandles available for starting
+    # another job
+    # Uses:
+    #	$opt::ungroup
+    #	%Global::fh
+    # Returns:
+    #	1 if ungrouped (thus not needing extra filehandles)
+    #	0 if too few filehandles
+    #	1 if enough filehandles
+    if(not $opt::ungroup) {
+	my %fh;
+	my $enough_filehandles = 1;
+	# perl uses 7 filehandles for something?
+	# open3 uses 2 extra filehandles temporarily
+	# We need a filehandle for each redirected file descriptor
+	# (normally just STDOUT and STDERR)
+	for my $i (1..(7+2+keys %Global::fh)) {
+	    $enough_filehandles &&= open($fh{$i}, "<", "/dev/null");
+	}
+	for (values %fh) { close $_; }
+	return $enough_filehandles;
+    } else {
+	# Ungrouped does not need extra file handles
+	return 1;
+    }
+}
+
+sub open_or_exit($) {
+    # Open a file name or exit if the file cannot be opened
+    # Inputs:
+    #	$file = filehandle or filename to open
+    # Uses:
+    #	$Global::original_stdin
+    # Returns:
+    #	$fh = file handle to read-opened file
+    my $file = shift;
+    if($file eq "-") {
+	return ($Global::original_stdin || *STDIN);
+    }
+    if(ref $file eq "GLOB") {
+	# This is an open filehandle
+	return $file;
+    }
+    my $fh = gensym;
+    if(not open($fh, "<", $file)) {
+	::error("Cannot open input file `$file': No such file or directory.");
+	wait_and_exit(255);
+    }
+    return $fh;
+}
+
+sub set_fh_blocking($) {
+    # Set filehandle as blocking
+    # Inputs:
+    #	$fh = filehandle to be blocking
+    # Returns:
+    #	N/A
+    my $fh = shift;
+    $Global::use{"Fcntl"} ||= eval "use Fcntl qw(:DEFAULT :flock); 1;";
+    my $flags;
+    # Get the current flags on the filehandle
+    fcntl($fh, &F_GETFL, $flags) || die $!;
+    # Remove non-blocking from the flags
+    $flags &= ~&O_NONBLOCK;
+    # Set the flags on the filehandle
+    fcntl($fh, &F_SETFL, $flags) || die $!;
+}
+
+sub set_fh_non_blocking($) {
+    # Set filehandle as non-blocking
+    # Inputs:
+    #	$fh = filehandle to be blocking
+    # Returns:
+    #	N/A
+    my $fh = shift;
+    $Global::use{"Fcntl"} ||= eval "use Fcntl qw(:DEFAULT :flock); 1;";
+    my $flags;
+    # Get the current flags on the filehandle
+    fcntl($fh, &F_GETFL, $flags) || die $!;
+    # Add non-blocking to the flags
+    $flags |= &O_NONBLOCK;
+    # Set the flags on the filehandle
+    fcntl($fh, &F_SETFL, $flags) || die $!;
+}
+
+
+sub __RUNNING_THE_JOBS_AND_PRINTING_PROGRESS__() {}
+
+
+# Variable structure:
+#
+#    $Global::running{$pid} = Pointer to Job-object
+#    @Global::virgin_jobs = Pointer to Job-object that have received no input
+#    $Global::host{$sshlogin} = Pointer to SSHLogin-object
+#    $Global::total_running = total number of running jobs
+#    $Global::total_started = total jobs started
+#    $Global::max_procs_file = filename if --jobs is given a filename
+#    $Global::JobQueue = JobQueue object for the queue of jobs
+#    $Global::timeoutq = queue of times where jobs timeout
+#    $Global::newest_job = Job object of the most recent job started
+#    $Global::newest_starttime = timestamp of $Global::newest_job
+#    @Global::sshlogin
+#    $Global::minimal_command_line_length = min len supported by all sshlogins
+#    $Global::start_no_new_jobs = should more jobs be started?
+#    $Global::original_stderr = file handle for STDERR when the program started
+#    $Global::total_started = total number of jobs started
+#    $Global::joblog = filehandle of joblog
+#    $Global::debug = Is debugging on?
+#    $Global::exitstatus = status code of GNU Parallel
+#    $Global::quoting = quote the command to run
+
+sub init_run_jobs() {
+    # Set Global variables and progress signal handlers
+    # Do the copying of basefiles
+    # Returns: N/A
+    $Global::total_running = 0;
+    $Global::total_started = 0;
+    $SIG{USR1} = \&list_running_jobs;
+    $SIG{USR2} = \&toggle_progress;
+    if(@opt::basefile) { setup_basefile(); }
+}
+
+{
+    my $last_time;
+    my %last_mtime;
+    my $max_procs_file_last_mod;
+
+    sub changed_procs_file {
+	# If --jobs is a file and it is modfied:
+	# Force recomputing of max_jobs_running for each $sshlogin
+	# Uses:
+	#   $Global::max_procs_file
+	#   %Global::host
+	# Returns: N/A
+	if($Global::max_procs_file) {
+	    # --jobs filename
+	    my $mtime = (stat($Global::max_procs_file))[9];
+	    $max_procs_file_last_mod ||= 0;
+	    if($mtime > $max_procs_file_last_mod) {
+		# file changed: Force re-computing max_jobs_running
+		$max_procs_file_last_mod = $mtime;
+		for my $sshlogin (values %Global::host) {
+		    $sshlogin->set_max_jobs_running(undef);
+		}
+	    }
+	}
+    }
+
+    sub changed_sshloginfile {
+	# If --slf is changed:
+	#   reload --slf
+	#   filter_hosts
+	#   setup_basefile
+	# Uses:
+	#   @opt::sshloginfile
+	#   @Global::sshlogin
+	#   %Global::host
+	#   $opt::filter_hosts
+	# Returns: N/A
+	if(@opt::sshloginfile) {
+	    # Is --sshloginfile changed?
+	    for my $slf (@opt::sshloginfile) {
+		my $actual_file = expand_slf_shorthand($slf);
+		my $mtime = (stat($actual_file))[9];
+		$last_mtime{$actual_file} ||= $mtime;
+		if($mtime - $last_mtime{$actual_file} > 1) {
+		    ::debug("run",
+			    "--sshloginfile $actual_file changed. reload\n");
+		    $last_mtime{$actual_file} = $mtime;
+		    # Reload $slf
+		    # Empty sshlogins
+		    @Global::sshlogin = ();
+		    for (values %Global::host) {
+			# Don't start new jobs on any host
+			# except the ones added back later
+			$_->set_max_jobs_running(0);
+		    }
+		    # This will set max_jobs_running on the SSHlogins
+		    read_sshloginfile($actual_file);
+		    parse_sshlogin();
+		    $opt::filter_hosts and filter_hosts();
+		    setup_basefile();
+		}
+	    }
+	}
+    }
+
+    sub start_more_jobs {
+	# Run start_another_job() but only if:
+	#   * not $Global::start_no_new_jobs set
+	#   * not JobQueue is empty
+	#   * not load on server is too high
+	#   * not server swapping
+	#   * not too short time since last remote login
+	# Uses:
+	#   %Global::host
+	#   $Global::start_no_new_jobs
+	#   $Global::JobQueue
+	#   $opt::pipe
+	#   $opt::load
+	#   $opt::noswap
+	#   $opt::delay
+	#   $Global::newest_starttime
+	# Returns:
+	#   $jobs_started = number of jobs started
+	my $jobs_started = 0;
+	if($Global::start_no_new_jobs) {
+	    return $jobs_started;
+	}
+	if(time - ($last_time||0) > 1) {
+	    # At most do this every second
+	    $last_time = time;
+	    changed_procs_file();
+	    changed_sshloginfile();
+	}
+	# This will start 1 job on each --sshlogin (if possible)
+	# thus distribute the jobs on the --sshlogins round robin
+	for my $sshlogin (values %Global::host) {
+	    if($Global::JobQueue->empty() and not $opt::pipe) {
+		# No more jobs in the queue
+		last;
+	    }
+	    debug("run", "Running jobs before on ", $sshlogin->string(), ": ",
+		  $sshlogin->jobs_running(), "\n");
+	    if ($sshlogin->jobs_running() < $sshlogin->max_jobs_running()) {
+		if($opt::delay
+		   and
+		   $opt::delay-0.008 > ::now()-$Global::newest_starttime) {
+		    # It has been too short since last start
+		    next;
+		}
+		if($opt::load and $sshlogin->loadavg_too_high()) {
+		    # The load is too high or unknown
+		    next;
+		}
+		if($opt::noswap and $sshlogin->swapping()) {
+		    # The server is swapping
+		    next;
+		}
+		if($opt::limit and $sshlogin->limit()) {
+		    # Over limit
+		    next;
+		}
+		if(($opt::memfree or $opt::memsuspend)
+		   and
+		   $sshlogin->memfree() < $Global::memlimit) {
+		    # The server has not enough mem free
+		    ::debug("mem", "Not starting job: not enough mem\n");
+		    next;
+		}
+		if($sshlogin->too_fast_remote_login()) {
+		    # It has been too short since last login
+		    next;
+		}
+		debug("run", $sshlogin->string(),
+		      " has ", $sshlogin->jobs_running(),
+		      " out of ", $sshlogin->max_jobs_running(),
+		      " jobs running. Start another.\n");
+		if(start_another_job($sshlogin) == 0) {
+		    # No more jobs to start on this $sshlogin
+		    debug("run","No jobs started on ",
+			  $sshlogin->string(), "\n");
+		    next;
+		}
+		$sshlogin->inc_jobs_running();
+		$sshlogin->set_last_login_at(::now());
+		$jobs_started++;
+	    }
+	    debug("run","Running jobs after on ", $sshlogin->string(), ": ",
+		  $sshlogin->jobs_running(), " of ",
+		  $sshlogin->max_jobs_running(), "\n");
+	}
+
+	return $jobs_started;
+    }
+}
+
+{
+    my $no_more_file_handles_warned;
+
+    sub start_another_job() {
+	# If there are enough filehandles
+	#   and JobQueue not empty
+	#   and not $job is in joblog
+	# Then grab a job from Global::JobQueue,
+	#   start it at sshlogin
+	#   mark it as virgin_job
+	# Inputs:
+	#   $sshlogin = the SSHLogin to start the job on
+	# Uses:
+	#   $Global::JobQueue
+	#   $opt::pipe
+	#   $opt::results
+	#   $opt::resume
+	#   @Global::virgin_jobs
+	# Returns:
+	#   1 if another jobs was started
+	#   0 otherwise
+	my $sshlogin = shift;
+	# Do we have enough file handles to start another job?
+	if(enough_file_handles()) {
+	    if($Global::JobQueue->empty() and not $opt::pipe) {
+		# No more commands to run
+		debug("start", "Not starting: JobQueue empty\n");
+		return 0;
+	    } else {
+		my $job;
+		# Skip jobs already in job log
+		# Skip jobs already in results
+		do {
+		    $job = get_job_with_sshlogin($sshlogin);
+		    if(not defined $job) {
+			# No command available for that sshlogin
+			debug("start", "Not starting: no jobs available for ",
+			      $sshlogin->string(), "\n");
+			return 0;
+		    }
+		    if($job->is_already_in_joblog()) {
+			$job->free_slot();
+		    }
+		} while ($job->is_already_in_joblog()
+			 or
+			 ($opt::results and $opt::resume
+			  and $job->is_already_in_results()));
+		debug("start", "Command to run on '",
+		      $job->sshlogin()->string(), "': '",
+		      $job->replaced(),"'\n");
+		if($job->start()) {
+		    if($opt::pipe) {
+			if($job->virgin()) {
+			    push(@Global::virgin_jobs,$job);
+			} else {
+			    # Block already set: This is a retry
+			    $job->write_block();
+			}
+		    }
+		    debug("start", "Started as seq ", $job->seq(),
+			  " pid:", $job->pid(), "\n");
+		    return 1;
+		} else {
+		    # Not enough processes to run the job.
+		    # Put it back on the queue.
+		    $Global::JobQueue->unget($job);
+		    # Count down the number of jobs to run for this SSHLogin.
+		    my $max = $sshlogin->max_jobs_running();
+		    if($max > 1) { $max--; } else {
+			my @arg;
+			for my $record (@{$job->{'commandline'}{'arg_list'}}) {
+			    push @arg, map { $_->orig() } @$record;
+			}
+			::error("No more processes: cannot run a single job. ".
+				"Something is wrong at @arg.");
+			::wait_and_exit(255);
+		    }
+		    $sshlogin->set_max_jobs_running($max);
+		    # Sleep up to 300 ms to give other processes time to die
+		    ::usleep(rand()*300);
+		    ::warning("No more processes: ".
+			      "Decreasing number of running jobs to $max.",
+			      "Try increasing 'ulimit -u' (try: ulimit -u `ulimit -Hu`)",
+			      "or increasing 'nproc' in /etc/security/limits.conf",
+			      "or increasing /proc/sys/kernel/pid_max");
+		    return 0;
+		}
+	    }
+	} else {
+	    # No more file handles
+	    $no_more_file_handles_warned++ or
+		::warning("No more file handles. ",
+			  "Try running 'parallel -j0 -N 100 --pipe parallel -j0'",
+			  "or increasing 'ulimit -n' (try: ulimit -n `ulimit -Hn`)",
+			  "or increasing 'nofile' in /etc/security/limits.conf",
+			  "or increasing /proc/sys/fs/file-max");
+	    debug("start", "No more file handles. ");
+	    return 0;
+	}
+    }
+}
+
+sub init_progress() {
+    # Uses:
+    #	$opt::bar
+    # Returns:
+    #	list of computers for progress output
+    $|=1;
+    if($opt::bar) {
+	return("","");
+    }
+    my %progress = progress();
+    return ("\nComputers / CPU cores / Max jobs to run\n",
+	    $progress{'workerlist'});
+}
+
+sub drain_job_queue(@) {
+    # Uses:
+    #	$opt::progress
+    #	$Global::total_running
+    #	$Global::max_jobs_running
+    #	%Global::running
+    #	$Global::JobQueue
+    #	%Global::host
+    #	$Global::start_no_new_jobs
+    # Returns: N/A
+    my @command = @_;
+    if($opt::progress) {
+	::status_no_nl(init_progress());
+    }
+    my $last_header = "";
+    my $sleep = 0.2;
+    my $sleepsum = 0;
+    do {
+	while($Global::total_running > 0) {
+	    debug("init",$Global::total_running, "==", scalar
+		  keys %Global::running," slots: ", $Global::max_jobs_running);
+	    if($opt::pipe) {
+		# When using --pipe sometimes file handles are not
+		# closed properly
+		for my $job (values %Global::running) {
+		    close $job->fh(0,"w");
+		}
+	    }
+	    if($opt::progress) {
+		my %progress = progress();
+		if($last_header ne $progress{'header'}) {
+		    ::status("", $progress{'header'});
+		    $last_header = $progress{'header'};
+		}
+		::status_no_nl("\r",$progress{'status'});
+	    }
+	    if($Global::total_running < $Global::max_jobs_running
+	       and not $Global::JobQueue->empty()) {
+		# These jobs may not be started because of loadavg
+		# or too little time between each ssh login.
+		if(start_more_jobs() > 0) {
+		    # Exponential back-on if jobs were started
+		    $sleep = $sleep/2+0.001;
+		}
+	    }
+	    # Exponential back-off sleeping
+	    $sleep = ::reap_usleep($sleep);
+	    $sleepsum += $sleep;
+	    if($sleepsum >= 1000) {
+		# At most do this every second
+		$sleepsum = 0;
+		changed_procs_file();
+		changed_sshloginfile();
+		start_more_jobs();
+	    }
+	}
+	if(not $Global::JobQueue->empty()) {
+	    # These jobs may not be started:
+	    # * because there the --filter-hosts has removed all
+	    if(not %Global::host) {
+		::error("There are no hosts left to run on.");
+		::wait_and_exit(255);
+	    }
+	    # * because of loadavg
+	    # * because of too little time between each ssh login.
+	    $sleep = ::reap_usleep($sleep);
+	    start_more_jobs();
+	    if($Global::max_jobs_running == 0) {
+		::warning("There are no job slots available. Increase --jobs.");
+	    }
+	}
+	while($opt::sqlmaster and not $Global::sql->finished()) {
+	    # SQL master
+	    $sleep = ::reap_usleep($sleep);
+	    start_more_jobs();
+	    if($Global::start_sqlworker) {
+		# Start an SQL worker as we are now sure there is work to do
+		$Global::start_sqlworker = 0;
+		if(my $pid = fork()) {
+		    $Global::unkilled_sqlworker = $pid;
+		} else {
+		    # Replace --sql/--sqlandworker with --sqlworker
+		    my @ARGV = (map { s/^--sql(andworker)?$/--sqlworker/; $_ }
+				@Global::options_in_argv);
+		    # exec the --sqlworker
+		    exec($0,@ARGV,@command);
+		}
+	    }
+	}
+    } while ($Global::total_running > 0
+	     or
+	     not $Global::start_no_new_jobs and not $Global::JobQueue->empty()
+	     or
+	     $opt::sqlmaster and not $Global::sql->finished());
+    if($opt::progress) {
+	my %progress = progress();
+	::status("\r".$progress{'status'});
+    }
+}
+
+sub toggle_progress() {
+    # Turn on/off progress view
+    # Uses:
+    #	$opt::progress
+    # Returns: N/A
+    $opt::progress = not $opt::progress;
+    if($opt::progress) {
+	::status_no_nl(init_progress());
+    }
+}
+
+sub progress() {
+    # Uses:
+    #	$opt::bar
+    #	$opt::eta
+    #	%Global::host
+    #	$Global::total_started
+    # Returns:
+    #	$workerlist = list of workers
+    #	$header = that will fit on the screen
+    #	$status = message that will fit on the screen
+    if($opt::bar) {
+	return ("workerlist" => "", "header" => "", "status" => bar());
+    }
+    my $eta = "";
+    my ($status,$header)=("","");
+    if($opt::eta) {
+	my($total, $completed, $left, $pctcomplete, $avgtime, $this_eta) =
+	    compute_eta();
+	$eta = sprintf("ETA: %ds Left: %d AVG: %.2fs  ",
+		       $this_eta, $left, $avgtime);
+    }
+    my $termcols = terminal_columns();
+    my @workers = sort keys %Global::host;
+    my %sshlogin = map { $_ eq ":" ? ($_ => "local") : ($_ => $_) } @workers;
+    my $workerno = 1;
+    my %workerno = map { ($_=>$workerno++) } @workers;
+    my $workerlist = "";
+    for my $w (@workers) {
+	$workerlist .=
+	$workerno{$w}.":".$sshlogin{$w} ." / ".
+	    ($Global::host{$w}->ncpus() || "-")." / ".
+	    $Global::host{$w}->max_jobs_running()."\n";
+    }
+    $status = "c"x($termcols+1);
+    # Select an output format that will fit on a single line
+    if(length $status > $termcols) {
+	# sshlogin1:XX/XX/XX%/XX.Xs s2:XX/XX/XX%/XX.Xs s3:XX/XX/XX%/XX.Xs
+	$header = "Computer:jobs running/jobs completed/".
+	    "%of started jobs/Average seconds to complete";
+	$status = $eta .
+	    join(" ",map
+		 {
+		     if($Global::total_started) {
+			 my $completed =
+			     ($Global::host{$_}->jobs_completed()||0);
+			 my $running = $Global::host{$_}->jobs_running();
+			 my $time = $completed ? (time-$^T)/($completed) : "0";
+			 sprintf("%s:%d/%d/%d%%/%.1fs ",
+				 $sshlogin{$_}, $running, $completed,
+				 ($running+$completed)*100
+				 / $Global::total_started, $time);
+		     }
+		 } @workers);
+    }
+    if(length $status > $termcols) {
+	# 1:XX/XX/XX%/X.Xs 2:XX/XX/XX%/X.Xs 3:XX/XX/XX%/X.Xs 4:XX/XX/XX%/X.Xs
+	$header = "Computer:jobs running/jobs completed/%of started jobs";
+	$status = $eta .
+	    join(" ",map
+		 {
+		     if($Global::total_started) {
+			 my $completed =
+			     ($Global::host{$_}->jobs_completed()||0);
+			 my $running = $Global::host{$_}->jobs_running();
+			 my $time = $completed ? (time-$^T)/($completed) : "0";
+			 sprintf("%s:%d/%d/%d%%/%.1fs ",
+				 $workerno{$_}, $running, $completed,
+				 ($running+$completed)*100
+				 / $Global::total_started, $time);
+		     }
+		 } @workers);
+    }
+    if(length $status > $termcols) {
+	# sshlogin1:XX/XX/XX% sshlogin2:XX/XX/XX% sshlogin3:XX/XX/XX%
+	$header = "Computer:jobs running/jobs completed/%of started jobs";
+	$status = $eta .
+	    join(" ",map
+		 {
+		     if($Global::total_started) {
+			 sprintf("%s:%d/%d/%d%%",
+				 $sshlogin{$_},
+				 $Global::host{$_}->jobs_running(),
+				 ($Global::host{$_}->jobs_completed()||0),
+				 ($Global::host{$_}->jobs_running()+
+				  ($Global::host{$_}->jobs_completed()||0))*100
+				 / $Global::total_started)
+		     }
+		 }
+		 @workers);
+    }
+    if(length $status > $termcols) {
+	# 1:XX/XX/XX% 2:XX/XX/XX% 3:XX/XX/XX% 4:XX/XX/XX% 5:XX/XX/XX%
+	$header = "Computer:jobs running/jobs completed/%of started jobs";
+	$status = $eta .
+	    join(" ",map
+		 {
+		     if($Global::total_started) {
+			 sprintf("%s:%d/%d/%d%%",
+				 $workerno{$_},
+				 $Global::host{$_}->jobs_running(),
+				 ($Global::host{$_}->jobs_completed()||0),
+				 ($Global::host{$_}->jobs_running()+
+				  ($Global::host{$_}->jobs_completed()||0))*100
+				 / $Global::total_started)
+		     }
+		 }
+		 @workers);
+    }
+    if(length $status > $termcols) {
+	# sshlogin1:XX/XX/XX% sshlogin2:XX/XX/XX% sshlogin3:XX/XX
+	$header = "Computer:jobs running/jobs completed";
+	$status = $eta .
+	    join(" ",
+		 map { sprintf("%s:%d/%d",
+			       $sshlogin{$_}, $Global::host{$_}->jobs_running(),
+			       ($Global::host{$_}->jobs_completed()||0)) }
+		 @workers);
+    }
+    if(length $status > $termcols) {
+	# sshlogin1:XX/XX sshlogin2:XX/XX sshlogin3:XX/XX sshlogin4:XX/XX
+	$header = "Computer:jobs running/jobs completed";
+	$status = $eta .
+	    join(" ",
+		 map { sprintf("%s:%d/%d",
+			       $sshlogin{$_}, $Global::host{$_}->jobs_running(),
+			       ($Global::host{$_}->jobs_completed()||0)) }
+		 @workers);
+    }
+    if(length $status > $termcols) {
+	# 1:XX/XX 2:XX/XX 3:XX/XX 4:XX/XX 5:XX/XX 6:XX/XX
+	$header = "Computer:jobs running/jobs completed";
+	$status = $eta .
+	    join(" ",
+		 map { sprintf("%s:%d/%d", $workerno{$_},
+			       $Global::host{$_}->jobs_running(),
+			       ($Global::host{$_}->jobs_completed()||0)) }
+		 @workers);
+    }
+    if(length $status > $termcols) {
+	# sshlogin1:XX sshlogin2:XX sshlogin3:XX sshlogin4:XX sshlogin5:XX
+	$header = "Computer:jobs completed";
+	$status = $eta .
+	    join(" ",
+		 map { sprintf("%s:%d", $sshlogin{$_},
+			       ($Global::host{$_}->jobs_completed()||0)) }
+		 @workers);
+    }
+    if(length $status > $termcols) {
+	# 1:XX 2:XX 3:XX 4:XX 5:XX 6:XX
+	$header = "Computer:jobs completed";
+	$status = $eta .
+	    join(" ",
+		 map { sprintf("%s:%d",
+			       $workerno{$_},
+			       ($Global::host{$_}->jobs_completed()||0)) }
+		 @workers);
+    }
+    return ("workerlist" => $workerlist, "header" => $header,
+	    "status" => $status);
+}
+
+{
+
+    my ($first_completed, $smoothed_avg_time, $last_eta);
+
+    sub compute_eta {
+	# Calculate important numbers for ETA
+	# Returns:
+	#   $total = number of jobs in total
+	#   $completed = number of jobs completed
+	#   $left = number of jobs left
+	#   $pctcomplete = percent of jobs completed
+	#   $avgtime = averaged time
+	#   $eta = smoothed eta
+	my $completed = $Global::total_completed;
+	# In rare cases with -X will $completed > total_jobs()
+	my $total = ::max($Global::JobQueue->total_jobs(),$completed);
+	my $left = $total - $completed;
+	if(not $completed) {
+	    return($total, $completed, $left, 0, 0, 0);
+	}
+	my $pctcomplete = ::min($completed / $total,100);
+	$first_completed ||= time;
+	my $timepassed = (time - $first_completed);
+	my $avgtime = $timepassed / $completed;
+	$smoothed_avg_time ||= $avgtime;
+	# Smooth the eta so it does not jump wildly
+	$smoothed_avg_time = (1 - $pctcomplete) * $smoothed_avg_time +
+	    $pctcomplete * $avgtime;
+	my $eta = int($left * $smoothed_avg_time);
+	if($eta*0.90 < $last_eta and $last_eta < $eta) {
+	    # Eta jumped less that 10% up: Keep the last eta instead
+	    $eta = $last_eta;
+	} else {
+	    $last_eta = $eta;
+	}
+	return($total, $completed, $left, $pctcomplete, $avgtime, $eta);
+    }
+}
+
+{
+    my ($rev,$reset);
+
+    sub bar() {
+	# Return:
+	#   $status = bar with eta, completed jobs, arg and pct
+	$rev ||= "\033[7m";
+	$reset ||= "\033[0m";
+	my($total, $completed, $left, $pctcomplete, $avgtime, $eta) =
+	    compute_eta();
+	my $arg = $Global::newest_job ?
+	    $Global::newest_job->{'commandline'}->
+	    replace_placeholders(["\257<\257>"],0,0) : "";
+	$arg = decode_utf8($arg);
+	my $eta_dhms = ::seconds_to_time_units($eta);
+	my $bar_text =
+	    sprintf("%d%% %d:%d=%s %s",
+		    $pctcomplete*100, $completed, $left, $eta_dhms, $arg);
+	my $terminal_width = terminal_columns();
+	my $s = sprintf("%-${terminal_width}s",
+			substr($bar_text." "x$terminal_width,
+			       0,$terminal_width));
+	my $width = int($terminal_width * $pctcomplete);
+	substr($s,$width,0) = $reset;
+	my $zenity = sprintf("%-${terminal_width}s",
+			     substr("#   $eta sec $arg",
+				    0,$terminal_width));
+	# Prefix with zenity header
+	$s = "\r" . $zenity . "\r" . $pctcomplete*100 .
+	    "\r" . $rev . $s . $reset;
+	return $s;
+    }
+}
+
+{
+    my ($rows,$columns,$last_update_time);
+
+    sub compute_terminal_size() {
+	# && true is to force spawning a shell and not just exec'ing
+	my @tput = qx{ tput lines cols </dev/tty 2>/dev/null && true };
+	$rows = 0 + $tput[0];
+	$columns = 0 + $tput[1];
+	if(not ($rows && $columns)) {
+	    # && true is to force spawning a shell and not just exec'ing
+	    my $stty = qx{ stty -a </dev/tty 2>/dev/null && true };
+	    # FreeBSD/OpenBSD/NetBSD/Dragonfly/MirOS
+	    # MacOSX/IRIX/AIX/Tru64
+	    $stty =~ /(\d+) columns/ and do { $columns = $1; };
+	    $stty =~ /(\d+) rows/ and do { $rows = $1; };
+	    # GNU/Linux/Solaris
+	    $stty =~ /columns (\d+)/ and do { $columns = $1; };
+	    $stty =~ /rows (\d+)/ and do { $rows = $1; };
+	    # Solaris-x86/HPUX/SCOsysV/UnixWare/OpenIndiana
+	    $stty =~ /columns = (\d+)/ and do { $columns = $1; };
+	    $stty =~ /rows = (\d+)/ and do { $rows = $1; };
+	    # QNX
+	    $stty =~ /rows=(\d+),(\d+)/ and do { ($rows,$columns) = ($1,$2); };
+	}
+	if(not ($rows && $columns)) {
+	    # && true is to force spawning a shell and not just exec'ing
+	    my $resize = qx{ resize 2>/dev/null && true };
+	    $resize =~ /COLUMNS=(\d+);/ and do { $columns ||= $1; };
+	    $resize =~ /LINES=(\d+);/ and do { $rows ||= $1; };
+	}
+	$rows ||= 24;
+	$columns ||= 80;
+    }
+
+    sub update_terminal_size() {
+	# Only update once per second.
+	if($last_update_time < time) {
+	    $last_update_time = time;
+	    compute_terminal_size();
+	    # Set signal WINdow CHange to force recompute
+	    $SIG{WINCH} = \&compute_terminal_size;
+	}
+    }
+
+    sub terminal_rows() {
+	# Get the number of rows of the terminal.
+	# Returns:
+	#   number of rows of the screen
+	update_terminal_size();
+	return $rows;
+    }
+
+    sub terminal_columns() {
+	# Get the number of columns of the terminal.
+	# Returns:
+	#   number of columns of the screen
+	update_terminal_size();
+	return $columns;
+    }
+}
+
+# Prototype forwarding
+sub get_job_with_sshlogin($);
+sub get_job_with_sshlogin($) {
+    # Input:
+    #	$sshlogin = which host should the job be run on?
+    # Uses:
+    #	$opt::hostgroups
+    #	$Global::JobQueue
+    # Returns:
+    #	$job = next job object for $sshlogin if any available
+    my $sshlogin = shift;
+    my $job;
+
+    if ($opt::hostgroups) {
+	my @other_hostgroup_jobs = ();
+
+	while($job = $Global::JobQueue->get()) {
+	    if($sshlogin->in_hostgroups($job->hostgroups())) {
+		# Found a job to be run on a hostgroup of this
+		# $sshlogin
+		last;
+	    } else {
+		# This job was not in the hostgroups of $sshlogin
+		push @other_hostgroup_jobs, $job;
+	    }
+	}
+	$Global::JobQueue->unget(@other_hostgroup_jobs);
+	if(not defined $job) {
+	    # No more jobs
+	    return undef;
+	}
+    } else {
+	$job = $Global::JobQueue->get();
+	if(not defined $job) {
+	    # No more jobs
+	    ::debug("start", "No more jobs: JobQueue empty\n");
+	    return undef;
+	}
+    }
+    if(not $job->suspended()) {
+	$job->set_sshlogin($sshlogin);
+    }
+    if(defined $opt::retries and $job->failed_here()) {
+	# This command with these args failed for this sshlogin
+	my ($no_of_failed_sshlogins,$min_failures) = $job->min_failed();
+	# Only look at the Global::host that have > 0 jobslots
+	if($no_of_failed_sshlogins ==
+	   grep { $_->max_jobs_running() > 0 } values %Global::host
+	   and $job->failed_here() == $min_failures) {
+	    # It failed the same or more times on another host:
+	    # run it on this host
+	} else {
+	    # If it failed fewer times on another host:
+	    # Find another job to run
+	    my $nextjob;
+	    if(not $Global::JobQueue->empty()) {
+		# This can potentially recurse for all args
+		no warnings 'recursion';
+		$nextjob = get_job_with_sshlogin($sshlogin);
+	    }
+	    # Push the command back on the queue
+	    $Global::JobQueue->unget($job);
+	    return $nextjob;
+	}
+    }
+    return $job;
+}
+
+
+sub __REMOTE_SSH__() {}
+
+
+sub read_sshloginfiles(@) {
+    # Read a list of --slf's
+    # Input:
+    #	@files = files or symbolic file names to read
+    # Returns: N/A
+    for my $s (@_) {
+	read_sshloginfile(expand_slf_shorthand($s));
+    }
+}
+
+sub expand_slf_shorthand($) {
+    # Expand --slf shorthand into a read file name
+    # Input:
+    #	$file = file or symbolic file name to read
+    # Returns:
+    #	$file = actual file name to read
+    my $file = shift;
+    if($file eq "-") {
+	# skip: It is stdin
+    } elsif($file eq "..") {
+	$file = $Global::config_dir."/sshloginfile";
+    } elsif($file eq ".") {
+	$file = "/etc/parallel/sshloginfile";
+    } elsif(not -r $file) {
+	for(@Global::config_dirs) {
+	    if(not -r $_."/".$file) {
+		# Try prepending $PARALLEL_HOME
+		::error("Cannot open $file.");
+		::wait_and_exit(255);
+	    } else {
+		$file = $_."/".$file;
+		last;
+	    }
+	}
+    }
+    return $file;
+}
+
+sub read_sshloginfile($) {
+    # Read sshloginfile into @Global::sshlogin
+    # Input:
+    #	$file = file to read
+    # Uses:
+    #	@Global::sshlogin
+    # Returns: N/A
+    local $/ = "\n";
+    my $file = shift;
+    my $close = 1;
+    my $in_fh;
+    ::debug("init","--slf ",$file);
+    if($file eq "-") {
+	$in_fh = *STDIN;
+	$close = 0;
+    } else {
+	if(not open($in_fh, "<", $file)) {
+	    # Try the filename
+	    ::error("Cannot open $file.");
+	    ::wait_and_exit(255);
+	}
+    }
+    while(<$in_fh>) {
+	chomp;
+	/^\s*#/ and next;
+	/^\s*$/ and next;
+	push @Global::sshlogin, $_;
+    }
+    if($close) {
+	close $in_fh;
+    }
+}
+
+sub parse_sshlogin() {
+    # Parse @Global::sshlogin into %Global::host.
+    # Keep only hosts that are in one of the given ssh hostgroups.
+    # Uses:
+    #	@Global::sshlogin
+    #	$Global::minimal_command_line_length
+    #	%Global::host
+    #	$opt::transfer
+    #	@opt::return
+    #	$opt::cleanup
+    #	@opt::basefile
+    #	@opt::trc
+    # Returns: N/A
+    my @login;
+    if(not @Global::sshlogin) { @Global::sshlogin = (":"); }
+    for my $sshlogin (@Global::sshlogin) {
+	# Split up -S sshlogin,sshlogin
+	# Parse ,, and \, as , but do not split on that
+	#   -S "ssh -J jump1,,jump2 host1,host2" =>
+	#     ssh -J jump1,jump2 host1
+	#     host2
+	# Protect \, and ,, as \0
+	$sshlogin =~ s/\\,|,,/\0/g;
+	for my $s (split /,|\n/, $sshlogin) {
+	    # Replace \0 => ,
+	    $s =~ s/\0/,/g;
+	    if ($s eq ".." or $s eq "-") {
+		# This may add to @Global::sshlogin - possibly bug
+		read_sshloginfile(expand_slf_shorthand($s));
+	    } else {
+		$s =~ s/\s*$//;
+		push (@login, $s);
+	    }
+	}
+    }
+    $Global::minimal_command_line_length = 100_000_000;
+    my @allowed_hostgroups;
+    for my $ncpu_sshlogin_string (::uniq(@login)) {
+	my $sshlogin = SSHLogin->new($ncpu_sshlogin_string);
+	my $sshlogin_string = $sshlogin->string();
+	if($sshlogin_string eq "") {
+	    # This is an ssh group: -S @webservers
+	    push @allowed_hostgroups, $sshlogin->hostgroups();
+	    next;
+	}
+	if($Global::host{$sshlogin_string}) {
+	    # This sshlogin has already been added:
+	    # It is probably a host that has come back
+	    # Set the max_jobs_running back to the original
+	    debug("run","Already seen $sshlogin_string\n");
+	    if($sshlogin->{'ncpus'}) {
+		# If ncpus set by '#/' of the sshlogin, overwrite it:
+		$Global::host{$sshlogin_string}->set_ncpus($sshlogin->ncpus());
+	    }
+	    $Global::host{$sshlogin_string}->set_max_jobs_running(undef);
+	    next;
+	}
+	$sshlogin->set_maxlength(Limits::Command::max_length());
+
+	$Global::minimal_command_line_length =
+	    ::min($Global::minimal_command_line_length, $sshlogin->maxlength());
+	$Global::host{$sshlogin_string} = $sshlogin;
+    }
+    $Global::usable_command_line_length =
+	# Usable len = maxlen - 3000 for wrapping, div 2 for hexing
+	int(($Global::minimal_command_line_length - 3000)/2);
+    if($opt::max_chars) {
+	if($opt::max_chars <= $Global::usable_command_line_length) {
+	    $Global::usable_command_line_length = $opt::max_chars;
+	} else {
+	    ::warning("Value for option -s should be < ".
+		      $Global::usable_command_line_length.".");
+	}
+    }
+    if(@allowed_hostgroups) {
+	# Remove hosts that are not in these groups
+	while (my ($string, $sshlogin) = each %Global::host) {
+	    if(not $sshlogin->in_hostgroups(@allowed_hostgroups)) {
+		delete $Global::host{$string};
+	    }
+	}
+    }
+
+    # debug("start", "sshlogin: ", my_dump(%Global::host),"\n");
+    if(@Global::transfer_files or @opt::return
+       or $opt::cleanup or @opt::basefile) {
+	if(not remote_hosts()) {
+	    # There are no remote hosts
+	    if(@opt::trc) {
+		::warning("--trc ignored as there are no remote --sshlogin.");
+	    } elsif (defined $opt::transfer) {
+		::warning("--transfer ignored as there are ".
+			  "no remote --sshlogin.");
+	    } elsif (@opt::transfer_files) {
+		::warning("--transferfile ignored as there ".
+			  "are no remote --sshlogin.");
+	    } elsif (@opt::return) {
+		::warning("--return ignored as there are no remote --sshlogin.");
+	    } elsif (defined $opt::cleanup and not %opt::template) {
+		::warning("--cleanup ignored as there ".
+			  "are no remote --sshlogin.");
+	    } elsif (@opt::basefile) {
+		::warning("--basefile ignored as there ".
+			  "are no remote --sshlogin.");
+	    }
+	}
+    }
+}
+
+sub remote_hosts() {
+    # Return sshlogins that are not ':'
+    # Uses:
+    #	%Global::host
+    # Returns:
+    #	list of sshlogins with ':' removed
+    return grep !/^:$/, keys %Global::host;
+}
+
+sub setup_basefile() {
+    # Transfer basefiles to each $sshlogin
+    # This needs to be done before first jobs on $sshlogin is run
+    # Uses:
+    #	%Global::host
+    #	@opt::basefile
+    # Returns: N/A
+    my @cmd;
+    my $rsync_destdir;
+    my $workdir;
+    for my $sshlogin (values %Global::host) {
+      if($sshlogin->local()) { next }
+      for my $file (@opt::basefile) {
+	if($file !~ m:^/: and $opt::workdir eq "...") {
+	  ::error("Work dir '...' will not work with relative basefiles.");
+	  ::wait_and_exit(255);
+	}
+	if(not $workdir) {
+	    my $dummycmdline =
+		CommandLine->new(1,["true"],{},0,0,[],[],[],[],{},{});
+	    my $dummyjob = Job->new($dummycmdline);
+	    $workdir = $dummyjob->workdir();
+	}
+	push @cmd, $sshlogin->rsync_transfer_cmd($file,$workdir);
+      }
+    }
+    debug("init", "basesetup: @cmd\n");
+    my ($exitstatus,$stdout_ref,$stderr_ref) =
+	run_gnu_parallel((join "\n",@cmd),"-j0","--retries",5);
+    if($exitstatus) {
+	my @stdout = @$stdout_ref;
+	my @stderr = @$stderr_ref;
+	::error("Copying of --basefile failed: @stdout@stderr");
+	::wait_and_exit(255);
+    }
+}
+
+sub cleanup_basefile() {
+    # Remove the basefiles transferred
+    # Uses:
+    #	%Global::host
+    #	@opt::basefile
+    # Returns: N/A
+    my @cmd;
+    my $workdir;
+    if(not $workdir) {
+	my $dummycmdline = CommandLine->new(1,["true"],{},0,0,[],[],[],[],{},{});
+	my $dummyjob = Job->new($dummycmdline);
+	$workdir = $dummyjob->workdir();
+    }
+    for my $sshlogin (values %Global::host) {
+	if($sshlogin->local()) { next }
+	for my $file (@opt::basefile) {
+	    push @cmd, $sshlogin->cleanup_cmd($file,$workdir);
+	}
+    }
+    debug("init", "basecleanup: @cmd\n");
+    my ($exitstatus,$stdout_ref,$stderr_ref) =
+	run_gnu_parallel(join("\n",@cmd),"-j0","--retries",5);
+    if($exitstatus) {
+	my @stdout = @$stdout_ref;
+	my @stderr = @$stderr_ref;
+	::error("Cleanup of --basefile failed: @stdout@stderr");
+	::wait_and_exit(255);
+    }
+}
+
+sub run_gnu_parallel() {
+    my ($stdin,@args) = @_;
+    my $cmd = join "",map { " $_ & " } split /\n/, $stdin;
+    print $Global::original_stderr ` $cmd wait` ;
+    return 0
+}
+
+sub _run_gnu_parallel() {
+    # Run GNU Parallel
+    # This should ideally just fork an internal copy
+    # and not start it through a shell
+    # Input:
+    #	$stdin = data to provide on stdin for GNU   Parallel
+    #	@args = command line arguments
+    # Returns:
+    #	$exitstatus = exitcode of GNU Parallel run
+    #	\@stdout = standard output
+    #	\@stderr = standard error
+    my ($stdin,@args) = @_;
+    my ($exitstatus,@stdout,@stderr);
+    my ($stdin_fh,$stdout_fh)=(gensym(),gensym());
+    my ($stderr_fh, $stderrname) = ::tmpfile(SUFFIX => ".par");
+    unlink $stderrname;
+
+    my $pid = ::open3($stdin_fh,$stdout_fh,$stderr_fh,
+		      $0,qw(--plain --shell /bin/sh --will-cite), @args);
+    if(my $writerpid = fork()) {
+	close $stdin_fh;
+	@stdout = <$stdout_fh>;
+	# Now stdout is closed:
+	# These pids should be dead or die very soon
+	while(kill 0, $writerpid) { ::usleep(1); }
+	die;
+#	reap $writerpid;
+#	while(kill 0, $pid) { ::usleep(1); }
+#	reap $writerpid;
+	$exitstatus = $?;
+	seek $stderr_fh, 0, 0;
+	@stderr = <$stderr_fh>;
+	close $stdout_fh;
+	close $stderr_fh;
+    } else {
+	close $stdout_fh;
+	close $stderr_fh;
+	print $stdin_fh $stdin;
+	close $stdin_fh;
+	exit(0);
+    }
+    return ($exitstatus,\@stdout,\@stderr);
+}
+
+sub filter_hosts() {
+    # Remove down --sshlogins from active duty.
+    # Find ncpus, ncores, maxlen, time-to-login for each host.
+    # Uses:
+    #	%Global::host
+    #	$Global::minimal_command_line_length
+    #	$opt::use_sockets_instead_of_threads
+    #	$opt::use_cores_instead_of_threads
+    #	$opt::use_cpus_instead_of_cores
+    # Returns: N/A
+
+    my ($nsockets_ref,$ncores_ref, $nthreads_ref, $time_to_login_ref,
+	$maxlen_ref, $echo_ref, $down_hosts_ref) =
+	parse_host_filtering(parallelized_host_filtering());
+
+    delete @Global::host{@$down_hosts_ref};
+    @$down_hosts_ref and ::warning("Removed @$down_hosts_ref.");
+
+    $Global::minimal_command_line_length = 100_000_000;
+    while (my ($string, $sshlogin) = each %Global::host) {
+	if($sshlogin->local()) { next }
+	my ($nsockets,$ncores,$nthreads,$time_to_login,$maxlen) =
+	    ($nsockets_ref->{$string},$ncores_ref->{$string},
+	     $nthreads_ref->{$string},$time_to_login_ref->{$string},
+	     $maxlen_ref->{$string});
+	defined $nsockets or ::die_bug("nsockets missing: $string");
+	defined $ncores or ::die_bug("ncores missing: $string");
+	defined $nthreads or ::die_bug("nthreads missing: $string");
+	defined $time_to_login or ::die_bug("time_to_login missing: $string");
+	defined $maxlen or ::die_bug("maxlen missing: $string");
+	# ncpus may be set by 4/hostname or may be undefined yet
+	my $ncpus = $sshlogin->{'ncpus'};
+	# $nthreads may be 0 if GNU Parallel is not installed remotely
+	$ncpus = $nthreads || $ncpus || $sshlogin->ncpus();
+	if($opt::use_cpus_instead_of_cores) {
+	    $ncpus = $ncores || $ncpus;
+	} elsif($opt::use_sockets_instead_of_threads) {
+	    $ncpus = $nsockets || $ncpus;
+	} elsif($opt::use_cores_instead_of_threads) {
+	    $ncpus = $ncores || $ncpus;
+	}
+	$sshlogin->set_ncpus($ncpus);
+	$sshlogin->set_time_to_login($time_to_login);
+	$maxlen = $maxlen || Limits::Command::max_length();
+	$sshlogin->set_maxlength($maxlen);
+	::debug("init", "Timing from -S:$string ",
+		" ncpus:", $ncpus,
+		" nsockets:",$nsockets,
+		" ncores:", $ncores,
+		" nthreads:",$nthreads,
+		" time_to_login:", $time_to_login,
+		" maxlen:", $maxlen,
+		" min_max_len:", $Global::minimal_command_line_length,"\n");
+    }
+}
+
+sub parse_host_filtering() {
+    # Input:
+    #	@lines = output from parallelized_host_filtering()
+    # Returns:
+    #	\%nsockets = number of sockets of {host}
+    #	\%ncores = number of cores of {host}
+    #	\%nthreads = number of hyperthreaded cores of {host}
+    #	\%time_to_login = time_to_login on {host}
+    #	\%maxlen = max command len on {host}
+    #	\%echo = echo received from {host}
+    #	\@down_hosts = list of hosts with no answer
+    local $/ = "\n";
+    my (%nsockets, %ncores, %nthreads, %time_to_login, %maxlen, %echo,
+	@down_hosts);
+    for (@_) {
+	::debug("init","Read: ",$_);
+	chomp;
+	my @col = split /\t/, $_;
+	if($col[0] =~ /^parallel: Warning:/) {
+	    # Timed out job: Ignore it
+	    next;
+	} elsif(defined $col[6]) {
+	    # This is a line from --joblog
+	    # seq host time spent sent received exit signal command
+	    # 2 : 1372607672.654 0.675 0 0 0 0 eval true\ m\;ssh\ m\ parallel\ --number-of-cores
+	    if($col[0] eq "Seq" and $col[1] eq "Host" and
+		    $col[2] eq "Starttime") {
+		# Header => skip
+		next;
+	    }
+	    # Get server from: eval true server\;
+	    $col[8] =~ /eval .?true.?\s([^\;]+);/ or
+		::die_bug("col8 does not contain host: $col[8] in $_");
+	    my $host = $1;
+	    $host =~ tr/\\//d;
+	    $Global::host{$host} or next;
+	    if($col[6] eq "255" or $col[6] eq "-1" or $col[6] eq "1") {
+		# exit == 255 or exit == timeout (-1): ssh failed/timedout
+		# exit == 1: lsh failed
+		# Remove sshlogin
+		::debug("init", "--filtered $host\n");
+		push(@down_hosts, $host);
+	    } elsif($col[6] eq "127") {
+		# signal == 127: parallel not installed remote
+		# Set nsockets, ncores, nthreads = 1
+		::warning("Could not figure out ".
+			  "number of cpus on $host. Using 1.");
+		$nsockets{$host} = 1;
+		$ncores{$host} = 1;
+		$nthreads{$host} = 1;
+		$maxlen{$host} = Limits::Command::max_length();
+	    } elsif($col[0] =~ /^\d+$/ and $Global::host{$host}) {
+		# Remember how log it took to log in
+		# 2 : 1372607672.654 0.675 0 0 0 0 eval true\ m\;ssh\ m\ echo
+		$time_to_login{$host} = ::min($time_to_login{$host},$col[3]);
+	    } else {
+		::die_bug("host check unmatched long jobline: $_");
+	    }
+	} elsif($Global::host{$col[0]}) {
+	    # This output from --number-of-cores, --number-of-cpus,
+	    # --max-line-length-allowed
+	    # ncores: server	   8
+	    # ncpus:  server	   2
+	    # maxlen: server	   131071
+	    if(/parallel: Warning: Cannot figure out number of/) {
+		next;
+	    }
+	    if(/\t(perl: warning:|LANGUAGE =|LC_ALL =|LANG =|are supported and installed|Disconnected from|Received disconnect from)/
+		    or
+		    /\tWarning: /
+		) {
+		# Skip these (from perl):
+		#   perl: warning: Setting locale failed.
+		#   perl: warning: Please check that your locale settings:
+		#   	  LANGUAGE = (unset),
+		#   	  LC_ALL = (unset),
+		#   	  LANG = "en_US.UTF-8"
+		#       are supported and installed on your system.
+		#   perl: warning: Falling back to the standard locale ("C").
+		#   Disconnected from 127.0.0.1 port 22
+		#
+		# Skip these (from ssh):
+		#   Warning: Permanently added * to the list of known hosts.
+		#   Warning: Identity file * not accessible: *
+	    } elsif(not defined $nsockets{$col[0]}) {
+		$nsockets{$col[0]} = $col[1];
+	    } elsif(not defined $ncores{$col[0]}) {
+		$ncores{$col[0]} = $col[1];
+	    } elsif(not defined $nthreads{$col[0]}) {
+		$nthreads{$col[0]} = $col[1];
+	    } elsif(not defined $maxlen{$col[0]}) {
+		$maxlen{$col[0]} = $col[1];
+	    } elsif(not defined $echo{$col[0]}) {
+		$echo{$col[0]} = $col[1];
+	    } else {
+		::die_bug("host check too many col0: $_");
+	    }
+	} else {
+	    ::die_bug("host check unmatched short jobline ($col[0]): $_");
+	}
+    }
+    @down_hosts = uniq(@down_hosts);
+    return(\%nsockets, \%ncores, \%nthreads, \%time_to_login,
+	   \%maxlen, \%echo, \@down_hosts);
+}
+
+sub parallelized_host_filtering() {
+    # Uses:
+    #	%Global::host
+    # Returns:
+    #	text entries with:
+    #	* joblog line
+    #	* hostname \t number of cores
+    #	* hostname \t number of cpus
+    #	* hostname \t max-line-length-allowed
+    #	* hostname \t empty
+
+    sub sshwrapped {
+	# Wrap with ssh and --env
+	# Return $default_value if command fails
+	my $sshlogin = shift;
+	my $command = shift;
+	# wrapper that returns output "0\n" if the command fails
+	# E.g. parallel not installed => "0\n"
+	my $wcmd = q(perl -e '$a=`).$command.q(`; print $? ? "0".v010 : $a');
+	my $commandline = CommandLine->new(1,[$wcmd],{},0,0,[],[],[],[],{},{});
+	my $job = Job->new($commandline);
+	$job->set_sshlogin($sshlogin);
+	$job->wrapped();
+	return($job->{'wrapped'});
+    }
+
+    my(@sockets, @cores, @threads, @maxline, @echo);
+    while (my ($host, $sshlogin) = each %Global::host) {
+	if($host eq ":") { next }
+	# The 'true' is used to get the $host out later
+	push(@sockets, $host."\t"."true $host; ".
+	     sshwrapped($sshlogin,"parallel --number-of-sockets")."\n\0");
+	push(@cores, $host."\t"."true $host; ".
+	     sshwrapped($sshlogin,"parallel --number-of-cores")."\n\0");
+	push(@threads, $host."\t"."true $host; ".
+	     sshwrapped($sshlogin,"parallel --number-of-threads")."\n\0");
+	push(@maxline, $host."\t"."true $host; ".
+	     sshwrapped($sshlogin,
+			"parallel --max-line-length-allowed")."\n\0");
+	# 'echo' is used to get the fastest possible ssh login time
+	push(@echo, $host."\t"."true $host; ".
+	     $sshlogin->wrap("echo $host")."\n\0");
+    }
+    # --timeout 10: Setting up an SSH connection and running a simple
+    #		    command should never take > 10 sec.
+    # --delay 0.1:  If multiple sshlogins use the same proxy the delay
+    #		    will make it less likely to overload the ssh daemon.
+    # --retries 3:  If the ssh daemon is overloaded, try 3 times
+    my $cmd =
+	"$0 -j0 --timeout 10 --joblog - --plain --delay 0.1 --retries 3 ".
+	"--tag --tagstring '{1}' -0 --colsep '\t' -k eval '{2}' && true ";
+    $cmd = $Global::shell." -c ".Q($cmd);
+    ::debug("init", $cmd, "\n");
+    my @out;
+    my $prepend = "";
+
+    my ($host_fh,$in,$err);
+    open3($in, $host_fh, $err, $cmd) || ::die_bug("parallel host check: $cmd");
+    ::debug("init", map { $_,"\n" } @sockets, @cores, @threads, @maxline, @echo);
+
+    if(not fork()) {
+	# Give the commands to run to the $cmd
+	close $host_fh;
+	print $in @sockets, @cores, @threads, @maxline, @echo;
+	close $in;
+	exit();
+    }
+    close $in;
+    # If -0: $/ must be \n
+    local $/ = "\n";
+    for(<$host_fh>) {
+	# TODO incompatible with '-quoting. Needs to be fixed differently
+	#if(/\'$/) {
+	#    # if last char = ' then append next line
+	#    # This may be due to quoting of \n in environment var
+	#    $prepend .= $_;
+	#    next;
+	#}
+	$_ = $prepend . $_;
+	$prepend = "";
+	push @out, $_;
+    }
+    close $host_fh;
+    return @out;
+}
+
+sub onall($@) {
+    # Runs @command on all hosts.
+    # Uses parallel to run @command on each host.
+    # --jobs = number of hosts to run on simultaneously.
+    # For each host a parallel command with the args will be running.
+    # Uses:
+    #	$Global::debug
+    #	$Global::exitstatus
+    #	$Global::joblog
+    #	$Global::quoting
+    #	$opt::D
+    #	$opt::arg_file_sep
+    #	$opt::arg_sep
+    #	$opt::colsep
+    #	$opt::files
+    #	$opt::group
+    #	$opt::joblog
+    #	$opt::jobs
+    #	$opt::keeporder
+    #	$opt::linebuffer
+    #	$opt::max_chars
+    #	$opt::plain
+    #	$opt::retries
+    #	$opt::tag
+    #	$opt::tee
+    #	$opt::timeout
+    #	$opt::ungroup
+    #	%Global::host
+    #	@opt::basefile
+    #	@opt::env
+    #	@opt::v
+    # Input:
+    #	@command = command to run on all hosts
+    # Returns: N/A
+    sub tmp_joblog {
+	# Input:
+	#   $joblog = filename of joblog - undef if none
+	# Returns:
+	#   $tmpfile = temp file for joblog - undef if none
+	my $joblog = shift;
+	if(not defined $joblog) {
+	    return undef;
+	}
+	my ($fh, $tmpfile) = ::tmpfile(SUFFIX => ".log");
+	close $fh;
+	return $tmpfile;
+    }
+    my ($input_source_fh_ref,@command) = @_;
+    if($Global::quoting) {
+       @command = shell_quote(@command);
+    }
+
+    # Copy all @input_source_fh (-a and :::) into tempfiles
+    my @argfiles = ();
+    for my $fh (@$input_source_fh_ref) {
+	my ($outfh, $name) = ::tmpfile(SUFFIX => ".all", UNLINK => not $opt::D);
+	print $outfh (<$fh>);
+	close $outfh;
+	push @argfiles, $name;
+    }
+    if(@opt::basefile) { setup_basefile(); }
+    # for each sshlogin do:
+    # parallel -S $sshlogin $command :::: @argfiles
+    #
+    # Pass some of the options to the sub-parallels, not all of them as
+    # -P should only go to the first, and -S should not be copied at all.
+    my $options =
+	join(" ",
+	     ((defined $opt::sshdelay) ? "--delay ".$opt::sshdelay : ""),
+	     ((defined $opt::memfree) ? "--memfree ".$opt::memfree : ""),
+	     ((defined $opt::memsuspend) ? "--memfree ".$opt::memsuspend : ""),
+	     ((defined $opt::D) ? "-D $opt::D" : ""),
+	     ((defined $opt::group) ? "--group" : ""),
+	     ((defined $opt::jobs) ? "-P $opt::jobs" : ""),
+	     ((defined $opt::keeporder) ? "--keeporder" : ""),
+	     ((defined $opt::linebuffer) ? "--linebuffer" : ""),
+	     ((defined $opt::max_chars) ? "--max-chars ".$opt::max_chars : ""),
+	     ((defined $opt::plain) ? "--plain" : ""),
+	     (($opt::ungroup == 1) ? "-u" : ""),
+	     ((defined $opt::tee) ? "--tee" : ""),
+	);
+    my $suboptions =
+	join(" ",
+	     ((defined $opt::sshdelay) ? "--delay ".$opt::sshdelay : ""),
+	     ((defined $opt::D) ? "-D $opt::D" : ""),
+	     ((defined $opt::arg_file_sep) ? "--arg-file-sep ".$opt::arg_file_sep : ""),
+	     ((defined $opt::arg_sep) ? "--arg-sep ".$opt::arg_sep : ""),
+	     ((defined $opt::colsep) ? "--colsep ".shell_quote($opt::colsep) : ""),
+	     ((defined $opt::files) ? "--files" : ""),
+	     ((defined $opt::group) ? "--group" : ""),
+	     ((defined $opt::cleanup) ? "--cleanup" : ""),
+	     ((defined $opt::keeporder) ? "--keeporder" : ""),
+	     ((defined $opt::linebuffer) ? "--linebuffer" : ""),
+	     ((defined $opt::max_chars) ? "--max-chars ".$opt::max_chars : ""),
+	     ((defined $opt::plain) ? "--plain" : ""),
+	     ((defined $opt::plus) ? "--plus" : ""),
+	     ((defined $opt::retries) ? "--retries ".$opt::retries : ""),
+	     ((defined $opt::timeout) ? "--timeout ".$opt::timeout : ""),
+	     (($opt::ungroup == 1) ? "-u" : ""),
+	     ((defined $opt::ssh) ? "--ssh '".$opt::ssh."'" : ""),
+	     ((defined $opt::tee) ? "--tee" : ""),
+	     ((defined $opt::workdir) ? "--wd ".Q($opt::workdir) : ""),
+	     (@Global::transfer_files ? map { "--tf ".Q($_) }
+	      @Global::transfer_files : ""),
+	     (@Global::ret_files ? map { "--return ".Q($_) }
+	      @Global::ret_files : ""),
+	     (@opt::env ? map { "--env ".Q($_) } @opt::env : ""),
+	     (map { "-v" } @opt::v),
+	);
+    ::debug("init", "| $0 $options\n");
+    open(my $parallel_fh, "|-", "$0 -0 --will-cite -j0 $options") ||
+	::die_bug("This does not run GNU Parallel: $0 $options");
+    my @joblogs;
+    for my $host (sort keys %Global::host) {
+	my $sshlogin = $Global::host{$host};
+	my $joblog = tmp_joblog($opt::joblog);
+	if($joblog) {
+	    push @joblogs, $joblog;
+	    $joblog = "--joblog $joblog";
+	}
+	my $quad = $opt::arg_file_sep || "::::";
+	# If PARALLEL_ENV is set: Pass it on
+	my $penv=$Global::parallel_env ?
+	    "PARALLEL_ENV=".Q($Global::parallel_env) :
+	    '';
+	::debug("init", "$penv $0 $suboptions -j1 $joblog ",
+	    ((defined $opt::tag) ?
+	     "--tagstring ".Q($sshlogin->string()) : ""),
+	     " -S ", Q($sshlogin->string())," ",
+	     join(" ",shell_quote(@command))," $quad @argfiles\n");
+	print $parallel_fh "$penv $0 $suboptions -j1 $joblog ",
+	    ((defined $opt::tag) ?
+	     "--tagstring ".Q($sshlogin->string()) : ""),
+	     " -S ", Q($sshlogin->string())," ",
+	     join(" ",shell_quote(@command))," $quad @argfiles\0";
+    }
+    close $parallel_fh;
+    $Global::exitstatus = $? >> 8;
+    debug("init", "--onall exitvalue ", $?);
+    if(@opt::basefile and $opt::cleanup) { cleanup_basefile(); }
+    $Global::debug or unlink(@argfiles);
+    my %seen;
+    for my $joblog (@joblogs) {
+	# Append to $joblog
+	open(my $fh, "<", $joblog) ||
+	    ::die_bug("Cannot open tmp joblog $joblog");
+	# Skip first line (header);
+	<$fh>;
+	print $Global::joblog (<$fh>);
+	close $fh;
+	unlink($joblog);
+    }
+}
+
+
+sub __SIGNAL_HANDLING__() {}
+
+
+sub sigtstp() {
+    # Send TSTP signal (Ctrl-Z) to all children process groups
+    # Uses:
+    #	%SIG
+    # Returns: N/A
+    signal_children("TSTP");
+}
+
+sub sigpipe() {
+    # Send SIGPIPE signal to all children process groups
+    # Uses:
+    #	%SIG
+    # Returns: N/A
+    signal_children("PIPE");
+}
+
+sub signal_children() {
+    # Send signal to all children process groups
+    # and GNU	Parallel itself
+    # Uses:
+    #	%SIG
+    # Returns: N/A
+    my $signal = shift;
+    debug("run", "Sending $signal ");
+    kill $signal, map { -$_ } keys %Global::running;
+    # Use default signal handler for GNU Parallel itself
+    $SIG{$signal} = undef;
+    kill $signal, $$;
+}
+
+sub save_original_signal_handler() {
+    # Remember the original signal handler
+    # Uses:
+    #	%Global::original_sig
+    # Returns: N/A
+    $SIG{INT} = sub {
+	if($opt::tmux) { ::qqx("tmux kill-session -t p$$"); }
+	wait_and_exit(255);
+    };
+    $SIG{TERM} = sub {
+	if($opt::tmux) { ::qqx("tmux kill-session -t p$$"); }
+	wait_and_exit(255);
+    };
+    %Global::original_sig = %SIG;
+    $SIG{TERM} = sub {}; # Dummy until jobs really start
+    $SIG{ALRM} = 'IGNORE';
+    # Allow Ctrl-Z to suspend and `fg` to continue
+    $SIG{TSTP} = \&sigtstp;
+    $SIG{PIPE} = \&sigpipe;
+    $SIG{CONT} = sub {
+	# Set $SIG{TSTP} again (it is undef'ed in sigtstp() )
+	$SIG{TSTP} = \&sigtstp;
+	for my $job (values %Global::running) {
+	    if($job->suspended()) {
+		# Force jobs to suspend, if they are marked as suspended.
+		# --memsupspend can suspend a job that will be resumed
+		# if the user presses CTRL-Z followed by `fg`.
+		$job->suspend();
+	    } else {
+		# Resume the rest of the jobs
+		$job->resume();
+	    }
+	}
+    };
+}
+
+sub list_running_jobs() {
+    # Print running jobs on tty
+    # Uses:
+    #	%Global::running
+    # Returns: N/A
+    for my $job (values %Global::running) {
+	::status("$Global::progname: ".$job->replaced());
+    }
+}
+
+sub start_no_new_jobs() {
+    # Start no more jobs
+    # Uses:
+    #	 %Global::original_sig
+    #	 %Global::unlink
+    #	 $Global::start_no_new_jobs
+    # Returns: N/A
+    unlink keys %Global::unlink;
+    ::status
+	("$Global::progname: SIGHUP received. No new jobs will be started.",
+	 "$Global::progname: Waiting for these ".(keys %Global::running).
+	 " jobs to finish. Send SIGTERM to stop now.");
+    list_running_jobs();
+    $Global::start_no_new_jobs ||= 1;
+}
+
+sub reapers() {
+    # Run reaper until there are no more left
+    # Returns:
+    #	@pids_reaped = pids of reaped processes
+    my @pids_reaped;
+    my $pid;
+    while($pid = reaper()) {
+	push @pids_reaped, $pid;
+    }
+    return @pids_reaped;
+}
+
+sub reaper() {
+    # A job finished:
+    # * Set exitstatus, exitsignal, endtime.
+    # * Free ressources for new job
+    # * Update median runtime
+    # * Print output
+    # * If --halt = now: Kill children
+    # * Print progress
+    # Uses:
+    #	%Global::running
+    #	$opt::timeout
+    #	$Global::timeoutq
+    #	$opt::keeporder
+    #	$Global::total_running
+    # Returns:
+    #	$stiff = PID of child finished
+    my $stiff;
+    debug("run", "Reaper ");
+    if(($stiff = waitpid(-1, &WNOHANG)) <= 0) {
+	# No jobs waiting to be reaped
+	return 0;
+    }
+
+    # $stiff = pid of dead process
+    my $job = $Global::running{$stiff};
+
+    # '-a <(seq 10)' will give us a pid not in %Global::running
+    # The same will one of the ssh -M: ignore
+    $job or return 0;
+    delete $Global::running{$stiff};
+    $Global::total_running--;
+    if($job->{'commandline'}{'skip'}) {
+	# $job->skip() was called
+	$job->set_exitstatus(-2);
+	$job->set_exitsignal(0);
+    } else {
+	$job->set_exitstatus($? >> 8);
+	$job->set_exitsignal($? & 127);
+    }
+
+    debug("run", "\nseq ",$job->seq()," died (", $job->exitstatus(), ")");
+    if($Global::delayauto or $Global::sshdelayauto) {
+	if($job->exitstatus()) {
+	    # Job failed: Increase delay (if $opt::(ssh)delay set)
+	    $opt::delay &&= $opt::delay * 1.3;
+	    $opt::sshdelay &&= $opt::sshdelay * 1.3;
+	} else {
+	    # Job succeeded: Decrease delay (if $opt::(ssh)delay set)
+	    $opt::delay &&= $opt::delay * 0.9;
+	    $opt::sshdelay &&= $opt::sshdelay * 0.9;
+	}
+	debug("run", "delay:$opt::delay ssh:$opt::sshdelay ");
+    }
+    $job->set_endtime(::now());
+    my $sshlogin = $job->sshlogin();
+    $sshlogin->dec_jobs_running();
+    if($job->should_be_retried()) {
+	# Free up file handles
+	$job->free_ressources();
+    } else {
+	# The job is done
+	$sshlogin->inc_jobs_completed();
+	# Free the jobslot
+	$job->free_slot();
+	if($opt::timeout and not $job->exitstatus()) {
+	    # Update average runtime for timeout only for successful jobs
+	    $Global::timeoutq->update_median_runtime($job->runtime());
+	}
+	if($opt::keeporder and not $opt::latestline) {
+	    # --latestline fixes --keeporder in Job::row()
+	    $job->print_earlier_jobs();
+	} else {
+	    $job->print();
+	}
+	if($job->should_we_halt() eq "now") {
+	    # Kill children
+	    ::kill_sleep_seq($job->pid());
+	    ::killall();
+	    ::wait_and_exit($Global::halt_exitstatus);
+	}
+    }
+    $job->cleanup();
+
+    if($opt::progress) {
+	my %progress = progress();
+	::status_no_nl("\r",$progress{'status'});
+    }
+
+    debug("run", "jobdone \n");
+    return $stiff;
+}
+
+
+sub __USAGE__() {}
+
+
+sub killall() {
+    # Kill all jobs by killing their process groups
+    # Uses:
+    #	$Global::start_no_new_jobs = we are stopping
+    #	$Global::killall = Flag to not run reaper
+    $Global::start_no_new_jobs ||= 1;
+    # Do not reap killed children: Ignore them instead
+    $Global::killall ||= 1;
+    kill_sleep_seq(keys %Global::running);
+}
+
+sub kill_sleep_seq(@) {
+    # Send jobs TERM,TERM,KILL to processgroups
+    # Input:
+    #	@pids = list of pids that are also processgroups
+    # Convert pids to process groups ($processgroup = -$pid)
+    my @pgrps = map { -$_ } @_;
+    my @term_seq = split/,/,$opt::termseq;
+    if(not @term_seq) {
+	@term_seq = ("TERM",200,"TERM",100,"TERM",50,"KILL",25);
+    }
+    # for each signal+waittime: kill process groups still not dead
+    while(@term_seq) {
+	@pgrps = kill_sleep(shift @term_seq, shift @term_seq, @pgrps);
+    }
+}
+
+sub kill_sleep() {
+    # Kill pids with a signal and wait a while for them to die
+    # Input:
+    #	$signal = signal to send to @pids
+    #	$sleep_max = number of ms to sleep at most before returning
+    #	@pids = pids to kill (actually process groups)
+    # Uses:
+    #	$Global::killall = set by killall() to avoid calling reaper
+    # Returns:
+    #	@pids = pids still alive
+    my ($signal, $sleep_max, @pids) = @_;
+    ::debug("kill","kill_sleep $signal ",(join " ",sort @pids),"\n");
+    kill $signal, @pids;
+    my $sleepsum = 0;
+    my $sleep = 0.001;
+
+    while(@pids and $sleepsum < $sleep_max) {
+	if($Global::killall) {
+	    # Killall => don't run reaper
+	    while(waitpid(-1, &WNOHANG) > 0) {
+		$sleep = $sleep/2+0.001;
+	    }
+	} elsif(reapers()) {
+	    $sleep = $sleep/2+0.001;
+	}
+	$sleep *= 1.1;
+	::usleep($sleep);
+	$sleepsum += $sleep;
+	# Keep only living children
+	@pids = grep { kill(0, $_) } @pids;
+    }
+    return @pids;
+}
+
+sub wait_and_exit($) {
+    # If we do not wait, we sometimes get segfault
+    # Returns: N/A
+    my $error = shift;
+    unlink keys %Global::unlink;
+    if($error) {
+	# Kill all jobs without printing
+	killall();
+    }
+    for (keys %Global::unkilled_children) {
+	# Kill any (non-jobs) children (e.g. reserved processes)
+	kill 9, $_;
+	waitpid($_,0);
+	delete $Global::unkilled_children{$_};
+    }
+    if($Global::unkilled_sqlworker) {
+	waitpid($Global::unkilled_sqlworker,0);
+    }
+    # Avoid: Warning: unable to close filehandle properly: No space
+    #	     left on device during global destruction.
+    $SIG{__WARN__} = sub {};
+    if($opt::_parset) {
+	# Make the shell script return $error
+	print "$Global::parset_endstring\nreturn $error";
+    }
+    exit($error);
+}
+
+sub die_usage() {
+    # Returns: N/A
+    usage();
+    wait_and_exit(255);
+}
+
+sub usage() {
+    # Returns: N/A
+    print join
+	("\n",
+	 "Usage:",
+	 "",
+	 "$Global::progname [options] [command [arguments]] < list_of_arguments",
+	 "$Global::progname [options] [command [arguments]] (::: arguments|:::: argfile(s))...",
+	 "cat ... | $Global::progname --pipe [options] [command [arguments]]",
+	 "",
+	 "-j n            Run n jobs in parallel",
+	 "-k              Keep same order",
+	 "-X              Multiple arguments with context replace",
+	 "--colsep regexp Split input on regexp for positional replacements",
+	 "{} {.} {/} {/.} {#} {%} {= perl code =} Replacement strings",
+	 "{3} {3.} {3/} {3/.} {=3 perl code =}    Positional replacement strings",
+	 "With --plus:    {} = {+/}/{/} = {.}.{+.} = {+/}/{/.}.{+.} = {..}.{+..} =",
+	 "                {+/}/{/..}.{+..} = {...}.{+...} = {+/}/{/...}.{+...}",
+	 "",
+	 "-S sshlogin     Example: foo\@server.example.com",
+	 "--slf ..        Use ~/.parallel/sshloginfile as the list of sshlogins",
+	 "--trc {}.bar    Shorthand for --transfer --return {}.bar --cleanup",
+	 "--onall         Run the given command with argument on all sshlogins",
+	 "--nonall        Run the given command with no arguments on all sshlogins",
+	 "",
+	 "--pipe          Split stdin (standard input) to multiple jobs.",
+	 "--recend str    Record end separator for --pipe.",
+	 "--recstart str  Record start separator for --pipe.",
+	 "",
+	 "GNU Parallel can do much more. See 'man $Global::progname' for details",
+	 "",
+	 "Academic tradition requires you to cite works you base your article on.",
+	 "If you use programs that use GNU Parallel to process data for an article in a",
+	 "scientific publication, please cite:",
+	 "",
+	 "  Tange, O. (2022, November 22). GNU Parallel 20221122 ('Херсо́н').",
+	 "  Zenodo. https://doi.org/10.5281/zenodo.7347980",
+	 "",
+	 # Before changing these lines,	 please read
+	 # https://www.gnu.org/software/parallel/parallel_design.html#citation-notice
+	 # https://git.savannah.gnu.org/cgit/parallel.git/tree/doc/citation-notice-faq.txt
+	 # You accept to be put in a public hall of shame by removing
+	 # these lines.
+	 "This helps funding further development; AND IT WON'T COST YOU A CENT.",
+	 "If you pay 10000 EUR you should feel free to use GNU Parallel without citing.",
+	 "",
+	 "",);
+}
+
+sub citation_notice() {
+    # if --will-cite or --plain: do nothing
+    # if stderr redirected: do nothing
+    # if $PARALLEL_HOME/will-cite: do nothing
+    # else: print citation notice to stderr
+    if($opt::willcite
+       or
+       $opt::plain
+       or
+       not -t $Global::original_stderr
+       or
+       grep { -e "$_/will-cite" } @Global::config_dirs) {
+	# skip
+    } else {
+	::status
+	    ("Academic tradition requires you to cite works you base your article on.",
+	     "If you use programs that use GNU Parallel to process data for an article in a",
+	     "scientific publication, please cite:",
+	     "",
+	     "  Tange, O. (2022, November 22). GNU Parallel 20221122 ('Херсо́н').",
+	     "  Zenodo. https://doi.org/10.5281/zenodo.7347980",
+	     "",
+	     # Before changing these line,  please read
+	     # https://www.gnu.org/software/parallel/parallel_design.html#citation-notice and
+	     # https://git.savannah.gnu.org/cgit/parallel.git/tree/doc/citation-notice-faq.txt
+	     # You accept to be put in a public hall of shame by
+	     # removing these lines.
+	     "This helps funding further development; AND IT WON'T COST YOU A CENT.",
+	     "If you pay 10000 EUR you should feel free to use GNU Parallel without citing.",
+	     "",
+	     "More about funding GNU Parallel and the citation notice:",
+	     "https://www.gnu.org/software/parallel/parallel_design.html#citation-notice",
+	     "",
+	     "To silence this citation notice: run 'parallel --citation' once.",
+	     ""
+	    );
+	mkdir $Global::config_dir;
+	# Number of times the user has run GNU Parallel without showing
+	# willingness to cite
+	my $runs = 0;
+	if(open (my $fh, "<", $Global::config_dir.
+		 "/runs-without-willing-to-cite")) {
+	    $runs = <$fh>;
+	    close $fh;
+	}
+	$runs++;
+	if(open (my $fh, ">", $Global::config_dir.
+		 "/runs-without-willing-to-cite")) {
+	    print $fh $runs;
+	    close $fh;
+	    if($runs >= 10) {
+		::status("Come on: You have run parallel $runs times. ".
+			 "Isn't it about time ",
+			 "you run 'parallel --citation' once to silence ".
+			 "the citation notice?",
+			 "");
+	    }
+	}
+    }
+}
+
+sub status(@) {
+    my @w = @_;
+    my $fh = $Global::status_fd || *STDERR;
+    print $fh map { ($_, "\n") } @w;
+    flush $fh;
+}
+
+sub status_no_nl(@) {
+    my @w = @_;
+    my $fh = $Global::status_fd || *STDERR;
+    print $fh @w;
+    flush $fh;
+}
+
+sub warning(@) {
+    my @w = @_;
+    my $prog = $Global::progname || "parallel";
+    status_no_nl(map { ($prog, ": Warning: ", $_, "\n"); } @w);
+}
+
+{
+    my %warnings;
+    sub warning_once(@) {
+	my @w = @_;
+	my $prog = $Global::progname || "parallel";
+	$warnings{@w}++ or
+	    status_no_nl(map { ($prog, ": Warning: ", $_, "\n"); } @w);
+    }
+}
+
+sub error(@) {
+    my @w = @_;
+    my $prog = $Global::progname || "parallel";
+    status(map { ($prog.": Error: ". $_); } @w);
+}
+
+sub die_bug($) {
+    my $bugid = shift;
+    print STDERR
+	("$Global::progname: This should not happen. You have found a bug. ",
+	 "Please follow\n",
+	 "https://www.gnu.org/software/parallel/man.html#reporting-bugs\n",
+	 "\n",
+	 "Include this in the report:\n",
+	 "* The version number: $Global::version\n",
+	 "* The bugid: $bugid\n",
+	 "* The command line being run\n",
+	 "* The files being read (put the files on a webserver if they are big)\n",
+	 "\n",
+	 "If you get the error on smaller/fewer files, please include those instead.\n");
+    ::wait_and_exit(255);
+}
+
+sub version() {
+    # Returns: N/A
+    print join
+	("\n",
+	 "GNU $Global::progname $Global::version",
+	 "Copyright (C) 2007-2022 Ole Tange, http://ole.tange.dk and Free Software",
+	 "Foundation, Inc.",
+	 "License GPLv3+: GNU GPL version 3 or later <https://gnu.org/licenses/gpl.html>",
+	 "This is free software: you are free to change and redistribute it.",
+	 "GNU $Global::progname comes with no warranty.",
+	 "",
+	 "Web site: https://www.gnu.org/software/${Global::progname}\n",
+	 "When using programs that use GNU Parallel to process data for publication",
+	 "please cite as described in 'parallel --citation'.\n",
+	);
+}
+
+sub citation() {
+    # Returns: N/A
+    my ($all_argv_ref,$argv_options_removed_ref) = @_;
+    my $all_argv = "@$all_argv_ref";
+    my $no_opts = "@$argv_options_removed_ref";
+    $all_argv=~s/--citation//;
+    if($all_argv ne $no_opts) {
+	::warning("--citation ignores all other options and arguments.");
+	::status("");
+    }
+
+    ::status(
+	"Academic tradition requires you to cite works you base your article on.",
+	"If you use programs that use GNU Parallel to process data for an article in a",
+	"scientific publication, please cite:",
+	"",
+	"\@software{tange_2022_7347980,",
+	"      author       = {Tange, Ole},",
+	"      title        = {GNU Parallel 20221122 ('Херсо́н')},",
+	"      month        = Nov,",
+	"      year         = 2022,",
+	"      note         = {{GNU Parallel is a general parallelizer to run",
+	"                       multiple serial command line programs in parallel",
+	"                       without changing them.}},",
+	"      publisher    = {Zenodo},",
+	"      doi          = {10.5281/zenodo.7347980},",
+	"      url          = {https://doi.org/10.5281/zenodo.7347980}",
+	"}",
+	"",
+	"(Feel free to use \\nocite{tange_2022_7347980})",
+	"",
+	# Before changing these lines, please read
+	# https://www.gnu.org/software/parallel/parallel_design.html#citation-notice and
+	# https://git.savannah.gnu.org/cgit/parallel.git/tree/doc/citation-notice-faq.txt
+	# You accept to be put in a public hall of shame by removing
+	# these lines.
+	"This helps funding further development; AND IT WON'T COST YOU A CENT.",
+	"If you pay 10000 EUR you should feel free to use GNU Parallel without citing.",
+	"",
+	"More about funding GNU Parallel and the citation notice:",
+	"https://lists.gnu.org/archive/html/parallel/2013-11/msg00006.html",
+	"https://www.gnu.org/software/parallel/parallel_design.html#citation-notice",
+	"https://git.savannah.gnu.org/cgit/parallel.git/tree/doc/citation-notice-faq.txt",
+	"",
+	"If you send a copy of your published article to tange\@gnu.org, it will be",
+	"mentioned in the release notes of next version of GNU Parallel.",
+	""
+	);
+    while(not grep { -e "$_/will-cite" } @Global::config_dirs) {
+	print "\nType: 'will cite' and press enter.\n> ";
+	my $input = <STDIN>;
+	if(not defined $input) {
+	    exit(255);
+	}
+	if($input =~ /will cite/i) {
+	    mkdir $Global::config_dir;
+	    if(open (my $fh, ">", $Global::config_dir."/will-cite")) {
+		close $fh;
+		::status(
+		    "",
+		    "Thank you for your support: You are the reason why there is funding to",
+		    "continue maintaining GNU Parallel. On behalf of future versions of",
+		    "GNU Parallel, which would not exist without your support:",
+		    "",
+		    "  THANK YOU SO MUCH",
+		    "",
+		    "It is really appreciated. The citation notice is now silenced.",
+		    "");
+	    } else {
+		::status(
+		      "",
+		      "Thank you for your support. It is much appreciated. The citation",
+		      "cannot permanently be silenced. Use '--will-cite' instead.",
+		      "",
+		      "If you use '--will-cite' in scripts to be run by others you are making",
+		      "it harder for others to see the citation notice.  The development of",
+		      "GNU Parallel is indirectly financed through citations, so if users",
+		      "do not know they should cite then you are making it harder to finance",
+		      "development. However, if you pay 10000 EUR, you should feel free to",
+		      "use '--will-cite' in scripts.",
+		      "");
+		last;
+	    }
+	}
+    }
+}
+
+sub show_limits() {
+    # Returns: N/A
+    print("Maximal size of command: ",Limits::Command::real_max_length(),"\n",
+	  "Maximal usable size of command: ",
+	  $Global::usable_command_line_length,"\n",
+	  "\n",
+	  "Execution will continue now, ",
+	  "and it will try to read its input\n",
+	  "and run commands; if this is not ",
+	  "what you wanted to happen, please\n",
+	  "press CTRL-D or CTRL-C\n");
+}
+
+sub embed() {
+    # Give an embeddable version of GNU	 Parallel
+    # Tested with: bash, zsh, ksh, ash, dash, sh
+    my $randomstring = "cut-here-".join"",
+	map { (0..9,"a".."z","A".."Z")[rand(62)] } (1..20);
+    if(not -f $0 or not -r $0) {
+	::error("--embed only works if parallel is a readable file");
+	exit(255);
+    }
+    if(open(my $fh, "<", $0)) {
+	# Read the source from $0
+	my @source = <$fh>;
+	my $user = $ENV{LOGNAME} || $ENV{USERNAME} || $ENV{USER};
+	my @env_parallel_source = ();
+	my $shell = $Global::shell;
+	$shell =~ s:.*/::;
+	for(which("env_parallel.$shell")) {
+	    -r $_ or next;
+	    # Read the source of env_parallel.shellname
+	    open(my $env_parallel_source_fh, $_) || die;
+	    @env_parallel_source = <$env_parallel_source_fh>;
+	    close $env_parallel_source_fh;
+	    last;
+	}
+	print "#!$Global::shell
+
+# Copyright (C) 2007-2022 $user, Ole Tange, http://ole.tange.dk
+# and Free Software Foundation, Inc.
+#
+# This program is free software; you can redistribute it and/or modify
+# it under the terms of the GNU General Public License as published by
+# the Free Software Foundation; either version 3 of the License, or
+# (at your option) any later version.
+#
+# This program is distributed in the hope that it will be useful, but
+# WITHOUT ANY WARRANTY; without even the implied warranty of
+# MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the GNU
+# General Public License for more details.
+#
+# You should have received a copy of the GNU General Public License
+# along with this program; if not, see <https://www.gnu.org/licenses/>
+# or write to the Free Software Foundation, Inc., 51 Franklin St,
+# Fifth Floor, Boston, MA 02110-1301 USA
+";
+
+	print q!
+# Embedded GNU Parallel created with --embed
+parallel() {
+    # Start GNU	 Parallel without leaving temporary files
+    #
+    # Not all shells support 'perl <(cat ...)'
+    # This is a complex way of doing:
+    #	perl <(cat <<'cut-here'
+    #	  [...]
+    #	  ) "$@"
+    # and also avoiding:
+    #	[1]+  Done   cat
+
+    # Make a temporary fifo that perl can read from
+    _fifo_with_GNU_Parallel_source=`perl -e 'use POSIX qw(mkfifo);
+      do {
+	$f = "/tmp/parallel-".join"",
+	  map { (0..9,"a".."z","A".."Z")[rand(62)] } (1..5);
+      } while(-e $f);
+      mkfifo($f,0600);
+      print $f;'`
+    # Put source code into temporary file
+    # so it is easy to copy to the fifo
+    _file_with_GNU_Parallel_source=`mktemp`;
+!,
+	"cat <<'$randomstring' > \$_file_with_GNU_Parallel_source\n",
+	@source,
+	$randomstring,"\n",
+	q!
+    # Copy the source code from the file to the fifo
+    # and remove the file and fifo ASAP
+    # 'sh -c' is needed to avoid
+    #	[1]+  Done   cat
+    sh -c "(rm $_file_with_GNU_Parallel_source; cat >$_fifo_with_GNU_Parallel_source; rm $_fifo_with_GNU_Parallel_source) < $_file_with_GNU_Parallel_source &"
+
+    # Read the source from the fifo
+    perl $_fifo_with_GNU_Parallel_source "$@"
+}
+!,
+	@env_parallel_source,
+	q!
+
+# This will call the functions above
+parallel -k echo ::: Put your code here
+env_parallel --session
+env_parallel -k echo ::: Put your code here
+parset p,y,c,h -k echo ::: Put your code here
+echo $p $y $c $h
+echo You can also activate GNU Parallel for interactive use by:
+echo . "$0"
+!;
+    } else {
+	::error("Cannot open $0");
+	exit(255);
+    }
+    ::status("Redirect the output to a file and add your changes at the end:",
+	"  $0 --embed > new_script");
+}
+
+
+sub __GENERIC_COMMON_FUNCTION__() {}
+
+
+sub mkdir_or_die($) {
+    # If dir is not executable: die
+    my $dir = shift;
+    # The eval is needed to catch exception from mkdir
+    eval { File::Path::mkpath($dir); };
+    if(not -x $dir) {
+	::error("Cannot change into non-executable dir $dir: $!");
+	::wait_and_exit(255);
+    }
+}
+
+sub tmpfile(@) {
+    # Create tempfile as $TMPDIR/parXXXXX
+    # Returns:
+    #	$filehandle = opened file handle
+    #	$filename = file name created
+    my($filehandle,$filename) =
+	::tempfile(DIR=>$ENV{'TMPDIR'}, TEMPLATE => 'parXXXXX', @_);
+    if(wantarray) {
+	return($filehandle,$filename);
+    } else {
+	# Separate unlink due to NFS dealing badly with File::Temp
+	unlink $filename;
+	return $filehandle;
+    }
+}
+
+sub tmpname($) {
+    # Select a name that does not exist
+    # Do not create the file as it may be used for creating a socket (by tmux)
+    # Remember the name in $Global::unlink to avoid hitting the same name twice
+    my $name = shift;
+    my($tmpname);
+    if(not -w $ENV{'TMPDIR'}) {
+	if(not -e $ENV{'TMPDIR'}) {
+	    ::error("Tmpdir '$ENV{'TMPDIR'}' does not exist.","Try 'mkdir $ENV{'TMPDIR'}'");
+	} else {
+	    ::error("Tmpdir '$ENV{'TMPDIR'}' is not writable.","Try 'chmod +w $ENV{'TMPDIR'}'");
+	}
+	::wait_and_exit(255);
+    }
+    do {
+	$tmpname = $ENV{'TMPDIR'}."/".$name.
+	    join"", map { (0..9,"a".."z","A".."Z")[rand(62)] } (1..5);
+    } while(-e $tmpname or $Global::unlink{$tmpname}++);
+    return $tmpname;
+}
+
+sub tmpfifo() {
+    # Find an unused name and mkfifo on it
+    my $tmpfifo = tmpname("fif");
+    mkfifo($tmpfifo,0600);
+    return $tmpfifo;
+}
+
+sub rm(@) {
+    # Remove file and remove it from %Global::unlink
+    # Uses:
+    #	%Global::unlink
+    delete @Global::unlink{@_};
+    unlink @_;
+}
+
+sub size_of_block_dev() {
+    # Like -s but for block devices
+    # Input:
+    #	$blockdev = file name of block device
+    # Returns:
+    #	$size = in bytes, undef if error
+    my $blockdev = shift;
+    if(open(my $fh, "<", $blockdev)) {
+	seek($fh,0,2) || ::die_bug("cannot seek $blockdev");
+	my $size = tell($fh);
+	close $fh;
+	return $size;
+    } else {
+	::error("cannot open $blockdev");
+	wait_and_exit(255);
+    }
+}
+
+sub qqx(@) {
+    # Like qx but with clean environment (except for @keep)
+    # and STDERR ignored
+    # This is needed if the environment contains functions
+    # that /bin/sh does not understand
+    my %env;
+    # ssh with ssh-agent needs PATH SSH_AUTH_SOCK SSH_AGENT_PID
+    # ssh with Kerberos needs KRB5CCNAME
+    # sshpass needs SSHPASS
+    # tmux needs LC_CTYPE
+    # lsh needs HOME LOGNAME
+    my @keep = qw(PATH SSH_AUTH_SOCK SSH_AGENT_PID KRB5CCNAME LC_CTYPE
+		  HOME LOGNAME SSHPASS);
+    @env{@keep} = @ENV{@keep};
+    local %ENV;
+    %ENV = %env;
+    if($Global::debug) {
+	# && true is to force spawning a shell and not just exec'ing
+	return qx{ @_ && true };
+    } else {
+	# CygWin does not respect 2>/dev/null
+	# so we do that by hand
+	# This trick does not work:
+	# https://stackoverflow.com/q/13833088/363028
+	# local *STDERR;
+	# open(STDERR, ">", "/dev/null");
+	open(local *CHILD_STDIN,  '<', '/dev/null') or die $!;
+	open(local *CHILD_STDERR, '>', '/dev/null') or die $!;
+	my $out;
+	# eval is needed if open3 fails (e.g. command line too long)
+	eval {
+	    my $pid = open3(
+		'<&CHILD_STDIN',
+		$out,
+		'>&CHILD_STDERR',
+		# && true is to force spawning a shell and not just exec'ing
+		"@_ && true");
+	    my @arr = <$out>;
+	    close $out;
+	    # Make sure $? is set
+	    waitpid($pid, 0);
+	    return wantarray ? @arr : join "",@arr;
+	} or do {
+	    # If eval fails, force $?=false
+	    `false`;
+	};
+    }
+}
+
+sub uniq(@) {
+    # Remove duplicates and return unique values
+    return keys %{{ map { $_ => 1 } @_ }};
+}
+
+sub min(@) {
+    # Returns:
+    #	Minimum value of array
+    my $min;
+    for (@_) {
+	# Skip undefs
+	defined $_ or next;
+	defined $min or do { $min = $_; next; }; # Set $_ to the first non-undef
+	$min = ($min < $_) ? $min : $_;
+    }
+    return $min;
+}
+
+sub max(@) {
+    # Returns:
+    #	Maximum value of array
+    my $max;
+    for (@_) {
+	# Skip undefs
+	defined $_ or next;
+	defined $max or do { $max = $_; next; }; # Set $_ to the first non-undef
+	$max = ($max > $_) ? $max : $_;
+    }
+    return $max;
+}
+
+sub sum(@) {
+    # Returns:
+    #	Sum of values of array
+    my @args = @_;
+    my $sum = 0;
+    for (@args) {
+	# Skip undefs
+	$_ and do { $sum += $_; }
+    }
+    return $sum;
+}
+
+sub undef_as_zero($) {
+    my $a = shift;
+    return $a ? $a : 0;
+}
+
+sub undef_as_empty($) {
+    my $a = shift;
+    return $a ? $a : "";
+}
+
+sub undef_if_empty($) {
+    if(defined($_[0]) and $_[0] eq "") {
+	return undef;
+    }
+    return $_[0];
+}
+
+sub multiply_binary_prefix(@) {
+    # Evalualte numbers with binary prefix
+    # Ki=2^10, Mi=2^20, Gi=2^30, Ti=2^40, Pi=2^50, Ei=2^70, Zi=2^80, Yi=2^80
+    # ki=2^10, mi=2^20, gi=2^30, ti=2^40, pi=2^50, ei=2^70, zi=2^80, yi=2^80
+    # K =2^10, M =2^20, G =2^30, T =2^40, P =2^50, E =2^70, Z =2^80, Y =2^80
+    # k =10^3, m =10^6, g =10^9, t=10^12, p=10^15, e=10^18, z=10^21, y=10^24
+    # 13G = 13*1024*1024*1024 = 13958643712
+    # Input:
+    #	$s = string with prefixes
+    # Returns:
+    #	$value = int with prefixes multiplied
+    my @v = @_;
+    for(@v) {
+	defined $_ or next;
+	s/ki/*1024/gi;
+	s/mi/*1024*1024/gi;
+	s/gi/*1024*1024*1024/gi;
+	s/ti/*1024*1024*1024*1024/gi;
+	s/pi/*1024*1024*1024*1024*1024/gi;
+	s/ei/*1024*1024*1024*1024*1024*1024/gi;
+	s/zi/*1024*1024*1024*1024*1024*1024*1024/gi;
+	s/yi/*1024*1024*1024*1024*1024*1024*1024*1024/gi;
+	s/xi/*1024*1024*1024*1024*1024*1024*1024*1024*1024/gi;
+
+	s/K/*1024/g;
+	s/M/*1024*1024/g;
+	s/G/*1024*1024*1024/g;
+	s/T/*1024*1024*1024*1024/g;
+	s/P/*1024*1024*1024*1024*1024/g;
+	s/E/*1024*1024*1024*1024*1024*1024/g;
+	s/Z/*1024*1024*1024*1024*1024*1024*1024/g;
+	s/Y/*1024*1024*1024*1024*1024*1024*1024*1024/g;
+	s/X/*1024*1024*1024*1024*1024*1024*1024*1024*1024/g;
+
+	s/k/*1000/g;
+	s/m/*1000*1000/g;
+	s/g/*1000*1000*1000/g;
+	s/t/*1000*1000*1000*1000/g;
+	s/p/*1000*1000*1000*1000*1000/g;
+	s/e/*1000*1000*1000*1000*1000*1000/g;
+	s/z/*1000*1000*1000*1000*1000*1000*1000/g;
+	s/y/*1000*1000*1000*1000*1000*1000*1000*1000/g;
+	s/x/*1000*1000*1000*1000*1000*1000*1000*1000*1000/g;
+
+	$_ = eval $_;
+    }
+    return wantarray ? @v : $v[0];
+}
+
+sub multiply_time_units($) {
+    # Evalualte numbers with time units
+    # s=1, m=60, h=3600, d=86400
+    # Input:
+    #	$s = string time units
+    # Returns:
+    #	$value = int in seconds
+    my @v = @_;
+    for(@v) {
+	defined $_ or next;
+	if(/[dhms]/i) {
+	    s/s/*1+/gi;
+	    s/m/*60+/gi;
+	    s/h/*3600+/gi;
+	    s/d/*86400+/gi;
+	    # 1m/3 => 1*60+/3 => 1*60/3
+	    s/\+(\D)/$1/gi;
+	}
+	$_ = eval $_."-0";
+    }
+    return wantarray ? @v : $v[0];
+}
+
+sub seconds_to_time_units() {
+    # Convert seconds into ??d??h??m??s
+    # s=1, m=60, h=3600, d=86400
+    # Input:
+    #	$s = int in seconds
+    # Returns:
+    #	$str = string time units
+    my $s = shift;
+    my $str;
+    my $d = int($s/86400);
+    $s -= $d * 86400;
+    my $h = int($s/3600);
+    $s -= $h * 3600;
+    my $m = int($s/60);
+    $s -= $m * 60;
+    if($d) {
+	$str = sprintf("%dd%02dh%02dm%02ds",$d,$h,$m,$s);
+    } elsif($h) {
+	$str = sprintf("%dh%02dm%02ds",$h,$m,$s);
+    } elsif($m) {
+	$str = sprintf("%dm%02ds",$m,$s);
+    } else {
+	$str = sprintf("%ds",$s);
+    }
+    return $str;
+}
+
+{
+    my ($disk_full_fh, $b8193, $error_printed);
+    sub exit_if_disk_full() {
+	# Checks if $TMPDIR is full by writing 8kb to a tmpfile
+	# If the disk is full: Exit immediately.
+	# Returns:
+	#   N/A
+	if(not $disk_full_fh) {
+	    $disk_full_fh = ::tmpfile(SUFFIX => ".df");
+	    $b8193 = "b"x8193;
+	}
+	# Linux does not discover if a disk is full if writing <= 8192
+	# Tested on:
+	# bfs btrfs cramfs ext2 ext3 ext4 ext4dev jffs2 jfs minix msdos
+	# ntfs reiserfs tmpfs ubifs vfat xfs
+	# TODO this should be tested on different OS similar to this:
+	#
+	# doit() {
+	#   sudo mount /dev/ram0 /mnt/loop; sudo chmod 1777 /mnt/loop
+	#   seq 100000 | parallel --tmpdir /mnt/loop/ true &
+	#   seq 6900000 > /mnt/loop/i && echo seq OK
+	#   seq 6980868 > /mnt/loop/i
+	#   seq 10000 > /mnt/loop/ii
+	#   sleep 3
+	#   sudo umount /mnt/loop/ || sudo umount -l /mnt/loop/
+	#   echo >&2
+	# }
+	print $disk_full_fh $b8193;
+	if(not $disk_full_fh
+	   or
+	   tell $disk_full_fh != 8193) {
+	    # On raspbian the disk can be full except for 10 chars.
+	    if(not $error_printed) {
+		::error("Output is incomplete.",
+			"Cannot append to buffer file in $ENV{'TMPDIR'}.",
+			"Is the disk full?",
+			"Change \$TMPDIR with --tmpdir or use --compress.");
+		$error_printed = 1;
+	    }
+	    ::wait_and_exit(255);
+	}
+	truncate $disk_full_fh, 0;
+	seek($disk_full_fh, 0, 0) || die;
+    }
+}
+
+sub spacefree($$) {
+    # Remove comments and spaces
+    # Inputs:
+    #	$spaces = keep 1 space?
+    #	$s = string to remove spaces from
+    # Returns:
+    #	$s = with spaces removed
+    my $spaces = shift;
+    my $s = shift;
+    $s =~ s/#.*//mg;
+    if(1 == $spaces) {
+	$s =~ s/\s+/ /mg;
+    } elsif(2 == $spaces) {
+	# Keep newlines
+	$s =~ s/\n\n+/\n/sg;
+	$s =~ s/[ \t]+/ /mg;
+    } elsif(3 == $spaces) {
+	# Keep perl code required space
+	$s =~ s{([^a-zA-Z0-9/])\s+}{$1}sg;
+	$s =~ s{([a-zA-Z0-9/])\s+([^:a-zA-Z0-9/])}{$1$2}sg;
+    } else {
+	$s =~ s/\s//mg;
+    }
+    return $s;
+}
+
+{
+    my $hostname;
+    sub hostname() {
+	local $/ = "\n";
+	if(not $hostname) {
+	    $hostname = `hostname`;
+	    chomp($hostname);
+	    $hostname ||= "nohostname";
+	}
+	return $hostname;
+    }
+}
+
+sub which(@) {
+    # Input:
+    #	@programs = programs to find the path to
+    # Returns:
+    #	@full_path = full paths to @programs. Nothing if not found
+    my @which;
+    for my $prg (@_) {
+	push(@which, grep { not -d $_ and -x $_ }
+	     map { $_."/".$prg } split(":",$ENV{'PATH'}));
+	if($prg =~ m:/:) {
+	    # Test if program with full path exists
+	    push(@which, grep { not -d $_ and -x $_ } $prg);
+	}
+    }
+    ::debug("which", "$which[0] in $ENV{'PATH'}\n");
+    return wantarray ? @which : $which[0];
+}
+
+{
+    my ($regexp,$shell,%fakename);
+
+    sub parent_shell {
+	# Input:
+	#   $pid = pid to see if (grand)*parent is a shell
+	# Returns:
+	#   $shellpath = path to shell - undef if no shell found
+	my $pid = shift;
+	::debug("init","Parent of $pid\n");
+	if(not $regexp) {
+	    # All shells known to mankind
+	    #
+	    # ash bash csh dash fdsh fish fizsh ksh ksh93 mksh pdksh
+	    # posh rbash rc rush rzsh sash sh static-sh tcsh yash zsh
+
+	    my @shells = (qw(ash bash bsd-csh csh dash fdsh fish fizsh ksh
+			  ksh93 lksh mksh pdksh posh rbash rc rush rzsh sash sh
+			  static-sh tcsh yash zsh -sh -csh -bash),
+			  '-sh (sh)' # sh on FreeBSD
+		);
+	    # Can be formatted as:
+	    #	[sh]  -sh  sh  busybox sh  -sh (sh)
+	    #	/bin/sh /sbin/sh /opt/csw/sh
+	    # But not: foo.sh sshd crash flush pdflush scosh fsflush ssh
+	    $shell = "(?:".join("|",map { "\Q$_\E" } @shells).")";
+	    $regexp = '^((\[)(-?)('. $shell. ')(\])|(|\S+/|busybox )'.
+		'(-?)('. $shell. '))( *$| [^(])';
+	    %fakename = (
+		# sh disguises itself as -sh (sh) on FreeBSD
+		"-sh (sh)" => ["sh"],
+		# csh and tcsh disguise themselves as -sh/-csh
+		# E.g.: ssh -tt csh@lo 'ps aux;true' |egrep ^csh
+		# but sh also disguises itself as -sh
+		# (TODO When does that happen?)
+		"-sh" => ["sh"],
+		"-csh" => ["tcsh", "csh"],
+		# ash disguises itself as -ash
+		"-ash" => ["ash", "dash", "sh"],
+		# dash disguises itself as -dash
+		"-dash" => ["dash", "ash", "sh"],
+		# bash disguises itself as -bash
+		"-bash" => ["bash", "sh"],
+		# ksh disguises itself as -ksh
+		"-ksh" => ["ksh", "sh"],
+		# zsh disguises itself as -zsh
+		"-zsh" => ["zsh", "sh"],
+		);
+	}
+	if($^O eq "linux") {
+	    # Optimized for GNU/Linux
+	    my $testpid = $pid;
+	    my $shellpath;
+	    my $shellline;
+	    while($testpid) {
+		if(open(my $fd, "<", "/proc/$testpid/cmdline")) {
+		    local $/="\0";
+		    chomp($shellline = <$fd>);
+		    if($shellline =~ /$regexp/o) {
+			my $shellname = $4 || $8;
+			my $dash = $3 || $7;
+			if($shellname eq "sh" and $dash) {
+			    # -sh => csh or sh
+			    if($shellpath = readlink "/proc/$testpid/exe") {
+				::debug("init","procpath $shellpath\n");
+				if($shellpath =~ m:/$shell$:o) {
+				    ::debug("init",
+					    "proc which ".$shellpath." => ");
+				    return $shellpath;
+				}
+			    }
+			}
+			::debug("init", "which ".$shellname." => ");
+			$shellpath = (which($shellname,
+					    @{$fakename{$shellname}}))[0];
+			::debug("init", "shell path $shellpath\n");
+			return $shellpath;
+		    }
+		}
+		# Get parent pid
+		if(open(my $fd, "<", "/proc/$testpid/stat")) {
+		    my $line = <$fd>;
+		    close $fd;
+		    # Parent pid is field 4
+		    $testpid = (split /\s+/, $line)[3];
+		} else {
+		    # Something is wrong: fall back to old method
+		    last;
+		}
+	    }
+	}
+	# if -sh or -csh try readlink /proc/$$/exe
+	my ($children_of_ref, $parent_of_ref, $name_of_ref) = pid_table();
+	my $shellpath;
+	my $testpid = $pid;
+	while($testpid) {
+	    if($name_of_ref->{$testpid} =~ /$regexp/o) {
+		my $shellname = $4 || $8;
+		my $dash = $3 || $7;
+		if($shellname eq "sh" and $dash) {
+		    # -sh => csh or sh
+		    if($shellpath = readlink "/proc/$testpid/exe") {
+			::debug("init","procpath $shellpath\n");
+			if($shellpath =~ m:/$shell$:o) {
+			    ::debug("init", "proc which ".$shellpath." => ");
+			    return $shellpath;
+			}
+		    }
+		}
+		::debug("init", "which ".$shellname." => ");
+		$shellpath = (which($shellname,@{$fakename{$shellname}}))[0];
+		::debug("init", "shell path $shellpath\n");
+		$shellpath and last;
+	    }
+	    if($testpid == $parent_of_ref->{$testpid}) {
+		# In Solaris zones, the PPID of the zsched process is itself
+		last;
+	    }
+	    $testpid = $parent_of_ref->{$testpid};
+	}
+	return $shellpath;
+    }
+}
+
+{
+    my %pid_parentpid_cmd;
+
+    sub pid_table() {
+	# Returns:
+	#   %children_of = { pid -> children of pid }
+	#   %parent_of = { pid -> pid of parent }
+	#   %name_of = { pid -> commandname }
+
+	if(not %pid_parentpid_cmd) {
+	    # Filter for SysV-style `ps`
+	    my $sysv = q( ps -ef |).
+		q(perl -ane '1..1 and /^(.*)CO?MM?A?N?D/ and $s=length $1;).
+		q(s/^.{$s}//; print "@F[1,2] $_"' );
+	    # Minix uses cols 2,3 and can have newlines in the command
+	    # so lines not having numbers in cols 2,3 must be ignored
+	    my $minix = q( ps -ef |).
+		q(perl -ane '1..1 and /^(.*)CO?MM?A?N?D/ and $s=length $1;).
+		q(s/^.{$s}// and $F[2]>0 and $F[3]>0 and print "@F[2,3] $_"' );
+	    # BSD-style `ps`
+	    my $bsd = q(ps -o pid,ppid,command -ax);
+	    %pid_parentpid_cmd =
+	    (
+	     'aix' => $sysv,
+	     'android' => $sysv,
+	     'cygwin' => $sysv,
+	     'darwin' => $bsd,
+	     'dec_osf' => $sysv,
+	     'dragonfly' => $bsd,
+	     'freebsd' => $bsd,
+	     'gnu' => $sysv,
+	     'hpux' => $sysv,
+	     'linux' => $sysv,
+	     'mirbsd' => $bsd,
+	     'minix' => $minix,
+	     'msys' => $sysv,
+	     'MSWin32' => $sysv,
+	     'netbsd' => $bsd,
+	     'nto' => $sysv,
+	     'openbsd' => $bsd,
+	     'solaris' => $sysv,
+	     'svr5' => $sysv,
+	     'syllable' => "echo ps not supported",
+	    );
+	}
+	$pid_parentpid_cmd{$^O} or
+	    ::die_bug("pid_parentpid_cmd for $^O missing");
+
+	my (@pidtable,%parent_of,%children_of,%name_of);
+	# Table with pid -> children of pid
+	@pidtable = `$pid_parentpid_cmd{$^O}`;
+	my $p=$$;
+	for (@pidtable) {
+	    # must match: 24436 21224 busybox ash
+	    # must match: 24436 21224 <<empty on MacOSX running cubase>>
+	    # must match: 24436 21224 <<empty on system running Viber>>
+	    #	or: perl -e 'while($0=" "){}'
+	    if(/^\s*(\S+)\s+(\S+)\s+(\S+.*)/
+	       or
+	       /^\s*(\S+)\s+(\S+)\s+()$/) {
+		$parent_of{$1} = $2;
+		push @{$children_of{$2}}, $1;
+		$name_of{$1} = $3;
+	    } else {
+		::die_bug("pidtable format: $_");
+	    }
+	}
+	return(\%children_of, \%parent_of, \%name_of);
+    }
+}
+
+sub now() {
+    # Returns time since epoch as in seconds with 3 decimals
+    # Uses:
+    #	@Global::use
+    # Returns:
+    #	$time = time now with millisecond accuracy
+    if(not $Global::use{"Time::HiRes"}) {
+	if(eval "use Time::HiRes qw ( time );") {
+	    eval "sub TimeHiRestime { return Time::HiRes::time };";
+	} else {
+	    eval "sub TimeHiRestime { return time() };";
+	}
+	$Global::use{"Time::HiRes"} = 1;
+    }
+
+    return (int(TimeHiRestime()*1000))/1000;
+}
+
+sub usleep($) {
+    # Sleep this many milliseconds.
+    # Input:
+    #	$ms = milliseconds to sleep
+    my $ms = shift;
+    ::debug("timing",int($ms),"ms ");
+    select(undef, undef, undef, $ms/1000);
+}
+
+sub make_regexp_ungreedy {
+    my $regexp = shift;
+    my $class_state = 0;
+    my $escape_state = 0;
+    my $found = 0;
+    my $ungreedy = "";
+    my $c;
+
+    for $c (split (//, $regexp)) {
+	if ($found) {
+	    if($c ne "?") { $ungreedy .= "?"; }
+	    $found = 0;
+	}
+	$ungreedy .= $c;
+
+	if ($escape_state) { $escape_state = 0; next; }
+	if ($c eq "\\") { $escape_state = 1; next; }
+	if ($c eq '[') { $class_state  = 1; next; }
+	if ($class_state) {
+	    if($c eq ']') { $class_state = 0; }
+	    next;
+	}
+	# Quantifiers: + * {...}
+	if ($c =~ /[*}+]/) { $found = 1; }
+    }
+    if($found) { $ungreedy .= '?'; }
+    return $ungreedy;
+}
+
+
+sub __KILLER_REAPER__() {}
+
+sub reap_usleep() {
+    # Reap dead children.
+    # If no dead children: Sleep specified amount with exponential backoff
+    # Input:
+    #	$ms = milliseconds to sleep
+    # Returns:
+    #	$ms/2+0.001 if children reaped
+    #	$ms*1.1 if no children reaped
+    my $ms = shift;
+    if(reapers()) {
+	if(not $Global::total_completed % 100) {
+	    if($opt::timeout) {
+		# Force cleaning the timeout queue for every 100 jobs
+		# Fixes potential memleak
+		$Global::timeoutq->process_timeouts();
+	    }
+	}
+	# Sleep exponentially shorter (1/2^n) if a job finished
+	return $ms/2+0.001;
+    } else {
+	if($opt::timeout) {
+	    $Global::timeoutq->process_timeouts();
+	}
+	if($opt::memfree) {
+	    kill_youngster_if_not_enough_mem($opt::memfree*0.5);
+	}
+	if($opt::memsuspend) {
+	    suspend_young_if_not_enough_mem($opt::memsuspend);
+	}
+	if($opt::limit) {
+	    kill_youngest_if_over_limit();
+	}
+	exit_if_disk_full();
+	if($Global::linebuffer) {
+	    my $something_printed = 0;
+	    if($opt::keeporder and not $opt::latestline) {
+		for my $job (values %Global::running) {
+		    $something_printed += $job->print_earlier_jobs();
+		}
+	    } else {
+		for my $job (values %Global::running) {
+		    $something_printed += $job->print();
+		}
+	    }
+	    if($something_printed) { $ms = $ms/2+0.001; }
+	}
+	if($ms > 0.002) {
+	    # When a child dies, wake up from sleep (or select(,,,))
+	    $SIG{CHLD} = sub { kill "ALRM", $$ };
+	    if($opt::delay and not $Global::linebuffer) {
+		# The 0.004s is approximately the time it takes for one round
+		my $next_earliest_start =
+		    $Global::newest_starttime + $opt::delay - 0.004;
+		my $remaining_ms = 1000 * ($next_earliest_start - ::now());
+		# The next job can only start at $next_earliest_start
+		# so sleep until then (but sleep at least $ms)
+		usleep(::max($ms,$remaining_ms));
+	    } else {
+		usleep($ms);
+	    }
+	    # --compress needs $SIG{CHLD} unset
+	    $SIG{CHLD} = 'DEFAULT';
+	}
+	# Sleep exponentially longer (1.1^n) if a job did not finish,
+	# though at most 1000 ms.
+	return (($ms < 1000) ? ($ms * 1.1) : ($ms));
+    }
+}
+
+sub kill_youngest_if_over_limit() {
+    # Check each $sshlogin we are over limit
+    # If over limit: kill off the youngest child
+    # Put the child back in the queue.
+    # Uses:
+    #	%Global::running
+    my %jobs_of;
+    my @sshlogins;
+
+    for my $job (values %Global::running) {
+	if(not $jobs_of{$job->sshlogin()}) {
+	    push @sshlogins, $job->sshlogin();
+	}
+	push @{$jobs_of{$job->sshlogin()}}, $job;
+    }
+    for my $sshlogin (@sshlogins) {
+	for my $job (sort { $b->seq() <=> $a->seq() }
+		     @{$jobs_of{$sshlogin}}) {
+	    if($sshlogin->limit() == 2) {
+		$job->kill();
+		last;
+	    }
+	}
+    }
+}
+
+sub suspend_young_if_not_enough_mem() {
+    # Check each $sshlogin if there is enough mem.
+    # If less than $limit free mem: suspend some of the young children
+    # Else: Resume all jobs
+    # Uses:
+    #	%Global::running
+    my $limit = shift;
+    my %jobs_of;
+    my @sshlogins;
+
+    for my $job (values %Global::running) {
+	if(not $jobs_of{$job->sshlogin()}) {
+	    push @sshlogins, $job->sshlogin();
+	}
+	push @{$jobs_of{$job->sshlogin()}}, $job;
+    }
+    for my $sshlogin (@sshlogins) {
+	my $free = $sshlogin->memfree();
+	if($free < 2*$limit) {
+	    # Suspend all jobs (resume some of them later)
+	    map { $_->suspended() or $_->suspend(); } @{$jobs_of{$sshlogin}};
+	    my @jobs = (sort { $b->seq() <=> $a->seq() }
+			@{$jobs_of{$sshlogin}});
+	    # how many should be running?
+	    # limit*1 => 1;
+	    # limit*1.5 => 2;
+	    # limit*1.75 => 4;
+	    # free < limit*(2-1/2^n);
+	    # =>
+	    # 1/(2-free/limit) < 2^n;
+	    my $run = int(1/(2-$free/$limit));
+	    $run = ::min($run,$#jobs);
+	    # Resume the oldest running
+	    for my $job ((sort { $a->seq() <=> $b->seq() } @jobs)[0..$run]) {
+		::debug("mem","\nResume ",$run+1, " jobs. Seq ",
+			$job->seq(), " resumed ",
+			$sshlogin->memfree()," < ",2*$limit);
+		$job->resume();
+	    }
+	} else {
+	    for my $job (@{$jobs_of{$sshlogin}}) {
+		if($job->suspended()) {
+		    $job->resume();
+		    ::debug("mem","\nResume ",$#{$jobs_of{$sshlogin}}+1,
+			    " jobs. Seq ", $job->seq(), " resumed ",
+			    $sshlogin->memfree()," > ",2*$limit);
+		    last;
+		}
+	    }
+	}
+    }
+}
+
+sub kill_youngster_if_not_enough_mem() {
+    # Check each $sshlogin if there is enough mem.
+    # If less than 50% enough free mem: kill off the youngest child
+    # Put the child back in the queue.
+    # Uses:
+    #	%Global::running
+    my $limit = shift;
+    my %jobs_of;
+    my @sshlogins;
+
+    for my $job (values %Global::running) {
+	if(not $jobs_of{$job->sshlogin()}) {
+	    push @sshlogins, $job->sshlogin();
+	}
+	push @{$jobs_of{$job->sshlogin()}}, $job;
+    }
+    for my $sshlogin (@sshlogins) {
+	for my $job (sort { $b->seq() <=> $a->seq() }
+		     @{$jobs_of{$sshlogin}}) {
+	    if($sshlogin->memfree() < $limit) {
+		::debug("mem","\n",map { $_->seq()." " }
+			(sort { $b->seq() <=> $a->seq() }
+			 @{$jobs_of{$sshlogin}}));
+		::debug("mem","\n", $job->seq(), "killed ",
+			$sshlogin->memfree()," < ",$limit);
+		$job->kill();
+		$sshlogin->memfree_recompute();
+	    } else {
+		last;
+	    }
+	}
+	::debug("mem","Free mem OK? ",
+		$sshlogin->memfree()," > ",$limit);
+    }
+}
+
+
+sub __DEBUGGING__() {}
+
+
+sub debug(@) {
+    # Uses:
+    #	$Global::debug
+    #	%Global::fh
+    # Returns: N/A
+    $Global::debug or return;
+    @_ = grep { defined $_ ? $_ : "" } @_;
+    if($Global::debug eq "all" or $Global::debug eq $_[0]) {
+	if($Global::fh{2}) {
+	    # Original stderr was saved
+	    my $stderr = $Global::fh{2};
+	    print $stderr @_[1..$#_];
+	} else {
+	    print STDERR @_[1..$#_];
+	}
+    }
+}
+
+sub my_memory_usage() {
+    # Returns:
+    #	memory usage if found
+    #	0 otherwise
+    use strict;
+    use FileHandle;
+
+    local $/ = "\n";
+    my $pid = $$;
+    if(-e "/proc/$pid/stat") {
+	my $fh = FileHandle->new("</proc/$pid/stat");
+
+	my $data = <$fh>;
+	chomp $data;
+	$fh->close;
+
+	my @procinfo = split(/\s+/,$data);
+
+	return undef_as_zero($procinfo[22]);
+    } else {
+	return 0;
+    }
+}
+
+sub my_size() {
+    # Returns:
+    #	$size = size of object if Devel::Size is installed
+    #	-1 otherwise
+    my @size_this = (@_);
+    eval "use Devel::Size qw(size total_size)";
+    if ($@) {
+	return -1;
+    } else {
+	return total_size(@_);
+    }
+}
+
+sub my_dump(@) {
+    # Returns:
+    #	ascii expression of object if Data::Dump(er) is installed
+    #	error code otherwise
+    my @dump_this = (@_);
+    eval "use Data::Dump qw(dump);";
+    if ($@) {
+	# Data::Dump not installed
+	eval "use Data::Dumper;";
+	if ($@) {
+	    my $err =  "Neither Data::Dump nor Data::Dumper is installed\n".
+		"Not dumping output\n";
+	    ::status($err);
+	    return $err;
+	} else {
+	    return Dumper(@dump_this);
+	}
+    } else {
+	# Create a dummy Data::Dump:dump as Hans Schou sometimes has
+	# it undefined
+	eval "sub Data::Dump:dump {}";
+	eval "use Data::Dump qw(dump);";
+	return (Data::Dump::dump(@dump_this));
+    }
+}
+
+sub my_croak(@) {
+    eval "use Carp; 1";
+    $Carp::Verbose = 1;
+    croak(@_);
+}
+
+sub my_carp() {
+    eval "use Carp; 1";
+    $Carp::Verbose = 1;
+    carp(@_);
+}
+
+
+sub __OBJECT_ORIENTED_PARTS__() {}
+
+
+package SSHLogin;
+
+sub new($$) {
+    my $class = shift;
+    my $s = shift;
+    my $origs = $s;
+    my %hostgroups;
+    my $ncpus;
+    my $sshcommand;
+    my $user;
+    my $password;
+    my $host;
+    my $port;
+    my $local;
+    my $string;
+    # SSHLogins can have these formats:
+    #	@grp+grp/ncpu//usr/bin/ssh user@server
+    #	ncpu//usr/bin/ssh user@server
+    #	/usr/bin/ssh user@server
+    #	user@server
+    #	ncpu/user@server
+    #	@grp+grp/user@server
+    #	above with: user:password@server
+    #	above with: user@server:port
+    # So:
+    #	[@grp+grp][ncpu/][ssh command ][[user][:password]@][server[:port]]
+
+    #	[@grp+grp]/ncpu//usr/bin/ssh user:pass@server:port
+    if($s =~ s:^\@([^/]+)/?::) {
+	# Look for SSHLogin hostgroups
+	%hostgroups = map { $_ => 1 } split(/\+/, $1);
+    }
+    # An SSHLogin is always in the hostgroup of its "numcpu/host"
+    $hostgroups{$s} = 1;
+
+    #	[ncpu/]/usr/bin/ssh user:pass@server:port
+    if ($s =~ s:^(\d+)/::) { $ncpus = $1; }
+
+    #	[/usr/bin/ssh ]user:pass@server:port
+    if($s =~ s/^(.*) //) { $sshcommand = $1; }
+
+    #	[user:pass@]server:port
+    if($s =~ s/^([^@]+)@//) {
+	my $userpw = $1;
+	# user[:pass]
+	if($userpw =~ s/:(.*)//) {
+	    $password = $1;
+	    if($password eq "") { $password = $ENV{'SSHPASS'} }
+	    if(not ::which("sshpass")) {
+		::error("--sshlogin with password requires sshpass installed");
+		::wait_and_exit(255);
+	    }
+	}
+	$user = $userpw;
+    }
+    #	[server]:port
+    if(not $s =~ /:.*:/
+       and
+       $s =~ s/^([-a-z0-9._]+)//i) {
+	# Not IPv6 (IPv6 has 2 or more ':')
+	$host = $1;
+    } elsif($s =~ s/^(\\[\[\]box0-9a-f.]+)//i) {
+	# RFC2673 allows for:
+	#   \[b11010000011101] \[o64072/14] \[xd074/14] \[208.116.0.0/14]
+	$host = $1;
+    } elsif($s =~ s/^\[([0-9a-f:]+)\]//i
+	    or
+	    $s =~ s/^([0-9a-f:]+)//i) {
+	# RFC5952
+	#   [2001:db8::1]:80
+	#   2001:db8::1.80
+	#   2001:db8::1p80
+	#   2001:db8::1#80
+	#   2001:db8::1:80 - not supported
+	#   2001:db8::1 port 80 - not supported
+	$host = $1;
+    }
+
+    #	[:port]
+    if($s =~ s/^:(\w+)//i) {
+	$port = $1;
+    } elsif($s =~ s/^[p\.\#](\w+)//i) {
+	# RFC5952
+	#   2001:db8::1.80
+	#   2001:db8::1p80
+	#   2001:db8::1#80
+	$port = $1;
+    }
+
+    if($s and $s ne ':') {
+	::die_bug("SSHLogin parser failed on '$origs' => '$s'");
+    }
+
+    $string =
+	# Only include the sshcommand in $string if it is set by user
+	($sshcommand && $sshcommand." ").
+	($user && $user."@").
+	($host && $host).
+	($port && ":$port");
+    if($host eq ':') {
+	$local = 1;
+	$string = ":";
+    } else {
+	$sshcommand ||= $opt::ssh || $ENV{'PARALLEL_SSH'} || "ssh";
+    }
+    # An SSHLogin is always in the hostgroup of its $string-name
+    $hostgroups{$string} = 1;
+    @Global::hostgroups{keys %hostgroups} = values %hostgroups;
+    # Used for file names for loadavg
+    my $no_slash_string = $string;
+    $no_slash_string =~ s/[^-a-z0-9:]/_/gi;
+    return bless {
+	'string' => $string,
+	    'jobs_running' => 0,
+	    'jobs_completed' => 0,
+	    'maxlength' => undef,
+	    'max_jobs_running' => undef,
+	    'orig_max_jobs_running' => undef,
+	    'ncpus' => $ncpus,
+	    'sshcommand' => $sshcommand,
+	    'user' => $user,
+	    'password' => $password,
+	    'host' => $host,
+	    'port' => $port,
+	    'hostgroups' => \%hostgroups,
+	    'local' => $local,
+	    'control_path_dir' => undef,
+	    'control_path' => undef,
+	    'time_to_login' => undef,
+	    'last_login_at' => undef,
+	    'loadavg_file' => $Global::cache_dir . "/tmp/sshlogin/" .
+	    $no_slash_string . "/loadavg",
+	    'loadavg' => undef,
+	    'last_loadavg_update' => 0,
+	    'swap_activity_file' => $Global::cache_dir . "/tmp/sshlogin/" .
+	    $no_slash_string . "/swap_activity",
+	    'swap_activity' => undef,
+    }, ref($class) || $class;
+}
+
+sub DESTROY($) {
+    my $self = shift;
+    # Remove temporary files if they are created.
+    ::rm($self->{'loadavg_file'});
+    ::rm($self->{'swap_activity_file'});
+}
+
+sub string($) {
+    my $self = shift;
+    return $self->{'string'};
+}
+
+sub host($) {
+    my $self = shift;
+    return $self->{'host'};
+}
+
+sub sshcmd($) {
+    # Give the ssh command without hostname
+    # Returns:
+    #	"sshpass -e ssh -p port -l user"
+    my $self = shift;
+    my @local;
+    # [sshpass -e] ssh -p port -l user
+    if($self->{'password'}) { push @local, "sshpass -e"; }
+    # [ssh] -p port -l user
+    push @local, $self->{'sshcommand'};
+    # [-p port] -l user
+    if($self->{'port'}) { push @local, '-p',$self->{'port'}; }
+    # [-l user]
+    if($self->{'user'}) { push @local, '-l',$self->{'user'}; }
+    if($opt::controlmaster) {
+	# Use control_path to make ssh faster
+	my $control_path = $self->control_path_dir()."/ssh-%r@%h:%p";
+	push @local, "-S", $control_path;
+	if(not $self->{'control_path'}{$control_path}++) {
+	    # Master is not running for this control_path
+	    # Start it
+	    my $pid = fork();
+	    if($pid) {
+		$Global::sshmaster{$pid} ||= 1;
+	    } else {
+		$SIG{'TERM'} = undef;
+		# Run a sleep that outputs data, so it will discover
+		# if the ssh connection closes.
+		my $sleep = ::Q('$|=1;while(1){sleep 1;print "foo\n"}');
+		# Ignore the 'foo' being printed
+		open(STDOUT,">","/dev/null");
+		# STDERR >/dev/null to ignore
+		open(STDERR,">","/dev/null");
+		open(STDIN,"<","/dev/null");
+		exec(@local, "-MT", $self->{'host'}, "--",
+		     "perl", "-e", $sleep);
+	    }
+	}
+    }
+
+    return "@local";
+}
+
+sub wrap($@) {
+    # Input:
+    #	@cmd = shell command to run on remote
+    # Returns:
+    #	$sshwrapped = ssh remote @cmd
+    my $self = shift;
+    my @remote = @_;
+    return(join " ",
+	   $self->sshcmd(), $self->{'host'}, "--", "exec", @remote);
+}
+
+sub hexwrap($@) {
+    # Input:
+    #	@cmd = perl expresion to eval
+    # Returns:
+    #	$hexencoded = perl command that decodes hex and evals @cmd
+    my $self = shift;
+    my $cmd = join("",@_);
+
+    # "#" is needed because Perl on MacOS X adds NULs
+    # when running pack q/H10000000/
+    my $hex = unpack "H*", $cmd."#";
+    # csh does not deal well with > 1000 chars in one word
+    # Insert space every 1000 char
+    $hex =~ s/\G.{1000}\K/ /sg;
+    # Explanation:
+    # Write this without special chars: eval pack 'H*', join '',@ARGV
+    # GNU_Parallel_worker = String so people can see this is from GNU Parallel
+    # eval+	     = way to write 'eval ' without space (gives warning)
+    # pack+	     = way to write 'pack ' without space
+    # q/H10000000/,  = almost the same as "H*" but does not use *
+    # join+q//,	     = join '',
+    return('perl -X -e '.
+	   'GNU_Parallel_worker,eval+pack+q/H10000000/,join+q//,@ARGV '.
+	   $hex);
+}
+
+sub jobs_running($) {
+    my $self = shift;
+    return ($self->{'jobs_running'} || "0");
+}
+
+sub inc_jobs_running($) {
+    my $self = shift;
+    $self->{'jobs_running'}++;
+}
+
+sub dec_jobs_running($) {
+    my $self = shift;
+    $self->{'jobs_running'}--;
+}
+
+sub set_maxlength($$) {
+    my $self = shift;
+    $self->{'maxlength'} = shift;
+}
+
+sub maxlength($) {
+    my $self = shift;
+    return $self->{'maxlength'};
+}
+
+sub jobs_completed() {
+    my $self = shift;
+    return $self->{'jobs_completed'};
+}
+
+sub in_hostgroups() {
+    # Input:
+    #	@hostgroups = the hostgroups to look for
+    # Returns:
+    #	true if intersection of @hostgroups and the hostgroups of this
+    #	     SSHLogin is non-empty
+    my $self = shift;
+    return grep { defined $self->{'hostgroups'}{$_} } @_;
+}
+
+sub hostgroups() {
+    my $self = shift;
+    return keys %{$self->{'hostgroups'}};
+}
+
+sub inc_jobs_completed($) {
+    my $self = shift;
+    $self->{'jobs_completed'}++;
+    $Global::total_completed++;
+}
+
+sub set_max_jobs_running($$) {
+    my $self = shift;
+    if(defined $self->{'max_jobs_running'}) {
+	$Global::max_jobs_running -= $self->{'max_jobs_running'};
+    }
+    $self->{'max_jobs_running'} = shift;
+
+    if(defined $self->{'max_jobs_running'}) {
+	# max_jobs_running could be resat if -j is a changed file
+	$Global::max_jobs_running += $self->{'max_jobs_running'};
+    }
+    # Initialize orig to the first non-zero value that comes around
+    $self->{'orig_max_jobs_running'} ||= $self->{'max_jobs_running'};
+}
+
+sub memfree() {
+    # Returns:
+    #	$memfree in bytes
+    my $self = shift;
+    $self->memfree_recompute();
+    # Return 1 if not defined.
+    return (not defined $self->{'memfree'} or $self->{'memfree'})
+}
+
+sub memfree_recompute() {
+    my $self = shift;
+    my $script = memfreescript();
+
+    # TODO add sshlogin and backgrounding
+    # Run the script twice if it gives 0 (typically intermittent error)
+    $self->{'memfree'} = ::qqx($script) || ::qqx($script);
+    if(not $self->{'memfree'}) {
+	::die_bug("Less than 1 byte memory free");
+    }
+    #::debug("mem","New free:",$self->{'memfree'}," ");
+}
+
+{
+    my $script;
+
+    sub memfreescript() {
+	# Returns:
+	#   shellscript for giving available memory in bytes
+	if(not $script) {
+	    my %script_of = (
+		# /proc/meminfo
+		# MemFree:	    7012 kB
+		# Buffers:	   19876 kB
+		# Cached:	  431192 kB
+		# SwapCached:	       0 kB
+		"linux" => (
+		    q{
+			print 1024 * qx{
+			awk '/^((Swap)?Cached|MemFree|Buffers):/
+			{ sum += \$2} END { print sum }'
+			    /proc/meminfo }
+		    }),
+		# Android uses same code as GNU/Linux
+		"android" => (
+		    q{
+			print 1024 * qx{
+			awk '/^((Swap)?Cached|MemFree|Buffers):/
+			{ sum += \$2} END { print sum }'
+			    /proc/meminfo }
+		    }),
+		# $ vmstat 1 1
+		#   procs	  memory	 page			faults	     cpu
+		# r  b	w    avm    free re at	pi po  fr de  sr   in	sy  cs	us sy id
+		# 1  0	0 242793  389737  5  1	 0  0	0  0   0  107  978  60	 1  1 99
+		"hpux" => (
+		    q{
+			print (((reverse `vmstat 1 1`)[0]
+			    =~ /(?:\d+\D+){4}(\d+)/)[0]*1024)
+		    }),
+		# $ vmstat 1 2
+		# kthr	    memory	      page	      disk	    faults	cpu
+		# r b w	  swap	free  re  mf pi po fr de sr s3 s4 -- --	  in   sy   cs us sy id
+		# 0 0 0 6496720 5170320 68 260 8 2  1  0  0 -0	3  0  0	 309 1371  255	1  2 97
+		# 0 0 0 6434088 5072656	 7  15 8 0  0  0  0  0 261 0  0 1889 1899 3222	0  8 92
+		#
+		# The second free value is correct
+		"solaris" => (
+		    q{
+			print (((reverse `vmstat 1 2`)[0]
+				=~ /(?:\d+\D+){4}(\d+)/)[0]*1024)
+		    }),
+		# hw.pagesize: 4096
+		# vm.stats.vm.v_cache_count: 0
+		# vm.stats.vm.v_inactive_count: 79574
+		# vm.stats.vm.v_free_count: 4507
+		"freebsd" => (
+		    q{
+			for(qx{/sbin/sysctl -a}) {
+			    if (/^([^:]+):\s+(.+)\s*$/s) {
+				$sysctl->{$1} = $2;
+			    }
+			}
+			print $sysctl->{"hw.pagesize"} *
+			    ($sysctl->{"vm.stats.vm.v_cache_count"}
+			     + $sysctl->{"vm.stats.vm.v_inactive_count"}
+			     + $sysctl->{"vm.stats.vm.v_free_count"});
+		    }),
+		# Mach Virtual Memory Statistics: (page size of 4096 bytes)
+		# Pages free:			      198061.
+		# Pages active:			      159701.
+		# Pages inactive:		       47378.
+		# Pages speculative:		       29707.
+		# Pages wired down:		       89231.
+		# "Translation faults":		   928901425.
+		# Pages copy-on-write:		   156988239.
+		# Pages zero filled:		   271267894.
+		# Pages reactivated:		       48895.
+		# Pageins:			     1798068.
+		# Pageouts:				 257.
+		# Object cache: 6603 hits of 1713223 lookups (0% hit rate)
+		'darwin' => (
+		    q{
+			$vm = `vm_stat`;
+			print (($vm =~ /page size of (\d+)/)[0] *
+			       (($vm =~ /Pages free:\s+(\d+)/)[0] +
+				($vm =~ /Pages inactive:\s+(\d+)/)[0]));
+		    }),
+		);
+	    my $perlscript = "";
+	    # Make a perl script that detects the OS ($^O) and runs
+	    # the appropriate command
+	    for my $os (keys %script_of) {
+		$perlscript .= 'if($^O eq "'.$os.'") { '.$script_of{$os}.'}';
+	    }
+	    $script = "perl -e " . ::Q(::spacefree(1,$perlscript));
+	}
+	return $script;
+    }
+}
+
+sub limit($) {
+    # Returns:
+    #  0 = Below limit. Start another job.
+    #  1 = Over limit. Start no jobs.
+    #  2 = Kill youngest job
+    my $self = shift;
+
+    if(not defined $self->{'limitscript'}) {
+	my %limitscripts =
+	    ("io" => q!
+	     io() {
+		 limit=$1;
+		 io_file=$2;
+		 # Do the measurement in the background
+		 ((tmp=$(tempfile);
+		 LANG=C iostat -x 1 2 > $tmp;
+		 mv $tmp $io_file) </dev/null >/dev/null & );
+		 perl -e '-e $ARGV[0] or exit(1);
+		   for(reverse <>) {
+		     /Device/ and last;
+		     /(\S+)$/ and $max = $max > $1 ? $max : $1; }
+		   exit ('$limit' < $max)' $io_file;
+	     };
+	     io %s %s
+	     !,
+	     "mem" => q!
+	     mem() {
+		 limit=$1;
+		 awk '/^((Swap)?Cached|MemFree|Buffers):/{ sum += $2}
+		      END {
+			 if (sum*1024 < '$limit'/2) { exit 2; }
+			 else { exit (sum*1024 < '$limit') }
+		      }' /proc/meminfo;
+	     };
+	     mem %s;
+	     !,
+	     "load" => q!
+	     load() {
+		 limit=$1;
+		 ps ax -o state,command |
+		     grep -E '^[DOR].[^[]' |
+		     wc -l |
+		 perl -ne 'exit ('$limit' < $_)';
+	     };
+	     load %s
+	     !,
+	    );
+	my ($cmd,@args) = split /\s+/,$opt::limit;
+	if($limitscripts{$cmd}) {
+	    my $tmpfile = ::tmpname("parlmt");
+	    ++$Global::unlink{$tmpfile};
+	    $self->{'limitscript'} =
+	    ::spacefree(1, sprintf($limitscripts{$cmd},
+				   ::multiply_binary_prefix(@args),$tmpfile));
+	} else {
+	    $self->{'limitscript'} = $opt::limit;
+	}
+    }
+
+    my %env = %ENV;
+    local %ENV = %env;
+    $ENV{'SSHLOGIN'} = $self->string();
+    system($Global::shell,"-c",$self->{'limitscript'});
+    #::qqx($self->{'limitscript'});
+    ::debug("limit","limit `".$self->{'limitscript'}."` result ".($?>>8)."\n");
+    return $?>>8;
+}
+
+
+sub swapping($) {
+    my $self = shift;
+    my $swapping = $self->swap_activity();
+    return (not defined $swapping or $swapping)
+}
+
+sub swap_activity($) {
+    # If the currently known swap activity is too old:
+    #	Recompute a new one in the background
+    # Returns:
+    #	last swap activity computed
+    my $self = shift;
+    # Should we update the swap_activity file?
+    my $update_swap_activity_file = 0;
+    # Test with (on 64 core machine):
+    # seq 100 | parallel --lb -j100 'seq 1000 | parallel  --noswap -j 1 true'
+    if(open(my $swap_fh, "<", $self->{'swap_activity_file'})) {
+	my $swap_out = <$swap_fh>;
+	close $swap_fh;
+	if($swap_out =~ /^(\d+)$/) {
+	    $self->{'swap_activity'} = $1;
+	    ::debug("swap", "New swap_activity: ", $self->{'swap_activity'});
+	}
+	::debug("swap", "Last update: ", $self->{'last_swap_activity_update'});
+	if(time - $self->{'last_swap_activity_update'} > 10) {
+	    # last swap activity update was started 10 seconds ago
+	    ::debug("swap", "Older than 10 sec: ", $self->{'swap_activity_file'});
+	    $update_swap_activity_file = 1;
+	}
+    } else {
+	::debug("swap", "No swap_activity file: ", $self->{'swap_activity_file'});
+	$self->{'swap_activity'} = undef;
+	$update_swap_activity_file = 1;
+    }
+    if($update_swap_activity_file) {
+	::debug("swap", "Updating swap_activity file ", $self->{'swap_activity_file'});
+	$self->{'last_swap_activity_update'} = time;
+	my $dir = ::dirname($self->{'swap_activity_file'});
+	-d $dir or eval { File::Path::mkpath($dir); };
+	my $swap_activity;
+	$swap_activity = swapactivityscript();
+	if(not $self->local()) {
+	    $swap_activity = $self->wrap($swap_activity);
+	}
+	# Run swap_activity measuring.
+	# As the command can take long to run if run remote
+	# save it to a tmp file before moving it to the correct file
+	my $file = $self->{'swap_activity_file'};
+	my ($dummy_fh, $tmpfile) = ::tmpfile(SUFFIX => ".swp");
+	::debug("swap", "\n", $swap_activity, "\n");
+	::qqx("($swap_activity > $tmpfile && mv $tmpfile $file || rm $tmpfile &)");
+    }
+    return $self->{'swap_activity'};
+}
+
+{
+    my $script;
+
+    sub swapactivityscript() {
+	# Returns:
+	#   shellscript for detecting swap activity
+	#
+	# arguments for vmstat are OS dependant
+	# swap_in and swap_out are in different columns depending on OS
+	#
+	if(not $script) {
+	    my %vmstat = (
+		# linux: $7*$8
+		# $ vmstat 1 2
+		# procs -----------memory---------- ---swap-- -----io---- -system-- ----cpu----
+		#  r  b	  swpd	 free	buff  cache   si   so	 bi    bo   in	 cs us sy id wa
+		#  5  0	 51208 1701096 198012 18857888	  0    0    37	 153   28   19 56 11 33	 1
+		#  3  0	 51208 1701288 198012 18857972	  0    0     0	   0 3638 10412 15  3 82  0
+		'linux' => ['vmstat 1 2 | tail -n1', '$7*$8'],
+
+		# solaris: $6*$7
+		# $ vmstat -S 1 2
+		#  kthr	     memory	       page	       disk	     faults	 cpu
+		#  r b w   swap	 free  si  so pi po fr de sr s3 s4 -- --   in	sy   cs us sy id
+		#  0 0 0 4628952 3208408 0  0  3  1  1	0  0 -0	 2  0  0  263  613  246	 1  2 97
+		#  0 0 0 4552504 3166360 0  0  0  0  0	0  0  0	 0  0  0  246  213  240	 1  1 98
+		'solaris' => ['vmstat -S 1 2 | tail -1', '$6*$7'],
+
+		# darwin (macosx): $21*$22
+		# $ vm_stat -c 2 1
+		# Mach Virtual Memory Statistics: (page size of 4096 bytes)
+		#     free   active   specul inactive throttle	  wired	 prgable   faults     copy    0fill reactive   purged file-backed anonymous cmprssed cmprssor  dcomprs	 comprs	 pageins  pageout  swapins swapouts
+		#   346306   829050    74871   606027	     0	 240231	   90367  544858K 62343596  270837K    14178   415070	   570102    939846	 356	  370	   116	    922	 4019813	4	 0	  0
+		#   345740   830383    74875   606031	     0	 239234	   90369     2696      359	553	   0	    0	   570110    941179	 356	  370	     0	      0	       0	0	 0	  0
+		'darwin' => ['vm_stat -c 2 1 | tail -n1', '$21*$22'],
+
+		# ultrix: $12*$13
+		# $ vmstat -S 1 2
+		#  procs      faults	cpu	 memory		     page	      disk
+		#  r b w   in  sy  cs us sy id	avm  fre  si so	 pi  po	 fr  de	 sr s0
+		#  1 0 0    4  23   2  3  0 97 7743 217k   0  0	  0   0	  0   0	  0  0
+		#  1 0 0    6  40   8  0  1 99 7743 217k   0  0	  3   0	  0   0	  0  0
+		'ultrix' => ['vmstat -S 1 2 | tail -1', '$12*$13'],
+
+		# aix: $6*$7
+		# $ vmstat 1 2
+		# System configuration: lcpu=1 mem=2048MB
+		#
+		# kthr	  memory	      page		faults	      cpu
+		# ----- ----------- ------------------------ ------------ -----------
+		#  r  b	  avm	fre  re	 pi  po	 fr   sr  cy  in   sy  cs us sy id wa
+		#  0  0 333933 241803	0   0	0   0	 0   0	10  143	 90  0	0 99  0
+		#  0  0 334125 241569	0   0	0   0	 0   0	37 5368 184  0	9 86  5
+		'aix' => ['vmstat 1 2 | tail -n1', '$6*$7'],
+
+		# freebsd: $8*$9
+		# $ vmstat -H 1 2
+		#  procs      memory	  page			  disks	    faults	   cpu
+		#  r b w     avm    fre	  flt  re  pi  po    fr	 sr ad0 ad1   in   sy	cs us sy id
+		#  1 0 0  596716   19560    32	 0   0	 0    33   8   0   0   11  220	277  0	0 99
+		#  0 0 0  596716   19560     2	 0   0	 0     0   0   0   0   11  144	263  0	1 99
+		'freebsd' => ['vmstat -H 1 2 | tail -n1', '$8*$9'],
+
+		# mirbsd: $8*$9
+		# $ vmstat 1 2
+		#  procs   memory	 page			 disks	   traps	 cpu
+		#  r b w    avm	   fre	 flt  re  pi  po  fr  sr wd0 cd0  int	sys   cs us sy id
+		#  0 0 0  25776 164968	  34   0   0   0   0   0   0   0  230	259   38  4  0 96
+		#  0 0 0  25776 164968	  24   0   0   0   0   0   0   0  237	275   37  0  0 100
+		'mirbsd' => ['vmstat 1 2 | tail -n1', '$8*$9'],
+
+		# netbsd: $7*$8
+		# $ vmstat 1 2
+		#  procs    memory	page			   disks   faults      cpu
+		#  r b	    avm	   fre	flt  re	 pi   po   fr	sr w0 w1   in	sy  cs us sy id
+		#  0 0	 138452	  6012	 54   0	  0    0    1	 2  3  0    4  100  23	0  0 100
+		#  0 0	 138456	  6008	  1   0	  0    0    0	 0  0  0    7	26  19	0 0 100
+		'netbsd' => ['vmstat 1 2 | tail -n1', '$7*$8'],
+
+		# openbsd: $8*$9
+		# $ vmstat 1 2
+		#  procs    memory	 page			 disks	  traps		 cpu
+		#  r b w    avm	    fre	 flt  re  pi  po  fr  sr wd0 wd1  int	sys   cs us sy id
+		#  0 0 0  76596	 109944	  73   0   0   0   0   0   0   1    5	259   22  0  1 99
+		#  0 0 0  76604	 109936	  24   0   0   0   0   0   0   0    7	114   20  0  1 99
+		'openbsd' => ['vmstat 1 2 | tail -n1', '$8*$9'],
+
+		# hpux: $8*$9
+		# $ vmstat 1 2
+		#	   procs	   memory		    page			      faults	   cpu
+		#     r	    b	  w	 avm	free   re   at	  pi   po    fr	  de	sr     in     sy    cs	us sy id
+		#     1	    0	  0   247211  216476	4    1	   0	0     0	   0	 0    102  73005    54	 6 11 83
+		#     1	    0	  0   247211  216421   43    9	   0	0     0	   0	 0    144   1675    96	25269512791222387000 25269512791222387000 105
+		'hpux' => ['vmstat 1 2 | tail -n1', '$8*$9'],
+
+		# dec_osf (tru64): $11*$12
+		# $ vmstat  1 2
+		# Virtual Memory Statistics: (pagesize = 8192)
+		#   procs      memory	     pages			      intr	 cpu
+		#   r	w   u  act free wire fault  cow zero react  pin pout  in  sy  cs us sy id
+		#   3 181  36  51K 1895 8696  348M  59M 122M   259  79M	   0   5 218 302  4  1 94
+		#   3 181  36  51K 1893 8696	 3   15	  21	 0   28	   0   4  81 321  1  1 98
+		'dec_osf' => ['vmstat 1 2 | tail -n1', '$11*$12'],
+
+		# gnu (hurd): $7*$8
+		# $ vmstat -k 1 2
+		# (pagesize: 4, size: 512288, swap size: 894972)
+		#   free   actv	 inact	wired	zeroed	react	 pgins	 pgouts	 pfaults  cowpfs hrat	 caobj	cache swfree
+		# 371940  30844	 89228	20276	298348	    0	 48192	  19016	  756105   99808  98%	   876	20628 894972
+		# 371940  30844	 89228	20276	    +0	   +0	    +0	     +0	     +42      +2  98%	   876	20628 894972
+		'gnu' => ['vmstat -k 1 2 | tail -n1', '$7*$8'],
+
+		# -nto (qnx has no swap)
+		#-irix
+		#-svr5 (scosysv)
+		);
+	    my $perlscript = "";
+	    # Make a perl script that detects the OS ($^O) and runs
+	    # the appropriate vmstat command
+	    for my $os (keys %vmstat) {
+		$vmstat{$os}[1] =~ s/\$/\\\\\\\$/g; # $ => \\\$
+		$perlscript .= 'if($^O eq "'.$os.'") { print `'.$vmstat{$os}[0].' | awk "{print ' .
+		    $vmstat{$os}[1] . '}"` }';
+	    }
+	    $script = "perl -e " . ::Q($perlscript);
+	}
+	return $script;
+    }
+}
+
+sub too_fast_remote_login($) {
+    my $self = shift;
+    if($self->{'last_login_at'} and $self->{'time_to_login'}) {
+	# sshd normally allows 10 simultaneous logins
+	# A login takes time_to_login
+	# So time_to_login/5 should be safe
+	# If now <= last_login + time_to_login/5: Then it is too soon.
+	my $too_fast = (::now() <= $self->{'last_login_at'}
+			+ $self->{'time_to_login'}/5);
+	::debug("run", "Too fast? $too_fast ");
+	return $too_fast;
+    } else {
+	# No logins so far (or time_to_login not computed): it is not too fast
+	return 0;
+    }
+}
+
+sub last_login_at($) {
+    my $self = shift;
+    return $self->{'last_login_at'};
+}
+
+sub set_last_login_at($$) {
+    my $self = shift;
+    $self->{'last_login_at'} = shift;
+}
+
+sub loadavg_too_high($) {
+    my $self = shift;
+    my $loadavg = $self->loadavg();
+    if(defined $loadavg) {
+	::debug("load", "Load $loadavg > ",$self->max_loadavg());
+	return $loadavg >= $self->max_loadavg();
+    } else {
+	# Unknown load: Assume load is too high
+	return 1;
+    }
+}
+
+
+
+sub loadavg($) {
+    # If the currently know loadavg is too old:
+    #	Recompute a new one in the background
+    # The load average is computed as the number of processes waiting
+    # for disk or CPU right now. So it is the server load this instant
+    # and not averaged over several minutes. This is needed so GNU
+    # Parallel will at most start one job that will push the load over
+    # the limit.
+    #
+    # Returns:
+    #	$last_loadavg = last load average computed (undef if none)
+
+    my $self = shift;
+    sub loadavg_cmd() {
+	if(not $Global::loadavg_cmd) {
+	    # aix => "ps -ae -o state,command" # state wrong
+	    # bsd => "ps ax -o state,command"
+	    # sysv => "ps -ef -o s -o comm"
+	    # cygwin => perl -ne 'close STDERR; /Name/ and print"\n"; \
+	    #	 /(Name|Pid|Ppid|State):\s+(\S+)/ and print "$2\t";' /proc/*/status |
+	    #	 awk '{print $2,$1}'
+	    # dec_osf => bsd
+	    # dragonfly => bsd
+	    # freebsd => bsd
+	    # gnu => bsd
+	    # hpux => ps -el|awk '{print $2,$14,$15}'
+	    # irix => ps -ef -o state -o comm
+	    # linux => bsd
+	    # minix => ps el|awk '{print \$1,\$11}'
+	    # mirbsd => bsd
+	    # netbsd => bsd
+	    # openbsd => bsd
+	    # solaris => sysv
+	    # svr5 => sysv
+	    # ultrix => ps -ax | awk '{print $3,$5}'
+	    # unixware => ps -el|awk '{print $2,$14,$15}'
+	    my $ps = ::spacefree(1,q{
+		$sysv="ps -ef -o s -o comm";
+		$sysv2="ps -ef -o state -o comm";
+		$bsd="ps ax -o state,command";
+		# Treat threads as processes
+		$bsd2="ps axH -o state,command";
+		$psel="ps -el|awk '{ print \$2,\$14,\$15 }'";
+		$cygwin=q{ perl -ne 'close STDERR; /Name/ and print"\n";
+		    /(Name|Pid|Ppid|State):\s+(\S+)/ and print "$2\t";' /proc/*/status |
+		    awk '{print $2,$1}' };
+		$dummy="echo S COMMAND;echo R dummy";
+		%ps=(
+		    # TODO Find better code for AIX/Android
+		    'aix' => "uptime",
+		    'android' => "uptime",
+		    'cygwin' => $cygwin,
+		    'darwin' => $bsd,
+		    'dec_osf' => $sysv2,
+		    'dragonfly' => $bsd,
+		    'freebsd' => $bsd2,
+		    'gnu' => $bsd,
+		    'hpux' => $psel,
+		    'irix' => $sysv2,
+		    'linux' => $bsd2,
+		    'minix' => "ps el|awk '{print \$1,\$11}'",
+		    'mirbsd' => $bsd,
+		    'msys' => $cygwin,
+		    'netbsd' => $bsd,
+		    'nto' => $dummy,
+		    'openbsd' => $bsd,
+		    'solaris' => $sysv,
+		    'svr5' => $psel,
+		    'ultrix' => "ps -ax | awk '{print \$3,\$5}'",
+		    'MSWin32' => $sysv,
+		    );
+		print `$ps{$^O}`;
+	    });
+	    # The command is too long for csh, so base64_wrap the command
+	    $Global::loadavg_cmd = $self->hexwrap($ps);
+	}
+	return $Global::loadavg_cmd;
+    }
+    # Should we update the loadavg file?
+    my $update_loadavg_file = 0;
+    if(open(my $load_fh, "<", $self->{'loadavg_file'})) {
+	local $/; # $/ = undef => slurp whole file
+	my $load_out = <$load_fh>;
+	close $load_fh;
+	if($load_out =~ /\S/) {
+	    # Content can be empty if ~/ is on NFS
+	    # due to reading being non-atomic.
+	    #
+	    # Count lines starting with D,O,R but command does not start with [
+	    my $load =()= ($load_out=~/(^\s?[DOR]\S* +(?=[^\[])\S)/gm);
+	    if($load > 0) {
+		# load is overestimated by 1
+		$self->{'loadavg'} = $load - 1;
+		::debug("load", "New loadavg: ", $self->{'loadavg'},"\n");
+	    } elsif ($load_out=~/average: (\d+.\d+)/) {
+		# AIX does not support instant load average
+		# 04:11AM   up 21 days,	 12:55,	 1 user,  load average: 1.85, 1.57, 1.55
+		$self->{'loadavg'} = $1;
+	    } else {
+		::die_bug("loadavg_invalid_content: " .
+			  $self->{'loadavg_file'} . "\n$load_out");
+	    }
+	}
+	$update_loadavg_file = 1;
+    } else {
+	::debug("load", "No loadavg file: ", $self->{'loadavg_file'});
+	$self->{'loadavg'} = undef;
+	$update_loadavg_file = 1;
+    }
+    if($update_loadavg_file) {
+	::debug("load", "Updating loadavg file", $self->{'loadavg_file'}, "\n");
+	$self->{'last_loadavg_update'} = time;
+	my $dir = ::dirname($self->{'swap_activity_file'});
+	-d $dir or eval { File::Path::mkpath($dir); };
+	-w $dir or ::die_bug("Cannot write to $dir");
+	my $cmd = "";
+	if($self->{'string'} ne ":") {
+	    $cmd = $self->wrap(loadavg_cmd());
+	} else {
+	    $cmd .= loadavg_cmd();
+	}
+	# As the command can take long to run if run remote
+	# save it to a tmp file before moving it to the correct file
+	::debug("load", "Update load\n");
+	my $file = $self->{'loadavg_file'};
+	# tmpfile on same filesystem as $file
+	my $tmpfile = $file.$$;
+	$ENV{'SSHPASS'} = $self->{'password'};
+	::qqx("($cmd > $tmpfile && mv $tmpfile $file || rm $tmpfile & )");
+    }
+    return $self->{'loadavg'};
+}
+
+sub max_loadavg($) {
+    my $self = shift;
+    # If --load is a file it might be changed
+    if($Global::max_load_file) {
+	my $mtime = (stat($Global::max_load_file))[9];
+	if($mtime > $Global::max_load_file_last_mod) {
+	    $Global::max_load_file_last_mod = $mtime;
+	    for my $sshlogin (values %Global::host) {
+		$sshlogin->set_max_loadavg(undef);
+	    }
+	}
+    }
+    if(not defined $self->{'max_loadavg'}) {
+	$self->{'max_loadavg'} =
+	    $self->compute_max_loadavg($opt::load);
+    }
+    ::debug("load", "max_loadavg: ", $self->string(), " ", $self->{'max_loadavg'});
+    return $self->{'max_loadavg'};
+}
+
+sub set_max_loadavg($$) {
+    my $self = shift;
+    $self->{'max_loadavg'} = shift;
+}
+
+sub compute_max_loadavg($) {
+    # Parse the max loadaverage that the user asked for using --load
+    # Returns:
+    #	max loadaverage
+    my $self = shift;
+    my $loadspec = shift;
+    my $load;
+    if(defined $loadspec) {
+	if($loadspec =~ /^\+(\d+)$/) {
+	    # E.g. --load +2
+	    my $j = $1;
+	    $load =
+		$self->ncpus() + $j;
+	} elsif ($loadspec =~ /^-(\d+)$/) {
+	    # E.g. --load -2
+	    my $j = $1;
+	    $load =
+		$self->ncpus() - $j;
+	} elsif ($loadspec =~ /^(\d+)\%$/) {
+	    my $j = $1;
+	    $load =
+		$self->ncpus() * $j / 100;
+	} elsif ($loadspec =~ /^(\d+(\.\d+)?)$/) {
+	    $load = $1;
+	} elsif (-f $loadspec) {
+	    $Global::max_load_file = $loadspec;
+	    $Global::max_load_file_last_mod = (stat($Global::max_load_file))[9];
+	    if(open(my $in_fh, "<", $Global::max_load_file)) {
+		my $opt_load_file = join("",<$in_fh>);
+		close $in_fh;
+		$load = $self->compute_max_loadavg($opt_load_file);
+	    } else {
+		::error("Cannot open $loadspec.");
+		::wait_and_exit(255);
+	    }
+	} else {
+	    ::error("Parsing of --load failed.");
+	    ::die_usage();
+	}
+	if($load < 0.01) {
+	    $load = 0.01;
+	}
+    }
+    return $load;
+}
+
+sub time_to_login($) {
+    my $self = shift;
+    return $self->{'time_to_login'};
+}
+
+sub set_time_to_login($$) {
+    my $self = shift;
+    $self->{'time_to_login'} = shift;
+}
+
+sub max_jobs_running($) {
+    my $self = shift;
+    if(not defined $self->{'max_jobs_running'}) {
+	my $nproc = $self->compute_number_of_processes($opt::jobs);
+	$self->set_max_jobs_running($nproc);
+    }
+    return $self->{'max_jobs_running'};
+}
+
+sub orig_max_jobs_running($) {
+    my $self = shift;
+    return $self->{'orig_max_jobs_running'};
+}
+
+sub compute_number_of_processes($) {
+    # Number of processes wanted and limited by system resources
+    # Returns:
+    #	Number of processes
+    my $self = shift;
+    my $opt_P = shift;
+    my $wanted_processes = $self->user_requested_processes($opt_P);
+    if(not defined $wanted_processes) {
+	$wanted_processes = $Global::default_simultaneous_sshlogins;
+    }
+    ::debug("load", "Wanted procs: $wanted_processes\n");
+    my $system_limit =
+	$self->processes_available_by_system_limit($wanted_processes);
+    ::debug("load", "Limited to procs: $system_limit\n");
+    return $system_limit;
+}
+
+{
+    my @children;
+    my $max_system_proc_reached;
+    my $more_filehandles;
+    my %fh;
+    my $tmpfhname;
+    my $count_jobs_already_read;
+    my @jobs;
+    my $job;
+    my @args;
+    my $arg;
+
+    sub reserve_filehandles($) {
+	# Reserves filehandle
+	my $n = shift;
+	for (1..$n) {
+	    $more_filehandles &&= open($fh{$tmpfhname++}, "<", "/dev/null");
+	}
+    }
+
+    sub reserve_process() {
+	# Spawn a dummy process
+	my $child;
+	if($child = fork()) {
+	    push @children, $child;
+	    $Global::unkilled_children{$child} = 1;
+	} elsif(defined $child) {
+	    # This is the child
+	    # The child takes one process slot
+	    # It will be killed later
+	    $SIG{'TERM'} = $Global::original_sig{'TERM'};
+	    if($^O eq "cygwin" or $^O eq "msys" or $^O eq "nto") {
+		# The exec does not work on Cygwin and QNX
+		sleep 10101010;
+	    } else {
+		# 'exec sleep' takes less RAM than sleeping in perl
+		exec 'sleep', 10101;
+	    }
+	    exit(0);
+	} else {
+	    # Failed to spawn
+	    $max_system_proc_reached = 1;
+	}
+    }
+
+    sub get_args_or_jobs() {
+	# Get an arg or a job (depending on mode)
+	if($Global::semaphore or ($opt::pipe and not $opt::tee)) {
+	    # Skip: No need to get args
+	    return 1;
+	} elsif(defined $opt::retries and $count_jobs_already_read) {
+	    # For retries we may need to run all jobs on this sshlogin
+	    # so include the already read jobs for this sshlogin
+	    $count_jobs_already_read--;
+	    return 1;
+	} else {
+	    if($opt::X or $opt::m) {
+		# The arguments may have to be re-spread over several jobslots
+		# So pessimistically only read one arg per jobslot
+		# instead of a full commandline
+		if($Global::JobQueue->{'commandlinequeue'}->{'arg_queue'}->empty()) {
+		    if($Global::JobQueue->empty()) {
+			return 0;
+		    } else {
+			$job = $Global::JobQueue->get();
+			push(@jobs, $job);
+			return 1;
+		    }
+		} else {
+		    $arg = $Global::JobQueue->{'commandlinequeue'}->{'arg_queue'}->get();
+		    push(@args, $arg);
+		    return 1;
+		}
+	    } else {
+		# If there are no more command lines, then we have a process
+		# per command line, so no need to go further
+		if($Global::JobQueue->empty()) {
+		    return 0;
+		} else {
+		    $job = $Global::JobQueue->get();
+		    # Replacement must happen here due to seq()
+		    $job and $job->replaced();
+		    push(@jobs, $job);
+		    return 1;
+		}
+	    }
+	}
+    }
+
+    sub cleanup() {
+	# Cleanup: Close the files
+	for (values %fh) { close $_ }
+	# Cleanup: Kill the children
+	for my $pid (@children) {
+	    kill 9, $pid;
+	    waitpid($pid,0);
+	    delete $Global::unkilled_children{$pid};
+	}
+	# Cleanup: Unget the command_lines or the @args
+	$Global::JobQueue->{'commandlinequeue'}{'arg_queue'}->unget(@args);
+	@args = ();
+	$Global::JobQueue->unget(@jobs);
+	@jobs = ();
+    }
+
+    sub processes_available_by_system_limit($) {
+	# If the wanted number of processes is bigger than the system limits:
+	# Limit them to the system limits
+	# Limits are: File handles, number of input lines, processes,
+	# and taking > 1 second to spawn 10 extra processes
+	# Returns:
+	#   Number of processes
+	my $self = shift;
+	my $wanted_processes = shift;
+	my $system_limit = 0;
+	my $slow_spawning_warning_printed = 0;
+	my $time = time;
+	$more_filehandles = 1;
+	$tmpfhname = "TmpFhNamE";
+
+	# perl uses 7 filehandles for something?
+	# parallel uses 1 for memory_usage
+	# parallel uses 4 for ?
+	reserve_filehandles(12);
+	# Two processes for load avg and ?
+	reserve_process();
+	reserve_process();
+
+	# For --retries count also jobs already run
+	$count_jobs_already_read = $Global::JobQueue->next_seq();
+	my $wait_time_for_getting_args = 0;
+	my $start_time = time;
+	if($wanted_processes < $Global::infinity) {
+	    $Global::dummy_jobs = 1;
+	}
+	while(1) {
+	    $system_limit >= $wanted_processes and last;
+	    not $more_filehandles and last;
+	    $max_system_proc_reached and last;
+
+	    my $before_getting_arg = time;
+	    if(!$Global::dummy_jobs) {
+		get_args_or_jobs() or last;
+	    }
+	    $wait_time_for_getting_args += time - $before_getting_arg;
+	    $system_limit++;
+
+	    # Every simultaneous process uses 2 filehandles to write to
+	    # and 2 filehandles to read from
+	    reserve_filehandles(4);
+
+	    # System process limit
+	    reserve_process();
+
+	    my $forktime = time - $time - $wait_time_for_getting_args;
+	    ::debug("run", "Time to fork $system_limit procs: ".
+		    $wait_time_for_getting_args, " ", $forktime,
+		    " (processes so far: ", $system_limit,")\n");
+	    if($system_limit > 10 and
+	       $forktime > 1 and
+	       $forktime > $system_limit * 0.01) {
+		# It took more than 0.01 second to fork a processes on avg.
+		# Give the user a warning. He can press Ctrl-C if this
+		# sucks.
+		::warning_once(
+		      "Starting $system_limit processes took > $forktime sec.",
+		      "Consider adjusting -j. Press CTRL-C to stop.");
+	    }
+	}
+	cleanup();
+
+	if($system_limit < $wanted_processes) {
+	    # The system_limit is less than the wanted_processes
+	    if($system_limit < 1 and not $Global::JobQueue->empty()) {
+		::warning("Cannot spawn any jobs.",
+			  "Try increasing 'ulimit -u' (try: ulimit -u `ulimit -Hu`)",
+			  "or increasing 'nproc' in /etc/security/limits.conf",
+			  "or increasing /proc/sys/kernel/pid_max");
+		::wait_and_exit(255);
+	    }
+	    if(not $more_filehandles) {
+		::warning("Only enough file handles to run ".
+			  $system_limit. " jobs in parallel.",
+			  "Try running 'parallel -j0 -N $system_limit --pipe parallel -j0'",
+			  "or increasing 'ulimit -n' (try: ulimit -n `ulimit -Hn`)",
+			  "or increasing 'nofile' in /etc/security/limits.conf",
+			  "or increasing /proc/sys/fs/file-max");
+	    }
+	    if($max_system_proc_reached) {
+		::warning("Only enough available processes to run ".
+			  $system_limit. " jobs in parallel.",
+			  "Try increasing 'ulimit -u' (try: ulimit -u `ulimit -Hu`)",
+			  "or increasing 'nproc' in /etc/security/limits.conf",
+			  "or increasing /proc/sys/kernel/pid_max");
+	    }
+	}
+	if($] == 5.008008 and $system_limit > 1000) {
+	    # https://savannah.gnu.org/bugs/?36942
+	    $system_limit = 1000;
+	}
+	if($Global::JobQueue->empty()) {
+	    $system_limit ||= 1;
+	}
+	if($self->string() ne ":" and
+	   $system_limit > $Global::default_simultaneous_sshlogins) {
+	    $system_limit =
+		$self->simultaneous_sshlogin_limit($system_limit);
+	}
+	return $system_limit;
+    }
+}
+
+sub simultaneous_sshlogin_limit($) {
+    # Test by logging in wanted number of times simultaneously
+    # Returns:
+    #	min($wanted_processes,$working_simultaneous_ssh_logins-1)
+    my $self = shift;
+    my $wanted_processes = shift;
+    if($self->{'time_to_login'}) {
+	return $wanted_processes;
+    }
+
+    # Try twice because it guesses wrong sometimes
+    # Choose the minimal
+    my $ssh_limit =
+	::min($self->simultaneous_sshlogin($wanted_processes),
+	      $self->simultaneous_sshlogin($wanted_processes));
+    if($ssh_limit < $wanted_processes) {
+	my $serverlogin = $self->string();
+	::warning("ssh to $serverlogin only allows ".
+		  "for $ssh_limit simultaneous logins.",
+		  "You may raise this by changing",
+		  "/etc/ssh/sshd_config:MaxStartups and MaxSessions on $serverlogin.",
+		  "You can also try --sshdelay 0.1",
+		  "Using only ".($ssh_limit-1)." connections ".
+		  "to avoid race conditions.");
+	# Race condition can cause problem if using all sshs.
+	if($ssh_limit > 1) { $ssh_limit -= 1; }
+    }
+    return $ssh_limit;
+}
+
+sub simultaneous_sshlogin($) {
+    # Using $sshlogin try to see if we can do $wanted_processes
+    # simultaneous logins
+    # (ssh host echo simul-login & ssh host echo simul-login & ...) |
+    #	grep simul|wc -l
+    # Input:
+    #	$wanted_processes = Try for this many logins in parallel
+    # Returns:
+    #	$ssh_limit = Number of succesful parallel logins
+    local $/ = "\n";
+    my $self = shift;
+    my $wanted_processes = shift;
+    my $sshdelay = $opt::sshdelay ? "sleep $opt::sshdelay;" : "";
+    # TODO sh -c wrapper to work for csh
+    my $cmd = ($sshdelay.$self->wrap("echo simultaneouslogin").
+	       "</dev/null 2>&1 &")x$wanted_processes;
+    ::debug("init","Trying $wanted_processes logins at ".$self->string()."\n");
+    open (my $simul_fh, "-|", "($cmd)|grep simultaneouslogin | wc -l") or
+	::die_bug("simultaneouslogin");
+    my $ssh_limit = <$simul_fh>;
+    close $simul_fh;
+    chomp $ssh_limit;
+    return $ssh_limit;
+}
+
+sub set_ncpus($$) {
+    my $self = shift;
+    $self->{'ncpus'} = shift;
+}
+
+sub user_requested_processes($) {
+    # Parse the number of processes that the user asked for using -j
+    # Input:
+    #	$opt_P = string formatted as for -P
+    # Returns:
+    #	$processes = the number of processes to run on this sshlogin
+    my $self = shift;
+    my $opt_P = shift;
+    my $processes;
+    if(defined $opt_P) {
+	if($opt_P =~ /^\+(\d+)$/) {
+	    # E.g. -P +2
+	    my $j = $1;
+	    $processes =
+		$self->ncpus() + $j;
+	} elsif ($opt_P =~ /^-(\d+)$/) {
+	    # E.g. -P -2
+	    my $j = $1;
+	    $processes =
+		$self->ncpus() - $j;
+	} elsif ($opt_P =~ /^(\d+(\.\d+)?)\%$/) {
+	    # E.g. -P 10.5%
+	    my $j = $1;
+	    $processes =
+		$self->ncpus() * $j / 100;
+	} elsif ($opt_P =~ /^(\d+)$/) {
+	    $processes = $1;
+	    if($processes == 0) {
+		# -P 0 = infinity (or at least close)
+		$processes = $Global::infinity;
+	    }
+	} elsif (-f $opt_P) {
+	    $Global::max_procs_file = $opt_P;
+	    if(open(my $in_fh, "<", $Global::max_procs_file)) {
+		my $opt_P_file = join("",<$in_fh>);
+		close $in_fh;
+		$processes = $self->user_requested_processes($opt_P_file);
+	    } else {
+		::error("Cannot open $opt_P.");
+		::wait_and_exit(255);
+	    }
+	} else {
+	    ::error("Parsing of --jobs/-j/--max-procs/-P failed.");
+	    ::die_usage();
+	}
+	$processes = ::ceil($processes);
+    }
+    return $processes;
+}
+
+sub ncpus($) {
+    # Number of CPU threads
+    # --use_sockets_instead_of_threads = count socket instead
+    # --use_cores_instead_of_threads = count physical cores instead
+    # Returns:
+    #	$ncpus = number of cpu (threads) on this sshlogin
+    local $/ = "\n";
+    my $self = shift;
+    if(not defined $self->{'ncpus'}) {
+	if($self->local()) {
+	    if($opt::use_sockets_instead_of_threads) {
+		$self->{'ncpus'} = socket_core_thread()->{'sockets'};
+	    } elsif($opt::use_cores_instead_of_threads) {
+		$self->{'ncpus'} = socket_core_thread()->{'cores'};
+	    } else {
+		$self->{'ncpus'} = socket_core_thread()->{'threads'};
+	    }
+	} else {
+	    my $ncpu;
+	    $ENV{'SSHPASS'} = $self->{'password'};
+	    ::debug("init",("echo | ".$self->wrap("parallel --number-of-sockets")));
+	    if($opt::use_sockets_instead_of_threads
+	       or
+		$opt::use_cpus_instead_of_cores) {
+		$ncpu = ::qqx("echo | ".$self->wrap("parallel --number-of-sockets"));
+	    } elsif($opt::use_cores_instead_of_threads) {
+		$ncpu = ::qqx("echo | ".$self->wrap("parallel --number-of-cores"));
+	    } else {
+		$ncpu = ::qqx("echo | ".$self->wrap("parallel --number-of-threads"));
+	    }
+	    chomp $ncpu;
+	    if($ncpu =~ /^\s*[0-9]+\s*$/s) {
+		$self->{'ncpus'} = $ncpu;
+	    } else {
+		::warning("Could not figure out ".
+			  "number of cpus on ".$self->string." ($ncpu). Using 1.");
+		$self->{'ncpus'} = 1;
+	    }
+	}
+    }
+    return $self->{'ncpus'};
+}
+
+
+sub nproc() {
+    # Returns:
+    #	Number of threads using `nproc`
+    my $no_of_threads = ::qqx("nproc");
+    chomp $no_of_threads;
+    return $no_of_threads;
+}
+
+sub no_of_sockets() {
+    return socket_core_thread()->{'sockets'};
+}
+
+sub no_of_cores() {
+    return socket_core_thread()->{'cores'};
+}
+
+sub no_of_threads() {
+    return socket_core_thread()->{'threads'};
+}
+
+sub socket_core_thread() {
+    # Returns:
+    #	{
+    #	  'sockets' => #sockets = number of socket with CPU present
+    #	  'cores' => #cores = number of physical cores
+    #	  'threads' => #threads = number of compute cores (hyperthreading)
+    #	  'active' => #taskset_threads = number of taskset limited cores
+    #	}
+    my $cpu;
+    if ($^O eq 'linux') {
+	$cpu = sct_gnu_linux($cpu);
+    } elsif ($^O eq 'android') {
+	$cpu = sct_android($cpu);
+    } elsif ($^O eq 'freebsd') {
+	$cpu = sct_freebsd($cpu);
+    } elsif ($^O eq 'netbsd') {
+	$cpu = sct_netbsd($cpu);
+    } elsif ($^O eq 'openbsd') {
+	$cpu = sct_openbsd($cpu);
+    } elsif ($^O eq 'gnu') {
+	$cpu = sct_hurd($cpu);
+    } elsif ($^O eq 'darwin') {
+	$cpu = sct_darwin($cpu);
+    } elsif ($^O eq 'solaris') {
+	$cpu = sct_solaris($cpu);
+    } elsif ($^O eq 'aix') {
+	$cpu = sct_aix($cpu);
+    } elsif ($^O eq 'hpux') {
+	$cpu = sct_hpux($cpu);
+    } elsif ($^O eq 'nto') {
+	$cpu = sct_qnx($cpu);
+    } elsif ($^O eq 'svr5') {
+	$cpu = sct_openserver($cpu);
+    } elsif ($^O eq 'irix') {
+	$cpu = sct_irix($cpu);
+    } elsif ($^O eq 'dec_osf') {
+	$cpu = sct_tru64($cpu);
+    } else {
+	# Try all methods until we find something that works
+	$cpu = (sct_gnu_linux($cpu)
+		|| sct_android($cpu)
+		|| sct_freebsd($cpu)
+		|| sct_netbsd($cpu)
+		|| sct_openbsd($cpu)
+		|| sct_hurd($cpu)
+		|| sct_darwin($cpu)
+		|| sct_solaris($cpu)
+		|| sct_aix($cpu)
+		|| sct_hpux($cpu)
+		|| sct_qnx($cpu)
+		|| sct_openserver($cpu)
+		|| sct_irix($cpu)
+		|| sct_tru64($cpu)
+	    );
+    }
+    if(not $cpu) {
+	# Fall back: Set all to nproc
+	my $nproc = nproc();
+	if($nproc) {
+	    $cpu->{'sockets'} =
+		$cpu->{'cores'} =
+		$cpu->{'threads'} =
+		$cpu->{'active'} =
+		$nproc;
+	}
+    }
+    if(not $cpu) {
+	::warning("Cannot figure out number of cpus. Using 1.");
+	$cpu->{'sockets'} =
+	    $cpu->{'cores'} =
+	    $cpu->{'threads'} =
+	    $cpu->{'active'} =
+	    1
+    }
+    $cpu->{'sockets'} ||= 1;
+    $cpu->{'threads'} ||= $cpu->{'cores'};
+    $cpu->{'active'} ||= $cpu->{'threads'};
+    chomp($cpu->{'sockets'},
+	  $cpu->{'cores'},
+	  $cpu->{'threads'},
+	  $cpu->{'active'});
+    # Choose minimum of active and actual
+    my $mincpu;
+    $mincpu->{'sockets'} = ::min($cpu->{'sockets'},$cpu->{'active'});
+    $mincpu->{'cores'} = ::min($cpu->{'cores'},$cpu->{'active'});
+    $mincpu->{'threads'} = ::min($cpu->{'threads'},$cpu->{'active'});
+    return $mincpu;
+}
+
+sub sct_gnu_linux($) {
+    # Returns:
+    #	{ 'sockets' => #sockets
+    #	  'cores' => #cores
+    #	  'threads' => #threads
+    #	  'active' => #taskset_threads }
+    my $cpu = shift;
+
+    sub read_topology($) {
+	my $prefix = shift;
+	my %sibiling;
+	my %socket;
+	my $thread;
+	for($thread = 0;
+	    -r "$prefix/cpu$thread/topology/physical_package_id";
+	    $thread++) {
+	    open(my $fh,"<",
+		 "$prefix/cpu$thread/topology/physical_package_id")
+		|| die;
+	    $socket{<$fh>}++;
+	    close $fh;
+	}
+	for($thread = 0;
+	    -r "$prefix/cpu$thread/topology/thread_siblings";
+	    $thread++) {
+	    open(my $fh,"<",
+		 "$prefix/cpu$thread/topology/thread_siblings")
+		|| die;
+	    $sibiling{<$fh>}++;
+	    close $fh;
+	}
+	$cpu->{'sockets'} = keys %socket;
+	$cpu->{'cores'} = keys %sibiling;
+	$cpu->{'threads'} = $thread;
+    }
+
+    sub read_cpuinfo(@) {
+	my @cpuinfo = @_;
+	$cpu->{'sockets'} = 0;
+	$cpu->{'cores'} = 0;
+	$cpu->{'threads'} = 0;
+	my %seen;
+	my %phy_seen;
+	my $physicalid;
+	for(@cpuinfo) {
+	    # physical id : 0
+	    if(/^physical id.*[:](.*)/) {
+		$physicalid = $1;
+		if(not $phy_seen{$1}++) {
+		    $cpu->{'sockets'}++;
+		}
+	    }
+	    # core id : 3
+	    if(/^core id.*[:](.*)/ and not $seen{$physicalid,$1}++) {
+		$cpu->{'cores'}++;
+	    }
+	    # processor : 2
+	    /^processor.*[:]\s*\d/i and $cpu->{'threads'}++;
+	}
+	$cpu->{'cores'} ||= $cpu->{'threads'};
+	$cpu->{'cpus'} ||= $cpu->{'threads'};
+	$cpu->{'sockets'} ||= 1;
+    }
+
+    sub read_lscpu(@) {
+	my @lscpu = @_;
+	my $threads_per_core;
+	my $cores_per_socket;
+	for(@lscpu) {
+	    /^CPU.s.:\s*(\d+)/ and $cpu->{'threads'} = $1;
+	    /^Thread.s. per core:\s*(\d+)/ and $threads_per_core = $1;
+	    /^Core.s. per socket:\s*(\d+)/ and $cores_per_socket = $1;
+	    /^(CPU )?Socket.s.:\s*(\d+)/i and $cpu->{'sockets'} = $2;
+	}
+	if($threads_per_core and $cpu->{'threads'}) {
+	    $cpu->{'cores'} =  $cpu->{'threads'} / $threads_per_core;
+	}
+	$cpu->{'cpus'} ||= $cpu->{'threads'};
+    }
+
+    local $/ = "\n"; # If delimiter is set, then $/ will be wrong
+    my @cpuinfo;
+    my @lscpu;
+    if($ENV{'PARALLEL_CPUINFO'}) {
+	# Use CPUINFO from environment - used for testing only
+	read_cpuinfo(split/(?<=\n)/,$ENV{'PARALLEL_CPUINFO'});
+    } elsif($ENV{'PARALLEL_LSCPU'}) {
+	# Use LSCPU from environment - used for testing only
+	read_lscpu(split/(?<=\n)/,$ENV{'PARALLEL_LSCPU'});
+    } elsif(-r "$ENV{'PARALLEL_CPUPREFIX'}/cpu0/topology/thread_siblings") {
+	# Use CPUPREFIX from environment - used for testing only
+	read_topology($ENV{'PARALLEL_CPUPREFIX'});
+    } elsif($cpu->{'sockets'} and $cpu->{'cores'} and $cpu->{'threads'}) {
+	# Skip /proc/cpuinfo - already set
+    } else {
+	# Not debugging: Look at this computer
+	if(!($cpu->{'sockets'} and $cpu->{'cores'} and $cpu->{'threads'})
+	   and
+	   open(my $in_fh, "-|", "lscpu")) {
+	    # Parse output from lscpu
+	    read_lscpu(<$in_fh>);
+	    close $in_fh;
+	}
+	if(!($cpu->{'sockets'} and $cpu->{'cores'} and $cpu->{'threads'})
+	   and
+	   -r "/sys/devices/system/cpu/cpu0/topology/thread_siblings") {
+	    read_topology("/sys/devices/system/cpu");
+	}
+	if(!($cpu->{'sockets'} and $cpu->{'cores'} and $cpu->{'threads'})
+	   and
+	   open(my $in_fh, "<", "/proc/cpuinfo")) {
+	    # Read /proc/cpuinfo
+	    read_cpuinfo(<$in_fh>);
+	    close $in_fh;
+	}
+    }
+    if(-e "/proc/self/status" and not $ENV{'PARALLEL_CPUINFO'}) {
+	# if 'taskset' is used to limit number of threads
+	if(open(my $in_fh, "<", "/proc/self/status")) {
+	    while(<$in_fh>) {
+		if(/^Cpus_allowed:\s*(\S+)/) {
+		    my $a = $1;
+		    $a =~ tr/,//d;
+		    $cpu->{'active'} = unpack ("%32b*", pack ("H*",$a));
+		}
+	    }
+	    close $in_fh;
+	}
+    }
+    return $cpu;
+}
+
+sub sct_android($) {
+    # Returns:
+    #	{ 'sockets' => #sockets
+    #	  'cores' => #cores
+    #	  'threads' => #threads
+    #	  'active' => #taskset_threads }
+    # Use GNU/Linux
+    return sct_gnu_linux($_[0]);
+}
+
+sub sct_freebsd($) {
+    # Returns:
+    #	{ 'sockets' => #sockets
+    #	  'cores' => #cores
+    #	  'threads' => #threads
+    #	  'active' => #taskset_threads }
+    local $/ = "\n";
+    my $cpu = shift;
+    $cpu->{'cores'} ||=
+	(::qqx(qq{ sysctl -a dev.cpu | grep \%parent | awk '{ print \$2 }' | uniq | wc -l | awk '{ print \$1 }' })
+	 or
+	 ::qqx(qq{ sysctl hw.ncpu | awk '{ print \$2 }' }));
+    $cpu->{'threads'} ||=
+	(::qqx(qq{ sysctl hw.ncpu | awk '{ print \$2 }' })
+	 or
+	 ::qqx(qq{ sysctl -a dev.cpu | grep \%parent | awk '{ print \$2 }' | uniq | wc -l | awk '{ print \$1 }' }));
+    return $cpu;
+}
+
+sub sct_netbsd($) {
+    # Returns:
+    #	{ 'sockets' => #sockets
+    #	  'cores' => #cores
+    #	  'threads' => #threads
+    #	  'active' => #taskset_threads }
+    local $/ = "\n";
+    my $cpu = shift;
+    $cpu->{'cores'} ||= ::qqx("sysctl -n hw.ncpu");
+    return $cpu;
+}
+
+sub sct_openbsd($) {
+    # Returns:
+    #	{ 'sockets' => #sockets
+    #	  'cores' => #cores
+    #	  'threads' => #threads
+    #	  'active' => #taskset_threads }
+    local $/ = "\n";
+    my $cpu = shift;
+    $cpu->{'cores'} ||= ::qqx('sysctl -n hw.ncpu');
+    return $cpu;
+}
+
+sub sct_hurd($) {
+    # Returns:
+    #	{ 'sockets' => #sockets
+    #	  'cores' => #cores
+    #	  'threads' => #threads
+    #	  'active' => #taskset_threads }
+    local $/ = "\n";
+    my $cpu = shift;
+    $cpu->{'cores'} ||= ::qqx("nproc");
+    return $cpu;
+}
+
+sub sct_darwin($) {
+    # Returns:
+    #	{ 'sockets' => #sockets
+    #	  'cores' => #cores
+    #	  'threads' => #threads
+    #	  'active' => #taskset_threads }
+    local $/ = "\n";
+    my $cpu = shift;
+    $cpu->{'cores'} ||=
+	(::qqx('sysctl -n hw.physicalcpu')
+	 or
+	 ::qqx(qq{ sysctl -a hw | grep [^a-z]physicalcpu[^a-z] | awk '{ print \$2 }' }));
+    $cpu->{'threads'} ||=
+	(::qqx('sysctl -n hw.logicalcpu')
+	 or
+	 ::qqx(qq{ sysctl -a hw | grep [^a-z]logicalcpu[^a-z] | awk '{ print \$2 }' }));
+    return $cpu;
+}
+
+sub sct_solaris($) {
+    # Returns:
+    #	{ 'sockets' => #sockets
+    #	  'cores' => #cores
+    #	  'threads' => #threads
+    #	  'active' => #taskset_threads }
+    local $/ = "\n";
+    my $cpu = shift;
+    if(not $cpu->{'cores'}) {
+	if(-x "/usr/bin/kstat") {
+	    my @chip_id = ::qqx("/usr/bin/kstat cpu_info|grep chip_id");
+	    if($#chip_id >= 0) {
+		$cpu->{'sockets'} ||= $#chip_id +1;
+	    }
+	    my @core_id = ::qqx("/usr/bin/kstat -m cpu_info|grep -w core_id|uniq");
+	    if($#core_id >= 0) {
+		$cpu->{'cores'} ||= $#core_id +1;
+	    }
+	}
+	if(-x "/usr/sbin/psrinfo") {
+	    my @psrinfo = ::qqx("/usr/sbin/psrinfo -p");
+	    if($#psrinfo >= 0) {
+		$cpu->{'sockets'} ||= $psrinfo[0];
+	    }
+	}
+	if(-x "/usr/sbin/prtconf") {
+	    my @prtconf = ::qqx("/usr/sbin/prtconf | grep cpu..instance");
+	    if($#prtconf >= 0) {
+		$cpu->{'cores'} ||= $#prtconf +1;
+	    }
+	}
+    }
+    return $cpu;
+}
+
+sub sct_aix($) {
+    # Returns:
+    #	{ 'sockets' => #sockets
+    #	  'cores' => #cores
+    #	  'threads' => #threads
+    #	  'active' => #taskset_threads }
+    local $/ = "\n";
+    my $cpu = shift;
+    if(not $cpu->{'cores'}) {
+	if(-x "/usr/sbin/lscfg") {
+	    if(open(my $in_fh, "-|",
+		    "/usr/sbin/lscfg -vs |grep proc | wc -l|tr -d ' '")) {
+		$cpu->{'cores'} = <$in_fh>;
+		close $in_fh;
+	    }
+	}
+    }
+    if(not $cpu->{'threads'}) {
+	if(-x "/usr/bin/vmstat") {
+	    if(open(my $in_fh, "-|", "/usr/bin/vmstat 1 1")) {
+		while(<$in_fh>) {
+		    /lcpu=([0-9]*) / and $cpu->{'threads'} = $1;
+		}
+		close $in_fh;
+	    }
+	}
+    }
+    return $cpu;
+}
+
+sub sct_hpux($) {
+    # Returns:
+    #	{ 'sockets' => #sockets
+    #	  'cores' => #cores
+    #	  'threads' => #threads
+    #	  'active' => #taskset_threads }
+    local $/ = "\n";
+    my $cpu = shift;
+    $cpu->{'cores'} ||=
+	::qqx(qq{ /usr/bin/mpsched -s 2>&1 | grep 'Locality Domain Count' | awk '{ print \$4 }'});
+    $cpu->{'threads'} ||=
+	::qqx(qq{ /usr/bin/mpsched -s 2>&1 | perl -ne '/Processor Count\\D+(\\d+)/ and print "\$1"'});
+    return $cpu;
+}
+
+sub sct_qnx($) {
+    # Returns:
+    #	{ 'sockets' => #sockets
+    #	  'cores' => #cores
+    #	  'threads' => #threads
+    #	  'active' => #taskset_threads }
+    local $/ = "\n";
+    my $cpu = shift;
+    # BUG: It is not known how to calculate this.
+
+    return $cpu;
+}
+
+sub sct_openserver($) {
+    # Returns:
+    #	{ 'sockets' => #sockets
+    #	  'cores' => #cores
+    #	  'threads' => #threads
+    #	  'active' => #taskset_threads }
+    local $/ = "\n";
+    my $cpu = shift;
+    if(not $cpu->{'cores'}) {
+	if(-x "/usr/sbin/psrinfo") {
+	    my @psrinfo = ::qqx("/usr/sbin/psrinfo");
+	    if($#psrinfo >= 0) {
+		$cpu->{'cores'} = $#psrinfo +1;
+	    }
+	}
+    }
+    $cpu->{'sockets'} ||= $cpu->{'cores'};
+    return $cpu;
+}
+
+sub sct_irix($) {
+    # Returns:
+    #	{ 'sockets' => #sockets
+    #	  'cores' => #cores
+    #	  'threads' => #threads
+    #	  'active' => #taskset_threads }
+    local $/ = "\n";
+    my $cpu = shift;
+    $cpu->{'cores'} ||=
+	::qqx(qq{ hinv | grep HZ | grep Processor | awk '{print \$1}' });
+    return $cpu;
+}
+
+sub sct_tru64($) {
+    # Returns:
+    #	{ 'sockets' => #sockets
+    #	  'cores' => #cores
+    #	  'threads' => #threads
+    #	  'active' => #taskset_threads }
+    local $/ = "\n";
+    my $cpu = shift;
+    $cpu->{'cores'} ||= ::qqx("sizer -pr");
+    $cpu->{'sockets'} ||= $cpu->{'cores'};
+    $cpu->{'threads'} ||= $cpu->{'cores'};
+
+    return $cpu;
+}
+
+sub sshcommand($) {
+    # Returns:
+    #	$sshcommand = the command (incl options) to run when using ssh
+    my $self = shift;
+    if (not defined $self->{'sshcommand'}) {
+	::die_bug("sshcommand not set");
+    }
+    return $self->{'sshcommand'};
+}
+
+sub local($) {
+    my $self = shift;
+    return $self->{'local'};
+}
+
+sub control_path_dir($) {
+    # Returns:
+    #	$control_path_dir = dir of control path (for -M)
+    my $self = shift;
+    if(not defined $self->{'control_path_dir'}) {
+	$self->{'control_path_dir'} =
+	    # Use $ENV{'TMPDIR'} as that is typically not
+	    # NFS mounted
+	    File::Temp::tempdir($ENV{'TMPDIR'}
+				. "/control_path_dir-XXXX",
+				CLEANUP => 1);
+    }
+    return $self->{'control_path_dir'};
+}
+
+sub rsync_transfer_cmd($) {
+    # Command to run to transfer a file
+    # Input:
+    #	$file = filename of file to transfer
+    #	$workdir = destination dir
+    # Returns:
+    #	$cmd = rsync command to run to transfer $file ("" if unreadable)
+    my $self = shift;
+    my $file = shift;
+    my $workdir = shift;
+    if(not -r $file) {
+	::warning($file. " is not readable and will not be transferred.");
+	return "true";
+    }
+    my $rsync_destdir;
+    my $relpath = ($file !~ m:^/:) || ($file =~ m:/\./:); # Is the path relative or /./?
+    if($relpath) {
+	$rsync_destdir = ::shell_quote_file($workdir);
+    } else {
+	# rsync /foo/bar /
+	$rsync_destdir = "/";
+    }
+    $file = ::shell_quote_file($file);
+    # Make dir if it does not exist
+    return($self->wrap("mkdir -p $rsync_destdir") . " && " .
+	   $self->rsync()." $file ".$self->{'host'}.":$rsync_destdir");
+}
+
+{
+    my $rsync_protocol;
+
+    sub rsync($) {
+	sub rsync_protocol {
+	    # rsync 3.1.x uses protocol 31 which is unsupported by 2.5.7.
+	    # If the version >= 3.1.0: downgrade to protocol 30
+	    # Returns:
+	    #   $rsync = "rsync" or "rsync --protocol 30"
+	    if(not $rsync_protocol) {
+		my @out = `rsync --version`;
+		if(not @out) {
+		    if(::which("rsync")) {
+			::die_bug("'rsync --version' gave no output.");
+		    } else {
+			::error("'rsync' is not in \$PATH.");
+			::wait_and_exit(255);
+		    }
+		}
+		for (@out) {
+		    # rsync	 version 3.1.3	protocol version 31
+		    # rsync	 version v3.2.3	 protocol version 31
+		    if(/version v?(\d+.\d+)(.\d+)?/) {
+			if($1 >= 3.1) {
+			    # Version 3.1.0 or later: Downgrade to protocol 30
+			    $rsync_protocol = "rsync --protocol 30";
+			} else {
+			    $rsync_protocol = "rsync";
+			}
+		    }
+		}
+		$rsync_protocol or
+		    ::die_bug("Cannot figure out version of rsync: @out");
+	    }
+	    return $rsync_protocol;
+	}
+	my $self = shift;
+
+	return rsync_protocol()." ".$ENV{'PARALLEL_RSYNC_OPTS'}.
+	    " -e".::Q($self->sshcmd());
+    }
+}
+
+sub cleanup_cmd($$$) {
+    # Command to run to remove the remote file
+    # Input:
+    #	$file = filename to remove
+    #	$workdir = destination dir
+    # Returns:
+    #	$cmd = ssh command to run to remove $file and empty parent dirs
+    my $self = shift;
+    my $file = shift;
+    my $workdir = shift;
+    my $f = $file;
+    if($f =~ m:/\./:) {
+	# foo/bar/./baz/quux => workdir/baz/quux
+	# /foo/bar/./baz/quux => workdir/baz/quux
+	$f =~ s:.*/\./:$workdir/:;
+    } elsif($f =~ m:^[^/]:) {
+	# foo/bar => workdir/foo/bar
+	$f = $workdir."/".$f;
+    }
+    my @subdirs = split m:/:, ::dirname($f);
+    my @rmdir;
+    my $dir = "";
+    for(@subdirs) {
+	$dir .= $_."/";
+	unshift @rmdir, ::shell_quote_file($dir);
+    }
+    my $rmdir = @rmdir ? "rmdir @rmdir 2>/dev/null;" : "";
+    if(defined $opt::workdir and $opt::workdir eq "...") {
+	$rmdir .= "rm -rf " . ::shell_quote_file($workdir).';';
+    }
+    my $rmf = "sh -c ".
+	::Q("rm -f ".::shell_quote_file($f)." 2>/dev/null;".$rmdir);
+    return $self->wrap(::Q($rmf));
+}
+
+package JobQueue;
+
+sub new($) {
+    my $class = shift;
+    my $commandref = shift;
+    my $read_from = shift;
+    my $context_replace = shift;
+    my $max_number_of_args = shift;
+    my $transfer_files = shift;
+    my $return_files = shift;
+    my $template_names = shift;
+    my $template_contents = shift;
+    my $commandlinequeue = CommandLineQueue->new
+	($commandref, $read_from, $context_replace, $max_number_of_args,
+	 $transfer_files, $return_files, $template_names, $template_contents);
+    my @unget = ();
+    return bless {
+	'unget' => \@unget,
+	'commandlinequeue' => $commandlinequeue,
+	'this_job_no' => 0,
+	'total_jobs' => undef,
+    }, ref($class) || $class;
+}
+
+sub get($) {
+    my $self = shift;
+
+    $self->{'this_job_no'}++;
+    if(@{$self->{'unget'}}) {
+	my $job = shift @{$self->{'unget'}};
+	# {%} may have changed, so flush computed values
+	$job && $job->flush_cache();
+	return $job;
+    } else {
+	my $commandline = $self->{'commandlinequeue'}->get();
+	if(defined $commandline) {
+	    return Job->new($commandline);
+	} else {
+	    $self->{'this_job_no'}--;
+	    return undef;
+	}
+    }
+}
+
+sub unget($) {
+    my $self = shift;
+    unshift @{$self->{'unget'}}, @_;
+    $self->{'this_job_no'} -= @_;
+}
+
+sub empty($) {
+    my $self = shift;
+    my $empty = (not @{$self->{'unget'}}) &&
+	$self->{'commandlinequeue'}->empty();
+    ::debug("run", "JobQueue->empty $empty ");
+    return $empty;
+}
+
+sub total_jobs($) {
+    my $self = shift;
+    if(not defined $self->{'total_jobs'}) {
+	if($opt::pipe and not $opt::tee) {
+	    ::error("--pipe is incompatible with --eta/--bar/--shuf");
+	    ::wait_and_exit(255);
+	}
+	if($opt::totaljobs) {
+	    $self->{'total_jobs'} = $opt::totaljobs;
+	} elsif($opt::sqlworker) {
+	    $self->{'total_jobs'} = $Global::sql->total_jobs();
+	} else {
+	    my $record;
+	    my @arg_records;
+	    my $record_queue = $self->{'commandlinequeue'}{'arg_queue'};
+	    my $start = time;
+	    while($record = $record_queue->get()) {
+		push @arg_records, $record;
+		if(time - $start > 10) {
+		    ::warning("Reading ".scalar(@arg_records).
+			      " arguments took longer than 10 seconds.");
+		    $opt::eta && ::warning("Consider removing --eta.");
+		    $opt::bar && ::warning("Consider removing --bar.");
+		    $opt::shuf && ::warning("Consider removing --shuf.");
+		    last;
+		}
+	    }
+	    while($record = $record_queue->get()) {
+		push @arg_records, $record;
+	    }
+	    if($opt::shuf and @arg_records) {
+		my $i = @arg_records;
+		while (--$i) {
+		    my $j = int rand($i+1);
+		    @arg_records[$i,$j] = @arg_records[$j,$i];
+		}
+	    }
+	    $record_queue->unget(@arg_records);
+	    # $#arg_records = number of args - 1
+	    # We have read one @arg_record for this job (so add 1 more)
+	    my $num_args = $#arg_records + 2;
+	    # This jobs is not started so -1
+	    my $started_jobs = $self->{'this_job_no'} - 1;
+	    my $max_args = ::max($Global::max_number_of_args,1);
+	    $self->{'total_jobs'} = ::ceil($num_args / $max_args)
+		+ $started_jobs;
+	    ::debug("init","Total jobs: ".$self->{'total_jobs'}.
+		    " ($num_args/$max_args + $started_jobs)\n");
+	}
+    }
+    return $self->{'total_jobs'};
+}
+
+sub flush_total_jobs($) {
+    # Unset total_jobs to force recomputing
+    my $self = shift;
+    ::debug("init","flush Total jobs: ");
+    $self->{'total_jobs'} = undef;
+}
+
+sub next_seq($) {
+    my $self = shift;
+
+    return $self->{'commandlinequeue'}->seq();
+}
+
+sub quote_args($) {
+    my $self = shift;
+    return $self->{'commandlinequeue'}->quote_args();
+}
+
+
+package Job;
+
+sub new($) {
+    my $class = shift;
+    my $commandlineref = shift;
+    return bless {
+	'commandline' => $commandlineref, # CommandLine object
+	'workdir' => undef, # --workdir
+	# filehandle for stdin (used for --pipe)
+	# filename for writing stdout to (used for --files)
+	# remaining data not sent to stdin (used for --pipe)
+	# tmpfiles to cleanup when job is done
+	'unlink' => [],
+	# amount of data sent via stdin (used for --pipe)
+	'transfersize' => 0, # size of files using --transfer
+	'returnsize' => 0, # size of files using --return
+	'pid' => undef,
+	# hash of { SSHLogins => number of times the command failed there }
+	'failed' => undef,
+	'sshlogin' => undef,
+	# The commandline wrapped with rsync and ssh
+	'sshlogin_wrap' => undef,
+	'exitstatus' => undef,
+	'exitsignal' => undef,
+	# Timestamp for timeout if any
+	'timeout' => undef,
+	'virgin' => 1,
+	# Output used for SQL and CSV-output
+	'output' => { 1 => [], 2 => [] },
+	'halfline' => { 1 => [], 2 => [] },
+    }, ref($class) || $class;
+}
+
+sub flush_cache($) {
+    my $self = shift;
+    $self->{'commandline'}->flush_cache();
+}
+
+sub replaced($) {
+    my $self = shift;
+    $self->{'commandline'} or ::die_bug("commandline empty");
+    return $self->{'commandline'}->replaced();
+}
+
+{
+    my $next_available_row;
+
+    sub row($) {
+	my $self = shift;
+	if(not defined $self->{'row'}) {
+	    if($opt::keeporder) {
+		$self->{'row'} = $self->seq();
+	    } else {
+		$self->{'row'} = ++$next_available_row;
+	    }
+	}
+	return $self->{'row'};
+    }
+}
+
+sub seq($) {
+    my $self = shift;
+    return $self->{'commandline'}->seq();
+}
+
+sub set_seq($$) {
+    my $self = shift;
+    return $self->{'commandline'}->set_seq(shift);
+}
+
+sub slot($) {
+    my $self = shift;
+    return $self->{'commandline'}->slot();
+}
+
+sub free_slot($) {
+    my $self = shift;
+    push @Global::slots, $self->slot();
+}
+
+{
+    my($cattail);
+
+    sub cattail() {
+	# Returns:
+	#   $cattail = perl program for:
+	#     cattail "decomp-prg" wpid [file_stdin] [file_to_unlink]
+	#     decomp-prg     = decompress program
+	#     wpid	     = pid of writer program
+	#     file_stdin     = file_to_decompress
+	#     file_to_unlink = unlink this file
+	if(not $cattail) {
+	    $cattail = q{
+		# cat followed by tail (possibly with rm as soon at the file is opened)
+		# If $writerpid dead: finish after this round
+		use Fcntl;
+		$|=1;
+
+		my ($comfile, $cmd, $writerpid, $read_file, $unlink_file) = @ARGV;
+		if($read_file) {
+		    open(IN,"<",$read_file) || die("cattail: Cannot open $read_file");
+		} else {
+		    *IN = *STDIN;
+		}
+		while(! -s $comfile) {
+		    # Writer has not opened the buffer file, so we cannot remove it yet
+		    $sleep = ($sleep < 30) ? ($sleep * 1.001 + 0.01) : ($sleep);
+		    usleep($sleep);
+		}
+		# The writer and we have both opened the file, so it is safe to unlink it
+		unlink $unlink_file;
+		unlink $comfile;
+
+		my $first_round = 1;
+		my $flags;
+		fcntl(IN, F_GETFL, $flags) || die $!; # Get the current flags on the filehandle
+		$flags |= O_NONBLOCK; # Add non-blocking to the flags
+		fcntl(IN, F_SETFL, $flags) || die $!; # Set the flags on the filehandle
+
+		while(1) {
+		    # clear EOF
+		    seek(IN,0,1);
+		    my $writer_running = kill 0, $writerpid;
+		    $read = sysread(IN,$buf,131072);
+		    if($read) {
+			if($first_round) {
+			    # Only start the command if there any input to process
+			    $first_round = 0;
+			    open(OUT,"|-",$cmd) || die("cattail: Cannot run $cmd");
+			}
+
+			# Blocking print
+			while($buf) {
+			    my $bytes_written = syswrite(OUT,$buf);
+			    # syswrite may be interrupted by SIGHUP
+			    substr($buf,0,$bytes_written) = "";
+			}
+			# Something printed: Wait less next time
+			$sleep /= 2;
+		    } else {
+			if(eof(IN) and not $writer_running) {
+			    # Writer dead: There will never be sent more to the decompressor
+			    close OUT;
+			    exit;
+			}
+			# TODO This could probably be done more efficiently using select(2)
+			# Nothing read: Wait longer before next read
+			# Up to 100 milliseconds
+			$sleep = ($sleep < 100) ? ($sleep * 1.001 + 0.01) : ($sleep);
+			usleep($sleep);
+		    }
+		}
+
+		sub usleep {
+		    # Sleep this many milliseconds.
+		    my $secs = shift;
+		    select(undef, undef, undef, $secs/1000);
+		}
+	    };
+	    $cattail =~ s/#.*//mg;
+	    $cattail =~ s/\s+/ /g;
+	}
+	return $cattail;
+    }
+}
+
+sub openoutputfiles($) {
+    # Open files for STDOUT and STDERR
+    # Set file handles in $self->fh
+    my $self = shift;
+    my ($outfhw, $errfhw, $outname, $errname);
+
+    if($opt::latestline) {
+	# Do not save to files: Use non-blocking pipe
+	my ($outfhr, $errfhr);
+	pipe($outfhr, $outfhw) || die;
+	$self->set_fh(1,'w',$outfhw);
+	$self->set_fh(2,'w',$outfhw);
+	$self->set_fh(1,'r',$outfhr);
+	$self->set_fh(2,'r',$outfhr);
+	# Make it possible to read non-blocking from the pipe
+	for my $fdno (1,2) {
+	    ::set_fh_non_blocking($self->fh($fdno,'r'));
+	}
+	# Return immediately because we do not need setting filenames
+	return;
+    } elsif($Global::linebuffer and not
+       ($opt::keeporder or $opt::files or $opt::results or
+	$opt::compress or $opt::compress_program or
+	$opt::decompress_program)) {
+	# Do not save to files: Use non-blocking pipe
+	my ($outfhr, $errfhr);
+	pipe($outfhr, $outfhw) || die;
+	pipe($errfhr, $errfhw) || die;
+	$self->set_fh(1,'w',$outfhw);
+	$self->set_fh(2,'w',$errfhw);
+	$self->set_fh(1,'r',$outfhr);
+	$self->set_fh(2,'r',$errfhr);
+	# Make it possible to read non-blocking from the pipe
+	for my $fdno (1,2) {
+	    ::set_fh_non_blocking($self->fh($fdno,'r'));
+	}
+	# Return immediately because we do not need setting filenames
+	return;
+    } elsif($opt::results and not $Global::csvsep and not $Global::jsonout) {
+	# If --results, but not --results *.csv/*.tsv
+	my $out = $self->{'commandline'}->results_out();
+	my $seqname;
+	if($out eq $opt::results or $out =~ m:/$:) {
+	    # $opt::results = simple string or ending in /
+	    # => $out is a dir/
+	    # prefix/name1/val1/name2/val2/seq
+	    $seqname = $out."seq";
+	    # prefix/name1/val1/name2/val2/stdout
+	    $outname = $out."stdout";
+	    # prefix/name1/val1/name2/val2/stderr
+	    $errname = $out."stderr";
+	} else {
+	    # $opt::results = replacement string not ending in /
+	    # => $out is a file
+	    $outname = $out;
+	    $errname = "$out.err";
+	    $seqname = "$out.seq";
+	}
+	my $seqfhw;
+	if(not open($seqfhw, "+>", $seqname)) {
+	    ::error("Cannot write to `$seqname'.");
+	    ::wait_and_exit(255);
+	}
+	print $seqfhw $self->seq();
+	close $seqfhw;
+	if(not open($outfhw, "+>", $outname)) {
+	    ::error("Cannot write to `$outname'.");
+	    ::wait_and_exit(255);
+	}
+	if(not open($errfhw, "+>", $errname)) {
+	    ::error("Cannot write to `$errname'.");
+	    ::wait_and_exit(255);
+	}
+	$self->set_fh(1,"unlink","");
+	$self->set_fh(2,"unlink","");
+	if($opt::sqlworker) {
+	    # Save the filenames in SQL table
+	    $Global::sql->update("SET Stdout = ?, Stderr = ? ".
+				 "WHERE Seq = ". $self->seq(),
+				 $outname, $errname);
+	}
+    } elsif(not $opt::ungroup) {
+	# To group we create temporary files for STDOUT and STDERR
+	# To avoid the cleanup unlink the files immediately (but keep them open)
+	if($opt::files) {
+	    ($outfhw, $outname) = ::tmpfile(SUFFIX => ".par");
+	    ($errfhw, $errname) = ::tmpfile(SUFFIX => ".par");
+	    # --files => only remove stderr
+	    $self->set_fh(1,"unlink","");
+	    $self->set_fh(2,"unlink",$errname);
+	} else {
+	    ($outfhw, $outname) = ::tmpfile(SUFFIX => ".par");
+	    ($errfhw, $errname) = ::tmpfile(SUFFIX => ".par");
+	    $self->set_fh(1,"unlink",$outname);
+	    $self->set_fh(2,"unlink",$errname);
+	}
+    } else {
+	# --ungroup
+	open($outfhw,">&",$Global::fh{1}) || die;
+	open($errfhw,">&",$Global::fh{2}) || die;
+	# File name must be empty as it will otherwise be printed
+	$outname = "";
+	$errname = "";
+	$self->set_fh(1,"unlink",$outname);
+	$self->set_fh(2,"unlink",$errname);
+    }
+    # Set writing FD
+    $self->set_fh(1,'w',$outfhw);
+    $self->set_fh(2,'w',$errfhw);
+    $self->set_fh(1,'name',$outname);
+    $self->set_fh(2,'name',$errname);
+    if($opt::compress) {
+	$self->filter_through_compress();
+    } elsif(not $opt::ungroup) {
+	$self->grouped();
+    }
+    if($Global::linebuffer) {
+	# Make it possible to read non-blocking from
+	# the buffer files
+	# Used for --linebuffer with -k, --files, --res, --compress*
+	for my $fdno (1,2) {
+	    ::set_fh_non_blocking($self->fh($fdno,'r'));
+	}
+    }
+}
+
+sub print_verbose_dryrun($) {
+    # If -v set: print command to stdout (possibly buffered)
+    # This must be done before starting the command
+    my $self = shift;
+    if($Global::verbose or $opt::dryrun) {
+	my $fh = $self->fh(1,"w");
+	if($Global::verbose <= 1) {
+	    print $fh $self->replaced(),"\n";
+	} else {
+	    # Verbose level > 1: Print the rsync and stuff
+	    print $fh $self->wrapped(),"\n";
+	}
+    }
+    if($opt::sqlworker) {
+	$Global::sql->update("SET Command = ? WHERE Seq = ".$self->seq(),
+			     $self->replaced());
+    }
+}
+
+sub add_rm($) {
+    # Files to remove when job is done
+    my $self = shift;
+    push @{$self->{'unlink'}}, @_;
+}
+
+sub get_rm($) {
+    # Files to remove when job is done
+    my $self = shift;
+    return @{$self->{'unlink'}};
+}
+
+sub cleanup($) {
+    # Remove files when job is done
+    my $self = shift;
+    unlink $self->get_rm();
+    delete @Global::unlink{$self->get_rm()};
+}
+
+sub grouped($) {
+    my $self = shift;
+    # Set reading FD if using --group (--ungroup does not need)
+    for my $fdno (1,2) {
+	# Re-open the file for reading
+	# so fdw can be closed seperately
+	# and fdr can be seeked seperately (for --line-buffer)
+	open(my $fdr,"<", $self->fh($fdno,'name')) ||
+	    ::die_bug("fdr: Cannot open ".$self->fh($fdno,'name'));
+	$self->set_fh($fdno,'r',$fdr);
+	# Unlink if not debugging
+	$Global::debug or ::rm($self->fh($fdno,"unlink"));
+    }
+}
+
+sub empty_input_wrapper($) {
+    # If no input: exit(0)
+    # If some input: Pass input as input to command on STDIN
+    # This avoids starting the command if there is no input.
+    # Input:
+    #	$command = command to pipe data to
+    # Returns:
+    #	$wrapped_command = the wrapped command
+    my $command = shift;
+    # The optimal block size differs
+    # It has been measured on:
+    # AMD 6376: 59000
+    # <big ppar --pipe --block 100M --test $1 -j1 'cat >/dev/null';
+    my $script =
+	::spacefree(0,q{
+	    if(sysread(STDIN, $buf, 1)) {
+		open($fh, "|-", @ARGV) || die;
+		syswrite($fh, $buf);
+		while($read = sysread(STDIN, $buf, 59000)) {
+		    syswrite($fh, $buf);
+		}
+		close $fh;
+		exit ($?&127 ? 128+($?&127) : 1+$?>>8)
+	    }
+		  });
+    ::debug("run",'Empty wrap: perl -e '.::Q($script)."\n");
+    if($Global::cshell
+       and
+       length $command > 499) {
+	# csh does not like words longer than 1000 (499 quoted)
+	# $command = "perl -e '".base64_zip_eval()."' ".
+	# join" ",string_zip_base64(
+	#	  'exec "'.::perl_quote_scalar($command).'"');
+	return 'perl -e '.::Q($script)." ".
+	    base64_wrap("exec \"$Global::shell\",'-c',\"".
+				   ::perl_quote_scalar($command).'"');
+    } else {
+	return 'perl -e '.::Q($script)." ".
+	    $Global::shell." -c ".::Q($command);
+    }
+}
+
+sub filter_through_compress($) {
+    my $self = shift;
+    # Send stdout to stdin for $opt::compress_program(1)
+    # Send stderr to stdin for $opt::compress_program(2)
+    # cattail get pid:	$pid = $self->fh($fdno,'rpid');
+    my $cattail = cattail();
+
+    for my $fdno (1,2) {
+	# Make a communication file.
+	my ($fh, $comfile) = ::tmpfile(SUFFIX => ".pac");
+	close $fh;
+	# Compressor: (echo > $comfile; compress pipe) > output
+	# When the echo is written to $comfile,
+	# it is known that output file is opened,
+	# thus output file can then be removed by the decompressor.
+	# empty_input_wrapper is needed for plzip
+	my $wpid = open(my $fdw,"|-", "(echo > $comfile; ".
+			empty_input_wrapper($opt::compress_program).") >".
+			::Q($self->fh($fdno,'name'))) || die $?;
+	$self->set_fh($fdno,'w',$fdw);
+	$self->set_fh($fdno,'wpid',$wpid);
+	# Decompressor: open output; -s $comfile > 0: rm $comfile output;
+	#		decompress output > stdout
+	my $rpid = open(my $fdr, "-|", "perl", "-e", $cattail, $comfile,
+			$opt::decompress_program, $wpid,
+			$self->fh($fdno,'name'),$self->fh($fdno,'unlink'))
+	    || die $?;
+	$self->set_fh($fdno,'r',$fdr);
+	$self->set_fh($fdno,'rpid',$rpid);
+    }
+}
+
+sub set_fh($$$$) {
+    # Set file handle
+    my ($self, $fd_no, $key, $fh) = @_;
+    $self->{'fd'}{$fd_no,$key} = $fh;
+}
+
+sub fh($) {
+    # Get file handle
+    my ($self, $fd_no, $key) = @_;
+    return $self->{'fd'}{$fd_no,$key};
+}
+
+sub write_block($) {
+    my $self = shift;
+    my $stdin_fh = $self->fh(0,"w");
+    if(fork()) {
+	# Close in parent
+	close $stdin_fh;
+    } else {
+	# If writing is to a closed pipe:
+	#   Do not call signal handler, but let nothing be written
+	local $SIG{PIPE} = undef;
+
+	for my $part (
+	    grep { defined $_ }
+	    $self->{'header'},$self->{'block'}) {
+	    # syswrite may not write all in one go,
+	    # so make sure everything is written.
+	    my $written;
+	    while($written = syswrite($stdin_fh,$$part)) {
+		substr($$part,0,$written) = "";
+	    }
+	}
+	close $stdin_fh;
+	exit(0);
+    }
+}
+
+sub write($) {
+    my $self = shift;
+    my $remaining_ref = shift;
+    my $stdin_fh = $self->fh(0,"w");
+
+    my $len = length $$remaining_ref;
+    # syswrite may not write all in one go,
+    # so make sure everything is written.
+    my $written;
+
+    # If writing is to a closed pipe:
+    #	Do not call signal handler, but let nothing be written
+    local $SIG{PIPE} = undef;
+    while($written = syswrite($stdin_fh,$$remaining_ref)){
+	substr($$remaining_ref,0,$written) = "";
+    }
+}
+
+sub set_block($$$$$$) {
+    # Copy stdin buffer from $block_ref up to $endpos
+    # Prepend with $header_ref if virgin (i.e. not --roundrobin)
+    # Remove $recstart and $recend if needed
+    # Input:
+    #	$header_ref = ref to $header to prepend
+    #	$buffer_ref = ref to $buffer containing the block
+    #	$endpos = length of $block to pass on
+    #	$recstart = --recstart regexp
+    #	$recend = --recend regexp
+    # Returns:
+    #	N/A
+    my $self = shift;
+    my ($header_ref,$buffer_ref,$endpos,$recstart,$recend) = @_;
+    $self->{'header'} = $header_ref;
+    if($opt::roundrobin or $opt::remove_rec_sep or defined $opt::retries) {
+	my $a = "";
+	if(($opt::roundrobin or defined $opt::retries) and $self->virgin()) {
+	    $a .= $$header_ref;
+	}
+	# Job is no longer virgin
+	$self->set_virgin(0);
+	# Make a full copy because $buffer will change
+	$a .= substr($$buffer_ref,0,$endpos);
+	$self->{'block'} = \$a;
+	if($opt::remove_rec_sep) {
+	    remove_rec_sep($self->{'block'},$recstart,$recend);
+	}
+	$self->{'block_length'} = length ${$self->{'block'}};
+    } else {
+	$self->set_virgin(0);
+	for(substr($$buffer_ref,0,$endpos)) {
+	    $self->{'block'} = \$_;
+	}
+	$self->{'block_length'} = $endpos + length ${$self->{'header'}};
+    }
+    $self->{'block_pos'} = 0;
+    $self->add_transfersize($self->{'block_length'});
+}
+
+sub block_ref($) {
+    my $self = shift;
+    return $self->{'block'};
+}
+
+sub block_length($) {
+    my $self = shift;
+    return $self->{'block_length'};
+}
+
+sub remove_rec_sep($) {
+    # Remove --recstart and --recend from $block
+    # Input:
+    #	$block_ref = reference to $block to be modified
+    #	$recstart = --recstart
+    #	$recend = --recend
+    # Uses:
+    #	$opt::regexp = Are --recstart/--recend regexp?
+    # Returns:
+    #	N/A
+    my ($block_ref,$recstart,$recend) = @_;
+    # Remove record separator
+    if($opt::regexp) {
+	$$block_ref =~ s/$recend$recstart//gom;
+	$$block_ref =~ s/^$recstart//os;
+	$$block_ref =~ s/$recend$//os;
+    } else {
+	$$block_ref =~ s/\Q$recend$recstart\E//gom;
+	$$block_ref =~ s/^\Q$recstart\E//os;
+	$$block_ref =~ s/\Q$recend\E$//os;
+    }
+}
+
+sub non_blocking_write($) {
+    my $self = shift;
+    my $something_written = 0;
+
+    my $in = $self->fh(0,"w");
+    my $rv = syswrite($in,
+		      substr(${$self->{'block'}},$self->{'block_pos'}));
+    if (!defined($rv) && $! == ::EAGAIN()) {
+	# would block - but would have written
+	$something_written = 0;
+	# avoid triggering auto expanding block size
+	$Global::no_autoexpand_block ||= 1;
+    } elsif ($self->{'block_pos'}+$rv != $self->{'block_length'}) {
+	# incomplete write
+	# Remove the written part
+	$self->{'block_pos'} += $rv;
+	$something_written = $rv;
+    } else {
+	# successfully wrote everything
+	# Empty block to free memory
+	my $a = "";
+	$self->set_block(\$a,\$a,0,"","");
+	$something_written = $rv;
+    }
+    ::debug("pipe", "Non-block: ", $something_written);
+    return $something_written;
+}
+
+
+sub virgin($) {
+    my $self = shift;
+    return $self->{'virgin'};
+}
+
+sub set_virgin($$) {
+    my $self = shift;
+    $self->{'virgin'} = shift;
+}
+
+sub pid($) {
+    my $self = shift;
+    return $self->{'pid'};
+}
+
+sub set_pid($$) {
+    my $self = shift;
+    $self->{'pid'} = shift;
+}
+
+sub starttime($) {
+    # Returns:
+    #	UNIX-timestamp this job started
+    my $self = shift;
+    return sprintf("%.3f",$self->{'starttime'});
+}
+
+sub set_starttime($@) {
+    my $self = shift;
+    my $starttime = shift || ::now();
+    $self->{'starttime'} = $starttime;
+    $opt::sqlworker and
+	$Global::sql->update("SET Starttime = ? WHERE Seq = ".$self->seq(),
+			     $starttime);
+}
+
+sub runtime($) {
+    # Returns:
+    #	Run time in seconds with 3 decimals
+    my $self = shift;
+    return sprintf("%.3f",
+		   int(($self->endtime() - $self->starttime())*1000)/1000);
+}
+
+sub endtime($) {
+    # Returns:
+    #	UNIX-timestamp this job ended
+    #	0 if not ended yet
+    my $self = shift;
+    return ($self->{'endtime'} || 0);
+}
+
+sub set_endtime($$) {
+    my $self = shift;
+    my $endtime = shift;
+    $self->{'endtime'} = $endtime;
+    $opt::sqlworker and
+	$Global::sql->update("SET JobRuntime = ? WHERE Seq = ".$self->seq(),
+			     $self->runtime());
+}
+
+sub is_timedout($) {
+    # Is the job timedout?
+    # Input:
+    #	$delta_time = time that the job may run
+    # Returns:
+    #	True or false
+    my $self = shift;
+    my $delta_time = shift;
+    return time > $self->{'starttime'} + $delta_time;
+}
+
+sub kill($) {
+    my $self = shift;
+    $self->set_exitstatus(-1);
+    ::kill_sleep_seq($self->pid());
+}
+
+sub suspend($) {
+    my $self = shift;
+    my @pgrps = map { -$_ } $self->pid();
+    kill "STOP", @pgrps;
+    $self->set_suspended(1);
+}
+
+sub set_suspended($$) {
+    my $self = shift;
+    $self->{'suspended'} = shift;
+}
+
+sub suspended($) {
+    my $self = shift;
+    return $self->{'suspended'};
+}
+
+sub resume($) {
+    my $self = shift;
+    my @pgrps = map { -$_ } $self->pid();
+    kill "CONT", @pgrps;
+    $self->set_suspended(0);
+}
+
+sub failed($) {
+    # return number of times failed for this $sshlogin
+    # Input:
+    #	$sshlogin
+    # Returns:
+    #	Number of times failed for $sshlogin
+    my $self = shift;
+    my $sshlogin = shift;
+    return $self->{'failed'}{$sshlogin};
+}
+
+sub failed_here($) {
+    # return number of times failed for the current $sshlogin
+    # Returns:
+    #	Number of times failed for this sshlogin
+    my $self = shift;
+    return $self->{'failed'}{$self->sshlogin()};
+}
+
+sub add_failed($) {
+    # increase the number of times failed for this $sshlogin
+    my $self = shift;
+    my $sshlogin = shift;
+    $self->{'failed'}{$sshlogin}++;
+}
+
+sub add_failed_here($) {
+    # increase the number of times failed for the current $sshlogin
+    my $self = shift;
+    $self->{'failed'}{$self->sshlogin()}++;
+}
+
+sub reset_failed($) {
+    # increase the number of times failed for this $sshlogin
+    my $self = shift;
+    my $sshlogin = shift;
+    delete $self->{'failed'}{$sshlogin};
+}
+
+sub reset_failed_here($) {
+    # increase the number of times failed for this $sshlogin
+    my $self = shift;
+    delete $self->{'failed'}{$self->sshlogin()};
+}
+
+sub min_failed($) {
+    # Returns:
+    #	the number of sshlogins this command has failed on
+    #	the minimal number of times this command has failed
+    my $self = shift;
+    my $min_failures =
+	::min(map { $self->{'failed'}{$_} } keys %{$self->{'failed'}});
+    my $number_of_sshlogins_failed_on = scalar keys %{$self->{'failed'}};
+    return ($number_of_sshlogins_failed_on,$min_failures);
+}
+
+sub total_failed($) {
+    # Returns:
+    #	$total_failures = the number of times this command has failed
+    my $self = shift;
+    my $total_failures = 0;
+    for (values %{$self->{'failed'}}) {
+	$total_failures += $_;
+    }
+    return $total_failures;
+}
+
+{
+    my $script;
+
+    sub postpone_exit_and_cleanup {
+	# Command to remove files and dirs (given as args) without
+	# affecting the exit value in $?/$status.
+	if(not $script) {
+	    $script = "perl -e '".
+		::spacefree(0,q{
+		    $bash=shift;
+		    $csh=shift;
+		    for(@ARGV){
+			unlink;
+			rmdir;
+		    }
+		    if($bash=~s/(\d+)h/$1/) {
+			exit $bash;
+		    }
+		    exit $csh;
+			    }).
+		# `echo \$?h` is needed to make fish not complain
+		"' ".'"`echo \\\\\\\\\$?h`" "$status" ';
+	}
+	return $script
+    }
+}
+
+{
+    my $script;
+
+    sub fifo_wrap() {
+	# Script to create a fifo, run a command on the fifo
+	# while copying STDIN to the fifo, and finally
+	# remove the fifo and return the exit code of the command.
+	if(not $script) {
+	    # {} == $PARALLEL_TMP for --fifo
+	    # To make it csh compatible a wrapper needs to:
+	    # * mkfifo
+	    # * spawn $command &
+	    # * cat > fifo
+	    # * waitpid to get the exit code from $command
+	    # * be less than 1000 chars long
+
+	    # The optimal block size differs
+	    # It has been measured on:
+	    # AMD 6376: 4095
+	    # ppar -a big --pipepart --block -1 --test $1 --fifo 'cat {} >/dev/null';
+	    $script = "perl -e '".
+		(::spacefree
+		 (0, q{
+		     ($s,$c,$f) = @ARGV;
+		     # mkfifo $PARALLEL_TMP
+		     system "mkfifo", $f;
+		     # spawn $shell -c $command &
+		     $pid = fork || exec $s, "-c", $c;
+		     open($o,">",$f) || die $!;
+		     # cat > $PARALLEL_TMP
+		     while(sysread(STDIN,$buf,4095)){
+			 syswrite $o, $buf;
+		     }
+		     close $o;
+		     # waitpid to get the exit code from $command
+		     waitpid $pid,0;
+		     # Cleanup
+		     unlink $f;
+		     exit $?/256;
+		  }))."'";
+	}
+	return $script;
+    }
+}
+
+sub wrapped($) {
+    # Wrap command with:
+    # * --shellquote
+    # * --nice
+    # * --cat
+    # * --fifo
+    # * --sshlogin
+    # * --pipepart (@Global::cat_prepends)
+    # * --tee (@Global::cat_prepends)
+    # * --pipe
+    # * --tmux
+    # The ordering of the wrapping is important:
+    # * --nice/--cat/--fifo should be done on the remote machine
+    # * --pipepart/--pipe should be done on the local machine inside --tmux
+    # Uses:
+    #	@opt::shellquote
+    #	$opt::nice
+    #	$Global::shell
+    #	$opt::cat
+    #	$opt::fifo
+    #	@Global::cat_prepends
+    #	$opt::pipe
+    #	$opt::tmux
+    # Returns:
+    #	$self->{'wrapped'} = the command wrapped with the above
+    my $self = shift;
+    if(not defined $self->{'wrapped'}) {
+	my $command = $self->replaced();
+	# Bug in Bash and Ksh when running multiline aliases
+	# This will force them to run correctly, but will fail in
+	# tcsh so we do not do it.
+	# $command .= "\n\n";
+	if(@opt::shellquote) {
+	    # Quote one time for each --shellquote
+	    my $c = $command;
+	    for(@opt::shellquote) {
+		$c = ::Q($c);
+	    }
+	    # Prepend "echo" (it is written in perl because
+	    # quoting '-e' causes problem in some versions and
+	    # csh's version does something wrong)
+	    $command = q(perl -e '$,=" "; print "@ARGV\n";' -- ) . ::Q($c);
+	}
+	if($Global::parallel_env) {
+	    # If $PARALLEL_ENV set, put that in front of the command
+	    # Used for env_parallel.*
+	    if($Global::shell =~ /zsh/) {
+		# The extra 'eval' will make aliases work, too
+		$command = $Global::parallel_env."\n".
+		    "eval ".::Q($command);
+	    } else {
+		$command = $Global::parallel_env."\n".$command;
+	    }
+	}
+	if($opt::cat) {
+	    # In '--cat' and '--fifo' {} == $PARALLEL_TMP.
+	    # This is to make it possible to compute $PARALLEL_TMP on
+	    # the fly when running remotely.
+	    # $ENV{PARALLEL_TMP} is set in the remote wrapper before
+	    # the command is run.
+	    #
+	    # Prepend 'cat > $PARALLEL_TMP;'
+	    # Append 'unlink $PARALLEL_TMP without affecting $?'
+	    $command =
+		'cat > $PARALLEL_TMP;'.
+		$command.";". postpone_exit_and_cleanup().
+					 '$PARALLEL_TMP';
+	} elsif($opt::fifo) {
+	    # Prepend fifo-wrapper. In essence:
+	    #	mkfifo {}
+	    #	( $command ) &
+	    #	# $command must read {}, otherwise this 'cat' will block
+	    #	cat > {};
+	    #	wait; rm {}
+	    # without affecting $?
+	    $command = fifo_wrap(). " ".
+		$Global::shell. " ". ::Q($command). ' $PARALLEL_TMP'. ';';
+	}
+	# Wrap with ssh + tranferring of files
+	$command = $self->sshlogin_wrap($command);
+	if(@Global::cat_prepends) {
+	    # --pipepart: prepend:
+	    # < /tmp/foo perl -e 'while(@ARGV) {
+	    #	sysseek(STDIN,shift,0) || die; $left = shift;
+	    #	while($read = sysread(STDIN,$buf, ($left > 60800 ? 60800 : $left))){
+	    #	  $left -= $read; syswrite(STDOUT,$buf);
+	    #	}
+	    # }'  0 0 0 11 |
+	    #
+	    # --pipepart --tee: prepend:
+	    #	< dash-a-file
+	    #
+	    # --pipe --tee: wrap:
+	    #	(rm fifo; ... ) < fifo
+	    #
+	    # --pipe --shard X:
+	    #	(rm fifo; ... ) < fifo
+	    $command = (shift @Global::cat_prepends). "($command)".
+		(shift @Global::cat_appends);
+	} elsif($opt::pipe and not $opt::roundrobin) {
+	    # Wrap with EOF-detector to avoid starting $command if EOF.
+	    $command = empty_input_wrapper($command);
+	}
+	if($opt::tmux) {
+	    # Wrap command with 'tmux'
+	    $command = $self->tmux_wrap($command);
+	}
+	if($Global::cshell
+	   and
+	   length $command > 499) {
+	    # csh does not like words longer than 1000 (499 quoted)
+	    # $command = "perl -e '".base64_zip_eval()."' ".
+	    # join" ",string_zip_base64(
+	    #	      'exec "'.::perl_quote_scalar($command).'"');
+	    $command = base64_wrap("exec \"$Global::shell\",'-c',\"".
+				   ::perl_quote_scalar($command).'"');
+	}
+	$self->{'wrapped'} = $command;
+    }
+    return $self->{'wrapped'};
+}
+
+sub set_sshlogin($$) {
+    my $self = shift;
+    my $sshlogin = shift;
+    $self->{'sshlogin'} = $sshlogin;
+    delete $self->{'sshlogin_wrap'}; # If sshlogin is changed the wrap is wrong
+    delete $self->{'wrapped'};
+
+    if($opt::sqlworker) {
+	# Identify worker as --sqlworker often runs on different machines
+	# If local: Use hostname
+	my $host = $sshlogin->local() ? ::hostname() : $sshlogin->host();
+	$Global::sql->update("SET Host = ? WHERE Seq = ".$self->seq(), $host);
+    }
+}
+
+sub sshlogin($) {
+    my $self = shift;
+    return $self->{'sshlogin'};
+}
+
+sub string_base64($) {
+    # Base64 encode strings into 1000 byte blocks.
+    # 1000 bytes is the largest word size csh supports
+    # Input:
+    #	@strings = to be encoded
+    # Returns:
+    #	@base64 = 1000 byte block
+    $Global::use{"MIME::Base64"} ||= eval "use MIME::Base64; 1;";
+    my @base64 = unpack("(A1000)*",encode_base64((join"",@_),""));
+    return @base64;
+}
+
+sub string_zip_base64($) {
+    # Pipe string through 'bzip2 -9' and base64 encode it into 1000
+    # byte blocks.
+    # 1000 bytes is the largest word size csh supports
+    # Zipping will make exporting big environments work, too
+    # Input:
+    #	@strings = to be encoded
+    # Returns:
+    #	@base64 = 1000 byte block
+    my($zipin_fh, $zipout_fh,@base64);
+    ::open3($zipin_fh,$zipout_fh,">&STDERR","bzip2 -9");
+    if(fork) {
+	close $zipin_fh;
+	$Global::use{"MIME::Base64"} ||= eval "use MIME::Base64; 1;";
+	# Split base64 encoded into 1000 byte blocks
+	@base64 = unpack("(A1000)*",encode_base64((join"",<$zipout_fh>),""));
+	close $zipout_fh;
+    } else {
+	close $zipout_fh;
+	print $zipin_fh @_;
+	close $zipin_fh;
+	exit;
+    }
+    ::debug("base64","Orig:@_\nAs bzip2 base64:@base64\n");
+    return @base64;
+}
+
+sub base64_zip_eval() {
+    # Script that:
+    #	* reads base64 strings from @ARGV
+    #	* decodes them
+    #	* pipes through 'bzip2 -dc'
+    #	* evals the result
+    # Reverse of string_zip_base64 + eval
+    # Will be wrapped in ' so single quote is forbidden
+    # Returns:
+    #	$script = 1-liner for perl -e
+    my $script = ::spacefree(0,q{
+	@GNU_Parallel = split /_/, "use_IPC::Open3;_use_MIME::Base64";
+	eval"@GNU_Parallel";
+	$chld = $SIG{CHLD};
+	$SIG{CHLD} = "IGNORE";
+	# Search for bzip2. Not found => use default path
+	my $zip = (grep { -x $_ } "/usr/local/bin/bzip2")[0] || "bzip2";
+	# $in = stdin on $zip, $out = stdout from $zip
+	# Forget my() to save chars for csh
+	# my($in, $out,$eval);
+	open3($in,$out,">&STDERR",$zip,"-dc");
+	if(my $perlpid = fork) {
+	    close $in;
+	    $eval = join "", <$out>;
+	    close $out;
+	} else {
+	    close $out;
+	    # Pipe decoded base64 into 'bzip2 -dc'
+	    print $in (decode_base64(join"",@ARGV));
+	    close $in;
+	    exit;
+	}
+	wait;
+	$SIG{CHLD} = $chld;
+	eval $eval;
+			     });
+    ::debug("base64",$script,"\n");
+    return $script;
+}
+
+sub base64_wrap($) {
+    # base64 encode Perl code
+    # Split it into chunks of < 1000 bytes
+    # Prepend it with a decoder that eval's it
+    # Input:
+    #	$eval_string = Perl code to run
+    # Returns:
+    #	$shell_command = shell command that runs $eval_string
+    my $eval_string = shift;
+    return
+	"perl -e ".
+	::Q(base64_zip_eval())." ".
+	join" ",::shell_quote(string_zip_base64($eval_string));
+}
+
+sub base64_eval($) {
+    # Script that:
+    #	* reads base64 strings from @ARGV
+    #	* decodes them
+    #	* evals the result
+    # Reverse of string_base64 + eval
+    # Will be wrapped in ' so single quote is forbidden.
+    # Spaces are stripped so spaces cannot be significant.
+    # The funny 'use IPC::Open3'-syntax is to avoid spaces and
+    # to make it clear that this is a GNU  Parallel command
+    # when looking at the process table.
+    # Returns:
+    #	$script = 1-liner for perl -e
+    my $script = ::spacefree(0,q{
+	@GNU_Parallel=("use","IPC::Open3;","use","MIME::Base64");
+	eval "@GNU_Parallel";
+	my $eval = decode_base64(join"",@ARGV);
+	eval $eval;
+			     });
+    ::debug("base64",$script,"\n");
+    return $script;
+}
+
+sub sshlogin_wrap($) {
+    # Wrap the command with the commands needed to run remotely
+    # Input:
+    #	$command = command to run
+    # Returns:
+    #	$self->{'sshlogin_wrap'} = command wrapped with ssh+transfer commands
+    sub monitor_parent_sshd_script {
+	# This script is to solve the problem of
+	# * not mixing STDERR and STDOUT
+	# * terminating with ctrl-c
+	# If its parent is ssh: all good
+	# If its parent is init(1): ssh died, so kill children
+	my $monitor_parent_sshd_script;
+
+	if(not $monitor_parent_sshd_script) {
+	    $monitor_parent_sshd_script =
+		# This will be packed in ', so only use "
+		::spacefree
+		(0,'$shell = "'.($ENV{'PARALLEL_SHELL'} || '$ENV{SHELL}').'";'.
+			    '$tmpdir = $ENV{"TMPDIR"} || "'.
+			    ::perl_quote_scalar($ENV{'PARALLEL_REMOTE_TMPDIR'}).'";'.
+			    '$nice = '.$opt::nice.';'.
+			    '$termseq = "'.$opt::termseq.'";'.
+			    # }
+			    q{
+		# Check that $tmpdir is writable
+		-w $tmpdir ||
+		    die("$tmpdir\040is\040not\040writable.".
+			"\040Set\040PARALLEL_REMOTE_TMPDIR");
+		# Set $PARALLEL_TMP to a non-existent file name in $TMPDIR
+		do {
+		    $ENV{PARALLEL_TMP} = $tmpdir."/par".
+			join"", map { (0..9,"a".."z","A".."Z")[rand(62)] } (1..5);
+		} while(-e $ENV{PARALLEL_TMP});
+		# Set $script to a non-existent file name in $TMPDIR
+		do {
+		    $script = $tmpdir."/par-job-$ENV{PARALLEL_SEQ}_".
+			join"", map { (0..9,"a".."z","A".."Z")[rand(62)] } (1..5);
+		} while(-e $script);
+		# Create a script from the hex code
+		# that removes itself and runs the commands
+		open($fh,">",$script) || die;
+		# \040 = space - but we remove spaces in the script
+		# ' needed due to rc-shell
+		print($fh("rm\040\'$script\'\n",$bashfunc.$cmd));
+		close $fh;
+		my $parent = getppid;
+		my $done = 0;
+		$SIG{CHLD} = sub { $done = 1; };
+		$pid = fork;
+		unless($pid) {
+		    # Make own process group to be able to kill HUP it later
+		    eval { setpgrp };
+		    # Set nice value
+		    eval { setpriority(0,0,$nice) };
+		    # Run the script
+		    exec($shell,$script);
+		    die("exec\040failed: $!");
+		}
+		while((not $done) and (getppid == $parent)) {
+		    # Parent pid is not changed, so sshd is alive
+		    # Exponential sleep up to 1 sec
+		    $s = $s < 1 ? 0.001 + $s * 1.03 : $s;
+		    select(undef, undef, undef, $s);
+		}
+		if(not $done) {
+		    # sshd is dead: User pressed Ctrl-C
+		    # Kill as per --termseq
+		    my @term_seq = split/,/,$termseq;
+		    if(not @term_seq) {
+			@term_seq = ("TERM",200,"TERM",100,"TERM",50,"KILL",25);
+		    }
+		    while(@term_seq && kill(0,-$pid)) {
+			kill(shift @term_seq, -$pid);
+			select(undef, undef, undef, (shift @term_seq)/1000);
+		    }
+		}
+		wait;
+		exit ($?&127 ? 128+($?&127) : 1+$?>>8)
+	    });
+	}
+	return $monitor_parent_sshd_script;
+    }
+
+    sub vars_to_export {
+	# Uses:
+	#   @opt::env
+	my @vars = ("parallel_bash_environment");
+	for my $varstring (@opt::env) {
+	    # Split up --env VAR1,VAR2
+	    push @vars, split /,/, $varstring;
+	}
+	for (@vars) {
+	    if(-r $_ and not -d) {
+		# Read as environment definition bug #44041
+		# TODO parse this
+		my $fh = ::open_or_exit($_);
+		$Global::envdef = join("",<$fh>);
+		close $fh;
+	    }
+	}
+	if(grep { /^_$/ } @vars) {
+	    local $/ = "\n";
+	    # --env _
+	    # Include all vars that are not in a clean environment
+	    if(open(my $vars_fh, "<", $Global::config_dir . "/ignored_vars")) {
+		my @ignore = <$vars_fh>;
+		chomp @ignore;
+		my %ignore;
+		@ignore{@ignore} = @ignore;
+		close $vars_fh;
+		push @vars, grep { not defined $ignore{$_} } keys %ENV;
+		@vars = grep { not /^_$/ } @vars;
+	    } else {
+		::error("Run '$Global::progname --record-env' ".
+			"in a clean environment first.");
+		::wait_and_exit(255);
+	    }
+	}
+	# Duplicate vars as BASH functions to include post-shellshock functions (v1+v2)
+	# So --env myfunc should look for BASH_FUNC_myfunc() and BASH_FUNC_myfunc%%
+
+	push(@vars, "PARALLEL_PID", "PARALLEL_SEQ",
+	     "PARALLEL_SSHLOGIN", "PARALLEL_SSHHOST",
+	     "PARALLEL_HOSTGROUPS", "PARALLEL_ARGHOSTGROUPS",
+	     "PARALLEL_JOBSLOT", $opt::process_slot_var,
+	     map { ("BASH_FUNC_$_()", "BASH_FUNC_$_%%") } @vars);
+	# Keep only defined variables
+	return grep { defined($ENV{$_}) } @vars;
+    }
+
+    sub env_as_eval {
+	# Returns:
+	#   $eval = '$ENV{"..."}=...; ...'
+	my @vars = vars_to_export();
+	my $csh_friendly = not grep { /\n/ } @ENV{@vars};
+	my @bash_functions = grep { substr($ENV{$_},0,4) eq "() {" } @vars;
+	my @non_functions = (grep { !/PARALLEL_ENV/ }
+			     grep { substr($ENV{$_},0,4) ne "() {" } @vars);
+
+	# eval of @envset will set %ENV
+	my $envset = join"", map {
+	    '$ENV{"'.::perl_quote_scalar($_).'"}="'.
+		::perl_quote_scalar($ENV{$_}).'";'; } @non_functions;
+
+	# running @bashfunc on the command line, will set the functions
+	my @bashfunc = map {
+	    my $v=$_;
+	    s/BASH_FUNC_(.*)(\(\)|%%)/$1/;
+	    "$_$ENV{$v};\nexport -f $_ 2> /dev/null;\n" } @bash_functions;
+	# eval $bashfuncset will set $bashfunc
+	my $bashfuncset;
+	if(@bashfunc) {
+	    # Functions are not supported for all shells
+	    if($Global::shell !~ m:(^|/)(ash|bash|rbash|zsh|rzsh|dash|ksh):) {
+		::warning("Shell functions may not be supported in $Global::shell.");
+	    }
+	    $bashfuncset =
+		'@bash_functions=qw('."@bash_functions".");".
+		::spacefree(1,'$shell="'.($ENV{'PARALLEL_SHELL'} || '$ENV{SHELL}').'";'.q{
+		    if($shell=~/csh/) {
+			print STDERR "CSH/TCSH DO NOT SUPPORT newlines IN VARIABLES/FUNCTIONS. Unset @bash_functions\n";
+			exec "false";
+		    }
+			    }).
+				"\n".'$bashfunc = "'.::perl_quote_scalar("@bashfunc").'";';
+	} else {
+	    $bashfuncset = '$bashfunc = "";'
+	}
+	if($ENV{'parallel_bash_environment'}) {
+	    $bashfuncset .= '$bashfunc .= "eval\ \"\$parallel_bash_environment\"\;";';
+	}
+	::debug("base64",$envset,$bashfuncset,"\n");
+	return $csh_friendly,$envset,$bashfuncset;
+    }
+
+    my $self = shift;
+    my $command = shift;
+    # TODO test that *sh -c 'parallel --env' use *sh
+    if(not defined $self->{'sshlogin_wrap'}{$command}) {
+	my $sshlogin = $self->sshlogin();
+	$ENV{'PARALLEL_SEQ'} = $self->seq();
+	$ENV{$opt::process_slot_var} = -1 +
+	    ($ENV{'PARALLEL_JOBSLOT'} = $self->slot());
+	$ENV{'PARALLEL_SSHLOGIN'} = $sshlogin->string();
+	$ENV{'PARALLEL_SSHHOST'} = $sshlogin->host();
+	if ($opt::hostgroups) {
+	    $ENV{'PARALLEL_HOSTGROUPS'} = join '+', $sshlogin->hostgroups();
+	    $ENV{'PARALLEL_ARGHOSTGROUPS'} = join '+', $self->hostgroups();
+	}
+	$ENV{'PARALLEL_PID'} = $$;
+	if($sshlogin->local()) {
+	    if($opt::workdir) {
+		# Create workdir if needed. Then cd to it.
+		my $wd = $self->workdir();
+		if($opt::workdir eq "." or $opt::workdir eq "...") {
+		    # If $wd does not start with '/': Prepend $HOME
+		    $wd =~ s:^([^/]):$ENV{'HOME'}/$1:;
+		}
+		::mkdir_or_die($wd);
+		my $post = "";
+		if($opt::workdir eq "...") {
+		    $post = ";".exitstatuswrapper("rm -rf ".::Q($wd).";");
+
+		}
+		$command = "cd ".::Q($wd)." || exit 255; " .
+		    $command . $post;;
+	    }
+	    if(@opt::env) {
+		# Prepend with environment setter, which sets functions in zsh
+		my ($csh_friendly,$envset,$bashfuncset) = env_as_eval();
+		my $perl_code = $envset.$bashfuncset.
+		    '@ARGV="'.::perl_quote_scalar($command).'";'.
+		    "exec\"$Global::shell\",\"-c\",\(\$bashfunc.\"\@ARGV\"\)\;die\"exec:\$\!\\n\"\;";
+		if(length $perl_code > 999
+		   or
+		   not $csh_friendly
+		   or
+		   $command =~ /\n/) {
+		    # csh does not deal well with > 1000 chars in one word
+		    # csh does not deal well with $ENV with \n
+		    $self->{'sshlogin_wrap'}{$command} = base64_wrap($perl_code);
+		} else {
+		    $self->{'sshlogin_wrap'}{$command} = "perl -e ".::Q($perl_code);
+		}
+	    } else {
+		$self->{'sshlogin_wrap'}{$command} = $command;
+	    }
+	} else {
+	    my $pwd = "";
+	    if($opt::workdir) {
+		# Create remote workdir if needed. Then cd to it.
+		my $wd = ::pQ($self->workdir());
+		$pwd = qq{system("mkdir","-p","--","$wd"); chdir "$wd" ||}.
+		    qq{print(STDERR "parallel: Cannot chdir to $wd\\n") &&}.
+		    qq{exit 255;};
+	    }
+	    my ($csh_friendly,$envset,$bashfuncset) = env_as_eval();
+	    my $cmd = $command;
+	    # q// does not quote \, so we must do that
+	    $cmd =~ s/\\/\\\\/g;
+
+	    my $remote_command = $sshlogin->hexwrap
+		($pwd.$envset.$bashfuncset.'$cmd='."q\0".$cmd."\0;".
+		 monitor_parent_sshd_script());
+	    my ($pre,$post,$cleanup)=("","","");
+	    # --transfer
+	    $pre .= $self->sshtransfer();
+	    # --return
+	    $post .= $self->sshreturn();
+	    # --cleanup
+	    $post .= $self->sshcleanup();
+	    if($post) {
+		# We need to save the exit status of the job
+		$post = exitstatuswrapper($post);
+	    }
+	    $self->{'sshlogin_wrap'}{$command} =
+		($pre
+		 . $sshlogin->wrap($remote_command)
+		 . ";"
+		 . $post);
+	}
+    }
+    return $self->{'sshlogin_wrap'}{$command};
+}
+
+sub fill_templates($) {
+    # Replace replacement strings in template(s)
+    # Returns:
+    #	@templates - File names of replaced templates
+    my $self = shift;
+
+    if(%opt::template) {
+	my @template_name =
+	    map { $self->{'commandline'}->replace_placeholders([$_],0,0) }
+	@{$self->{'commandline'}{'template_names'}};
+	::debug("tmpl","Names: @template_name\n");
+	for(my $i = 0; $i <= $#template_name; $i++) {
+	    open(my $fh, ">", $template_name[$i]) || die;
+	    print $fh $self->{'commandline'}->
+		replace_placeholders([$self->{'commandline'}
+				      {'template_contents'}[$i]],0,0);
+	    close $fh;
+	}
+	if($opt::cleanup) {
+	    $self->add_rm(@template_name);
+	}
+    }
+}
+
+sub filter($) {
+    # Replace replacement strings in filter(s) and evaluate them
+    # Returns:
+    #	$run - 1=yes, undef=no
+    my $self = shift;
+    my $run = 1;
+    if(@opt::filter) {
+	for my $eval ($self->{'commandline'}->
+		      replace_placeholders(\@opt::filter,0,0)) {
+	    $run &&= eval $eval;
+	}
+	$self->{'commandline'}{'skip'} ||= not $run;
+    }
+    return $run;
+}
+
+sub transfer($) {
+    # Files to transfer
+    # Non-quoted and with {...} substituted
+    # Returns:
+    #	@transfer - File names of files to transfer
+    my $self = shift;
+
+    my $transfersize = 0;
+    my @transfer = $self->{'commandline'}->
+	replace_placeholders($self->{'commandline'}{'transfer_files'},0,0);
+    for(@transfer) {
+	# filesize
+	if(-e $_) {
+	    $transfersize += (stat($_))[7];
+	}
+    }
+    $self->add_transfersize($transfersize);
+    return @transfer;
+}
+
+sub transfersize($) {
+    my $self = shift;
+    return $self->{'transfersize'};
+}
+
+sub add_transfersize($) {
+    my $self = shift;
+    my $transfersize = shift;
+    $self->{'transfersize'} += $transfersize;
+    $opt::sqlworker and
+	$Global::sql->update("SET Send = ? WHERE Seq = ".$self->seq(),
+			     $self->{'transfersize'});
+}
+
+sub sshtransfer($) {
+    # Returns for each transfer file:
+    #	rsync $file remote:$workdir
+    my $self = shift;
+    my @pre;
+    my $sshlogin = $self->sshlogin();
+    my $workdir = $self->workdir();
+    for my $file ($self->transfer()) {
+	push @pre, $sshlogin->rsync_transfer_cmd($file,$workdir).";";
+    }
+    return join("",@pre);
+}
+
+sub return($) {
+    # Files to return
+    # Non-quoted and with {...} substituted
+    # Returns:
+    #	@non_quoted_filenames
+    my $self = shift;
+    return $self->{'commandline'}->
+	replace_placeholders($self->{'commandline'}{'return_files'},0,0);
+}
+
+sub returnsize($) {
+    # This is called after the job has finished
+    # Returns:
+    #	$number_of_bytes transferred in return
+    my $self = shift;
+    for my $file ($self->return()) {
+	if(-e $file) {
+	    $self->{'returnsize'} += (stat($file))[7];
+	}
+    }
+    return $self->{'returnsize'};
+}
+
+sub add_returnsize($) {
+    my $self = shift;
+    my $returnsize = shift;
+    $self->{'returnsize'} += $returnsize;
+    $opt::sqlworker and
+	$Global::sql->update("SET Receive = ? WHERE Seq = ".$self->seq(),
+			     $self->{'returnsize'});
+}
+
+sub sshreturn($) {
+    # Returns for each return-file:
+    #	rsync remote:$workdir/$file .
+    my $self = shift;
+    my $sshlogin = $self->sshlogin();
+    my $pre = "";
+    for my $file ($self->return()) {
+	$file =~ s:^\./::g; # Remove ./ if any
+	my $relpath = ($file !~ m:^/:) ||
+	    ($file =~ m:/\./:); # Is the path relative or /./?
+	my $cd = "";
+	my $wd = "";
+	if($relpath) {
+	    #	rsync -avR /foo/./bar/baz.c remote:/tmp/
+	    # == (on old systems)
+	    #	rsync -avR --rsync-path="cd /foo; rsync" remote:bar/baz.c /tmp/
+	    $wd = ::shell_quote_file($self->workdir()."/");
+	}
+	# Only load File::Basename if actually needed
+	$Global::use{"File::Basename"} ||= eval "use File::Basename; 1;";
+	# dir/./file means relative to dir, so remove dir on remote
+	$file =~ m:(.*)/\./:;
+	my $basedir = $1 ? ::shell_quote_file($1."/") : "";
+	my $nobasedir = $file;
+	$nobasedir =~ s:.*/\./::;
+	$cd = ::shell_quote_file(::dirname($nobasedir));
+	my $rsync_cd = '--rsync-path='.::Q("cd $wd$cd; rsync");
+	my $basename = ::Q(::shell_quote_file(::basename($file)));
+	# --return
+	#   mkdir -p /home/tange/dir/subdir/;
+	#   rsync (--protocol 30) -rlDzR
+	#     --rsync-path="cd /home/tange/dir/subdir/; rsync"
+	#     server:file.gz /home/tange/dir/subdir/
+	$pre .= "mkdir -p $basedir$cd" . " && " .
+	    $sshlogin->rsync(). " $rsync_cd -- ".$sshlogin->host().':'.
+	    $basename . " ".$basedir.$cd.";";
+    }
+    return $pre;
+}
+
+sub sshcleanup($) {
+    # Return the sshcommand needed to remove the file
+    # Returns:
+    #	ssh command needed to remove files from sshlogin
+    my $self = shift;
+    my $sshlogin = $self->sshlogin();
+    my $workdir = $self->workdir();
+    my $cleancmd = "";
+
+    for my $file ($self->remote_cleanup()) {
+	my @subworkdirs = parentdirs_of($file);
+	$cleancmd .= $sshlogin->cleanup_cmd($file,$workdir).";";
+    }
+    if(defined $opt::workdir and $opt::workdir eq "...") {
+	$cleancmd .= $sshlogin->wrap("rm -rf " . ::Q($workdir).';');
+    }
+    return $cleancmd;
+}
+
+sub remote_cleanup($) {
+    # Returns:
+    #	Files to remove at cleanup
+    my $self = shift;
+    if($opt::cleanup) {
+	my @transfer = $self->transfer();
+	my @return = $self->return();
+	return (@transfer,@return);
+    } else {
+	return ();
+    }
+}
+
+sub exitstatuswrapper(@) {
+    # Input:
+    #	@shellcode = shell code to execute
+    # Returns:
+    #	shell script that returns current status after executing @shellcode
+    if($Global::cshell) {
+	return ('set _EXIT_status=$status; ' .
+		join(" ",@_).
+		'exit $_EXIT_status;');
+    } else {
+	return ('_EXIT_status=$?; ' .
+		join(" ",@_).
+		'exit $_EXIT_status;');
+    }
+}
+
+sub workdir($) {
+    # Returns:
+    #	the workdir on a remote machine
+    my $self = shift;
+    if(not defined $self->{'workdir'}) {
+	my $workdir;
+	if(defined $opt::workdir) {
+	    if($opt::workdir eq ".") {
+		# . means current dir
+		my $home = $ENV{'HOME'};
+		eval 'use Cwd';
+		my $cwd = cwd();
+		$workdir = $cwd;
+		if($home) {
+		    # If homedir exists: remove the homedir from
+		    # workdir if cwd starts with homedir
+		    # E.g. /home/foo/my/dir => my/dir
+		    # E.g. /tmp/my/dir => /tmp/my/dir
+		    my ($home_dev, $home_ino) = (stat($home))[0,1];
+		    my $parent = "";
+		    my @dir_parts = split(m:/:,$cwd);
+		    my $part;
+		    while(defined ($part = shift @dir_parts)) {
+			$part eq "" and next;
+			$parent .= "/".$part;
+			my ($parent_dev, $parent_ino) = (stat($parent))[0,1];
+			if($parent_dev == $home_dev and $parent_ino == $home_ino) {
+			    # dev and ino is the same: We found the homedir.
+			    $workdir = join("/",@dir_parts);
+			    last;
+			}
+		    }
+		}
+		if($workdir eq "") {
+		    $workdir = ".";
+		}
+	    } elsif($opt::workdir eq "...") {
+		$workdir = ".parallel/tmp/" . ::hostname() . "-" . $$
+		    . "-" . $self->seq();
+	    } else {
+		$workdir = $self->{'commandline'}->
+		    replace_placeholders([$opt::workdir],0,0);
+		#$workdir = $opt::workdir;
+		# Rsync treats /./ special. We dont want that
+		$workdir =~ s:/\./:/:g; # Remove /./
+		$workdir =~ s:(.)/+$:$1:; # Remove ending / if any
+		$workdir =~ s:^\./::g; # Remove starting ./ if any
+	    }
+	} else {
+	    $workdir = ".";
+	}
+	$self->{'workdir'} = $workdir;
+    }
+    return $self->{'workdir'};
+}
+
+sub parentdirs_of($) {
+    # Return:
+    #	all parentdirs except . of this dir or file - sorted desc by length
+    my $d = shift;
+    my @parents = ();
+    while($d =~ s:/[^/]+$::) {
+	if($d ne ".") {
+	    push @parents, $d;
+	}
+    }
+    return @parents;
+}
+
+sub start($) {
+    # Setup STDOUT and STDERR for a job and start it.
+    # Returns:
+    #	job-object or undef if job not to run
+
+    sub open3_setpgrp_internal {
+	# Run open3+setpgrp followed by the command
+	# Input:
+	#   $stdin_fh = Filehandle to use as STDIN
+	#   $stdout_fh = Filehandle to use as STDOUT
+	#   $stderr_fh = Filehandle to use as STDERR
+	#   $command = Command to run
+	# Returns:
+	#   $pid = Process group of job started
+	my ($stdin_fh,$stdout_fh,$stderr_fh,$command) = @_;
+	my $pid;
+	local (*OUT,*ERR);
+	open OUT, '>&', $stdout_fh or ::die_bug("Can't dup STDOUT: $!");
+	open ERR, '>&', $stderr_fh or ::die_bug("Can't dup STDERR: $!");
+	# The eval is needed to catch exception from open3
+	eval {
+	    if(not $pid = ::open3($stdin_fh, ">&OUT", ">&ERR", "-")) {
+		# Each child gets its own process group to make it safe to killall
+		eval{ setpgrp(0,0) };
+		eval{ setpriority(0,0,$opt::nice) };
+		exec($Global::shell,"-c",$command)
+		    || ::die_bug("open3-$stdin_fh ".substr($command,0,200));
+	    }
+	};
+	return $pid;
+    }
+
+    sub open3_setpgrp_external {
+	# Run open3 on $command wrapped with a perl script doing setpgrp
+	# Works on systems that do not support open3(,,,"-")
+	# Input:
+	#   $stdin_fh = Filehandle to use as STDIN
+	#   $stdout_fh = Filehandle to use as STDOUT
+	#   $stderr_fh = Filehandle to use as STDERR
+	#   $command = Command to run
+	# Returns:
+	#   $pid = Process group of job started
+	my ($stdin_fh,$stdout_fh,$stderr_fh,$command) = @_;
+	local (*OUT,*ERR);
+	open OUT, '>&', $stdout_fh or ::die_bug("Can't dup STDOUT: $!");
+	open ERR, '>&', $stderr_fh or ::die_bug("Can't dup STDERR: $!");
+
+	my $pid;
+	my @setpgrp_wrap =
+	    ('perl','-e',
+	     "eval\{setpgrp\}\;eval\{setpriority\(0,0,$opt::nice\)\}\;".
+	     "exec '$Global::shell', '-c', \@ARGV");
+	# The eval is needed to catch exception from open3
+	eval {
+	    $pid = ::open3($stdin_fh, ">&OUT", ">&ERR", @setpgrp_wrap, $command)
+		|| ::die_bug("open3-$stdin_fh");
+	    1;
+	};
+	return $pid;
+    }
+
+    sub redefine_open3_setpgrp {
+	my $setgprp_cache = shift;
+	# Select and run open3_setpgrp_internal/open3_setpgrp_external
+	no warnings 'redefine';
+	my ($outfh,$name) = ::tmpfile(SUFFIX => ".tst");
+	# Test to see if open3(x,x,x,"-") is fully supported
+	# Can an exported bash function be called via open3?
+	my $script = 'if($pid=::open3($i,$o,$e,"-")) { wait; } '.
+	    'else { exec("bash","-c","testfun && true"); }';
+	my $bash =
+	    ::shell_quote_scalar_default(
+	    "testfun() { rm $name; }; export -f testfun; ".
+	    "perl -MIPC::Open3 -e ".
+	    ::shell_quote_scalar_default($script)
+	    );
+	my $redefine_eval;
+	# Redirect STDERR temporarily,
+	# so errors on MacOS X are ignored.
+	open my $saveerr, ">&STDERR";
+	open STDERR, '>', "/dev/null";
+	# Run the test
+	::debug("init",qq{bash -c $bash 2>/dev/null});
+	qx{ bash -c $bash 2>/dev/null };
+	open STDERR, ">&", $saveerr;
+
+	if(-e $name) {
+	    # Does not support open3(x,x,x,"-")
+	    # or does not have bash:
+	    # Use (slow) external version
+	    unlink($name);
+	    $redefine_eval = '*open3_setpgrp = \&open3_setpgrp_external';
+	    ::debug("init","open3_setpgrp_external chosen\n");
+	} else {
+	    # Supports open3(x,x,x,"-")
+	    # This is 0.5 ms faster to run
+	    $redefine_eval = '*open3_setpgrp = \&open3_setpgrp_internal';
+	    ::debug("init","open3_setpgrp_internal chosen\n");
+	}
+	if(open(my $fh, ">", $setgprp_cache)) {
+	    print $fh $redefine_eval;
+	    close $fh;
+	} else {
+	    ::debug("init","Cannot write to $setgprp_cache");
+	}
+	eval $redefine_eval;
+    }
+
+    sub open3_setpgrp {
+	my $setgprp_cache = $Global::cache_dir . "/tmp/sshlogin/" .
+	    ::hostname() . "/setpgrp_func";
+	sub read_cache() {
+	    -e $setgprp_cache || return 0;
+	    local $/ = undef;
+	    open(my $fh, "<", $setgprp_cache) || return 0;
+	    eval <$fh> || return 0;
+	    close $fh;
+	    return 1;
+	}
+	if(not read_cache()) {
+	    redefine_open3_setpgrp($setgprp_cache);
+	}
+	# The sub is now redefined. Call it
+	return open3_setpgrp(@_);
+    }
+
+    my $job = shift;
+    # Get the shell command to be executed (possibly with ssh infront).
+    my $command = $job->wrapped();
+    my $pid;
+
+    if($Global::interactive or $Global::stderr_verbose) {
+	$job->interactive_start();
+    }
+    # Must be run after $job->interactive_start():
+    # $job->interactive_start() may call $job->skip()
+    if($job->{'commandline'}{'skip'}
+       or
+       not $job->filter()) {
+	# $job->skip() was called or job filtered
+	$command = "true";
+    }
+    $job->openoutputfiles();
+    $job->print_verbose_dryrun();
+    my($stdout_fh,$stderr_fh) = ($job->fh(1,"w"),$job->fh(2,"w"));
+    if($opt::dryrun or $opt::sqlmaster) { $command = "true"; }
+    $ENV{'PARALLEL_SEQ'} = $job->seq();
+    $ENV{'PARALLEL_PID'} = $$;
+    $ENV{$opt::process_slot_var} = -1 +
+	($ENV{'PARALLEL_JOBSLOT'} = $job->slot());
+    $ENV{'PARALLEL_TMP'} = ::tmpname("par");
+    $job->add_rm($ENV{'PARALLEL_TMP'});
+    $job->fill_templates();
+    $ENV{'SSHPASS'} = $job->{'sshlogin'}->{'password'};
+    ::debug("run", $Global::total_running, " processes . Starting (",
+	    $job->seq(), "): $command\n");
+    if($opt::pipe) {
+	my ($stdin_fh) = ::gensym();
+	$pid = open3_setpgrp($stdin_fh,$stdout_fh,$stderr_fh,$command);
+	if($opt::roundrobin and not $opt::keeporder) {
+	    # --keep-order will make sure the order will be reproducible
+	    ::set_fh_non_blocking($stdin_fh);
+	}
+	$job->set_fh(0,"w",$stdin_fh);
+	if($opt::tee or $opt::shard or $opt::bin) { $job->set_virgin(0); }
+    } elsif(($opt::tty or $opt::open_tty) and -c "/dev/tty" and
+	    open(my $devtty_fh, "<", "/dev/tty")) {
+	# Give /dev/tty to the command if no one else is using it
+	# The eval is needed to catch exception from open3
+	local (*IN,*OUT,*ERR);
+	open OUT, '>&', $stdout_fh or ::die_bug("Can't dup STDOUT: $!");
+	open ERR, '>&', $stderr_fh or ::die_bug("Can't dup STDERR: $!");
+	*IN = $devtty_fh;
+	# The eval is needed to catch exception from open3
+	my @wrap = ('perl','-e',
+			    "eval\{setpriority\(0,0,$opt::nice\)\}\;".
+			    "exec '$Global::shell', '-c', \@ARGV");
+	eval {
+	    $pid = ::open3("<&IN", ">&OUT", ">&ERR", @wrap, $command)
+		|| ::die_bug("open3-/dev/tty");
+	    1;
+	};
+	close $devtty_fh;
+	$job->set_virgin(0);
+    } elsif($Global::semaphore) {
+	# Allow sem to read from stdin
+	$pid = open3_setpgrp("<&STDIN",$stdout_fh,$stderr_fh,$command);
+	$job->set_virgin(0);
+    } else {
+	$pid = open3_setpgrp(::gensym(),$stdout_fh,$stderr_fh,$command);
+	$job->set_virgin(0);
+    }
+    if($pid) {
+	# A job was started
+	$Global::total_running++;
+	$Global::total_started++;
+	$job->set_pid($pid);
+	$job->set_starttime();
+	$Global::running{$job->pid()} = $job;
+	if($opt::timeout) {
+	    $Global::timeoutq->insert($job);
+	}
+	$Global::newest_job = $job;
+	$Global::newest_starttime = ::now();
+	return $job;
+    } else {
+	# No more processes
+	::debug("run", "Cannot spawn more jobs.\n");
+	return undef;
+    }
+}
+
+sub interactive_start($) {
+    my $self = shift;
+    my $command = $self->wrapped();
+    if($Global::interactive) {
+	my $answer;
+	::status_no_nl("$command ?...");
+	do{
+	    open(my $tty_fh, "<", "/dev/tty") || ::die_bug("interactive-tty");
+	    $answer = <$tty_fh>;
+	    close $tty_fh;
+	    # Sometime we get an empty string (not even \n)
+	    # Do not know why, so let us just ignore it and try again
+	} while(length $answer < 1);
+	if (not ($answer =~ /^\s*y/i)) {
+	    $self->{'commandline'}->skip();
+	}
+    } else {
+	print $Global::original_stderr "$command\n";
+    }
+}
+
+{
+    my $tmuxsocket;
+
+    sub tmux_wrap($) {
+	# Wrap command with tmux for session pPID
+	# Input:
+	#   $actual_command = the actual command being run (incl ssh wrap)
+	my $self = shift;
+	my $actual_command = shift;
+	# Temporary file name. Used for fifo to communicate exit val
+	my $tmpfifo = ::tmpname("tmx");
+	$self->add_rm($tmpfifo);
+
+	if(length($tmpfifo) >=100) {
+	    ::error("tmux does not support sockets with path > 100.");
+	    ::wait_and_exit(255);
+	}
+	if($opt::tmuxpane) {
+	    # Move the command into a pane in window 0
+	    $actual_command = $ENV{'PARALLEL_TMUX'}.' joinp -t :0 ; '.
+		$ENV{'PARALLEL_TMUX'}.' select-layout -t :0 tiled ; '.
+		$actual_command;
+	}
+	my $visual_command = $self->replaced();
+	my $title = $visual_command;
+	if($visual_command =~ /\0/) {
+	    ::error("Command line contains NUL. tmux is confused by NUL.");
+	    ::wait_and_exit(255);
+	}
+	# ; causes problems
+	# ascii 194-245 annoys tmux
+	$title =~ tr/[\011-\016;\302-\365]/ /s;
+	$title = ::Q($title);
+
+	my $l_act = length($actual_command);
+	my $l_tit = length($title);
+	my $l_fifo = length($tmpfifo);
+	# The line to run contains a 118 chars extra code + the title 2x
+	my $l_tot = 2 * $l_tit + $l_act + $l_fifo;
+
+	my $quoted_space75 = ::Q(" ")x75;
+	while($l_tit < 1000 and
+	      (
+	       (890 < $l_tot and $l_tot < 1350)
+	       or
+	       (9250 < $l_tot and $l_tot < 9800)
+	      )) {
+	    # tmux blocks for certain lengths:
+	    # 900 < title + command < 1200
+	    # 9250 < title + command < 9800
+	    # but only if title < 1000, so expand the title with 75 spaces
+	    # The measured lengths are:
+	    # 996 < (title + whole command) < 1127
+	    # 9331 < (title + whole command) < 9636
+	    $title .= $quoted_space75;
+	    $l_tit = length($title);
+	    $l_tot = 2 * $l_tit + $l_act + $l_fifo;
+	}
+
+	my $tmux;
+	$ENV{'PARALLEL_TMUX'} ||= "tmux";
+	if(not $tmuxsocket) {
+	    $tmuxsocket = ::tmpname("tms");
+	    ::debug("tmux", "Start: $ENV{'PARALLEL_TMUX'} -S $tmuxsocket attach");
+	    if($opt::fg) {
+		if(not fork) {
+		    # Run tmux in the foreground
+		    # Wait for the socket to appear
+		    while (not -e $tmuxsocket) { }
+		    `$ENV{'PARALLEL_TMUX'} -S $tmuxsocket attach`;
+		    exit;
+		}
+	    }
+	    ::status("See output with: $ENV{'PARALLEL_TMUX'} -S $tmuxsocket attach");
+	}
+	$tmux = "sh -c '".
+	    $ENV{'PARALLEL_TMUX'}.
+	    " -S $tmuxsocket new-session -s p$$ -d \"sleep .2\" >/dev/null 2>&1';" .
+	    $ENV{'PARALLEL_TMUX'}.
+	    " -S $tmuxsocket new-window -t p$$ -n $title";
+
+	::debug("tmux", "title len:", $l_tit, " act ", $l_act, " max ",
+		$Limits::Command::line_max_len, " tot ",
+		$l_tot, "\n");
+
+	return "mkfifo $tmpfifo && $tmux ".
+	    # Run in tmux
+	    ::Q
+	    (
+	     "(".$actual_command.');'.
+	     # The triple print is needed - otherwise the testsuite fails
+	     q[ perl -e 'while($t++<3){ print $ARGV[0],"\n" }' $?h/$status >> ].
+	     $tmpfifo."&".
+	     "echo $title; echo \007Job finished at: `date`;sleep 10"
+	    ).
+	    # Run outside tmux
+	    # Read a / separated line: 0h/2 for csh, 2/0 for bash.
+	    # If csh the first will be 0h, so use the second as exit value.
+	    # Otherwise just use the first value as exit value.
+	    q{; exec perl -e '$/="/";$_=<>;$c=<>;unlink $ARGV; }.
+	    q{/(\d+)h/ and exit($1);exit$c' }.$tmpfifo;
+    }
+}
+
+sub is_already_in_results($) {
+    # Do we already have results for this job?
+    # Returns:
+    #	$job_already_run = bool whether there is output for this or not
+    my $job = $_[0];
+    if($Global::csvsep) {
+	if($opt::joblog) {
+	    # OK: You can look for job run in joblog
+	    return 0
+	} else {
+	    ::warning_once(
+		  "--resume --results .csv/.tsv/.json is not supported yet\n");
+	    # TODO read and parse the file
+	    return 0
+	}
+    }
+    my $out = $job->{'commandline'}->results_out();
+    ::debug("run", "Test ${out}stdout", -e "${out}stdout", "\n");
+    return(-e $out."stdout" or -f $out);
+}
+
+sub is_already_in_joblog($) {
+    my $job = shift;
+    return vec($Global::job_already_run,$job->seq(),1);
+}
+
+sub set_job_in_joblog($) {
+    my $job = shift;
+    vec($Global::job_already_run,$job->seq(),1) = 1;
+}
+
+sub should_be_retried($) {
+    # Should this job be retried?
+    # Returns
+    #	0 - do not retry
+    #	1 - job queued for retry
+    my $self = shift;
+    if (not defined $opt::retries) { return 0; }
+    if(not $self->exitstatus() and not $self->exitsignal()) {
+	# Completed with success. If there is a recorded failure: forget it
+	$self->reset_failed_here();
+	return 0;
+    } else {
+	# The job failed. Should it be retried?
+	$self->add_failed_here();
+	my $retries = $self->{'commandline'}->
+	    replace_placeholders([$opt::retries],0,0);
+	# 0 = Inf
+	if($retries == 0) { $retries = 2**31; }
+	# Ignore files already unlinked to avoid memory leak
+	$self->{'unlink'} = [ grep { -e $_ } @{$self->{'unlink'}} ];
+	map { -e $_ or delete $Global::unlink{$_} } keys %Global::unlink;
+	if($self->total_failed() == $retries) {
+	    # This has been retried enough
+	    return 0;
+	} else {
+	    # This command should be retried
+	    $self->set_endtime(undef);
+	    $self->reset_exitstatus();
+	    $Global::JobQueue->unget($self);
+	    ::debug("run", "Retry ", $self->seq(), "\n");
+	    return 1;
+	}
+    }
+}
+
+{
+    my (%print_later,$job_seq_to_print);
+
+    sub print_earlier_jobs($) {
+	# Print jobs whose output is postponed due to --keep-order
+	# Returns: N/A
+	my $job = shift;
+	$print_later{$job->seq()} = $job;
+	$job_seq_to_print ||= 1;
+	my $returnsize = 0;
+	::debug("run", "Looking for: $job_seq_to_print ",
+		"This: ", $job->seq(), "\n");
+	for(;vec($Global::job_already_run,$job_seq_to_print,1);
+	    $job_seq_to_print++) {}
+	while(my $j = $print_later{$job_seq_to_print}) {
+	    $returnsize += $j->print();
+	    if($j->endtime()) {
+		# Job finished - look at the next
+		delete $print_later{$job_seq_to_print};
+		$job_seq_to_print++;
+		next;
+	    } else {
+		# Job not finished yet - look at it again next round
+		last;
+	    }
+	}
+	return $returnsize;
+    }
+}
+
+sub print($) {
+    # Print the output of the jobs
+    # Returns: N/A
+    my $self = shift;
+
+    ::debug("print", ">>joboutput ", $self->replaced(), "\n");
+    if($opt::dryrun) {
+	# Nothing was printed to this job:
+	# cleanup tmp files if --files was set
+	::rm($self->fh(1,"name"));
+    }
+    if($opt::pipe and $self->virgin() and not $opt::tee) {
+	# Skip --joblog, --dryrun, --verbose
+    } else {
+	if($opt::ungroup) {
+	    # NULL returnsize = 0 returnsize
+	    $self->returnsize() or $self->add_returnsize(0);
+	    if($Global::joblog and defined $self->{'exitstatus'}) {
+		# Add to joblog when finished
+		$self->print_joblog();
+		# Printing is only relevant for grouped/--line-buffer output.
+		$opt::ungroup and return;
+	    }
+	}
+	# Check for disk full
+	::exit_if_disk_full();
+    }
+
+    my $returnsize = $self->returnsize();
+    my @fdno;
+    if($opt::latestline) {
+	@fdno = (1);
+    } else {
+	@fdno = (sort { $a <=> $b } keys %Global::fh);
+    }
+    for my $fdno (@fdno) {
+	# Sort by file descriptor numerically: 1,2,3,..,9,10,11
+	$fdno == 0 and next;
+	my $out_fh = $Global::fh{$fdno};
+	my $in_fh = $self->fh($fdno,"r");
+	if(not $in_fh) {
+	    if(not $Job::file_descriptor_warning_printed{$fdno}++) {
+		# ::warning("File descriptor $fdno not defined\n");
+	    }
+	    next;
+	}
+	::debug("print", "File descriptor $fdno (", $self->fh($fdno,"name"), "):\n");
+	if($Global::linebuffer) {
+	    # Line buffered print out
+	    $self->print_linebuffer($fdno,$in_fh,$out_fh);
+	} elsif($opt::files) {
+	    $self->print_files($fdno,$in_fh,$out_fh);
+	} elsif($opt::results) {
+	    $self->print_results($fdno,$in_fh,$out_fh);
+	} else {
+	    $self->print_normal($fdno,$in_fh,$out_fh);
+	}
+	flush $out_fh;
+    }
+    ::debug("print", "<<joboutput\n");
+    if(defined $self->{'exitstatus'}
+       and not ($self->virgin() and $opt::pipe)) {
+	if($Global::joblog and not $opt::sqlworker) {
+	    # Add to joblog when finished
+	    $self->print_joblog();
+	}
+	if($opt::sqlworker and not $opt::results) {
+	    $Global::sql->output($self);
+	}
+	if($Global::csvsep) {
+	    # Add output to CSV when finished
+	    $self->print_csv();
+	}
+	if($Global::jsonout) {
+	    $self->print_json();
+	}
+    }
+    return $returnsize - $self->returnsize();
+}
+
+{
+    my %jsonmap;
+
+    sub print_json($) {
+	my $self = shift;
+	sub jsonquote($) {
+	    my $a = shift;
+	    if(not $jsonmap{"\001"}) {
+		map { $jsonmap{sprintf("%c",$_)} =
+			  sprintf '\u%04x', $_ } 0..31;
+	    }
+	    $a =~ s/\\/\\\\/g;
+	    $a =~ s/\"/\\"/g;
+	    $a =~ s/([\000-\037])/$jsonmap{$1}/g;
+	    return $a;
+	}
+
+	my $cmd;
+	if($Global::verbose <= 1) {
+	    $cmd = jsonquote($self->replaced());
+	} else {
+	    # Verbose level > 1: Print the rsync and stuff
+	    $cmd = jsonquote(join " ", @{$self->{'commandline'}});
+	}
+	my $record_ref = $self->{'commandline'}{'arg_list_flat_orig'};
+
+	# Memory optimization: Overwrite with the joined output
+	$self->{'output'}{1} = join("", @{$self->{'output'}{1}});
+	$self->{'output'}{2} = join("", @{$self->{'output'}{2}});
+	# {
+	#   "Seq": 12,
+	#   "Host": "/usr/bin/ssh foo@lo",
+	#   "Starttime": 1608344711.743,
+	#   "JobRuntime": 0.01,
+	#   "Send": 0,
+	#   "Receive": 10,
+	#   "Exitval": 0,
+	#   "Signal": 0,
+	#   "Command": "echo 1",
+	#   "V": [
+	#     "1"
+	#   ],
+	#   "Stdout": "1\n",
+	#   "Stderr": ""
+	# }
+	#
+	printf($Global::csv_fh
+	       q({ "Seq": %s, "Host": "%s", "Starttime": %s, "JobRuntime": %s, ).
+	       q("Send": %s, "Receive": %s, "Exitval": %s, "Signal": %s, ).
+	       q("Command": "%s", "V": [ %s ], "Stdout": "%s", "Stderr": "%s" }).
+	       "\n",
+	       $self->seq(),
+	       jsonquote($self->sshlogin()->string()),
+	       $self->starttime(), sprintf("%0.3f",$self->runtime()),
+	       $self->transfersize(), $self->returnsize(),
+	       $self->exitstatus(), $self->exitsignal(), $cmd,
+	       (join ",",
+		map { '"'.jsonquote($_).'"' } @$record_ref[1..$#$record_ref],
+	       ),
+	       jsonquote($self->{'output'}{1}),
+	       jsonquote($self->{'output'}{2})
+	    );
+    }
+}
+
+{
+    my $header_printed;
+
+    sub print_csv($) {
+	my $self = shift;
+	my $cmd;
+	if($Global::verbose <= 1) {
+	    $cmd = $self->replaced();
+	} else {
+	    # Verbose level > 1: Print the rsync and stuff
+	    $cmd = join " ", @{$self->{'commandline'}};
+	}
+	my $record_ref = $self->{'commandline'}{'arg_list_flat_orig'};
+
+	if(not $header_printed) {
+	    # Variable headers
+	    # Normal => V1..Vn
+	    # --header : => first value from column
+	    my @V;
+	    if($opt::header) {
+		my $i = 1;
+		@V = (map { $Global::input_source_header{$i++} }
+		      @$record_ref[1..$#$record_ref]);
+	    } else {
+		my $V = "V1";
+		@V = (map { $V++ } @$record_ref[1..$#$record_ref]);
+	    }
+	    print $Global::csv_fh
+		(map { $$_ }
+		 combine_ref("Seq", "Host", "Starttime", "JobRuntime",
+			     "Send", "Receive", "Exitval", "Signal", "Command",
+			     @V,
+			     "Stdout","Stderr"
+		 )),"\n";
+	    $header_printed++;
+	}
+	# Memory optimization: Overwrite with the joined output
+	$self->{'output'}{1} = join("", @{$self->{'output'}{1}});
+	$self->{'output'}{2} = join("", @{$self->{'output'}{2}});
+	print $Global::csv_fh
+	    (map { $$_ }
+	     combine_ref
+	     ($self->seq(),
+	      $self->sshlogin()->string(),
+	      $self->starttime(), sprintf("%0.3f",$self->runtime()),
+	      $self->transfersize(), $self->returnsize(),
+	      $self->exitstatus(), $self->exitsignal(), \$cmd,
+	      \@$record_ref[1..$#$record_ref],
+	      \$self->{'output'}{1},
+	      \$self->{'output'}{2})),"\n";
+    }
+}
+
+sub combine_ref($) {
+    # Inspired by Text::CSV_PP::_combine (by Makamaka Hannyaharamitu)
+    my @part = @_;
+    my $sep = $Global::csvsep;
+    my $quot = '"';
+    my @out = ();
+
+    my $must_be_quoted;
+    for my $column (@part) {
+	# Memory optimization: Content transferred as reference
+	if(ref $column ne "SCALAR") {
+	    # Convert all columns to scalar references
+	    my $v = $column;
+	    $column = \$v;
+	}
+	if(not defined $$column) {
+	    $$column = '';
+	    next;
+	}
+
+	$must_be_quoted = 0;
+
+	if($$column =~ s/$quot/$quot$quot/go){
+	    # Replace " => ""
+	    $must_be_quoted ||=1;
+	}
+	if($$column =~ /[\s\Q$sep\E]/o){
+	    # Put quotes around if the column contains ,
+	    $must_be_quoted ||=1;
+	}
+
+	$Global::use{"bytes"} ||= eval "use bytes; 1;";
+	if ($$column =~ /\0/) {
+	    # Contains \0 => put quotes around
+	    $must_be_quoted ||=1;
+	}
+	if($must_be_quoted){
+	    push @out, \$sep, \$quot, $column, \$quot;
+	} else {
+	    push @out, \$sep, $column;
+	}
+    }
+    # Remove the first $sep: ,val,"val" => val,"val"
+    shift @out;
+    return @out;
+}
+
+sub print_files($) {
+    # Print the name of the file containing stdout on stdout
+    # Uses:
+    #	$opt::pipe
+    #	$opt::group = Print when job is done
+    #	$opt::linebuffer = Print ASAP
+    # Returns: N/A
+    my $self = shift;
+    my ($fdno,$in_fh,$out_fh) = @_;
+
+    # If the job is dead: close printing fh. Needed for --compress
+    close $self->fh($fdno,"w");
+    if($? and $opt::compress) {
+	::error($opt::compress_program." failed.");
+	$self->set_exitstatus(255);
+    }
+    if($opt::compress) {
+	# Kill the decompressor which will not be needed
+	CORE::kill "TERM", $self->fh($fdno,"rpid");
+    }
+    close $in_fh;
+
+    if($opt::pipe and $self->virgin()) {
+	# Nothing was printed to this job:
+	# cleanup unused tmp files because --files was set
+	for my $fdno (1,2) {
+	    ::rm($self->fh($fdno,"name"));
+	    ::rm($self->fh($fdno,"unlink"));
+	}
+    } elsif($fdno == 1 and $self->fh($fdno,"name")) {
+	print $out_fh $self->tag(),$self->fh($fdno,"name"),"\n";
+	if($Global::membuffer) {
+	    push @{$self->{'output'}{$fdno}},
+		$self->tag(), $self->fh($fdno,"name");
+	}
+	$self->add_returnsize(-s $self->fh($fdno,"name"));
+	# Mark as printed - do not print again
+	$self->set_fh($fdno,"name",undef);
+    }
+}
+
+
+# Different print types
+# (--ll | --ll --bar | --lb | --group | --parset | --sql-worker)
+# (--files | --results (.json|.csv|.tsv) )
+# --color-failed
+# --color
+# --keep-order
+# --tag
+# --bar
+{
+    my ($up,$currow,$maxrow);
+    my ($minvisible,%print_later,%notvisible);
+    my (%binmodeset,%tab);
+
+    sub latestline_init() {
+	# cursor_up cuu1 = up one line
+	$up = `sh -c "tput cuu1 </dev/tty" 2>/dev/null`;
+	chomp($up);
+	$currow = 1;
+	$maxrow = 1;
+	$minvisible = 1;
+	for(0..8) {
+	    $tab{$_} = " "x(8-($_%8));
+	}
+    }
+
+    sub print_latest_line($) {
+	my $self = shift;
+	my $out_fh = shift;
+	my $row = $self->row();
+	# Is row visible?
+	if(not ($minvisible <= $row
+		and
+		$row < $minvisible + ::terminal_rows() - 1)) {
+	    return;
+	}
+	if(not $binmodeset{$out_fh}++) {
+	    # Enable utf8 if possible
+	    eval q{ binmode $out_fh, "encoding(utf8)"; };
+	}
+	my ($color,$reset_color) = $self->color();
+	# Strings with TABs give the wrong length. Untabify strings
+	my $termcol = ::terminal_columns();
+	my $untabify_tag = ::decode_utf8($self->untabtag());
+	my $taglen = length $untabify_tag;
+	my $truncated_tag = "";
+	my $strlen = $termcol - $taglen;
+	my $untabify_str = ::decode_utf8($self->{$out_fh,'latestline'});
+	$untabify_str =~ s/\t/$tab{$-[0]%8}/g;
+	my $strspc = $strlen - length $untabify_str;
+	$strlen--;
+	if($strlen < 0) { $strlen = 0;}
+	# Line is shorter than terminal width: add " "
+	# Line is longer than terminal width: add ">"
+	my $truncated = ($strspc > 0) ? " " : ">";
+	if($taglen > $termcol) {
+	    # Tag is longer than terminal width: add ">" to tag
+	    # Remove $truncated (it will not be shown at all)
+	    $taglen = $termcol - 1;
+	    $truncated_tag = ">";
+	    $truncated = "";
+	}
+
+	$maxrow = $row > $maxrow ? $row : $maxrow;
+	printf($out_fh
+	       ("%s%s%s". # up down \r
+		"%.${taglen}s%s". # tag
+		"%s%.${strlen}s%s%s". # color + line
+		"%s" # down
+	       ),
+	       "$up"x($currow - $row),
+	       "\n"x($row - $currow),
+	       "\r", $untabify_tag,$truncated_tag,
+	       $color, $untabify_str, $truncated, $reset_color,
+	       "\n"x($maxrow - $row + 1));
+	$currow = $maxrow + 1;
+    }
+
+    sub print_linebuffer($) {
+	my $self = shift;
+	my ($fdno,$in_fh,$out_fh) = @_;
+	if(defined $self->{'exitstatus'}) {
+	    # If the job is dead: close printing fh. Needed for --compress
+	    close $self->fh($fdno,"w");
+	    if($opt::compress) {
+		if($?) {
+		    ::error($opt::compress_program." failed.");
+		    $self->set_exitstatus(255);
+		}
+		# Blocked reading in final round
+		for my $fdno (1,2) { ::set_fh_blocking($self->fh($fdno,'r')); }
+	    }
+	    if($opt::latestline) { $print_later{$self->row()} = $self; }
+	}
+	if(not $self->virgin()) {
+	    if($opt::files or ($opt::results and not $Global::csvsep)) {
+		# Print filename
+		if($fdno == 1 and not $self->fh($fdno,"printed")) {
+		    print $out_fh $self->tag(),$self->fh($fdno,"name"),"\n";
+		    if($Global::membuffer) {
+			push(@{$self->{'output'}{$fdno}}, $self->tag(),
+			     $self->fh($fdno,"name"));
+		    }
+		    $self->set_fh($fdno,"printed",1);
+		}
+		# No need for reading $in_fh, as it is from "cat >/dev/null"
+	    } else {
+		# Read halflines and print full lines
+		my $outputlength = 0;
+		my $halfline_ref = $self->{'halfline'}{$fdno};
+		my ($buf,$i,$rv);
+		# 1310720 gives 1.2 GB/s
+		# 131072  gives 0.9 GB/s
+		# The optimal block size differs
+		# It has been measured on:
+		# AMD 6376: 60800 (>70k is also reasonable)
+		# Intel i7-3632QM: 52-59k, 170-175k
+		# seq 64 | ppar --_test $1 --lb \
+		#   'yes {} `seq 1000`|head -c 10000000' >/dev/null
+		while($rv = sysread($in_fh, $buf, 60800)) {
+		    $outputlength += $rv;
+		    # TODO --recend
+		    # Treat both \n and \r as line end
+		    # Only test for \r if there is no \n
+		    # Test:
+		    #   perl -e '$a="x"x1000000;
+		    #	     $b="$a\r$a\n$a\r$a\n";
+		    #	     map { print $b,$_ } 1..10'
+		    $i = ((rindex($buf,"\n")+1) || (rindex($buf,"\r")+1));
+		    if($i) {
+			if($opt::latestline) {
+			    # Keep the latest full line
+			    my $l = join('', @$halfline_ref,
+					 substr($buf,0,$i-1));
+			    my $j = ((rindex($l,"\n")+1) ||
+				     (rindex($l,"\r")+1));
+			    $self->{$out_fh,'latestline'} = substr($l,$j);
+			    # Remove the processed part
+			    # by keeping the unprocessed part
+			    @$halfline_ref = (substr($buf,$i));
+			} else {
+			    # One or more complete lines were found
+			    if($Global::color) {
+				my $print = join("",@$halfline_ref,
+						 substr($buf,0,$i));
+				chomp($print);
+				my ($color,$reset_color) = $self->color();
+				my $colortag = $color.$self->tag();
+				# \n => reset \n color tag
+				$print =~ s{([\n\r])(?=.|$)}
+				{$reset_color$1$colortag}gs;
+				print($out_fh $colortag, $print,
+				      $reset_color, "\n");
+			    } elsif($opt::tag or defined $opt::tagstring) {
+				# Replace ^ with $tag within the full line
+				if($Global::cache_replacement_eval) {
+				    # Replace with the same value for tag
+				    my $tag = $self->tag();
+				    unshift @$halfline_ref, $tag;
+				    # TODO --recend that can be partially in
+				    # @$halfline_ref
+				    substr($buf,0,$i-1) =~
+					s/([\n\r])(?=.|$)/$1$tag/gs;
+				} else {
+				    # Replace with freshly computed tag-value
+				    unshift @$halfline_ref, $self->tag();
+				    substr($buf,0,$i-1) =~
+					s/([\n\r])(?=.|$)/$1.$self->tag()/gse;
+				}
+				# The length changed,
+				# so find the new ending pos
+				$i = ::max((rindex($buf,"\n")+1),
+					   (rindex($buf,"\r")+1));
+				# Print the partial line (halfline)
+				# and the last half
+				print $out_fh @$halfline_ref, substr($buf,0,$i);
+			    } else {
+				# Print the partial line (halfline)
+				# and the last half
+				print $out_fh @$halfline_ref, substr($buf,0,$i);
+			    }
+			    # Buffer in memory for SQL and CSV-output
+			    if($Global::membuffer) {
+				push(@{$self->{'output'}{$fdno}},
+				     @$halfline_ref, substr($buf,0,$i));
+			    }
+			    # Remove the printed part by keeping the unprinted
+			    @$halfline_ref = (substr($buf,$i));
+			}
+		    } else {
+			# No newline, so append to the halfline
+			push @$halfline_ref, $buf;
+		    }
+		}
+		$self->add_returnsize($outputlength);
+		if($opt::latestline) { $self->print_latest_line($out_fh); }
+	    }
+	    if(defined $self->{'exitstatus'}) {
+		if($opt::latestline) {
+		    # Force re-computing color if --colorfailed
+		    if($opt::colorfailed) { delete $self->{'color'}; }
+		    $self->print_latest_line($out_fh);
+		    # Print latest line from jobs that are already done
+		    while($print_later{$minvisible}) {
+			$print_later{$minvisible}->print_latest_line($out_fh);
+			delete $print_later{$minvisible};
+			$minvisible++;
+		    }
+		    # Print latest line from jobs that are on screen now
+		    for(my $row = $minvisible;
+			$row < $minvisible -1 + ::terminal_rows();
+			$row++) {
+			$print_later{$row} and
+			$print_later{$row}->print_latest_line($out_fh);
+		    }
+		}
+		if($opt::files or ($opt::results and not $Global::csvsep)) {
+		    $self->add_returnsize(-s $self->fh($fdno,"name"));
+		} else {
+		    # If the job is dead: print the remaining partial line
+		    # read remaining
+		    my $halfline_ref = $self->{'halfline'}{$fdno};
+		    if(grep /./, @$halfline_ref) {
+			my $returnsize = 0;
+			for(@{$self->{'halfline'}{$fdno}}) {
+			    $returnsize += length $_;
+			}
+			$self->add_returnsize($returnsize);
+			if($opt::tag or defined $opt::tagstring) {
+			    # Prepend $tag the the remaining half line
+			    unshift @$halfline_ref, $self->tag();
+			}
+			# Print the partial line (halfline)
+			print $out_fh @{$self->{'halfline'}{$fdno}};
+			# Buffer in memory for SQL and CSV-output
+			if($Global::membuffer) {
+			    push(@{$self->{'output'}{$fdno}}, @$halfline_ref);
+			}
+			@$halfline_ref = ();
+		    }
+		}
+		if($self->fh($fdno,"rpid") and
+		   CORE::kill 0, $self->fh($fdno,"rpid")) {
+		    # decompress still running
+		} else {
+		    # decompress done: close fh
+		    close $in_fh;
+		    if($? and $opt::compress) {
+			::error($opt::decompress_program." failed.");
+			$self->set_exitstatus(255);
+		    }
+		}
+	    }
+	}
+    }
+}
+
+sub free_ressources() {
+    my $self = shift;
+    if(not $opt::ungroup) {
+	my $fh;
+	for my $fdno (sort { $a <=> $b } keys %Global::fh) {
+	    $fh = $self->fh($fdno,"w");
+	    $fh and close $fh;
+	    $fh = $self->fh($fdno,"r");
+	    $fh and close $fh;
+	}
+    }
+}
+
+sub print_parset($) {
+    # Wrap output with shell script code to set as variables
+    my $self = shift;
+    my ($fdno,$in_fh,$out_fh) = @_;
+    my $outputlength = 0;
+
+    ::debug("parset","print $Global::parset");
+    if($Global::parset eq "assoc") {
+	# Start: (done in parse_parset())
+	#   eval "`echo 'declare -A myassoc; myassoc=(
+	# Each: (done here)
+	#   [$'a\tb']=$'a\tb\tc	 ddd'
+	# End: (done in wait_and_exit())
+	#   )'`"
+	print '[',::Q($self->{'commandline'}->
+		      replace_placeholders(["\257<\257>"],0,0)),']=';
+    } elsif($Global::parset eq "array") {
+	# Start: (done in parse_parset())
+	#   eval "`echo 'myassoc=(
+	# Each: (done here)
+	#   $'a\tb\tc  ddd'
+	# End: (done in wait_and_exit())
+	#   )'`"
+    } elsif($Global::parset eq "var") {
+	# Start: (done in parse_parset())
+	#   <empty>
+	# Each: (done here)
+	#   var=$'a\tb\tc  ddd'
+	# End: (done in wait_and_exit())
+	#   <empty>
+	if(not @Global::parset_vars) {
+	    ::error("Too few named destination variables");
+	    ::wait_and_exit(255);
+	}
+	print shift @Global::parset_vars,"=";
+    }
+    local $/ = "\n";
+    my $tag = $self->tag();
+    my @out;
+    while(<$in_fh>) {
+	$outputlength += length $_;
+	# Tag lines with \r, too
+	$_ =~ s/(?<=[\r])(?=.|$)/$tag/gs;
+	push @out, $tag,$_;
+    }
+    # Remove last newline
+    # This often makes it easier to use the output in shell
+    @out and ${out[$#out]} =~ s/\n$//s;
+    print ::Q(join("",@out)),"\n";
+    return $outputlength;
+}
+
+sub print_normal($) {
+    my $self = shift;
+    my ($fdno,$in_fh,$out_fh) = @_;
+    my $buf;
+    close $self->fh($fdno,"w");
+    if($? and $opt::compress) {
+	::error($opt::compress_program." failed.");
+	$self->set_exitstatus(255);
+    }
+    if(not $self->virgin()) {
+	seek $in_fh, 0, 0;
+	# $in_fh is now ready for reading at position 0
+	my $outputlength = 0;
+	my @output;
+
+	if($Global::parset and $fdno == 1) {
+	    $outputlength += $self->print_parset($fdno,$in_fh,$out_fh);
+	} elsif(defined $opt::tag or defined $opt::tagstring
+		or $Global::color or $opt::colorfailed) {
+	    if($Global::color or $opt::colorfailed) {
+		my ($color,$reset_color) = $self->color();
+		my $colortag = $color.$self->tag();
+		# Read line by line
+		local $/ = "\n";
+		while(<$in_fh>) {
+		    $outputlength += length $_;
+		    # Tag lines with \r, too
+		    chomp;
+		    s{([\n\r])(?=.|$)}{$reset_color$1$colortag}gs;
+		    print $out_fh $colortag,$_,$reset_color,"\n";
+		}
+	    } else {
+		my $tag = $self->tag();
+		my $pretag = 1;
+		my $s;
+		while(sysread($in_fh,$buf,32767)) {
+		    $outputlength += length $buf;
+		    $buf =~ s/(?<=[\r\n])(?=.)/$tag/gs;
+		    print $out_fh ($pretag ? $tag : ""),$buf;
+		    if($Global::membuffer) {
+			push @{$self->{'output'}{$fdno}},
+			    ($pretag ? $tag : ""),$buf;
+		    }
+		    # Should next print start with a tag?
+		    $s = substr($buf, -1);
+		    # This is faster than ($s eq "\n") || ($s eq "\r")
+		    $pretag = ($s eq "\n") ? 1 : ($s eq "\r");
+		}
+	    }
+	} else {
+	    # Most efficient way of copying data from $in_fh to $out_fh
+	    # Intel i7-3632QM: 25k-
+	    while(sysread($in_fh,$buf,32767)) {
+		print $out_fh $buf;
+		$outputlength += length $buf;
+		if($Global::membuffer) {
+		    push @{$self->{'output'}{$fdno}}, $buf;
+		}
+	    }
+	}
+	if($fdno == 1) {
+	    $self->add_returnsize($outputlength);
+	}
+	close $in_fh;
+	if($? and $opt::compress) {
+	    ::error($opt::decompress_program." failed.");
+	    $self->set_exitstatus(255);
+	}
+    }
+}
+
+sub print_results($) {
+    my $self = shift;
+    my ($fdno,$in_fh,$out_fh) = @_;
+    my $buf;
+    close $self->fh($fdno,"w");
+    if($? and $opt::compress) {
+	::error($opt::compress_program." failed.");
+	$self->set_exitstatus(255);
+    }
+    if(not $self->virgin()) {
+	seek $in_fh, 0, 0;
+	# $in_fh is now ready for reading at position 0
+	my $outputlength = 0;
+	my @output;
+
+	if($Global::membuffer) {
+	    # Read data into membuffer
+	    if($opt::tag or $opt::tagstring) {
+		# Read line by line
+		local $/ = "\n";
+		my $tag = $self->tag();
+		while(<$in_fh>) {
+		    $outputlength += length $_;
+		    # Tag lines with \r, too
+		    $_ =~ s/(?<=[\r])(?=.|$)/$tag/gs;
+		    push @{$self->{'output'}{$fdno}}, $tag, $_;
+		}
+	    } else {
+		# Most efficient way of copying data from $in_fh to $out_fh
+		while(sysread($in_fh,$buf,60000)) {
+		    $outputlength += length $buf;
+		    push @{$self->{'output'}{$fdno}}, $buf;
+		}
+	    }
+	} else {
+	    # Not membuffer: No need to read the file
+	    if($opt::compress) {
+		$outputlength = -1;
+	    } else {
+		# Determine $outputlength = file length
+		seek($in_fh, 0, 2) || ::die_bug("cannot seek result");
+		$outputlength = tell($in_fh);
+	    }
+	}
+	if($fdno == 1) { $self->add_returnsize($outputlength); }
+	close $in_fh;
+	if($? and $opt::compress) {
+	    ::error($opt::decompress_program." failed.");
+	    $self->set_exitstatus(255);
+	}
+    }
+}
+
+sub print_joblog($) {
+    my $self = shift;
+    my $cmd;
+    if($Global::verbose <= 1) {
+	$cmd = $self->replaced();
+    } else {
+	# Verbose level > 1: Print the rsync and stuff
+	$cmd = $self->wrapped();
+    }
+    # Newlines make it hard to parse the joblog
+    $cmd =~ s/\n/\0/g;
+    print $Global::joblog
+	join("\t", $self->seq(), $self->sshlogin()->string(),
+	     $self->starttime(), sprintf("%10.3f",$self->runtime()),
+	     $self->transfersize(), $self->returnsize(),
+	     $self->exitstatus(), $self->exitsignal(), $cmd
+	). "\n";
+    flush $Global::joblog;
+    $self->set_job_in_joblog();
+}
+
+sub tag($) {
+    my $self = shift;
+    if(not defined $self->{'tag'} or not $Global::cache_replacement_eval) {
+	if(defined $opt::tag or defined $opt::tagstring) {
+	    $self->{'tag'} =
+		($self->{'commandline'}->
+		 replace_placeholders([$opt::tagstring],0,0)).
+		"\t";
+	} else {
+	    # No tag
+	    $self->{'tag'} = "";
+	}
+    }
+    return $self->{'tag'};
+}
+
+sub untabtag($) {
+    # tag with \t replaced with spaces
+    my $self = shift;
+    my $tag = $self->tag();
+    if(not defined $self->{'untab'}{$tag}) {
+	my $t = $tag;
+	$t =~ s/\t/" "x(8-($-[0]%8))/eg;
+	$self->{'untab'}{$tag} = $t;
+    }
+    return $self->{'untab'}{$tag};
+}
+
+{
+    my (@color,$eol,$reset_color,$init);
+
+    sub init_color() {
+	if(not $init) {
+	    $init = 1;
+	    # color combinations that are readable: black/white text
+	    # on colored background, but not white on yellow
+	    my @color_combinations =
+		# Force each color code to have the same length in chars
+		# This will make \t work as expected
+		((map { [sprintf("%03d",$_),"000"] }
+		  6..7,9..11,13..15,40..51,75..87,113..123,147..159,
+		  171..182,185..231,249..254),
+		 (map { [sprintf("%03d",$_),231] }
+		  1..9,12..13,16..45,52..81,88..114,124..149,
+		  160..178,180,182..184,196..214,232..250));
+	    # reorder list so adjacent colors are dissimilar
+	    # %23 and %7 were found experimentally
+	    @color_combinations = @color_combinations[
+		sort { ($a%23 <=> $b%23) or ($b%7 <=> $a%7) }
+		0..$#color_combinations
+		];
+	    @color = map {
+		# TODO Can this be done with `tput` codes?
+		"\033[48;5;".$_->[0].";38;5;".$_->[1]."m"
+	    } @color_combinations;
+
+	    # clr_eol el = clear to end of line
+	    $eol = `sh -c "tput el </dev/tty" 2>/dev/null`;
+	    chomp($eol);
+	    if($eol eq "") { $eol = "\033[K"; }
+	    # exit_attribute_mode sgr0 = turn off all attributes
+	    $reset_color = `sh -c "tput sgr0 </dev/tty" 2>/dev/null`;
+	    chomp($reset_color);
+	    if($reset_color eq "") { $reset_color = "\033[m"; }
+	}
+    }
+
+    sub color($) {
+	my $self = shift;
+	if(not defined $self->{'color'}) {
+	    if($Global::color) {
+		# Choose a value based on the seq
+		$self->{'color'} = $color[$self->seq() % ($#color+1)].$eol;
+		$self->{'reset_color'} = $reset_color;
+	    } else {
+		$self->{'color'} = "";
+		$self->{'reset_color'} = "";
+	    }
+	    if($opt::colorfailed) {
+		if($self->exitstatus()) {
+		    # White on Red
+		    # Can this be done more generally?
+		    $self->{'color'} =
+			"\033[48;5;"."196".";38;5;"."231"."m".$eol;
+		    $self->{'reset_color'} = $reset_color;
+		}
+	    }
+	}
+	return ($self->{'color'},$self->{'reset_color'});
+    }
+}
+
+sub hostgroups($) {
+    my $self = shift;
+    if(not defined $self->{'hostgroups'}) {
+	$self->{'hostgroups'} =
+	    $self->{'commandline'}->{'arg_list'}[0][0]->{'hostgroups'};
+    }
+    return @{$self->{'hostgroups'}};
+}
+
+sub exitstatus($) {
+    my $self = shift;
+    return $self->{'exitstatus'};
+}
+
+sub set_exitstatus($$) {
+    my $self = shift;
+    my $exitstatus = shift;
+    if($exitstatus) {
+	# Overwrite status if non-zero
+	$self->{'exitstatus'} = $exitstatus;
+    } else {
+	# Set status but do not overwrite
+	# Status may have been set by --timeout
+	$self->{'exitstatus'} ||= $exitstatus;
+    }
+    $opt::sqlworker and
+	$Global::sql->update("SET Exitval = ? WHERE Seq = ".$self->seq(),
+			     $exitstatus);
+}
+
+sub reset_exitstatus($) {
+    my $self = shift;
+    undef $self->{'exitstatus'};
+}
+
+sub exitsignal($) {
+    my $self = shift;
+    return $self->{'exitsignal'};
+}
+
+sub set_exitsignal($$) {
+    my $self = shift;
+    my $exitsignal = shift;
+    $self->{'exitsignal'} = $exitsignal;
+    $opt::sqlworker and
+	$Global::sql->update("SET _Signal = ? WHERE Seq = ".$self->seq(),
+			     $exitsignal);
+}
+
+{
+    my $total_jobs;
+
+    sub should_we_halt {
+	# Should we halt? Immediately? Gracefully?
+	# Returns: N/A
+	my $job = shift;
+	my $limit;
+	if($Global::semaphore) {
+	    # Emulate Bash's +128 if there is a signal
+	    $Global::halt_exitstatus =
+		($job->exitstatus()
+		 or
+		 $job->exitsignal() ? $job->exitsignal() + 128 : 0);
+	}
+	if($job->exitstatus() or $job->exitsignal()) {
+	    # Job failed
+	    $Global::exitstatus++;
+	    $Global::total_failed++;
+	    if($Global::halt_fail) {
+		::status("$Global::progname: This job failed:",
+			 $job->replaced());
+		$limit = $Global::total_failed;
+	    }
+	} elsif($Global::halt_success) {
+	    ::status("$Global::progname: This job succeeded:",
+		     $job->replaced());
+	    $limit = $Global::total_completed - $Global::total_failed;
+	}
+	if($Global::halt_done) {
+	    ::status("$Global::progname: This job finished:",
+		     $job->replaced());
+	    $limit = $Global::total_completed;
+	}
+	if(not defined $limit) {
+	    return ""
+	}
+	#  --halt # => 1..100 (number of jobs failed, 101 means > 100)
+	#  --halt % => 1..100 (pct of jobs failed)
+	if($Global::halt_pct and not $Global::halt_count) {
+	    $total_jobs ||= $Global::JobQueue->total_jobs();
+	    # From the pct compute the number of jobs that must fail/succeed
+	    $Global::halt_count = $total_jobs * $Global::halt_pct;
+	}
+	if($limit >= $Global::halt_count) {
+	    # At least N jobs have failed/succeded/completed
+	    # or at least N% have failed/succeded/completed
+	    # So we should prepare for exit
+	    if($Global::halt_fail or $Global::halt_done) {
+		# Set exit status
+		if(not defined $Global::halt_exitstatus) {
+		    if($Global::halt_pct) {
+			# --halt now,fail=X% or soon,fail=X%
+			# --halt now,done=X% or soon,done=X%
+			$Global::halt_exitstatus =
+			    ::ceil($Global::total_failed / $total_jobs * 100);
+		    } elsif($Global::halt_count) {
+			# --halt now,fail=X or soon,fail=X
+			# --halt now,done=X or soon,done=X
+			$Global::halt_exitstatus =
+			    ::min($Global::total_failed,101);
+		    }
+		    if($Global::halt_count and $Global::halt_count == 1) {
+			# --halt now,fail=1 or soon,fail=1
+			# --halt now,done=1 or soon,done=1
+			# Emulate Bash's +128 if there is a signal
+			$Global::halt_exitstatus =
+			    ($job->exitstatus()
+			     or
+			     $job->exitsignal() ? $job->exitsignal() + 128 : 0);
+		    }
+		}
+		::debug("halt","Pct: ",$Global::halt_pct,
+			" count: ",$Global::halt_count,
+			" status: ",$Global::halt_exitstatus,"\n");
+	    } elsif($Global::halt_success) {
+		$Global::halt_exitstatus = 0;
+	    }
+	    if($Global::halt_when eq "soon") {
+		$Global::start_no_new_jobs ||= 1;
+		if(scalar(keys %Global::running) > 0) {
+		    # Only warn if there are more jobs running
+		    ::status
+			("$Global::progname: Starting no more jobs. ".
+			 "Waiting for ". (keys %Global::running).
+			 " jobs to finish.");
+		}
+	    }
+	    return($Global::halt_when);
+	}
+	return "";
+    }
+}
+
+
+package CommandLine;
+
+sub new($) {
+    my $class = shift;
+    my $seq = shift;
+    my $commandref = shift;
+    $commandref || die;
+    my $arg_queue = shift;
+    my $context_replace = shift;
+    my $max_number_of_args = shift; # for -N and normal (-n1)
+    my $transfer_files = shift;
+    my $return_files = shift;
+    my $template_names = shift;
+    my $template_contents = shift;
+    my $replacecount_ref = shift;
+    my $len_ref = shift;
+    my %replacecount = %$replacecount_ref;
+    my %len = %$len_ref;
+    for (keys %$replacecount_ref) {
+	# Total length of this replacement string {} replaced with all args
+	$len{$_} = 0;
+    }
+    return bless {
+	'command' => $commandref,
+	'seq' => $seq,
+	'len' => \%len,
+	'arg_list' => [],
+	'arg_list_flat' => [],
+	'arg_list_flat_orig' => [undef],
+	'arg_queue' => $arg_queue,
+	'max_number_of_args' => $max_number_of_args,
+	'replacecount' => \%replacecount,
+	'context_replace' => $context_replace,
+	'transfer_files' => $transfer_files,
+	'return_files' => $return_files,
+	'template_names' => $template_names,
+	'template_contents' => $template_contents,
+	'replaced' => undef,
+    }, ref($class) || $class;
+}
+
+sub flush_cache() {
+    my $self = shift;
+    for my $arglist (@{$self->{'arg_list'}}) {
+	for my $arg (@$arglist) {
+	    $arg->flush_cache();
+	}
+    }
+    $self->{'arg_queue'}->flush_cache();
+    $self->{'replaced'} = undef;
+}
+
+sub seq($) {
+    my $self = shift;
+    return $self->{'seq'};
+}
+
+sub set_seq($$) {
+    my $self = shift;
+    $self->{'seq'} = shift;
+}
+
+sub slot($) {
+    # Find the number of a free job slot and return it
+    # Uses:
+    #	@Global::slots - list with free jobslots
+    # Returns:
+    #	$jobslot = number of jobslot
+    my $self = shift;
+    if(not $self->{'slot'}) {
+	if(not @Global::slots) {
+	    # $max_slot_number will typically be $Global::max_jobs_running
+	    push @Global::slots, ++$Global::max_slot_number;
+	}
+	$self->{'slot'} = shift @Global::slots;
+    }
+    return $self->{'slot'};
+}
+
+{
+    my $already_spread;
+    my $darwin_max_len;
+
+    sub populate($) {
+	# Add arguments from arg_queue until the number of arguments or
+	# max line length is reached
+	# Uses:
+	#   $Global::usable_command_line_length
+	#   $opt::cat
+	#   $opt::fifo
+	#   $Global::JobQueue
+	#   $opt::m
+	#   $opt::X
+	#   $Global::max_jobs_running
+	# Returns: N/A
+	my $self = shift;
+	my $next_arg;
+	my $max_len = $Global::usable_command_line_length || die;
+	if($^O eq "darwin") {
+	    # Darwin's limit is affected by:
+	    # * number of environment names (variables+functions)
+	    # * size of environment
+	    # * the length of arguments:
+	    #	a one-char argument lowers the limit by 5
+	    #	To be safe assume all arguments are one-char
+	    # The max_len is cached between runs, but if the size of
+	    # the environment is different we need to recompute the
+	    # usable max length for this run of GNU Parallel
+	    # See https://unix.stackexchange.com/a/604943/2972
+	    if(not $darwin_max_len) {
+		my $envc = (keys %ENV);
+		my $envn = length join"",(keys %ENV);
+		my $envv = length join"",(values %ENV);
+		$darwin_max_len = -146+($max_len - $envn - $envv) - $envc*10;
+		::debug("init",
+			"length: $darwin_max_len ".
+			"3+($max_len - $envn - $envv)/5 - $envc*2");
+	    }
+	    $max_len = $darwin_max_len;
+	}
+	if($opt::cat or $opt::fifo) {
+	    # Get the empty arg added by --pipepart (if any)
+	    $Global::JobQueue->{'commandlinequeue'}->{'arg_queue'}->get();
+	    # $PARALLEL_TMP will point to a tempfile that will be used as {}
+	    $Global::JobQueue->{'commandlinequeue'}->{'arg_queue'}->
+		unget([Arg->new('$PARALLEL_TMP')]);
+	}
+	while (not $self->{'arg_queue'}->empty()) {
+	    $next_arg = $self->{'arg_queue'}->get();
+	    if(not defined $next_arg) {
+		next;
+	    }
+	    $self->push($next_arg);
+	    if($self->len() >= $max_len) {
+		# Command length is now > max_length
+		# If there are arguments: remove the last
+		# If there are no arguments: Error
+		# TODO stuff about -x opt_x
+		if($self->number_of_args() > 1) {
+		    # There is something to work on
+		    $self->{'arg_queue'}->unget($self->pop());
+		    last;
+		} else {
+		    my $args = join(" ", map { $_->orig() } @$next_arg);
+		    ::error("Command line too long (".
+			    $self->len(). " >= ".
+			    $max_len.
+			    ") at input ".
+			    $self->{'arg_queue'}->arg_number().
+			    ": ".
+			    ((length $args > 50) ?
+			     (substr($args,0,50))."..." :
+			     $args));
+		    $self->{'arg_queue'}->unget($self->pop());
+		    ::wait_and_exit(255);
+		}
+	    }
+
+	    if(defined $self->{'max_number_of_args'}) {
+		if($self->number_of_args() >= $self->{'max_number_of_args'}) {
+		    last;
+		}
+	    }
+	}
+	if(($opt::m or $opt::X) and not $already_spread
+	   and $self->{'arg_queue'}->empty() and $Global::max_jobs_running) {
+	    # -m or -X and EOF => Spread the arguments over all jobslots
+	    # (unless they are already spread)
+	    $already_spread ||= 1;
+	    if($self->number_of_args() > 1) {
+		$self->{'max_number_of_args'} =
+		    ::ceil($self->number_of_args()/$Global::max_jobs_running);
+		$Global::JobQueue->{'commandlinequeue'}->{'max_number_of_args'} =
+		    $self->{'max_number_of_args'};
+		$self->{'arg_queue'}->unget($self->pop_all());
+		while($self->number_of_args() < $self->{'max_number_of_args'}) {
+		    $self->push($self->{'arg_queue'}->get());
+		}
+	    }
+	    $Global::JobQueue->flush_total_jobs();
+	}
+
+	if($opt::sqlmaster) {
+	    # Insert the V1..Vn for this $seq in SQL table
+	    # instead of generating one
+	    $Global::sql->insert_records($self->seq(), $self->{'command'},
+					 $self->{'arg_list_flat_orig'});
+	}
+    }
+}
+
+sub push($) {
+    # Add one or more records as arguments
+    # Returns: N/A
+    my $self = shift;
+    my $record = shift;
+    push @{$self->{'arg_list_flat_orig'}}, map { $_->orig() } @$record;
+    push @{$self->{'arg_list_flat'}}, @$record;
+    push @{$self->{'arg_list'}}, $record;
+    # Make @arg available for {= =}
+    *Arg::arg = $self->{'arg_list_flat_orig'};
+
+    my $quote_arg = ($Global::quote_replace and not $Global::quoting);
+    my $col;
+    for my $perlexpr (keys %{$self->{'replacecount'}}) {
+	if($perlexpr =~ /^(-?\d+)(?:\D.*|)$/) {
+	    # Positional replacement string
+	    # Deal with negative positional replacement string
+	    $col = ($1 < 0) ? $1 : $1-1;
+	    if(defined($record->[$col])) {
+		$self->{'len'}{$perlexpr} +=
+		    length $record->[$col]->replace($perlexpr,$quote_arg,$self);
+	    }
+	} else {
+	    for my $arg (@$record) {
+		if(defined $arg) {
+		    $self->{'len'}{$perlexpr} +=
+			length $arg->replace($perlexpr,$quote_arg,$self);
+		}
+	    }
+	}
+    }
+}
+
+sub pop($) {
+    # Remove last argument
+    # Returns:
+    #	the last record
+    my $self = shift;
+    my $record = pop @{$self->{'arg_list'}};
+    # pop off arguments from @$record
+    splice @{$self->{'arg_list_flat_orig'}}, -($#$record+1), $#$record+1;
+    splice @{$self->{'arg_list_flat'}}, -($#$record+1), $#$record+1;
+    my $quote_arg = ($Global::quote_replace and not $Global::quoting);
+    for my $perlexpr (keys %{$self->{'replacecount'}}) {
+	if($perlexpr =~ /^(\d+) /) {
+	    # Positional
+	    defined($record->[$1-1]) or next;
+	    $self->{'len'}{$perlexpr} -=
+		length $record->[$1-1]->replace($perlexpr,$quote_arg,$self);
+	} else {
+	    for my $arg (@$record) {
+		if(defined $arg) {
+		    $self->{'len'}{$perlexpr} -=
+			length $arg->replace($perlexpr,$quote_arg,$self);
+		}
+	    }
+	}
+    }
+    return $record;
+}
+
+sub pop_all($) {
+    # Remove all arguments and zeros the length of replacement perlexpr
+    # Returns:
+    #	all records
+    my $self = shift;
+    my @popped = @{$self->{'arg_list'}};
+    for my $perlexpr (keys %{$self->{'replacecount'}}) {
+	$self->{'len'}{$perlexpr} = 0;
+    }
+    $self->{'arg_list'} = [];
+    $self->{'arg_list_flat_orig'} = [undef];
+    $self->{'arg_list_flat'} = [];
+    return @popped;
+}
+
+sub number_of_args($) {
+    # The number of records
+    # Returns:
+    #	number of records
+    my $self = shift;
+    # This is really the number of records
+    return $#{$self->{'arg_list'}}+1;
+}
+
+sub number_of_recargs($) {
+    # The number of args in records
+    # Returns:
+    #	number of args records
+    my $self = shift;
+    my $sum = 0;
+    my $nrec = scalar @{$self->{'arg_list'}};
+    if($nrec) {
+	$sum = $nrec * (scalar @{$self->{'arg_list'}[0]});
+    }
+    return $sum;
+}
+
+sub args_as_string($) {
+    # Returns:
+    #  all unmodified arguments joined with ' ' (similar to {})
+    my $self = shift;
+    return (join " ", map { $_->orig() }
+	    map { @$_ } @{$self->{'arg_list'}});
+}
+
+sub results_out($) {
+    sub max_file_name_length {
+	# Figure out the max length of a subdir
+	# TODO and the max total length
+	# Ext4 = 255,130816
+	# Uses:
+	#   $Global::max_file_length is set
+	# Returns:
+	#   $Global::max_file_length
+	my $testdir = shift;
+
+	my $upper = 100_000_000;
+	# Dir length of 8 chars is supported everywhere
+	my $len = 8;
+	my $dir = "d"x$len;
+	do {
+	    rmdir($testdir."/".$dir);
+	    $len *= 16;
+	    $dir = "d"x$len;
+	} while ($len < $upper and mkdir $testdir."/".$dir);
+	# Then search for the actual max length between $len/16 and $len
+	my $min = $len/16;
+	my $max = $len;
+	while($max-$min > 5) {
+	    # If we are within 5 chars of the exact value:
+	    # it is not worth the extra time to find the exact value
+	    my $test = int(($min+$max)/2);
+	    $dir = "d"x$test;
+	    if(mkdir $testdir."/".$dir) {
+		rmdir($testdir."/".$dir);
+		$min = $test;
+	    } else {
+		$max = $test;
+	    }
+	}
+	$Global::max_file_length = $min;
+	return $min;
+    }
+
+    my $self = shift;
+    my $out = $self->replace_placeholders([$opt::results],0,0);
+    if($out eq $opt::results) {
+	# $opt::results simple string: Append args_as_dirname
+	my $args_as_dirname = $self->args_as_dirname();
+	# Output in: prefix/name1/val1/name2/val2/stdout
+	$out = $opt::results."/".$args_as_dirname;
+	if(-d $out or eval{ File::Path::mkpath($out); }) {
+	    # OK
+	} else {
+	    # mkpath failed: Argument probably too long.
+	    # Set $Global::max_file_length, which will keep the individual
+	    # dir names shorter than the max length
+	    max_file_name_length($opt::results);
+	    $args_as_dirname = $self->args_as_dirname();
+	    # prefix/name1/val1/name2/val2/
+	    $out = $opt::results."/".$args_as_dirname;
+	    File::Path::mkpath($out);
+	}
+	$out .="/";
+    } else {
+	if($out =~ m:/$:) {
+	    # / = dir
+	    if(-d $out or eval{ File::Path::mkpath($out); }) {
+		# OK
+	    } else {
+		::error("Cannot make dir '$out'.");
+		::wait_and_exit(255);
+	    }
+	} else {
+	    $out =~ m:(.*)/:;
+	    File::Path::mkpath($1);
+	}
+    }
+    return $out;
+}
+
+sub args_as_dirname($) {
+    # Returns:
+    #  all unmodified arguments joined with '/' (similar to {})
+    #  \t \0 \\ and / are quoted as: \t \0 \\ \_
+    # If $Global::max_file_length: Keep subdirs < $Global::max_file_length
+    my $self = shift;
+    my @res = ();
+
+    for my $rec_ref (@{$self->{'arg_list'}}) {
+	# If headers are used, sort by them.
+	# Otherwise keep the order from the command line.
+	my @header_indexes_sorted = header_indexes_sorted($#$rec_ref+1);
+	for my $n (@header_indexes_sorted) {
+	    CORE::push(@res,
+		 $Global::input_source_header{$n},
+		 map { my $s = $_;
+		       #  \t \0 \\ and / are quoted as: \t \0 \\ \_
+		       $s =~ s/\\/\\\\/g;
+		       $s =~ s/\t/\\t/g;
+		       $s =~ s/\0/\\0/g;
+		       $s =~ s:/:\\_:g;
+		       if($Global::max_file_length) {
+			   # Keep each subdir shorter than the longest
+			   # allowed file name
+			   $s = substr($s,0,$Global::max_file_length);
+		       }
+		       $s; }
+		 $rec_ref->[$n-1]->orig());
+	}
+    }
+    return join "/", @res;
+}
+
+sub header_indexes_sorted($) {
+    # Sort headers first by number then by name.
+    # E.g.: 1a 1b 11a 11b
+    # Returns:
+    #  Indexes of %Global::input_source_header sorted
+    my $max_col = shift;
+
+    no warnings 'numeric';
+    for my $col (1 .. $max_col) {
+	# Make sure the header is defined. If it is not: use column number
+	if(not defined $Global::input_source_header{$col}) {
+	    $Global::input_source_header{$col} = $col;
+	}
+    }
+    my @header_indexes_sorted = sort {
+	# Sort headers numerically then asciibetically
+	$Global::input_source_header{$a} <=> $Global::input_source_header{$b}
+	or
+	    $Global::input_source_header{$a} cmp $Global::input_source_header{$b}
+    } 1 .. $max_col;
+    return @header_indexes_sorted;
+}
+
+sub len($) {
+    # Uses:
+    #	@opt::shellquote
+    # The length of the command line with args substituted
+    my $self = shift;
+    my $len = 0;
+    # Add length of the original command with no args
+    # Length of command w/ all replacement args removed
+    $len += $self->{'len'}{'noncontext'} + @{$self->{'command'}} -1;
+    ::debug("length", "noncontext + command: $len\n");
+    # MacOS has an overhead of 8 bytes per argument
+    my $darwin = ($^O eq "darwin") ? 8 : 0;
+    my $recargs = $self->number_of_recargs();
+    if($self->{'context_replace'}) {
+	# Context is duplicated for each arg
+	$len += $recargs * $self->{'len'}{'context'};
+	for my $replstring (keys %{$self->{'replacecount'}}) {
+	    # If the replacements string is more than once: mulitply its length
+	    $len += $self->{'len'}{$replstring} *
+		$self->{'replacecount'}{$replstring};
+	    ::debug("length", $replstring, " ", $self->{'len'}{$replstring}, "*",
+		    $self->{'replacecount'}{$replstring}, "\n");
+	}
+	# echo 11 22 33 44 55 66 77 88 99 1010
+	# echo 1 2 3 4 5 6 7 8 9 10 1 2 3 4 5 6 7 8 9 10
+	# 5 +  ctxgrp*arg
+	::debug("length", "Ctxgrp: ", $self->{'len'}{'contextgroups'},
+		" Groups: ", $self->{'len'}{'noncontextgroups'}, "\n");
+	# Add space between context groups
+	$len += ($recargs-1) * ($self->{'len'}{'contextgroups'});
+	if($darwin) {
+	    $len += $recargs * $self->{'len'}{'contextgroups'} * $darwin;
+	}
+    } else {
+	# Each replacement string may occur several times
+	# Add the length for each time
+	$len += 1*$self->{'len'}{'context'};
+	::debug("length", "context+noncontext + command: $len\n");
+	for my $replstring (keys %{$self->{'replacecount'}}) {
+	    # (space between recargs + length of replacement)
+	    # * number this replacement is used
+	    $len += ($recargs -1 + $self->{'len'}{$replstring}) *
+		$self->{'replacecount'}{$replstring};
+	    if($darwin) {
+		$len += ($recargs * $self->{'replacecount'}{$replstring}
+			 * $darwin);
+	    }
+	}
+    }
+    if(defined $Global::parallel_env) {
+	# If we are using --env, add the prefix for that, too.
+	$len += length $Global::parallel_env;
+    }
+    if($Global::quoting) {
+	# Pessimistic length if -q is set
+	# Worse than worst case: ' => "'" + " => '"'
+	# TODO can we count the number of expanding chars?
+	#   and count them in arguments, too?
+	$len *= 3;
+    }
+    if(@opt::shellquote) {
+	# Pessimistic length if --shellquote is set
+	# Worse than worst case: ' => "'"
+	for(@opt::shellquote) {
+	    $len *= 3;
+	}
+	$len *= 5;
+    }
+    if(@opt::sshlogin) {
+	# Pessimistic length if remote
+	# Worst case is BASE64 encoding 3 bytes -> 4 bytes
+	$len = int($len*4/3);
+    }
+    return $len;
+}
+
+sub replaced($) {
+    # Uses:
+    #	$Global::quote_replace
+    #	$Global::quoting
+    # Returns:
+    #	$replaced = command with place holders replaced and prepended
+    my $self = shift;
+    if(not defined $self->{'replaced'}) {
+	# Don't quote arguments if the input is the full command line
+	my $quote_arg = ($Global::quote_replace and not $Global::quoting);
+	# or if ($opt::cat or $opt::pipe) as they use $PARALLEL_TMP
+	$quote_arg = ($opt::cat || $opt::fifo) ? 0 : $quote_arg;
+	$self->{'replaced'} = $self->
+	    replace_placeholders($self->{'command'},$Global::quoting,
+				 $quote_arg);
+	my $len = length $self->{'replaced'};
+	if ($len != $self->len()) {
+	    ::debug("length", $len, " != ", $self->len(),
+		    " ", $self->{'replaced'}, "\n");
+	} else {
+	    ::debug("length", $len, " == ", $self->len(),
+		    " ", $self->{'replaced'}, "\n");
+	}
+    }
+    return $self->{'replaced'};
+}
+
+sub replace_placeholders($$$$) {
+    # Replace foo{}bar with fooargbar
+    # Input:
+    #	$targetref = command as shell words
+    #	$quote = should everything be quoted?
+    #	$quote_arg = should replaced arguments be quoted?
+    # Uses:
+    #	@Arg::arg = arguments as strings to be use in {= =}
+    # Returns:
+    #	@target with placeholders replaced
+    my $self = shift;
+    my $targetref = shift;
+    my $quote = shift;
+    my $quote_arg = shift;
+    my %replace;
+
+    # Token description:
+    #	\0spc = unquoted space
+    #	\0end = last token element
+    #	\0ign = dummy token to be ignored
+    #	\257<...\257> = replacement expression
+    #	" " = quoted space, that splits -X group
+    #	text = normal text - possibly part of -X group
+    my $spacer = 0;
+    my @tokens = grep { length $_ > 0 } map {
+	if(/^\257<|^ $/) {
+	    # \257<...\257> or space
+	    $_
+	} else {
+	    # Split each space/tab into a token
+	    split /(?=\s)|(?<=\s)/
+	}
+    }
+    # Split \257< ... \257> into own token
+    map { split /(?=\257<)|(?<=\257>)/ }
+    # Insert "\0spc" between every element
+    # This space should never be quoted
+    map { $spacer++ ? ("\0spc",$_) : $_ }
+    map { $_ eq "" ? "\0empty" : $_ }
+    @$targetref;
+
+    if(not @tokens) {
+	# @tokens is empty: Return empty array
+	return @tokens;
+    }
+    ::debug("replace", "Tokens ".join":",@tokens,"\n");
+    # Make it possible to use $arg[2] in {= =}
+    *Arg::arg = $self->{'arg_list_flat_orig'};
+    # Flat list:
+    # $self->{'arg_list'} = [ [Arg11, Arg12], [Arg21, Arg22], [Arg31, Arg32] ]
+    # $self->{'arg_list_flat'} = [ Arg11, Arg12, Arg21, Arg22, Arg31, Arg32 ]
+    if(not @{$self->{'arg_list_flat'}}) {
+	@{$self->{'arg_list_flat'}} = Arg->new("");
+    }
+    my $argref = $self->{'arg_list_flat'};
+    # Number of arguments - used for positional arguments
+    my $n = $#$argref+1;
+
+    # $self is actually a CommandLine-object,
+    # but it looks nice to be able to say {= $job->slot() =}
+    my $job = $self;
+    # @replaced = tokens with \257< \257> replaced
+    my @replaced;
+    if($self->{'context_replace'}) {
+	my @ctxgroup;
+	for my $t (@tokens,"\0end") {
+	    # \0end = last token was end of tokens.
+	    if($t eq "\t" or $t eq " " or $t eq "\0end" or $t eq "\0spc") {
+		# Context group complete: Replace in it
+		if(grep { /^\257</ } @ctxgroup) {
+		    # Context group contains a replacement string:
+		    # Copy once per arg
+		    my $space = "\0ign";
+		    for my $arg (@$argref) {
+			my $normal_replace;
+			# Push output
+			# Put unquoted space before each context group
+			# except the first
+			CORE::push @replaced, $space, map {
+			    $a = $_;
+			    if($a =~
+				s{\257<(-?\d+)?(.*)\257>}
+			    {
+				if($1) {
+				    # Positional replace
+				    # Find the relevant arg and replace it
+				    ($argref->[$1 > 0 ? $1-1 : $n+$1] ? # If defined: replace
+				     $argref->[$1 > 0 ? $1-1 : $n+$1]->
+				     replace($2,$quote_arg,$self)
+				     : "");
+				} else {
+				    # Normal replace
+				    $normal_replace ||= 1;
+				    ($arg ? $arg->replace($2,$quote_arg,$self) : "");
+				}
+			    }sgxe) {
+				# Token is \257<..\257>
+			    } else {
+				if($Global::escape_string_present) {
+				    # Command line contains \257:
+				    # Unescape it \257\256 => \257
+				    $a =~ s/\257\256/\257/g;
+				}
+			    }
+			    $a
+			} @ctxgroup;
+			$normal_replace or last;
+			$space = "\0spc";
+		    }
+		} else {
+		    # Context group has no a replacement string: Copy it once
+		    CORE::push @replaced, map {
+			$Global::escape_string_present and s/\257\256/\257/g; $_;
+		    } @ctxgroup;
+		}
+		# New context group
+		@ctxgroup=();
+	    }
+	    if($t eq "\0spc" or $t eq " ") {
+		CORE::push @replaced,$t;
+	    } else {
+		CORE::push @ctxgroup,$t;
+	    }
+	}
+    } else {
+	# @group = @token
+	# Replace in group
+	# Push output
+	# repquote = no if {} first on line, no if $quote, yes otherwise
+	for my $t (@tokens) {
+	    if($t =~ /^\257</) {
+		my $space = "\0ign";
+		for my $arg (@$argref) {
+		    my $normal_replace;
+		    $a = $t;
+		    $a =~
+			s{\257<(-?\d+)?(.*)\257>}
+		    {
+			if($1) {
+			    # Positional replace
+			    # Find the relevant arg and replace it
+			    ($argref->[$1 > 0 ? $1-1 : $n+$1] ?
+			     # If defined: replace
+			     $argref->[$1 > 0 ? $1-1 : $n+$1]->
+			     replace($2,$quote_arg,$self)
+			     : "");
+			} else {
+			    # Normal replace
+			    $normal_replace ||= 1;
+			    ($arg ? $arg->replace($2,$quote_arg,$self) : "");
+			}
+		    }sgxe;
+		    CORE::push @replaced, $space, $a;
+		    $normal_replace or last;
+		    $space = "\0spc";
+		}
+	    } else {
+		# No replacement
+		CORE::push @replaced, map {
+		    $Global::escape_string_present and s/\257\256/\257/g; $_;
+		} $t;
+	    }
+	}
+    }
+    *Arg::arg = [];
+    ::debug("replace","Replaced: ".join":",@replaced,"\n");
+
+    # Put tokens into groups that may be quoted.
+    my @quotegroup;
+    my @quoted;
+    for (map { $_ eq "\0empty" ? "" : $_ }
+	 grep { $_ ne "\0ign" and $_ ne "\0noarg" and $_ ne "'\0noarg'" }
+	 @replaced, "\0end") {
+	if($_ eq "\0spc" or $_ eq "\0end") {
+	    # \0spc splits quotable groups
+	    if($quote) {
+		if(@quotegroup) {
+		    CORE::push @quoted, ::Q(join"",@quotegroup);;
+		}
+	    } else {
+		CORE::push @quoted, join"",@quotegroup;
+	    }
+	    @quotegroup = ();
+	} else {
+	    CORE::push @quotegroup, $_;
+	}
+    }
+    ::debug("replace","Quoted: ".join":",@quoted,"\n");
+    return wantarray ? @quoted : "@quoted";
+}
+
+sub skip($) {
+    # Skip this job
+    my $self = shift;
+    $self->{'skip'} = 1;
+}
+
+
+package CommandLineQueue;
+
+sub new($) {
+    my $class = shift;
+    my $commandref = shift;
+    my $read_from = shift;
+    my $context_replace = shift || 0;
+    my $max_number_of_args = shift;
+    my $transfer_files = shift;
+    my $return_files = shift;
+    my $template_names = shift;
+    my $template_contents = shift;
+    my @unget = ();
+    my $posrpl;
+    my ($replacecount_ref, $len_ref);
+    my @command = @$commandref;
+    my $seq = 1;
+    # Replace replacement strings with {= perl expr =}
+    # '{=' 'perlexpr' '=}'  => '{= perlexpr =}'
+    @command = merge_rpl_parts(@command);
+
+    # Protect matching inside {= perl expr =}
+    # by replacing {= and =} with \257< and \257>
+    # in options that can contain replacement strings:
+    # @command, --transferfile, --return,
+    # --tagstring, --workdir, --results
+    for(@command, @$transfer_files, @$return_files,
+	@$template_names, @$template_contents,
+	$opt::tagstring, $opt::workdir, $opt::results, $opt::retries,
+	@opt::filter) {
+	# Skip if undefined
+	defined($_) or next;
+	# Escape \257 => \257\256
+	$Global::escape_string_present += s/\257/\257\256/g;
+	# Needs to match rightmost left parens (Perl defaults to leftmost)
+	# to deal with: {={==} and {={==}=}
+	# Replace {= -> \257<  and  =} -> \257>
+	#
+	# Complex way to do:
+	#   s/{=(.*)=}/\257<$1\257>/g
+	# which would not work
+	s[\Q$Global::parensleft\E # Match {=
+	  # Match . unless the next string is {= or =}
+	  #   needed to force matching the shortest {= =}
+	  ((?:(?! \Q$Global::parensleft\E|\Q$Global::parensright\E ).)*?)
+	  \Q$Global::parensright\E ] # Match =}
+	{\257<$1\257>}gxs;
+	for my $rpl (sort { length $b <=> length $a } keys %Global::rpl) {
+	    # Replace long --rpl's before short ones, as a short may be a
+	    # substring of a long:
+	    #	--rpl '% s/a/b/' --rpl '%% s/b/a/'
+	    #
+	    # Replace the shorthand string (--rpl)
+	    # with the {= perl expr =}
+	    #
+	    # Avoid searching for shorthand strings inside existing {= perl expr =}
+	    #
+	    # Replace $$1 in {= perl expr =} with groupings in shorthand string
+	    #
+	    #	--rpl '{/(\.\S+)/(\.\S+)} s/$$1/$$2/g;'
+	    #	  echo {/.tar/.gz} ::: UU.tar.gz
+	    my ($prefix,$grp_regexp,$postfix) =
+		$rpl =~ /^( [^(]*  )	# Prefix - e.g. {%%
+			  ( \(.*\) )?	# Group capture regexp - e.g (.*)
+			  ( [^)]*  )$	# Postfix - e.g }
+			/xs;
+	    $grp_regexp ||= '';
+	    my $rplval = $Global::rpl{$rpl};
+	    while(s{( (?: ^|\257> ) (?: [^\257]*|[\257][^<>] )*? )
+		      # Don't replace after \257 unless \257>
+		    \Q$prefix\E $grp_regexp \Q$postfix\E}
+		  {
+		      # The start remains the same
+		      my $unchanged = $1;
+		      # Dummy entry to start at 1.
+		      my @grp = (1);
+		      # $2 = first ()-group in $grp_regexp
+		      # Put $2 in $grp[1], Put $3 in $grp[2]
+		      # so first ()-group in $grp_regexp is $grp[1];
+		      for(my $i = 2; defined $grp[$#grp]; $i++) {
+			  push @grp, eval '$'.$i;
+		      }
+		      my $rv = $rplval;
+		      # replace $$1 with $_pAr_gRp1, $$2 with $_pAr_gRp2
+		      # in the code to be executed
+		      $rv =~ s/\$\$ (\d+)/\$_pAr_gRp$1/gx;
+		      # prepend with $_pAr_gRp1 = perlquote($1),
+		      my $set_args = "";
+		      for(my $i = 1;defined $grp[$i]; $i++) {
+			  $set_args .= "\$_pAr_gRp$i = \"" .
+			      ::perl_quote_scalar($grp[$i]) . "\";";
+		      }
+		      $unchanged . "\257<" . $set_args . $rv . "\257>"
+		  }gxes) {
+	    }
+	    # Do the same for the positional replacement strings
+	    $posrpl = $rpl;
+	    if($posrpl =~ s/^\{//) {
+		# Only do this if the shorthand start with {
+		$prefix=~s/^\{//;
+		# Don't replace after \257 unless \257>
+		while(s{( (?: ^|\257> ) (?: [^\257]*|[\257][^<>] )*? )
+		  \{(-?\d+) \s* \Q$prefix\E $grp_regexp \Q$postfix\E}
+		      {
+		      # The start remains the same
+		      my $unchanged = $1;
+		      my $position = $2;
+		      # Dummy entry to start at 1.
+		      my @grp = (1);
+		      # $3 = first ()-group in $grp_regexp
+		      # Put $3 in $grp[1], Put $4 in $grp[2]
+		      # so first ()-group in $grp_regexp is $grp[1];
+		      for(my $i = 3; defined $grp[$#grp]; $i++) {
+			  push @grp, eval '$'.$i;
+		      }
+		      my $rv = $rplval;
+		      # replace $$1 with $_pAr_gRp1, $$2 with $_pAr_gRp2
+		      # in the code to be executed
+		      $rv =~ s/\$\$ (\d+)/\$_pAr_gRp$1/gx;
+		      # prepend with $_pAr_gRp1 = perlquote($1),
+		      my $set_args = "";
+		      for(my $i = 1;defined $grp[$i]; $i++) {
+			  $set_args .= "\$_pAr_gRp$i = \"" .
+			      ::perl_quote_scalar($grp[$i]) . "\";";
+		      }
+		      $unchanged . "\257<" . $position . $set_args . $rv . "\257>"
+		  }gxes) {
+		}
+	    }
+	}
+    }
+    # Add {} if no replacement strings in @command
+    ($replacecount_ref, $len_ref, @command) =
+	replacement_counts_and_lengths($transfer_files, $return_files,
+				       $template_names, $template_contents,
+				       @command);
+    if("@command" =~ /^[^ \t\n=]*\257</) {
+	# Replacement string is (part of) the command (and not just
+	# argument or variable definition V1={})
+	# E.g. parallel {}, parallel my_{= s/_//=}, parallel {2}
+	# Do no quote (Otherwise it will fail if the input contains spaces)
+	$Global::quote_replace = 0;
+    }
+
+    if($opt::sqlmaster and $Global::sql->append()) {
+	$seq = $Global::sql->max_seq() + 1;
+    }
+
+    return bless {
+	('unget' => \@unget,
+	 'command' => \@command,
+	 'replacecount' => $replacecount_ref,
+	 'arg_queue' => RecordQueue->new($read_from,$opt::colsep),
+	 'context_replace' => $context_replace,
+	 'len' => $len_ref,
+	 'max_number_of_args' => $max_number_of_args,
+	 'size' => undef,
+	 'transfer_files' => $transfer_files,
+	 'return_files' => $return_files,
+	 'template_names' => $template_names,
+	 'template_contents' => $template_contents,
+	 'seq' => $seq,
+	 )
+    }, ref($class) || $class;
+}
+
+sub merge_rpl_parts($) {
+    # '{=' 'perlexpr' '=}'  => '{= perlexpr =}'
+    # Input:
+    #	@in = the @command as given by the user
+    # Uses:
+    #	$Global::parensleft
+    #	$Global::parensright
+    # Returns:
+    #	@command with parts merged to keep {= and =} as one
+    my @in = @_;
+    my @out;
+    my $l = quotemeta($Global::parensleft);
+    my $r = quotemeta($Global::parensright);
+
+    while(@in) {
+	my $s = shift @in;
+	$_ = $s;
+	# Remove matching (right most) parens
+	while(s/(.*)$l.*?$r/$1/os) {}
+	if(/$l/o) {
+	    # Missing right parens
+	    while(@in) {
+		$s .= " ".shift @in;
+		$_ = $s;
+		while(s/(.*)$l.*?$r/$1/os) {}
+		if(not /$l/o) {
+		    last;
+		}
+	    }
+	}
+	push @out, $s;
+    }
+    return @out;
+}
+
+sub replacement_counts_and_lengths($$@) {
+    # Count the number of different replacement strings.
+    # Find the lengths of context for context groups and non-context
+    # groups.
+    # If no {} found in @command: add it to @command
+    #
+    # Input:
+    #	\@transfer_files = array of filenames to transfer
+    #	\@return_files = array of filenames to return
+    #	\@template_names = array of names to copy to
+    #	\@template_contents = array of contents to write
+    #	@command = command template
+    # Output:
+    #	\%replacecount, \%len, @command
+    my $transfer_files = shift;
+    my $return_files = shift;
+    my $template_names = shift;
+    my $template_contents = shift;
+    my @command = @_;
+    my (%replacecount,%len);
+    my $sum = 0;
+    while($sum == 0) {
+	# Count how many times each replacement string is used
+	my @cmd = @command;
+	my $contextlen = 0;
+	my $noncontextlen = 0;
+	my $contextgroups = 0;
+	for my $c (@cmd) {
+	    while($c =~ s/ \257<( (?: [^\257]*|[\257][^<>] )*?)\257> /\000/xs) {
+		# %replacecount = { "perlexpr" => number of times seen }
+		# e.g { "s/a/b/" => 2 }
+		$replacecount{$1}++;
+		$sum++;
+	    }
+	    # Measure the length of the context around the {= perl expr =}
+	    # Use that {=...=} has been replaced with \000 above
+	    # So there is no need to deal with \257<
+	    while($c =~ s/ (\S*\000\S*) //xs) {
+		my $w = $1;
+		$w =~ tr/\000//d; # Remove all \000's
+		$contextlen += length($w);
+		$contextgroups++;
+	    }
+	    # All {= perl expr =} have been removed: The rest is non-context
+	    $noncontextlen += length $c;
+	}
+	for(@$transfer_files, @$return_files,
+	    @$template_names, @$template_contents,
+	    @opt::filter,
+	    $opt::tagstring, $opt::workdir, $opt::results, $opt::retries) {
+	    # Options that can contain replacement strings
+	    defined($_) or next;
+	    my $t = $_;
+	    while($t =~ s/ \257<( (?: [^\257]*|[\257][^<>] )* )\257> //xs) {
+		# %replacecount = { "perlexpr" => number of times seen }
+		# e.g { "$_++" => 2 }
+		# But for tagstring we just need to mark it as seen
+		$replacecount{$1} ||= 1;
+	    }
+	}
+	if($opt::bar) {
+	    # If the command does not contain {} force it to be computed
+	    # as it is being used by --bar
+	    $replacecount{""} ||= 1;
+	}
+
+	$len{'context'} = 0+$contextlen;
+	$len{'noncontext'} = $noncontextlen;
+	$len{'contextgroups'} = $contextgroups;
+	$len{'noncontextgroups'} = @cmd-$contextgroups;
+	::debug("length", "@command Context: ", $len{'context'},
+		" Non: ", $len{'noncontext'}, " Ctxgrp: ", $len{'contextgroups'},
+		" NonCtxGrp: ", $len{'noncontextgroups'}, "\n");
+	if($sum == 0) {
+	    if(not @command) {
+		# Default command = {}
+		@command = ("\257<\257>");
+	    } elsif(($opt::pipe or $opt::pipepart)
+		    and not $opt::fifo and not $opt::cat) {
+		# With --pipe / --pipe-part you can have no replacement
+		last;
+	    } else {
+		# Append {} to the command if there are no {...}'s and no {=...=}
+		push @command, ("\257<\257>");
+	    }
+	}
+    }
+    return(\%replacecount,\%len,@command);
+}
+
+sub get($) {
+    my $self = shift;
+    if(@{$self->{'unget'}}) {
+	my $cmd_line = shift @{$self->{'unget'}};
+	return ($cmd_line);
+    } else {
+	if($opt::sqlworker) {
+	    # Get the sequence number from the SQL table
+	    $self->set_seq($SQL::next_seq);
+	    # Get the command from the SQL table
+	    $self->{'command'} = $SQL::command_ref;
+	    my @command;
+	    # Recompute replace counts based on the read command
+	    ($self->{'replacecount'},
+	     $self->{'len'}, @command) =
+		replacement_counts_and_lengths($self->{'transfer_files'},
+					       $self->{'return_files'},
+					       $self->{'template_name'},
+					       $self->{'template_contents'},
+					       @$SQL::command_ref);
+	    if("@command" =~ /^[^ \t\n=]*\257</) {
+		# Replacement string is (part of) the command (and not just
+		# argument or variable definition V1={})
+		# E.g. parallel {}, parallel my_{= s/_//=}, parallel {2}
+		# Do no quote (Otherwise it will fail if the input contains spaces)
+		$Global::quote_replace = 0;
+	    }
+	}
+
+	my $cmd_line = CommandLine->new($self->seq(),
+					$self->{'command'},
+					$self->{'arg_queue'},
+					$self->{'context_replace'},
+					$self->{'max_number_of_args'},
+					$self->{'transfer_files'},
+					$self->{'return_files'},
+					$self->{'template_names'},
+					$self->{'template_contents'},
+					$self->{'replacecount'},
+					$self->{'len'},
+	    );
+	$cmd_line->populate();
+	::debug("run","cmd_line->number_of_args ",
+		$cmd_line->number_of_args(), "\n");
+	if(not $Global::no_more_input and ($opt::pipe or $opt::pipepart)) {
+	    if($cmd_line->replaced() eq "") {
+		# Empty command - pipe requires a command
+		::error("--pipe/--pipepart must have a command to pipe into ".
+			"(e.g. 'cat').");
+		::wait_and_exit(255);
+	    }
+	} elsif($cmd_line->number_of_args() == 0) {
+	    # We did not get more args - maybe at EOF string?
+	    return undef;
+	}
+	$self->set_seq($self->seq()+1);
+	return $cmd_line;
+    }
+}
+
+sub unget($) {
+    my $self = shift;
+    unshift @{$self->{'unget'}}, @_;
+}
+
+sub empty($) {
+    my $self = shift;
+    my $empty = (not @{$self->{'unget'}}) &&
+	$self->{'arg_queue'}->empty();
+    ::debug("run", "CommandLineQueue->empty $empty");
+    return $empty;
+}
+
+sub seq($) {
+    my $self = shift;
+    return $self->{'seq'};
+}
+
+sub set_seq($$) {
+    my $self = shift;
+    $self->{'seq'} = shift;
+}
+
+sub quote_args($) {
+    my $self = shift;
+    # If there is not command emulate |bash
+    return $self->{'command'};
+}
+
+
+package Limits::Command;
+
+# Maximal command line length (for -m and -X)
+sub max_length($) {
+    # Find the max_length of a command line and cache it
+    # Returns:
+    #	number of chars on the longest command line allowed
+    if(not $Limits::Command::line_max_len) {
+	# Disk cache of max command line length
+	my $len_cache = $Global::cache_dir . "/tmp/sshlogin/" . ::hostname() .
+	    "/linelen";
+	my $cached_limit;
+	local $/ = undef;
+	if(open(my $fh, "<", $len_cache)) {
+	    $cached_limit = <$fh>;
+	    $cached_limit || ::die_bug("Cannot read $len_cache");
+	    close $fh;
+	}
+	if(not $cached_limit) {
+	    $cached_limit = real_max_length();
+	    # If $HOME is write protected: Do not fail
+	    my $dir = ::dirname($len_cache);
+	    -d $dir or eval { File::Path::mkpath($dir); };
+	    open(my $fh, ">", $len_cache.$$);
+	    print $fh $cached_limit;
+	    close $fh;
+	    rename $len_cache.$$, $len_cache || ::die_bug("rename cache file");
+	}
+	$Limits::Command::line_max_len = tmux_length($cached_limit);
+    }
+    return int($Limits::Command::line_max_len);
+}
+
+sub real_max_length() {
+    # Find the max_length of a command line
+    # Returns:
+    #	The maximal command line length with 1 byte arguments
+    # return find_max(" c");
+    return find_max("c");
+}
+
+sub find_max($) {
+    my $string = shift;
+    # This is slow on Cygwin, so give Cygwin users a warning
+    if($^O eq "cygwin" or $^O eq "msys") {
+	::warning("Finding the maximal command line length. ".
+		  "This may take up to 1 minute.")
+    }
+    # Use an upper bound of 100 MB if the shell allows for infinite
+    # long lengths
+    my $upper = 100_000_000;
+    my $lower;
+    # 1000 is supported everywhere, so the search can start anywhere 1..999
+    # 324 makes the search much faster on Cygwin, so let us use that
+    my $len = 324;
+    do {
+	if($len > $upper) { return $len };
+	$lower = $len;
+	$len *= 16;
+	::debug("init", "Maxlen: $lower<$len<$upper(".($upper-$lower)."): ");
+    } while (is_acceptable_command_line_length($len,$string));
+    # Then search for the actual max length between
+    # last successful length ($len/16) and upper bound
+    return binary_find_max(int($len/16),$len,$string);
+}
+
+
+# Prototype forwarding
+sub binary_find_max($$$);
+sub binary_find_max($$$) {
+    # Given a lower and upper bound find the max (length or args) of a
+    # command line
+    # Returns:
+    #   number of chars on the longest command line allowed
+    my ($lower, $upper, $string) = (@_);
+    if($lower == $upper
+       or $lower == $upper-1
+       or $lower/$upper > 0.99) {
+        # $lower is +- 1 or within 1%: Don't search more
+        return $lower;
+    }
+    # Unevenly split binary search which is faster for Microsoft Windows.
+    # Guessing too high is cheap. Guessing too low is expensive.
+    my $split = ($^O eq "cygwin" or $^O eq "msys") ? 0.93 : 0.5;
+    my $middle = int (($upper-$lower)*$split + $lower);
+    ::debug("init", "Maxlen: $lower<$middle<$upper(".($upper-$lower)."): ");
+    if (is_acceptable_command_line_length($middle,$string)) {
+        return binary_find_max($middle,$upper,$string);
+    } else {
+        return binary_find_max($lower,$middle,$string);
+    }
+}
+
+{
+    my $prg;
+
+    sub is_acceptable_command_line_length($$) {
+	# Test if a command line of this length can run
+	# in the current environment
+	# If the string is " x" it tests how many args are allowed
+	# Returns:
+	#   0 if the command line length is too long
+	#   1 otherwise
+	my $len = shift;
+	my $string = shift;
+	if($Global::parallel_env) {
+	    $len += length $Global::parallel_env;
+	}
+	# Force using non-built-in command
+	$prg ||= ::which("echo");
+	::qqx("$prg ".${string}x(($len-1-length $prg)/length $string));
+	::debug("init", "$len=$?\n");
+	return not $?;
+    }
+}
+
+sub tmux_length($) {
+    # If $opt::tmux set, find the limit for tmux
+    # tmux 1.8 has a 2kB limit
+    # tmux 1.9 has a 16kB limit
+    # tmux 2.0 has a 16kB limit
+    # tmux 2.1 has a 16kB limit
+    # tmux 2.2 has a 16kB limit
+    # Input:
+    #	$len = maximal command line length
+    # Returns:
+    #	$tmux_len = maximal length runable in tmux
+    local $/ = "\n";
+    my $len = shift;
+    if($opt::tmux) {
+	$ENV{'PARALLEL_TMUX'} ||= "tmux";
+	if(not ::which($ENV{'PARALLEL_TMUX'})) {
+	    ::error($ENV{'PARALLEL_TMUX'}." not found in \$PATH.");
+	    ::wait_and_exit(255);
+	}
+	my @out;
+	for my $l (1, 2020, 16320, 30000, $len) {
+	    my $tmpfile = ::tmpname("tms");
+	    my $tmuxcmd = $ENV{'PARALLEL_TMUX'}.
+		" -S $tmpfile new-session -d -n echo $l".
+		("t"x$l). " && echo $l; rm -f $tmpfile";
+	    push @out, ::qqx($tmuxcmd);
+	    ::rm($tmpfile);
+	}
+	::debug("tmux","tmux-out ",@out);
+	chomp @out;
+	# The arguments is given 3 times on the command line
+	# and the tmux wrapping is around 30 chars
+	# (29 for tmux1.9, 33 for tmux1.8)
+	my $tmux_len = ::max(@out);
+	$len = ::min($len,int($tmux_len/4-33));
+	::debug("tmux","tmux-length ",$len);
+    }
+    return $len;
+}
+
+
+package RecordQueue;
+
+sub new($) {
+    my $class = shift;
+    my $fhs = shift;
+    my $colsep = shift;
+    my @unget = ();
+    my $arg_sub_queue;
+    if($opt::sqlworker) {
+	# Open SQL table
+	$arg_sub_queue = SQLRecordQueue->new();
+    } elsif(defined $colsep) {
+	# Open one file with colsep or CSV
+	$arg_sub_queue = RecordColQueue->new($fhs);
+    } else {
+	# Open one or more files if multiple -a
+	$arg_sub_queue = MultifileQueue->new($fhs);
+    }
+    return bless {
+	'unget' => \@unget,
+	'arg_number' => 0,
+	'arg_sub_queue' => $arg_sub_queue,
+    }, ref($class) || $class;
+}
+
+sub get($) {
+    # Returns:
+    #	reference to array of Arg-objects
+    my $self = shift;
+    if(@{$self->{'unget'}}) {
+	$self->{'arg_number'}++;
+	# Flush cached computed replacements in Arg-objects
+	# To fix: parallel --bar echo {%} ::: a b c ::: d e f
+	my $ret = shift @{$self->{'unget'}};
+	if($ret) {
+	    map { $_->flush_cache() } @$ret;
+	}
+	return $ret;
+    }
+    my $ret = $self->{'arg_sub_queue'}->get();
+    if($ret) {
+	if(grep { index($_->orig(),"\0") > 0 } @$ret) {
+	    # Allow for \0 in position 0 because GNU  Parallel uses "\0noarg"
+	    # to mean no-string
+	    ::warning("A NUL character in the input was replaced with \\0.",
+		      "NUL cannot be passed through in the argument list.",
+		      "Did you mean to use the --null option?");
+	    for(grep { index($_->orig(),"\0") > 0 } @$ret) {
+		# Replace \0 with \\0
+		my $a = $_->orig();
+		$a =~ s/\0/\\0/g;
+		$_->set_orig($a);
+	    }
+	}
+	if(defined $Global::max_number_of_args
+	   and $Global::max_number_of_args == 0) {
+	    ::debug("run", "Read 1 but return 0 args\n");
+	    # \0noarg => nothing (not the empty string)
+	    map { $_->set_orig("\0noarg"); } @$ret;
+	}
+	# Flush cached computed replacements in Arg-objects
+	# To fix: parallel --bar echo {%} ::: a b c ::: d e f
+	map { $_->flush_cache() } @$ret;
+    }
+    return $ret;
+}
+
+sub unget($) {
+    my $self = shift;
+    ::debug("run", "RecordQueue-unget\n");
+    $self->{'arg_number'} -= @_;
+    unshift @{$self->{'unget'}}, @_;
+}
+
+sub empty($) {
+    my $self = shift;
+    my $empty = (not @{$self->{'unget'}}) &&
+	$self->{'arg_sub_queue'}->empty();
+    ::debug("run", "RecordQueue->empty $empty");
+    return $empty;
+}
+
+sub flush_cache($) {
+    my $self = shift;
+    for my $record (@{$self->{'unget'}}) {
+	for my $arg (@$record) {
+	    $arg->flush_cache();
+	}
+    }
+    $self->{'arg_sub_queue'}->flush_cache();
+}
+
+sub arg_number($) {
+    my $self = shift;
+    return $self->{'arg_number'};
+}
+
+
+package RecordColQueue;
+
+sub new($) {
+    my $class = shift;
+    my $fhs = shift;
+    my @unget = ();
+    my $arg_sub_queue = MultifileQueue->new($fhs);
+    return bless {
+	'unget' => \@unget,
+	'arg_sub_queue' => $arg_sub_queue,
+    }, ref($class) || $class;
+}
+
+sub get($) {
+    # Returns:
+    #	reference to array of Arg-objects
+    my $self = shift;
+    if(@{$self->{'unget'}}) {
+	return shift @{$self->{'unget'}};
+    }
+    if($self->{'arg_sub_queue'}->empty()) {
+	return undef;
+    }
+    my $in_record = $self->{'arg_sub_queue'}->get();
+    if(defined $in_record) {
+	my @out_record = ();
+	for my $arg (@$in_record) {
+	    ::debug("run", "RecordColQueue::arg $arg\n");
+	    my $line = $arg->orig();
+	    ::debug("run", "line='$line'\n");
+	    if($line ne "") {
+		if($opt::csv) {
+		    # Parse CSV and put it into a record
+		    chomp $line;
+		    if(not $Global::csv->parse($line)) {
+			die "CSV has unexpected format: ^$line^";
+		    }
+		    for($Global::csv->fields()) {
+			push @out_record, Arg->new($_);
+		    }
+		} else {
+		    # Split --colsep into record
+		    for my $s (split /$opt::colsep/o, $line, -1) {
+			push @out_record, Arg->new($s);
+		    }
+		}
+	    } else {
+		push @out_record, Arg->new("");
+	    }
+	}
+	return \@out_record;
+    } else {
+	return undef;
+    }
+}
+
+sub unget($) {
+    my $self = shift;
+    ::debug("run", "RecordColQueue-unget '@_'\n");
+    unshift @{$self->{'unget'}}, @_;
+}
+
+sub empty($) {
+    my $self = shift;
+    my $empty = (not @{$self->{'unget'}}) &&
+	$self->{'arg_sub_queue'}->empty();
+    ::debug("run", "RecordColQueue->empty $empty");
+    return $empty;
+}
+
+sub flush_cache($) {
+    my $self = shift;
+    for my $arg (@{$self->{'unget'}}) {
+	$arg->flush_cache();
+    }
+    $self->{'arg_sub_queue'}->flush_cache();
+}
+
+
+package SQLRecordQueue;
+
+sub new($) {
+    my $class = shift;
+    my @unget = ();
+    return bless {
+	'unget' => \@unget,
+    }, ref($class) || $class;
+}
+
+sub get($) {
+    # Returns:
+    #	reference to array of Arg-objects
+    my $self = shift;
+    if(@{$self->{'unget'}}) {
+	return shift @{$self->{'unget'}};
+    }
+    return $Global::sql->get_record();
+}
+
+sub unget($) {
+    my $self = shift;
+    ::debug("run", "SQLRecordQueue-unget '@_'\n");
+    unshift @{$self->{'unget'}}, @_;
+}
+
+sub empty($) {
+    my $self = shift;
+    if(@{$self->{'unget'}}) { return 0; }
+    my $get = $self->get();
+    if(defined $get) {
+	$self->unget($get);
+    }
+    my $empty = not $get;
+    ::debug("run", "SQLRecordQueue->empty $empty");
+    return $empty;
+}
+
+sub flush_cache($) {
+    my $self = shift;
+    for my $record (@{$self->{'unget'}}) {
+	for my $arg (@$record) {
+	    $arg->flush_cache();
+	}
+    }
+}
+
+
+package MultifileQueue;
+
+@Global::unget_argv=();
+
+sub new($$) {
+    my $class = shift;
+    my $fhs = shift;
+    for my $fh (@$fhs) {
+	if(-t $fh and -t ($Global::status_fd || *STDERR)) {
+	    ::warning(
+		  "Input is read from the terminal. You are either an expert",
+		  "(in which case: YOU ARE AWESOME!) or maybe you forgot",
+		  "::: or :::: or -a or to pipe data into parallel. If so",
+		  "consider going through the tutorial: man parallel_tutorial",
+		  "Press CTRL-D to exit.");
+	}
+    }
+    return bless {
+	'unget' => \@Global::unget_argv,
+	'fhs' => $fhs,
+	'arg_matrix' => undef,
+    }, ref($class) || $class;
+}
+
+sub get($) {
+    my $self = shift;
+    if($opt::link) {
+	return $self->link_get();
+    } else {
+	return $self->nest_get();
+    }
+}
+
+sub unget($) {
+    my $self = shift;
+    ::debug("run", "MultifileQueue-unget '@_'\n");
+    unshift @{$self->{'unget'}}, @_;
+}
+
+sub empty($) {
+    my $self = shift;
+    my $empty = (not @Global::unget_argv) &&
+	not @{$self->{'unget'}};
+    for my $fh (@{$self->{'fhs'}}) {
+	$empty &&= eof($fh);
+    }
+    ::debug("run", "MultifileQueue->empty $empty ");
+    return $empty;
+}
+
+sub flush_cache($) {
+    my $self = shift;
+    for my $record (@{$self->{'unget'}}, @{$self->{'arg_matrix'}}) {
+	for my $arg (@$record) {
+	    $arg->flush_cache();
+	}
+    }
+}
+
+sub link_get($) {
+    my $self = shift;
+    if(@{$self->{'unget'}}) {
+	return shift @{$self->{'unget'}};
+    }
+    my @record = ();
+    my $prepend;
+    my $empty = 1;
+    for my $i (0..$#{$self->{'fhs'}}) {
+	my $fh = $self->{'fhs'}[$i];
+	my $arg = read_arg_from_fh($fh);
+	if(defined $arg) {
+	    # Record $arg for recycling at end of file
+	    push @{$self->{'arg_matrix'}[$i]}, $arg;
+	    push @record, $arg;
+	    $empty = 0;
+	} else {
+	    ::debug("run", "EOA ");
+	    # End of file: Recycle arguments
+	    push @{$self->{'arg_matrix'}[$i]}, shift @{$self->{'arg_matrix'}[$i]};
+	    # return last @{$args->{'args'}{$fh}};
+	    push @record, @{$self->{'arg_matrix'}[$i]}[-1];
+	}
+    }
+    if($empty) {
+	return undef;
+    } else {
+	return \@record;
+    }
+}
+
+sub nest_get($) {
+    my $self = shift;
+    if(@{$self->{'unget'}}) {
+	return shift @{$self->{'unget'}};
+    }
+    my @record = ();
+    my $prepend;
+    my $empty = 1;
+    my $no_of_inputsources = $#{$self->{'fhs'}} + 1;
+    if(not $self->{'arg_matrix'}) {
+	# Initialize @arg_matrix with one arg from each file
+	# read one line from each file
+	my @first_arg_set;
+	my $all_empty = 1;
+	for (my $fhno = 0; $fhno < $no_of_inputsources ; $fhno++) {
+	    my $arg = read_arg_from_fh($self->{'fhs'}[$fhno]);
+	    if(defined $arg) {
+		$all_empty = 0;
+	    }
+	    $self->{'arg_matrix'}[$fhno][0] = $arg || Arg->new("");
+	    push @first_arg_set, $self->{'arg_matrix'}[$fhno][0];
+	}
+	if($all_empty) {
+	    # All filehandles were at eof or eof-string
+	    return undef;
+	}
+	return [@first_arg_set];
+    }
+
+    # Treat the case with one input source special.  For multiple
+    # input sources we need to remember all previously read values to
+    # generate all combinations. But for one input source we can
+    # forget the value after first use.
+    if($no_of_inputsources == 1) {
+	my $arg = read_arg_from_fh($self->{'fhs'}[0]);
+	if(defined($arg)) {
+	    return [$arg];
+	}
+	return undef;
+    }
+    for (my $fhno = $no_of_inputsources - 1; $fhno >= 0; $fhno--) {
+	if(eof($self->{'fhs'}[$fhno])) {
+	    next;
+	} else {
+	    # read one
+	    my $arg = read_arg_from_fh($self->{'fhs'}[$fhno]);
+	    defined($arg) || next; # If we just read an EOF string: Treat this as EOF
+	    my $len = $#{$self->{'arg_matrix'}[$fhno]} + 1;
+	    $self->{'arg_matrix'}[$fhno][$len] = $arg;
+	    # make all new combinations
+	    my @combarg = ();
+	    for (my $fhn = 0; $fhn < $no_of_inputsources; $fhn++) {
+		push(@combarg, [0, $#{$self->{'arg_matrix'}[$fhn]}],
+		     # Is input source --link'ed to the next?
+		     $opt::linkinputsource[$fhn+1]);
+	    }
+	    # Find only combinations with this new entry
+	    $combarg[2*$fhno] = [$len,$len];
+	    # map combinations
+	    # [ 1, 3, 7 ], [ 2, 4, 1 ]
+	    # =>
+	    # [ m[0][1], m[1][3], m[2][7] ], [ m[0][2], m[1][4], m[2][1] ]
+	    my @mapped;
+	    for my $c (expand_combinations(@combarg)) {
+		my @a;
+		for my $n (0 .. $no_of_inputsources - 1 ) {
+		    push @a,  $self->{'arg_matrix'}[$n][$$c[$n]];
+		}
+		push @mapped, \@a;
+	    }
+	    # append the mapped to the ungotten arguments
+	    push @{$self->{'unget'}}, @mapped;
+	    # get the first
+	    if(@mapped) {
+		return shift @{$self->{'unget'}};
+	    }
+	}
+    }
+    # all are eof or at EOF string; return from the unget queue
+    return shift @{$self->{'unget'}};
+}
+
+{
+    my $cr_count = 0;
+    my $nl_count = 0;
+    my $dos_crnl_determined;
+    sub read_arg_from_fh($) {
+	# Read one Arg from filehandle
+	# Returns:
+	#   Arg-object with one read line
+	#   undef if end of file
+	my $fh = shift;
+	my $prepend;
+	my $arg;
+	my $half_record = 0;
+	do {{
+	    # This makes 10% faster
+	    if(not defined ($arg = <$fh>)) {
+		if(defined $prepend) {
+		    return Arg->new($prepend);
+		} else {
+		    return undef;
+		}
+	    }
+	    if(not $dos_crnl_determined and not defined $opt::d) {
+		# Warn if input has CR-NL and -d is not set
+		if($arg =~ /\r$/) {
+		    $cr_count++;
+		} else {
+		    $nl_count++;
+		}
+		if($cr_count == 3 or $nl_count == 3) {
+		    $dos_crnl_determined = 1;
+		    if($nl_count == 0 and $cr_count == 3) {
+			::warning('The first three values end in CR-NL. '.
+				  'Consider using -d "\r\n"');
+		    }
+		}
+	    }
+	    if($opt::csv) {
+		# We need to read a full CSV line.
+		if(($arg =~ y/"/"/) % 2 ) {
+		    # The number of " on the line is uneven:
+		    # If we were in a half_record => we have a full record now
+		    # If we were outside a half_record =>
+		    #	 we are in a half record now
+		    $half_record = not $half_record;
+		}
+		if($half_record) {
+		    # CSV half-record with quoting:
+		    #	col1,"col2 2""x3"" board newline  <-this one
+		    #	cont",col3
+		    $prepend .= $arg;
+		    redo;
+		} else {
+		    # Now we have a full CSV record
+		}
+	    }
+	    # Remove delimiter
+	    chomp $arg;
+	    if($Global::end_of_file_string and
+	       $arg eq $Global::end_of_file_string) {
+		# Ignore the rest of input file
+		close $fh;
+		::debug("run", "EOF-string ($arg) met\n");
+		if(defined $prepend) {
+		    return Arg->new($prepend);
+		} else {
+		    return undef;
+		}
+	    }
+	    if(defined $prepend) {
+		$arg = $prepend.$arg; # For line continuation
+		undef $prepend;
+	    }
+	    if($Global::ignore_empty) {
+		if($arg =~ /^\s*$/) {
+		    redo; # Try the next line
+		}
+	    }
+	    if($Global::max_lines) {
+		if($arg =~ /\s$/) {
+		    # Trailing space => continued on next line
+		    $prepend = $arg;
+		    redo;
+		}
+	    }
+	    }} while (1 == 0); # Dummy loop {{}} for redo
+	if(defined $arg) {
+	    return Arg->new($arg);
+	} else {
+	    ::die_bug("multiread arg undefined");
+	}
+    }
+}
+
+# Prototype forwarding
+sub expand_combinations(@);
+sub expand_combinations(@) {
+    # Input:
+    #	([xmin,xmax], [ymin,ymax], ...)
+    # Returns: ([x,y,...],[x,y,...])
+    # where xmin <= x <= xmax and ymin <= y <= ymax
+    my $minmax_ref = shift;
+    my $link = shift; # This is linked to the next input source
+    my $xmin = $$minmax_ref[0];
+    my $xmax = $$minmax_ref[1];
+    my @p;
+    if(@_) {
+	my @rest = expand_combinations(@_);
+	if($link) {
+	    # Linked to next col with --link/:::+/::::+
+	    # TODO BUG does not wrap values if not same number of vals
+	    push(@p, map { [$$_[0], @$_] }
+		 grep { $xmin <= $$_[0] and $$_[0] <= $xmax } @rest);
+	} else {
+	    # If there are more columns: Compute those recursively
+	    for(my $x = $xmin; $x <= $xmax; $x++) {
+		push @p, map { [$x, @$_] } @rest;
+	    }
+	}
+    } else {
+	for(my $x = $xmin; $x <= $xmax; $x++) {
+	    push @p, [$x];
+	}
+    }
+    return @p;
+}
+
+
+package Arg;
+
+sub new($) {
+    my $class = shift;
+    my $orig = shift;
+    my @hostgroups;
+    if($opt::hostgroups) {
+	if($orig =~ s:@(.+)::) {
+	    # We found hostgroups on the arg
+	    @hostgroups = split(/\+/, $1);
+	    if(not grep { defined $Global::hostgroups{$_} } @hostgroups) {
+		# This hostgroup is not defined using -S
+		# Add it
+		::warning("Adding hostgroups: @hostgroups");
+		# Add sshlogin
+		for(grep { not defined $Global::hostgroups{$_} } @hostgroups) {
+		    my $sshlogin = SSHLogin->new($_);
+		    my $sshlogin_string = $sshlogin->string();
+		    $Global::host{$sshlogin_string} = $sshlogin;
+		    $Global::hostgroups{$sshlogin_string} = 1;
+		}
+	    }
+	} else {
+	    # No hostgroup on the arg => any hostgroup
+	    @hostgroups = (keys %Global::hostgroups);
+	}
+    }
+    return bless {
+	'orig' => $orig,
+	'hostgroups' => \@hostgroups,
+    }, ref($class) || $class;
+}
+
+sub Q($) {
+    # Q alias for ::shell_quote_scalar
+    my $ret = ::Q($_[0]);
+    no warnings 'redefine';
+    *Q = \&::Q;
+    return $ret;
+}
+
+sub pQ($) {
+    # pQ alias for ::perl_quote_scalar
+    my $ret = ::pQ($_[0]);
+    no warnings 'redefine';
+    *pQ = \&::pQ;
+    return $ret;
+}
+
+sub hash($) {
+    $Global::use{"DBI"} ||= eval "use B; 1;";
+    B::hash(@_);
+}
+
+sub total_jobs() {
+    return $Global::JobQueue->total_jobs();
+}
+
+{
+    my %perleval;
+    my $job;
+    sub skip() {
+	# shorthand for $job->skip();
+	$job->skip();
+    }
+    sub slot() {
+	# shorthand for $job->slot();
+	$job->slot();
+    }
+    sub seq() {
+	# shorthand for $job->seq();
+	$job->seq();
+    }
+    sub uq() {
+	# Do not quote this arg
+	$Global::unquote_arg = 1;
+    }
+    sub yyyy_mm_dd_hh_mm_ss() {
+	# ISO8601 2038-01-19T03:14:08
+	::strftime("%Y-%m-%dT%H:%M:%S", localtime(time()));
+    }
+    sub yyyy_mm_dd_hh_mm() {
+	# ISO8601 2038-01-19T03:14
+	::strftime("%Y-%m-%dT%H:%M", localtime(time()));
+    }
+    sub yyyy_mm_dd() {
+	# ISO8601 2038-01-19
+	::strftime("%Y-%m-%d", localtime(time()));
+    }
+    sub hh_mm_ss() {
+	# ISO8601 03:14:08
+	::strftime("%H:%M:%S", localtime(time()));
+    }
+    sub hh_mm() {
+	# ISO8601 03:14
+	::strftime("%H:%M", localtime(time()));
+    }
+    sub yyyymmddhhmmss() {
+	# ISO8601 20380119 + ISO8601 031408
+	::strftime("%Y%m%d%H%M%S", localtime(time()));
+    }
+    sub yyyymmddhhmm() {
+	# ISO8601 20380119 + ISO8601 0314
+	::strftime("%Y%m%d%H%M", localtime(time()));
+    }
+    sub yyyymmdd() {
+	# ISO8601 20380119
+	::strftime("%Y%m%d", localtime(time()));
+    }
+    sub hhmmss() {
+	# ISO8601 031408
+	::strftime("%H%M%S", localtime(time()));
+    }
+    sub hhmm() {
+	# ISO8601 0314
+	::strftime("%H%M", localtime(time()));
+    }
+
+    sub replace($$$$) {
+	# Calculates the corresponding value for a given perl expression
+	# Returns:
+	#   The calculated string (quoted if asked for)
+	my $self = shift;
+	my $perlexpr = shift; # E.g. $_=$_ or s/.gz//
+	my $quote = shift; # should the string be quoted?
+	# This is actually a CommandLine-object,
+	# but it looks nice to be able to say {= $job->slot() =}
+	$job = shift;
+	# Positional replace treated as normal replace
+	$perlexpr =~ s/^(-?\d+)? *//;
+	if(not $Global::cache_replacement_eval
+	   or
+	   not $self->{'cache'}{$perlexpr}) {
+	    # Only compute the value once
+	    # Use $_ as the variable to change
+	    local $_;
+	    if($Global::trim eq "n") {
+		$_ = $self->{'orig'};
+	    } else {
+		# Trim the input
+		$_ = trim_of($self->{'orig'});
+	    }
+	    ::debug("replace", "eval ", $perlexpr, " ", $_, "\n");
+	    if(not $perleval{$perlexpr}) {
+		# Make an anonymous function of the $perlexpr
+		# And more importantly: Compile it only once
+		if($perleval{$perlexpr} =
+		   eval('sub { no strict; no warnings; my $job = shift; '.
+			$perlexpr.' }')) {
+		    # All is good
+		} else {
+		    # The eval failed. Maybe $perlexpr is invalid perl?
+		    ::error("Cannot use $perlexpr: $@");
+		    ::wait_and_exit(255);
+		}
+	    }
+	    # Execute the function
+	    $perleval{$perlexpr}->($job);
+	    $self->{'cache'}{$perlexpr} = $_;
+	    if($Global::unquote_arg) {
+		# uq() was called in perlexpr
+		$self->{'cache'}{'unquote'}{$perlexpr} = 1;
+		# Reset for next perlexpr
+		$Global::unquote_arg = 0;
+	    }
+	}
+	# Return the value quoted if needed
+	if($self->{'cache'}{'unquote'}{$perlexpr}) {
+	    return($self->{'cache'}{$perlexpr});
+	} else {
+	    return($quote ? Q($self->{'cache'}{$perlexpr})
+		   : $self->{'cache'}{$perlexpr});
+	}
+    }
+}
+
+sub flush_cache($) {
+    # Flush cache of computed values
+    my $self = shift;
+    $self->{'cache'} = undef;
+}
+
+sub orig($) {
+    my $self = shift;
+    return $self->{'orig'};
+}
+
+sub set_orig($$) {
+    my $self = shift;
+    $self->{'orig'} = shift;
+}
+
+sub trim_of($) {
+    # Removes white space as specifed by --trim:
+    # n = nothing
+    # l = start
+    # r = end
+    # lr|rl = both
+    # Returns:
+    #	string with white space removed as needed
+    my @strings = map { defined $_ ? $_ : "" } (@_);
+    my $arg;
+    if($Global::trim eq "n") {
+	# skip
+    } elsif($Global::trim eq "l") {
+	for my $arg (@strings) { $arg =~ s/^\s+//; }
+    } elsif($Global::trim eq "r") {
+	for my $arg (@strings) { $arg =~ s/\s+$//; }
+    } elsif($Global::trim eq "rl" or $Global::trim eq "lr") {
+	for my $arg (@strings) { $arg =~ s/^\s+//; $arg =~ s/\s+$//; }
+    } else {
+	::error("--trim must be one of: r l rl lr.");
+	::wait_and_exit(255);
+    }
+    return wantarray ? @strings : "@strings";
+}
+
+
+package TimeoutQueue;
+
+sub new($) {
+    my $class = shift;
+    my $delta_time = shift;
+    my ($pct);
+    if($delta_time =~ /(\d+(\.\d+)?)%/) {
+	# Timeout in percent
+	$pct = $1/100;
+	$delta_time = 1_000_000;
+    }
+    $delta_time = ::multiply_time_units($delta_time);
+
+    return bless {
+	'queue' => [],
+	'delta_time' => $delta_time,
+	'pct' => $pct,
+	'remedian_idx' => 0,
+	'remedian_arr' => [],
+	'remedian' => undef,
+    }, ref($class) || $class;
+}
+
+sub delta_time($) {
+    my $self = shift;
+    return $self->{'delta_time'};
+}
+
+sub set_delta_time($$) {
+    my $self = shift;
+    $self->{'delta_time'} = shift;
+}
+
+sub remedian($) {
+    my $self = shift;
+    return $self->{'remedian'};
+}
+
+sub set_remedian($$) {
+    # Set median of the last 999^3 (=997002999) values using Remedian
+    #
+    # Rousseeuw, Peter J., and Gilbert W. Bassett Jr. "The remedian: A
+    # robust averaging method for large data sets." Journal of the
+    # American Statistical Association 85.409 (1990): 97-104.
+    my $self = shift;
+    my $val = shift;
+    my $i = $self->{'remedian_idx'}++;
+    my $rref = $self->{'remedian_arr'};
+    $rref->[0][$i%999] = $val;
+    $rref->[1][$i/999%999] = (sort @{$rref->[0]})[$#{$rref->[0]}/2];
+    $rref->[2][$i/999/999%999] = (sort @{$rref->[1]})[$#{$rref->[1]}/2];
+    $self->{'remedian'} = (sort @{$rref->[2]})[$#{$rref->[2]}/2];
+}
+
+sub update_median_runtime($) {
+    # Update delta_time based on runtime of finished job if timeout is
+    # a percentage
+    my $self = shift;
+    my $runtime = shift;
+    if($self->{'pct'}) {
+	$self->set_remedian($runtime);
+	$self->{'delta_time'} = $self->{'pct'} * $self->remedian();
+	::debug("run", "Timeout: $self->{'delta_time'}s ");
+    }
+}
+
+sub process_timeouts($) {
+    # Check if there was a timeout
+    my $self = shift;
+    # $self->{'queue'} is sorted by start time
+    while (@{$self->{'queue'}}) {
+	my $job = $self->{'queue'}[0];
+	if($job->endtime()) {
+	    # Job already finished. No need to timeout the job
+	    # This could be because of --keep-order
+	    shift @{$self->{'queue'}};
+	} elsif($job->is_timedout($self->{'delta_time'})) {
+	    # Need to shift off queue before kill
+	    # because kill calls usleep that calls process_timeouts
+	    shift @{$self->{'queue'}};
+	    ::warning("This job was killed because it timed out:",
+		      $job->replaced());
+	    $job->kill();
+	} else {
+	    # Because they are sorted by start time the rest are later
+	    last;
+	}
+    }
+}
+
+sub insert($) {
+    my $self = shift;
+    my $in = shift;
+    push @{$self->{'queue'}}, $in;
+}
+
+
+package SQL;
+
+sub new($) {
+    my $class = shift;
+    my $dburl = shift;
+    $Global::use{"DBI"} ||= eval "use DBI; 1;";
+    # +DBURL = append to this DBURL
+    my $append = $dburl=~s/^\+//;
+    my %options = parse_dburl(get_alias($dburl));
+    my %driveralias = ("sqlite" => "SQLite",
+		       "sqlite3" => "SQLite",
+		       "pg" => "Pg",
+		       "postgres" => "Pg",
+		       "postgresql" => "Pg",
+		       "csv" => "CSV",
+		       "oracle" => "Oracle",
+		       "ora" => "Oracle");
+    my $driver = $driveralias{$options{'databasedriver'}} ||
+	$options{'databasedriver'};
+    my $database = $options{'database'};
+    my $host = $options{'host'} ? ";host=".$options{'host'} : "";
+    my $port = $options{'port'} ? ";port=".$options{'port'} : "";
+    my $dsn = "DBI:$driver:dbname=$database$host$port";
+    my $userid = $options{'user'};
+    my $password = $options{'password'};;
+    if(not grep /$driver/, DBI->available_drivers) {
+	::error("$driver not supported. Are you missing a perl DBD::$driver module?");
+	::wait_and_exit(255);
+    }
+    my $dbh;
+    if($driver eq "CSV") {
+	# CSV does not use normal dsn
+	if(-d $database) {
+	    $dbh = DBI->connect("dbi:CSV:", "", "", { f_dir => "$database", })
+		or die $DBI::errstr;
+	} else {
+	    ::error("$database is not a directory.");
+	    ::wait_and_exit(255);
+	}
+    } else {
+	$dbh = DBI->connect($dsn, $userid, $password,
+			   { RaiseError => 1, AutoInactiveDestroy => 1 })
+	or die $DBI::errstr;
+    }
+    $dbh->{'PrintWarn'} = $Global::debug || 0;
+    $dbh->{'PrintError'} = $Global::debug || 0;
+    $dbh->{'RaiseError'} = 1;
+    $dbh->{'ShowErrorStatement'} = 1;
+    $dbh->{'HandleError'} = sub {};
+    if(not defined $options{'table'}) {
+	::error("The DBURL ($dburl) must contain a table.");
+	::wait_and_exit(255);
+    }
+
+    return bless {
+	'dbh' => $dbh,
+	'driver' => $driver,
+	'max_number_of_args' => undef,
+	'table' => $options{'table'},
+	'append' => $append,
+    }, ref($class) || $class;
+}
+
+# Prototype forwarding
+sub get_alias($);
+sub get_alias($) {
+    my $alias = shift;
+    $alias =~ s/^(sql:)*//; # Accept aliases prepended with sql:
+    if ($alias !~ /^:/) {
+	return $alias;
+    }
+
+    # Find the alias
+    my $path;
+    if (-l $0) {
+	($path) = readlink($0) =~ m|^(.*)/|;
+    } else {
+	($path) = $0 =~ m|^(.*)/|;
+    }
+
+    my @deprecated = ("$ENV{HOME}/.dburl.aliases",
+		      "$path/dburl.aliases", "$path/dburl.aliases.dist");
+    for (@deprecated) {
+	if(-r $_) {
+	    ::warning("$_ is deprecated. ".
+		      "Use .sql/aliases instead (read man sql).");
+	}
+    }
+    my @urlalias=();
+    check_permissions("$ENV{HOME}/.sql/aliases");
+    check_permissions("$ENV{HOME}/.dburl.aliases");
+    my @search = ("$ENV{HOME}/.sql/aliases",
+		  "$ENV{HOME}/.dburl.aliases", "/etc/sql/aliases",
+		  "$path/dburl.aliases", "$path/dburl.aliases.dist");
+    for my $alias_file (@search) {
+	# local $/ needed if -0 set
+	local $/ = "\n";
+	if(-r $alias_file) {
+	    open(my $in, "<", $alias_file) || die;
+	    push @urlalias, <$in>;
+	    close $in;
+	}
+    }
+    my ($alias_part,$rest) = $alias=~/(:\w*)(.*)/;
+    # If we saw this before: we have an alias loop
+    if(grep {$_ eq $alias_part } @Private::seen_aliases) {
+	::error("$alias_part is a cyclic alias.");
+	exit -1;
+    } else {
+	push @Private::seen_aliases, $alias_part;
+    }
+
+    my $dburl;
+    for (@urlalias) {
+	/^$alias_part\s+(\S+.*)/ and do { $dburl = $1; last; }
+    }
+
+    if($dburl) {
+	return get_alias($dburl.$rest);
+    } else {
+	::error("$alias is not defined in @search");
+	exit(-1);
+    }
+}
+
+sub check_permissions($) {
+    my $file = shift;
+
+    if(-e $file) {
+	if(not -o $file) {
+	    my $username = (getpwuid($<))[0];
+	    ::warning("$file should be owned by $username: ".
+		      "chown $username $file");
+	}
+	my ($dev,$ino,$mode,$nlink,$uid,$gid,$rdev,$size,
+	    $atime,$mtime,$ctime,$blksize,$blocks) = stat($file);
+	if($mode & 077) {
+	    my $username = (getpwuid($<))[0];
+	    ::warning("$file should be only be readable by $username: ".
+		      "chmod 600 $file");
+	}
+    }
+}
+
+sub parse_dburl($) {
+    my $url = shift;
+    my %options = ();
+    # sql:mysql://[[user][:password]@][host][:port]/[database[/table][?query]]
+
+    if($url=~m!^(?:sql:)? # You can prefix with 'sql:'
+	       ((?:oracle|ora|mysql|pg|postgres|postgresql)(?:s|ssl|)|
+		 (?:sqlite|sqlite2|sqlite3|csv)):// # Databasedriver ($1)
+	       (?:
+		([^:@/][^:@]*|) # Username ($2)
+		(?:
+		 :([^@]*) # Password ($3)
+		)?
+	       @)?
+	       ([^:/]*)? # Hostname ($4)
+	       (?:
+		:
+		([^/]*)? # Port ($5)
+	       )?
+	       (?:
+		/
+		([^/?]*)? # Database ($6)
+	       )?
+	       (?:
+		/
+		([^?]*)? # Table ($7)
+	       )?
+	       (?:
+		\?
+		(.*)? # Query ($8)
+	       )?
+	      $!ix) {
+	$options{databasedriver} = ::undef_if_empty(lc(uri_unescape($1)));
+	$options{user} = ::undef_if_empty(uri_unescape($2));
+	$options{password} = ::undef_if_empty(uri_unescape($3));
+	$options{host} = ::undef_if_empty(uri_unescape($4));
+	$options{port} = ::undef_if_empty(uri_unescape($5));
+	$options{database} = ::undef_if_empty(uri_unescape($6));
+	$options{table} = ::undef_if_empty(uri_unescape($7));
+	$options{query} = ::undef_if_empty(uri_unescape($8));
+	::debug("sql", "dburl $url\n");
+	::debug("sql", "databasedriver ", $options{databasedriver},
+		" user ", $options{user},
+		" password ", $options{password}, " host ", $options{host},
+		" port ", $options{port}, " database ", $options{database},
+		" table ", $options{table}, " query ", $options{query}, "\n");
+    } else {
+	::error("$url is not a valid DBURL");
+	exit 255;
+    }
+    return %options;
+}
+
+sub uri_unescape($) {
+    # Copied from http://cpansearch.perl.org/src/GAAS/URI-1.55/URI/Escape.pm
+    # to avoid depending on URI::Escape
+    # This section is (C) Gisle Aas.
+    # Note from RFC1630:  "Sequences which start with a percent sign
+    # but are not followed by two hexadecimal characters are reserved
+    # for future extension"
+    my $str = shift;
+    if (@_ && wantarray) {
+	# not executed for the common case of a single argument
+	my @str = ($str, @_);  # need to copy
+	foreach (@str) {
+	    s/%([0-9A-Fa-f]{2})/chr(hex($1))/eg;
+	}
+	return @str;
+    }
+    $str =~ s/%([0-9A-Fa-f]{2})/chr(hex($1))/eg if defined $str;
+    $str;
+}
+
+sub run($) {
+    my $self = shift;
+    my $stmt = shift;
+    if($self->{'driver'} eq "CSV") {
+	$stmt=~ s/;$//;
+	if($stmt eq "BEGIN" or
+	   $stmt eq "COMMIT") {
+	    return undef;
+	}
+    }
+    my @retval;
+    my $dbh = $self->{'dbh'};
+    ::debug("sql","$opt::sqlmaster$opt::sqlworker run $stmt\n");
+    # Execute with the rest of the args - if any
+    my $rv;
+    my $sth;
+    my $lockretry = 0;
+    while($lockretry < 10) {
+	$sth = $dbh->prepare($stmt);
+	if($sth
+	   and
+	   eval { $rv = $sth->execute(@_) }) {
+	    last;
+	} else {
+	    if($@ =~ /no such table|Table .* doesn.t exist|relation ".*" does not exist/
+	       or
+	       $DBI::errstr =~ /no such table|Table .* doesn.t exist|relation ".*" does not exist/) {
+		# This is fine:
+		# It is just a worker that reported back too late -
+		# another worker had finished the job first
+		# and the table was then dropped
+		$rv = $sth = 0;
+		last;
+	    }
+	    if($DBI::errstr =~ /locked/) {
+		::debug("sql", "Lock retry: $lockretry");
+		$lockretry++;
+		::usleep(rand()*300);
+	    } elsif(not $sth) {
+		# Try again
+		$lockretry++;
+	    } else {
+		::error($DBI::errstr);
+		::wait_and_exit(255);
+	    }
+	}
+    }
+    if($lockretry >= 10) {
+	::die_bug("retry > 10: $DBI::errstr");
+    }
+    if($rv < 0 and $DBI::errstr){
+	::error($DBI::errstr);
+	::wait_and_exit(255);
+    }
+    return $sth;
+}
+
+sub get($) {
+    my $self = shift;
+    my $sth = $self->run(@_);
+    my @retval;
+    # If $sth = 0 it means the table was dropped by another process
+    while($sth) {
+	my @row = $sth->fetchrow_array();
+	@row or last;
+	push @retval, \@row;
+    }
+    return \@retval;
+}
+
+sub table($) {
+    my $self = shift;
+    return $self->{'table'};
+}
+
+sub append($) {
+    my $self = shift;
+    return $self->{'append'};
+}
+
+sub update($) {
+    my $self = shift;
+    my $stmt = shift;
+    my $table = $self->table();
+    $self->run("UPDATE $table $stmt",@_);
+}
+
+sub output($) {
+    my $self = shift;
+    my $commandline = shift;
+
+    $self->update("SET Stdout = ?, Stderr = ? WHERE Seq = ".
+		  $commandline->seq(),
+		  join("",@{$commandline->{'output'}{1}}),
+		  join("",@{$commandline->{'output'}{2}}));
+}
+
+sub max_number_of_args($) {
+    # Maximal number of args for this table
+    my $self = shift;
+    if(not $self->{'max_number_of_args'}) {
+	# Read the number of args from the SQL table
+	my $table = $self->table();
+	my $v = $self->get("SELECT * FROM $table LIMIT 1;");
+	my @reserved_columns = qw(Seq Host Starttime JobRuntime Send
+	    Receive Exitval _Signal Command Stdout Stderr);
+	if(not $v) {
+	    ::error("$table contains no records");
+	}
+	# Count the number of Vx columns
+	$self->{'max_number_of_args'} = $#{$v->[0]} - $#reserved_columns;
+    }
+    return $self->{'max_number_of_args'};
+}
+
+sub set_max_number_of_args($$) {
+    my $self = shift;
+    $self->{'max_number_of_args'} = shift;
+}
+
+sub create_table($) {
+    my $self = shift;
+    if($self->append()) { return; }
+    my $max_number_of_args = shift;
+    $self->set_max_number_of_args($max_number_of_args);
+    my $table = $self->table();
+    $self->run(qq(DROP TABLE IF EXISTS $table;));
+    # BIGINT and TEXT are not supported in these databases or are too small
+    my %vartype = (
+	"Oracle" => { "BIGINT" => "NUMBER(19,0)",
+		      "TEXT" => "CLOB", },
+	"mysql" => { "TEXT" => "BLOB", },
+	"CSV" => { "BIGINT" => "INT",
+		   "FLOAT" => "REAL", },
+	);
+    my $BIGINT = $vartype{$self->{'driver'}}{"BIGINT"} || "BIGINT";
+    my $TEXT = $vartype{$self->{'driver'}}{"TEXT"} || "TEXT";
+    my $FLOAT = $vartype{$self->{'driver'}}{"FLOAT"} || "FLOAT(44)";
+    my $v_def = join "", map { "V$_ $TEXT," } (1..$self->max_number_of_args());
+    $self->run(qq{CREATE TABLE $table
+		(Seq $BIGINT,
+		 Host $TEXT,
+		 Starttime $FLOAT,
+		 JobRuntime $FLOAT,
+		 Send $BIGINT,
+		 Receive $BIGINT,
+		 Exitval $BIGINT,
+		 _Signal $BIGINT,
+		 Command $TEXT,}.
+	       $v_def.
+	       qq{Stdout $TEXT,
+		 Stderr $TEXT);});
+}
+
+sub insert_records($) {
+    my $self = shift;
+    my $seq = shift;
+    my $command_ref = shift;
+    my $record_ref = shift;
+    my $table = $self->table();
+    # For SQL encode the command with \257 space as split points
+    my $command = join("\257 ",@$command_ref);
+    my @v_cols = map { ", V$_" } (1..$self->max_number_of_args());
+    # Two extra value due to $seq, Exitval, Send
+    my $v_vals = join ",", map { "?" } (1..$self->max_number_of_args()+4);
+    $self->run("INSERT INTO $table (Seq,Command,Exitval,Send @v_cols) ".
+	       "VALUES ($v_vals);", $seq, $command, -1000,
+	       0, @$record_ref[1..$#$record_ref]);
+}
+
+
+sub get_record($) {
+    my $self = shift;
+    my @retval;
+    my $table = $self->table();
+    my @v_cols = map { ", V$_" } (1..$self->max_number_of_args());
+    my $rand = "Reserved-".$$.rand();
+    my $v;
+    my $more_pending;
+
+    do {
+	if($self->{'driver'} eq "CSV") {
+	    # Sub SELECT is not supported in CSV
+	    # So to minimize the race condition below select a job at random
+	    my $r = $self->get("SELECT Seq, Command @v_cols FROM $table ".
+			       "WHERE Exitval = -1000 LIMIT 100;");
+	    $v = [ sort { rand() > 0.5 } @$r ];
+	} else {
+	    # Avoid race condition where multiple workers get the same job
+	    # by setting Stdout to a unique string
+	    # (SELECT * FROM (...) AS dummy) is needed due to sillyness in MySQL
+	    $self->update("SET Stdout = ?,Exitval = ? ".
+			  "WHERE Seq = (".
+			  "  SELECT * FROM (".
+			  "    SELECT min(Seq) FROM $table WHERE Exitval = -1000".
+			  "  ) AS dummy".
+			  ") AND Exitval = -1000;", $rand, -1210);
+	    # If a parallel worker overwrote the unique string this will get nothing
+	    $v = $self->get("SELECT Seq, Command @v_cols FROM $table ".
+			    "WHERE Stdout = ?;", $rand);
+	}
+	if($v->[0]) {
+	    my $val_ref = $v->[0];
+	    # Mark record as taken
+	    my $seq = shift @$val_ref;
+	    # Save the sequence number to use when running the job
+	    $SQL::next_seq = $seq;
+	    $self->update("SET Exitval = ? WHERE Seq = ".$seq, -1220);
+	    # Command is encoded with '\257 space' as splitting char
+	    my @command = split /\257 /, shift @$val_ref;
+	    $SQL::command_ref = \@command;
+	    for (@$val_ref) {
+		push @retval, Arg->new($_);
+	    }
+	} else {
+	    # If the record was updated by another job in parallel,
+	    # then we may not be done, so see if there are more jobs pending
+	    $more_pending =
+		$self->get("SELECT Seq FROM $table WHERE Exitval = ?;", -1210);
+	}
+    } while (not $v->[0] and $more_pending->[0]);
+
+    if(@retval) {
+	return \@retval;
+    } else {
+	return undef;
+    }
+}
+
+sub total_jobs($) {
+    my $self = shift;
+    my $table = $self->table();
+    my $v = $self->get("SELECT count(*) FROM $table;");
+    if($v->[0]) {
+	return $v->[0]->[0];
+    } else {
+	::die_bug("SQL::total_jobs");
+    }
+}
+
+sub max_seq($) {
+    my $self = shift;
+    my $table = $self->table();
+    my $v = $self->get("SELECT max(Seq) FROM $table;");
+    if($v->[0]) {
+	return $v->[0]->[0];
+    } else {
+	::die_bug("SQL::max_seq");
+    }
+}
+
+sub finished($) {
+    # Check if there are any jobs left in the SQL table that do not
+    # have a "real" exitval
+    my $self = shift;
+    if($opt::wait or $Global::start_sqlworker) {
+	my $table = $self->table();
+	my $rv = $self->get("select Seq,Exitval from $table ".
+			    "where Exitval <= -1000 limit 1");
+	return not $rv->[0];
+    } else {
+	return 1;
+    }
+}
+
+package Semaphore;
+
+# This package provides a counting semaphore
+#
+# If a process dies without releasing the semaphore the next process
+# that needs that entry will clean up dead semaphores
+#
+# The semaphores are stored in $PARALLEL_HOME/semaphores/id-<name> Each
+# file in $PARALLEL_HOME/semaphores/id-<name>/ is the process ID of the
+# process holding the entry. If the process dies, the entry can be
+# taken by another process.
+
+sub new($) {
+    my $class = shift;
+    my $id = shift;
+    my $count = shift;
+    $id =~ s/([^-_a-z0-9])/unpack("H*",$1)/ige; # Convert non-word chars to hex
+    $id = "id-".$id; # To distinguish it from a process id
+    my $parallel_locks = $Global::cache_dir . "/semaphores";
+    -d $parallel_locks or ::mkdir_or_die($parallel_locks);
+    my $lockdir = "$parallel_locks/$id";
+    my $lockfile = $lockdir.".lock";
+    if(-d $parallel_locks and -w $parallel_locks
+       and -r $parallel_locks and -x $parallel_locks) {
+	# skip
+    } else {
+	::error("Semaphoredir must be writable: '$parallel_locks'");
+	::wait_and_exit(255);
+    }
+
+    if($count < 1) { ::die_bug("semaphore-count: $count"); }
+    return bless {
+	'lockfile' => $lockfile,
+	'lockfh' => Symbol::gensym(),
+	'lockdir' => $lockdir,
+	'id' => $id,
+	'idfile' => $lockdir."/".$id,
+	'pid' => $$,
+	'pidfile' => $lockdir."/".$$.'@'.::hostname(),
+	'count' => $count + 1 # nlinks returns a link for the 'id-' as well
+    }, ref($class) || $class;
+}
+
+sub remove_dead_locks($) {
+    my $self = shift;
+    my $lockdir = $self->{'lockdir'};
+
+    for my $d (glob "$lockdir/*") {
+	$d =~ m:$lockdir/([0-9]+)\@([-\._a-z0-9]+)$:o or next;
+	my ($pid, $host) = ($1, $2);
+	if($host eq ::hostname()) {
+	    if(kill 0, $pid) {
+		::debug("sem", "Alive: $pid $d\n");
+	    } else {
+		::debug("sem", "Dead: $d\n");
+		::rm($d);
+	    }
+	}
+    }
+}
+
+sub acquire($) {
+    my $self = shift;
+    my $sleep = 1; # 1 ms
+    my $start_time = time;
+    while(1) {
+	# Can we get a lock?
+	$self->atomic_link_if_count_less_than() and last;
+	$self->remove_dead_locks();
+	# Retry slower and slower up to 1 second
+	$sleep = ($sleep < 1000) ? ($sleep * 1.1) : ($sleep);
+	# Random to avoid every sleeping job waking up at the same time
+	::usleep(rand()*$sleep);
+	if($opt::semaphoretimeout) {
+	    if($opt::semaphoretimeout > 0
+	       and
+	       time - $start_time > $opt::semaphoretimeout) {
+		# Timeout: Take the semaphore anyway
+		::warning("Semaphore timed out. Stealing the semaphore.");
+		if(not -e $self->{'idfile'}) {
+		    open (my $fh, ">", $self->{'idfile'}) or
+			::die_bug("timeout_write_idfile: $self->{'idfile'}");
+		    close $fh;
+		}
+		link $self->{'idfile'}, $self->{'pidfile'};
+		last;
+	    }
+	    if($opt::semaphoretimeout < 0
+	       and
+	       time - $start_time > -$opt::semaphoretimeout) {
+		# Timeout: Exit
+		::warning("Semaphore timed out. Exiting.");
+		exit(1);
+		last;
+	    }
+	}
+    }
+    ::debug("sem", "acquired $self->{'pid'}\n");
+}
+
+sub release($) {
+    my $self = shift;
+    ::rm($self->{'pidfile'});
+    if($self->nlinks() == 1) {
+	# This is the last link, so atomic cleanup
+	$self->lock();
+	if($self->nlinks() == 1) {
+	    ::rm($self->{'idfile'});
+	    rmdir $self->{'lockdir'};
+	}
+	$self->unlock();
+    }
+    ::debug("run", "released $self->{'pid'}\n");
+}
+
+sub pid_change($) {
+    # This should do what release()+acquire() would do without having
+    # to re-acquire the semaphore
+    my $self = shift;
+
+    my $old_pidfile =  $self->{'pidfile'};
+    $self->{'pid'} = $$;
+    $self->{'pidfile'} = $self->{'lockdir'}."/".$$.'@'.::hostname();
+    my $retval = link $self->{'idfile'}, $self->{'pidfile'};
+    ::debug("sem","link($self->{'idfile'},$self->{'pidfile'})=$retval\n");
+    ::rm($old_pidfile);
+}
+
+sub atomic_link_if_count_less_than($) {
+    # Link $file1 to $file2 if nlinks to $file1 < $count
+    my $self = shift;
+    my $retval = 0;
+    $self->lock();
+    my $nlinks = $self->nlinks();
+    ::debug("sem","$nlinks<$self->{'count'} ");
+    if($nlinks < $self->{'count'}) {
+	-d $self->{'lockdir'} or ::mkdir_or_die($self->{'lockdir'});
+	if(not -e $self->{'idfile'}) {
+	    open (my $fh, ">", $self->{'idfile'}) or
+		::die_bug("write_idfile: $self->{'idfile'}");
+	    close $fh;
+	}
+	$retval = link $self->{'idfile'}, $self->{'pidfile'};
+	::debug("sem","link($self->{'idfile'},$self->{'pidfile'})=$retval\n");
+    }
+    $self->unlock();
+    ::debug("sem", "atomic $retval");
+    return $retval;
+}
+
+sub nlinks($) {
+    my $self = shift;
+    if(-e $self->{'idfile'}) {
+	return (stat(_))[3];
+    } else {
+	return 0;
+    }
+}
+
+sub lock($) {
+    my $self = shift;
+    my $sleep = 100; # 100 ms
+    my $total_sleep = 0;
+    $Global::use{"Fcntl"} ||= eval "use Fcntl qw(:DEFAULT :flock); 1;";
+    my $locked = 0;
+    while(not $locked) {
+	if(tell($self->{'lockfh'}) == -1) {
+	    # File not open
+	    open($self->{'lockfh'}, ">", $self->{'lockfile'})
+		or ::debug("run", "Cannot open $self->{'lockfile'}");
+	}
+	if($self->{'lockfh'}) {
+	    # File is open
+	    chmod 0666, $self->{'lockfile'}; # assuming you want it a+rw
+	    if(flock($self->{'lockfh'}, LOCK_EX()|LOCK_NB())) {
+		# The file is locked: No need to retry
+		$locked = 1;
+		last;
+	    } else {
+		if ($! =~ m/Function not implemented/) {
+		    ::warning("flock: $!",
+			      "Will wait for a random while.");
+		    ::usleep(rand(5000));
+		    # File cannot be locked: No need to retry
+		    $locked = 2;
+		    last;
+		}
+	    }
+	}
+	# Locking failed in first round
+	# Sleep and try again
+	$sleep = ($sleep < 1000) ? ($sleep * 1.1) : ($sleep);
+	# Random to avoid every sleeping job waking up at the same time
+	::usleep(rand()*$sleep);
+	$total_sleep += $sleep;
+	if($opt::semaphoretimeout) {
+	    if($opt::semaphoretimeout > 0
+	       and
+	       $total_sleep/1000 > $opt::semaphoretimeout) {
+		# Timeout: Take the semaphore anyway
+		::warning("Semaphore timed out. Taking the semaphore.");
+		$locked = 3;
+		last;
+	    }
+	    if($opt::semaphoretimeout < 0
+	       and
+	       $total_sleep/1000 > -$opt::semaphoretimeout) {
+		# Timeout: Exit
+		::warning("Semaphore timed out. Exiting.");
+		$locked = 4;
+		last;
+	    }
+	} else {
+	    if($total_sleep/1000 > 30) {
+		::warning("Semaphore stuck for 30 seconds. ".
+			  "Consider using --semaphoretimeout.");
+	    }
+	}
+    }
+    ::debug("run", "locked $self->{'lockfile'}");
+}
+
+sub unlock($) {
+    my $self = shift;
+    ::rm($self->{'lockfile'});
+    close $self->{'lockfh'};
+    ::debug("run", "unlocked\n");
+}
+
+# Keep perl -w happy
+
+$opt::x = $Semaphore::timeout = $Semaphore::wait =
+$Job::file_descriptor_warning_printed = $Global::envdef = @Arg::arg =
+$Global::max_slot_number = $opt::session;
+
+package main;
+
+sub main() {
+    save_stdin_stdout_stderr();
+    save_original_signal_handler();
+    parse_options();
+    ::debug("init", "Open file descriptors: ", join(" ",keys %Global::fh), "\n");
+    my $number_of_args;
+    if($Global::max_number_of_args) {
+	$number_of_args = $Global::max_number_of_args;
+    } elsif ($opt::X or $opt::m or $opt::xargs) {
+	$number_of_args = undef;
+    } else {
+	$number_of_args = 1;
+    }
+
+    my @command = @ARGV;
+    my @input_source_fh;
+    if($opt::pipepart) {
+	if($opt::tee) {
+	    @input_source_fh = map { open_or_exit($_) } @opt::a;
+	    # Remove the first: It will be the file piped.
+	    shift @input_source_fh;
+	    if(not @input_source_fh and not $opt::pipe) {
+		@input_source_fh = (*STDIN);
+	    }
+	} else {
+	    # -a is used for data - not for command line args
+	    @input_source_fh = map { open_or_exit($_) } "/dev/null";
+	}
+    } else {
+	@input_source_fh = map { open_or_exit($_) } @opt::a;
+	if(not @input_source_fh and not $opt::pipe) {
+	    @input_source_fh = (*STDIN);
+	}
+    }
+
+    if($opt::skip_first_line) {
+	# Skip the first line for the first file handle
+	my $fh = $input_source_fh[0];
+	<$fh>;
+    }
+
+    set_input_source_header(\@command,\@input_source_fh);
+    if($opt::filter_hosts and (@opt::sshlogin or @opt::sshloginfile)) {
+	# Parallel check all hosts are up. Remove hosts that are down
+	filter_hosts();
+    }
+
+
+    if($opt::sqlmaster and $opt::sqlworker) {
+	# Start a real --sqlworker in the background later
+	$Global::start_sqlworker = 1;
+	$opt::sqlworker = undef;
+    }
+
+    if($opt::nonall or $opt::onall) {
+	onall(\@input_source_fh,@command);
+	wait_and_exit(min(undef_as_zero($Global::exitstatus),254));
+    }
+
+    $Global::JobQueue = JobQueue->new(
+	\@command, \@input_source_fh, $Global::ContextReplace,
+	$number_of_args, \@Global::transfer_files, \@Global::ret_files,
+	\@Global::template_names, \@Global::template_contents
+	);
+
+    if($opt::sqlmaster) {
+	# Create SQL table to hold joblog + output
+	# Figure out how many arguments are in a job
+	# (It is affected by --colsep, -N, $number_source_fh)
+	my $record_queue = $Global::JobQueue->{'commandlinequeue'}{'arg_queue'};
+	my $record = $record_queue->get();
+	my $no_of_values = $number_of_args * (1+$#{$record});
+	$record_queue->unget($record);
+	$Global::sql->create_table($no_of_values);
+	if($opt::sqlworker) {
+	    # Start a real --sqlworker in the background later
+	    $Global::start_sqlworker = 1;
+	    $opt::sqlworker = undef;
+	}
+    }
+
+    if($opt::pipepart) {
+	pipepart_setup();
+    } elsif($opt::pipe) {
+	if($opt::tee) {
+	    pipe_tee_setup();
+	} elsif($opt::shard or $opt::bin) {
+	    pipe_shard_setup();
+	} elsif($opt::groupby) {
+	    pipe_group_by_setup();
+	}
+    }
+
+    if($opt::eta or $opt::bar or $opt::shuf or $Global::halt_pct) {
+	# Count the number of jobs or shuffle all jobs
+	# before starting any.
+	# Must be done after ungetting any --pipepart jobs.
+	$Global::JobQueue->total_jobs();
+    }
+    # Compute $Global::max_jobs_running
+    # Must be done after ungetting any --pipepart jobs.
+    max_jobs_running();
+
+    init_run_jobs();
+    my $sem;
+    if($Global::semaphore) {
+	$sem = acquire_semaphore();
+    }
+    $SIG{TERM} = $Global::original_sig{TERM};
+    $SIG{HUP} = \&start_no_new_jobs;
+
+    if($opt::tee or $opt::shard or $opt::bin) {
+	# All jobs must be running in parallel for --tee/--shard/--bin
+	while(start_more_jobs()) {}
+	$Global::start_no_new_jobs = 1;
+	if(not $Global::JobQueue->empty()) {
+	    if($opt::tee) {
+		::error("--tee requires --jobs to be higher. Try --jobs 0.");
+	    } elsif($opt::bin) {
+		::error("--bin requires --jobs to be higher than the number of",
+			"arguments. Increase --jobs.");
+	    } elsif($opt::shard) {
+		::error("--shard requires --jobs to be higher than the number of",
+			"arguments. Increase --jobs.");
+	    } else {
+		::die_bug("--bin/--shard/--tee should not get here");
+	    }
+	    ::wait_and_exit(255);
+	}
+    } elsif($opt::pipe and not $opt::pipepart and not $opt::semaphore) {
+	# Fill all jobslots
+	while(start_more_jobs()) {}
+	spreadstdin();
+    } else {
+	# Reap the finished jobs and start more
+	while(reapers() + start_more_jobs()) {}
+    }
+    ::debug("init", "Start draining\n");
+    drain_job_queue(@command);
+    ::debug("init", "Done draining\n");
+    reapers();
+    ::debug("init", "Done reaping\n");
+    if($Global::semaphore) { $sem->release(); }
+    cleanup();
+    ::debug("init", "Halt\n");
+    halt();
+}
+
+main();
diff --git a/src/sem.pod b/src/sem.pod
new file mode 100644
index 0000000..15d4ea7
--- /dev/null
+++ b/src/sem.pod
@@ -0,0 +1,381 @@
+#!/usr/bin/perl -w
+
+# SPDX-FileCopyrightText: 2021-2022 Ole Tange, http://ole.tange.dk and Free Software and Foundation, Inc.
+# SPDX-License-Identifier: GFDL-1.3-or-later
+# SPDX-License-Identifier: CC-BY-SA-4.0
+
+=head1 NAME
+
+sem - semaphore for executing shell command lines in parallel
+
+=head1 SYNOPSIS
+
+B<sem> [--fg] [--id <id>] [--semaphoretimeout <secs>] [-j <num>] [--wait] command
+
+=head1 DESCRIPTION
+
+GNU B<sem> is an alias for GNU B<parallel --semaphore>.
+
+GNU B<sem> acts as a counting semaphore. When GNU B<sem> is called
+with command it starts the command in the background. When I<num>
+number of commands are running in the background, GNU B<sem> waits for
+one of these to complete before starting the command.
+
+GNU B<sem> does not read any arguments to build the command (no -a,
+:::, and ::::). It simply waits for a semaphore to become available
+and then runs the command given.
+
+Before looking at the options you may want to check out the examples
+after the list of options. That will give you an idea of what GNU
+B<sem> is capable of.
+
+=head1 OPTIONS
+
+=over 9
+
+=item I<command>
+
+Command to execute. The command may be followed by arguments for the
+command.
+
+
+=item B<--bg>
+
+Run command in background thus GNU B<sem> will not wait for
+completion of the command before exiting. This is the default.
+
+In toilet analogy: GNU B<sem> waits for a toilet to be available,
+gives the toilet to a person, and exits immediately.
+
+See also: B<--fg>
+
+
+=item B<--jobs> I<N>
+
+=item B<-j> I<N>
+
+=item B<--max-procs> I<N>
+
+=item B<-P> I<N>
+
+Run up to N commands in parallel. Default is 1 thus acting like a
+mutex.
+
+In toilet analogy: B<-j> is the number of toilets.
+
+
+=item B<--jobs> I<+N>
+
+=item B<-j> I<+N>
+
+=item B<--max-procs> I<+N>
+
+=item B<-P> I<+N>
+
+Add N to the number of CPU cores.  Run up to this many jobs in
+parallel. For compute intensive jobs B<-j> +0 is useful as it will run
+number-of-cpu-cores jobs simultaneously.
+
+
+=item B<--jobs> I<-N>
+
+=item B<-j> I<-N>
+
+=item B<--max-procs> I<-N>
+
+=item B<-P> I<-N>
+
+Subtract N from the number of CPU cores.  Run up to this many jobs in
+parallel.  If the evaluated number is less than 1 then 1 will be used.
+See also B<--use-cpus-instead-of-cores>.
+
+
+=item B<--jobs> I<N>%
+
+=item B<-j> I<N>%
+
+=item B<--max-procs> I<N>%
+
+=item B<-P> I<N>%
+
+Multiply N% with the number of CPU cores.  Run up to this many jobs in
+parallel.  If the evaluated number is less than 1 then 1 will be used.
+See also B<--use-cpus-instead-of-cores>.
+
+
+=item B<--jobs> I<procfile>
+
+=item B<-j> I<procfile>
+
+=item B<--max-procs> I<procfile>
+
+=item B<-P> I<procfile>
+
+Read parameter from file. Use the content of I<procfile> as parameter
+for I<-j>. E.g. I<procfile> could contain the string 100% or +2 or
+10.
+
+
+=item B<--pipe>
+
+Pass stdin (standard input) to I<command>.
+
+If I<command> read from stdin (standard input), use B<--pipe>.
+
+
+=item B<--semaphorename> I<name>
+
+=item B<--id> I<name>
+
+Use B<name> as the name of the semaphore. Default is the name of the
+controlling tty (output from B<tty>).
+
+The default normally works as expected when used interactively, but
+when used in a script I<name> should be set. I<$$> or I<my_task_name>
+are often a good value.
+
+The semaphore is stored in ~/.parallel/semaphores/
+
+In toilet analogy the name corresponds to different types of toilets:
+e.g. male, female, customer, staff.
+
+
+=item B<--fg>
+
+Do not put command in background.
+
+In toilet analogy: GNU B<sem> waits for a toilet to be available,
+takes a person to the toilet, waits for the person to finish, and
+exits.
+
+
+=item B<--semaphoretimeout> I<secs>
+
+=item B<--st> I<secs>
+
+If I<secs> > 0: If the semaphore is not released within I<secs>
+seconds, take it anyway.
+
+If I<secs> < 0: If the semaphore is not released within I<secs>
+seconds, exit.
+
+In toilet analogy: I<secs> > 0: If no toilet becomes available within
+I<secs> seconds, pee on the floor. I<secs> < 0: If no toilet becomes
+available within I<secs> seconds, exit without doing anything.
+
+
+=item B<--wait>
+
+Wait for all commands to complete.
+
+In toilet analogy: Wait until all toilets are empty, then exit.
+
+
+=back
+
+=head1 UNDERSTANDING A SEMAPHORE
+
+Try the following example:
+
+  sem -j 2 'sleep 1;echo 1 finished';   echo sem 1 exited
+  sem -j 2 'sleep 2;echo 2 finished';   echo sem 2 exited
+  sem -j 2 'sleep 3;echo 3 finished';   echo sem 3 exited
+  sem -j 2 'sleep 4;echo 4 finished';   echo sem 4 exited
+  sem --wait; echo sem --wait done
+
+In toilet analogy this uses 2 toilets (B<-j 2>). GNU B<sem> takes '1'
+to a toilet, and exits immediately. While '1' is sleeping, another GNU
+B<sem> takes '2' to a toilet, and exits immediately.
+
+While '1' and '2' are sleeping, another GNU B<sem> waits for a free
+toilet. When '1' finishes, a toilet becomes available, and this GNU
+B<sem> stops waiting, and takes '3' to a toilet, and exits
+immediately.
+
+While '2' and '3' are sleeping, another GNU B<sem> waits for a free
+toilet.  When '2' finishes, a toilet becomes available, and this GNU
+B<sem> stops waiting, and takes '4' to a toilet, and exits
+immediately.
+
+Finally another GNU B<sem> waits for all toilets to become free.
+
+
+=head1 EXAMPLE: Gzipping *.log
+
+Run one gzip process per CPU core. Block until a CPU core becomes
+available.
+
+  for i in *.log ; do
+    echo $i
+    sem -j+0 gzip $i ";" echo done
+  done
+  sem --wait
+
+=head1 EXAMPLE: Protecting pod2html from itself
+
+pod2html creates two files: pod2htmd.tmp and pod2htmi.tmp which it
+does not clean up. It uses these two files for a short time. But if
+you run multiple pod2html in parallel (e.g. in a Makefile with make
+-j) there is a risk that two different instances of pod2html will
+write to the files at the same time:
+
+  # This may fail due to shared pod2htmd.tmp/pod2htmi.tmp files
+  foo.html:
+          pod2html foo.pod --outfile foo.html
+
+  bar.html:
+          pod2html bar.pod --outfile bar.html
+
+  $ make -j foo.html bar.html
+
+You need to protect pod2html from running twice at the same time.
+B<sem> running as a mutex will make sure only one runs:
+
+  foo.html:
+          sem --id pod2html pod2html foo.pod --outfile foo.html
+
+  bar.html:
+          sem --id pod2html pod2html bar.pod --outfile bar.html
+
+  clean: foo.html bar.html
+          sem --id pod2html --wait
+          rm -f pod2htmd.tmp pod2htmi.tmp
+
+  $ make -j foo.html bar.html clean
+
+=head1 BUGS
+
+None known.
+
+
+=head1 REPORTING BUGS
+
+Report bugs to <bug-parallel@gnu.org>.
+
+
+=head1 AUTHOR
+
+Copyright (C) 2010-2022 Ole Tange, http://ole.tange.dk and Free
+Software Foundation, Inc.
+
+
+=head1 LICENSE
+
+This program is free software; you can redistribute it and/or modify
+it under the terms of the GNU General Public License as published by
+the Free Software Foundation; either version 3 of the License, or
+at your option any later version.
+
+This program is distributed in the hope that it will be useful,
+but WITHOUT ANY WARRANTY; without even the implied warranty of
+MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the
+GNU General Public License for more details.
+
+You should have received a copy of the GNU General Public License
+along with this program.  If not, see <https://www.gnu.org/licenses/>.
+
+=head2 Documentation license I
+
+Permission is granted to copy, distribute and/or modify this
+documentation under the terms of the GNU Free Documentation License,
+Version 1.3 or any later version published by the Free Software
+Foundation; with no Invariant Sections, with no Front-Cover Texts, and
+with no Back-Cover Texts.  A copy of the license is included in the
+file LICENSES/GFDL-1.3-or-later.txt.
+
+=head2 Documentation license II
+
+You are free:
+
+=over 9
+
+=item B<to Share>
+
+to copy, distribute and transmit the work
+
+=item B<to Remix>
+
+to adapt the work
+
+=back
+
+Under the following conditions:
+
+=over 9
+
+=item B<Attribution>
+
+You must attribute the work in the manner specified by the author or
+licensor (but not in any way that suggests that they endorse you or
+your use of the work).
+
+=item B<Share Alike>
+
+If you alter, transform, or build upon this work, you may distribute
+the resulting work only under the same, similar or a compatible
+license.
+
+=back
+
+With the understanding that:
+
+=over 9
+
+=item B<Waiver>
+
+Any of the above conditions can be waived if you get permission from
+the copyright holder.
+
+=item B<Public Domain>
+
+Where the work or any of its elements is in the public domain under
+applicable law, that status is in no way affected by the license.
+
+=item B<Other Rights>
+
+In no way are any of the following rights affected by the license:
+
+=over 2
+
+=item *
+
+Your fair dealing or fair use rights, or other applicable
+copyright exceptions and limitations;
+
+=item *
+
+The author's moral rights;
+
+=item *
+
+Rights other persons may have either in the work itself or in
+how the work is used, such as publicity or privacy rights.
+
+=back
+
+=back
+
+=over 9
+
+=item B<Notice>
+
+For any reuse or distribution, you must make clear to others the
+license terms of this work.
+
+=back
+
+A copy of the full license is included in the file as
+LICENCES/CC-BY-SA-4.0.txt
+
+
+=head1 DEPENDENCIES
+
+GNU B<sem> uses Perl, and the Perl modules Getopt::Long,
+Symbol, Fcntl.
+
+
+=head1 SEE ALSO
+
+B<parallel>(1)
+
+=cut
diff --git a/src/sql b/src/sql
new file mode 100755
index 0000000..822c07c
--- /dev/null
+++ b/src/sql
@@ -0,0 +1,1274 @@
+#!/usr/bin/perl -w
+
+# Copyright (C) 2008-2010 Ole Tange, http://ole.tange.dk
+#
+# Copyright (C) 2010-2022 Ole Tange, http://ole.tange.dk and
+# Free Software Foundation, Inc.
+#
+# This program is free software; you can redistribute it and/or modify
+# it under the terms of the GNU General Public License as published by
+# the Free Software Foundation; either version 3 of the License, or
+# (at your option) any later version.
+#
+# This program is distributed in the hope that it will be useful, but
+# WITHOUT ANY WARRANTY; without even the implied warranty of
+# MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the GNU
+# General Public License for more details.
+#
+# You should have received a copy of the GNU General Public License
+# along with this program; if not, see <http://www.gnu.org/licenses/>
+# or write to the Free Software Foundation, Inc., 51 Franklin St,
+# Fifth Floor, Boston, MA 02110-1301 USA
+#
+# SPDX-FileCopyrightText: 2008-2022 Ole Tange, http://ole.tange.dk and Free Software and Foundation, Inc.
+# SPDX-License-Identifier: GPL-3.0-or-later
+# SPDX-License-Identifier: GFDL-1.3-or-later
+
+=head1 NAME
+
+sql - execute a command on a database determined by a dburl
+
+=head1 SYNOPSIS
+
+B<sql> [options] I<dburl> [I<commands>]
+
+B<sql> [options] I<dburl> < commandfile
+
+B<#!/usr/bin/sql> B<--shebang> [options] I<dburl>
+
+=head1 DESCRIPTION
+
+GNU B<sql> aims to give a simple, unified interface for accessing
+databases through all the different databases' command line
+clients. So far the focus has been on giving a common way to specify
+login information (protocol, username, password, hostname, and port
+number), size (database and table size), and running queries.
+
+The database is addressed using a DBURL. If I<commands> are left out
+you will get that database's interactive shell.
+
+GNU B<sql> is often used in combination with GNU B<parallel>.
+
+=over 9
+
+=item I<dburl>
+
+A DBURL has the following syntax:
+[sql:]vendor://
+[[user][:password]@][host][:port]/[database][?sqlquery]
+
+See the section DBURL below.
+
+=item I<commands>
+
+The SQL commands to run. Each argument will have a newline
+appended.
+
+Example: "SELECT * FROM foo;" "SELECT * FROM bar;"
+
+If the arguments contain '\n' or '\x0a' this will be replaced with a
+newline:
+
+Example: "SELECT * FROM foo;\n SELECT * FROM bar;"
+
+If no commands are given SQL is read from the keyboard or STDIN.
+
+Example: echo 'SELECT * FROM foo;' | sql mysql:///
+
+
+=item B<--csv> (beta testing)
+
+CSV output.
+
+
+=item B<--db-size>
+
+=item B<--dbsize>
+
+Size of database. Show the size of the database on disk. For Oracle
+this requires access to read the table I<dba_data_files> - the user
+I<system> has that.
+
+
+=item B<--help>
+
+=item B<-h>
+
+Print a summary of the options to GNU B<sql> and exit.
+
+
+=item B<--html>
+
+HTML output. Turn on HTML tabular output.
+
+
+=item B<--json> (beta testing)
+
+=item B<--pretty> (beta testing)
+
+Pretty JSON output.
+
+
+=item B<--list-databases>
+
+=item B<--listdbs>
+
+=item B<--show-databases>
+
+=item B<--showdbs>
+
+List the databases (table spaces) in the database.
+
+
+=item B<--listproc>
+
+=item B<--proclist>
+
+=item B<--show-processlist>
+
+Show the list of running queries.
+
+
+=item B<--list-tables>
+
+=item B<--show-tables>
+
+=item B<--table-list>
+
+List the tables in the database.
+
+
+=item B<--noheaders>
+
+=item B<--no-headers>
+
+=item B<-n>
+
+Remove headers and footers and print only tuples. Bug in Oracle: it
+still prints number of rows found.
+
+
+=item B<-p> I<pass-through>
+
+The string following -p will be given to the database connection
+program as arguments. Multiple -p's will be joined with
+space. Example: pass '-U' and the user name to the program:
+
+I<-p "-U scott"> can also be written I<-p -U -p scott>.
+
+
+=item B<--precision> <I<rfc3339|h|m|s|ms|u|ns>>
+
+Precision of timestamps.
+
+Specifiy the format of the output timestamps: rfc3339, h, m, s, ms, u
+or ns.
+
+
+=item B<-r>
+
+Try 3 times. Short version of I<--retries 3>.
+
+
+=item B<--retries> I<ntimes>
+
+Try I<ntimes> times. If the client program returns with an error,
+retry the command. Default is I<--retries 1>.
+
+
+=item B<--sep> I<string>
+
+=item B<-s> I<string>
+
+Field separator. Use I<string> as separator between columns.
+
+
+=item B<--skip-first-line>
+
+Do not use the first line of input (used by GNU B<sql> itself
+when called with B<--shebang>).
+
+
+=item B<--table-size>
+
+=item B<--tablesize>
+
+Size of tables. Show the size of the tables in the database.
+
+
+=item B<--verbose>
+
+=item B<-v>
+
+Print which command is sent.
+
+
+=item B<--version>
+
+=item B<-V>
+
+Print the version GNU B<sql> and exit.
+
+
+=item B<--shebang>
+
+=item B<-Y>
+
+GNU B<sql> can be called as a shebang (#!) command as the first line of a script. Like this:
+
+  #!/usr/bin/sql -Y mysql:///
+
+  SELECT * FROM foo;
+
+For this to work B<--shebang> or B<-Y> must be set as the first option.
+
+=back
+
+=head1 DBURL
+
+A DBURL has the following syntax:
+[sql:]vendor://
+[[user][:password]@][host][:port]/[database][?sqlquery]
+
+To quote special characters use %-encoding specified in
+http://tools.ietf.org/html/rfc3986#section-2.1 (E.g. a password
+containing '/' would contain '%2F').
+
+Examples:
+
+ mysql://scott:tiger@my.example.com/mydb
+ influxdb://scott:tiger@influxdb.example.com/foo
+ sql:oracle://scott:tiger@ora.example.com/xe
+ postgresql://scott:tiger@pg.example.com/pgdb
+ pg:///
+ postgresqlssl://scott@pg.example.com:3333/pgdb
+ sql:sqlite2:////tmp/db.sqlite?SELECT * FROM foo;
+ sqlite3:///../db.sqlite3?SELECT%20*%20FROM%20foo;
+
+Currently supported vendors: MySQL (mysql), MySQL with SSL (mysqls,
+mysqlssl), Oracle (oracle, ora), PostgreSQL (postgresql, pg, pgsql,
+postgres), PostgreSQL with SSL (postgresqlssl, pgs, pgsqlssl,
+postgresssl, pgssl, postgresqls, pgsqls, postgress), SQLite2 (sqlite,
+sqlite2), SQLite3 (sqlite3), InfluxDB 1.x (influx, influxdb), InfluxDB
+with SSL (influxdbssl, influxdbs, influxs, influxssl)
+
+Aliases must start with ':' and are read from
+/etc/sql/aliases and ~/.sql/aliases. The user's own
+~/.sql/aliases should only be readable by the user.
+
+Example of aliases:
+
+ :myalias1 pg://scott:tiger@pg.example.com/pgdb
+ :myalias2 ora://scott:tiger@ora.example.com/xe
+ # Short form of mysql://`whoami`:nopassword@localhost:3306/`whoami`
+ :myalias3 mysql:///
+ # Short form of mysql://`whoami`:nopassword@localhost:33333/mydb
+ :myalias4 mysql://:33333/mydb
+ # Alias for an alias
+ :m      :myalias4
+ # the sortest alias possible
+ :       sqlite2:////tmp/db.sqlite
+ # Including an SQL query
+ :query  sqlite:////tmp/db.sqlite?SELECT * FROM foo;
+
+=head1 EXAMPLES
+
+=head2 Get an interactive prompt
+
+The most basic use of GNU B<sql> is to get an interactive prompt:
+
+B<sql sql:oracle://scott:tiger@ora.example.com/xe>
+
+If you have setup an alias you can do:
+
+B<sql :myora>
+
+
+=head2 Run a query
+
+To run a query directly from the command line:
+
+B<sql :myalias "SELECT * FROM foo;">
+
+Oracle requires newlines after each statement. This can be done like
+this:
+
+B<sql :myora "SELECT * FROM foo;" "SELECT * FROM bar;">
+
+Or this:
+
+B<sql :myora "SELECT * FROM foo;\nSELECT * FROM bar;">
+
+
+=head2 Copy a PostgreSQL database
+
+To copy a PostgreSQL database use pg_dump to generate the dump and GNU
+B<sql> to import it:
+
+B<pg_dump pg_database | sql pg://scott:tiger@pg.example.com/pgdb>
+
+
+=head2 Empty all tables in a MySQL database
+
+Using GNU B<parallel> it is easy to empty all tables without dropping them:
+
+B<sql -n mysql:/// 'show tables' | parallel sql mysql:/// DELETE FROM {};>
+
+
+=head2 Drop all tables in a PostgreSQL database
+
+To drop all tables in a PostgreSQL database do:
+
+B<sql -n pg:/// '\dt' | parallel --colsep '\|' -r sql pg:/// DROP TABLE {2};>
+
+
+=head2 Run as a script
+
+Instead of doing:
+
+B<sql mysql:/// < sqlfile>
+
+you can combine the sqlfile with the DBURL to make a
+UNIX-script. Create a script called I<demosql>:
+
+B<#!/usr/bin/sql -Y mysql:///>
+
+B<SELECT * FROM foo;>
+
+Then do:
+
+B<chmod +x demosql; ./demosql>
+
+
+=head2 Use --colsep to process multiple columns
+
+Use GNU B<parallel>'s B<--colsep> to separate columns:
+
+B<sql -s '\t' :myalias 'SELECT * FROM foo;' | parallel --colsep '\t' do_stuff {4} {1}>
+
+
+=head2 Retry if the connection fails
+
+If the access to the database fails occasionally B<--retries> can help
+make sure the query succeeds:
+
+B<sql --retries 5 :myalias 'SELECT * FROM really_big_foo;'>
+
+
+=head2 Get info about the running database system
+
+Show how big the database is:
+
+B<sql --db-size :myalias>
+
+List the tables:
+
+B<sql --list-tables :myalias>
+
+List the size of the tables:
+
+B<sql --table-size :myalias>
+
+List the running processes:
+
+B<sql --show-processlist :myalias>
+
+
+=head1 REPORTING BUGS
+
+GNU B<sql> is part of GNU B<parallel>. Report bugs to <bug-parallel@gnu.org>.
+
+
+=head1 AUTHOR
+
+When using GNU B<sql> for a publication please cite:
+
+O. Tange (2011): GNU SQL - A Command Line Tool for Accessing Different
+Databases Using DBURLs, ;login: The USENIX Magazine, April 2011:29-32.
+
+Copyright (C) 2008-2010 Ole Tange http://ole.tange.dk
+
+Copyright (C) 2010-2022 Ole Tange, http://ole.tange.dk and Free
+Software Foundation, Inc.
+
+=head1 LICENSE
+
+This program is free software; you can redistribute it and/or modify
+it under the terms of the GNU General Public License as published by
+the Free Software Foundation; either version 3 of the License, or
+at your option any later version.
+
+This program is distributed in the hope that it will be useful,
+but WITHOUT ANY WARRANTY; without even the implied warranty of
+MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the
+GNU General Public License for more details.
+
+You should have received a copy of the GNU General Public License
+along with this program.  If not, see <http://www.gnu.org/licenses/>.
+
+=head2 Documentation license I
+
+Permission is granted to copy, distribute and/or modify this
+documentation under the terms of the GNU Free Documentation License,
+Version 1.3 or any later version published by the Free Software
+Foundation; with no Invariant Sections, with no Front-Cover Texts, and
+with no Back-Cover Texts.  A copy of the license is included in the
+file LICENSES/GFDL-1.3-or-later.txt.
+
+
+=head2 Documentation license II
+
+You are free:
+
+=over 9
+
+=item B<to Share>
+
+to copy, distribute and transmit the work
+
+=item B<to Remix>
+
+to adapt the work
+
+=back
+
+Under the following conditions:
+
+=over 9
+
+=item B<Attribution>
+
+You must attribute the work in the manner specified by the author or
+licensor (but not in any way that suggests that they endorse you or
+your use of the work).
+
+=item B<Share Alike>
+
+If you alter, transform, or build upon this work, you may distribute
+the resulting work only under the same, similar or a compatible
+license.
+
+=back
+
+With the understanding that:
+
+=over 9
+
+=item B<Waiver>
+
+Any of the above conditions can be waived if you get permission from
+the copyright holder.
+
+=item B<Public Domain>
+
+Where the work or any of its elements is in the public domain under
+applicable law, that status is in no way affected by the license.
+
+=item B<Other Rights>
+
+In no way are any of the following rights affected by the license:
+
+=over 9
+
+=item *
+
+Your fair dealing or fair use rights, or other applicable
+copyright exceptions and limitations;
+
+=item *
+
+The author's moral rights;
+
+=item *
+
+Rights other persons may have either in the work itself or in
+how the work is used, such as publicity or privacy rights.
+
+=back
+
+=item B<Notice>
+
+For any reuse or distribution, you must make clear to others the
+license terms of this work.
+
+=back
+
+A copy of the full license is included in the file as cc-by-sa.txt.
+
+=head1 DEPENDENCIES
+
+GNU B<sql> uses Perl. If B<mysql> is installed, MySQL dburls will
+work. If B<psql> is installed, PostgreSQL dburls will work.  If
+B<sqlite> is installed, SQLite2 dburls will work.  If B<sqlite3> is
+installed, SQLite3 dburls will work. If B<sqlplus> is installed,
+Oracle dburls will work. If B<rlwrap> is installed, GNU B<sql> will
+have a command history for Oracle.
+
+
+=head1 FILES
+
+~/.sql/aliases - user's own aliases with DBURLs
+
+/etc/sql/aliases - common aliases with DBURLs
+
+
+=head1 SEE ALSO
+
+B<mysql>(1), B<psql>(1), B<rlwrap>(1), B<sqlite>(1), B<sqlite3>(1),
+B<sqlplus>(1), B<influx>(1)
+
+=cut
+
+use Getopt::Long;
+use strict;
+use File::Temp qw/tempfile tempdir/;
+
+parse_options();
+
+my $pass_through_options = (defined $::opt_p) ? join(" ",@{$::opt_p}) : "";
+my $dburl_or_alias = shift;
+if (not defined $dburl_or_alias) { Usage("No DBURL given"); exit -1; }
+my %dburl = parse_dburl(get_alias($dburl_or_alias));
+
+my $interactive_command;
+my $batch_command;
+
+my $database_driver = database_driver_alias($dburl{'databasedriver'});
+if($database_driver eq "mysql" or
+   $database_driver eq "mysqlssl") {
+    ($batch_command,$interactive_command) =
+	mysql_commands($database_driver,%dburl);
+} elsif($database_driver eq "postgresql" or
+	$database_driver eq "postgresqlssl") {
+    ($batch_command,$interactive_command) =
+	postgresql_commands($database_driver,%dburl);
+} elsif($database_driver eq "oracle") {
+    ($batch_command,$interactive_command) =
+	oracle_commands($database_driver,%dburl);
+} elsif($database_driver eq "sqlite" or
+	$database_driver eq "sqlite3") {
+    ($batch_command,$interactive_command) =
+	sqlite_commands($database_driver,%dburl);
+} elsif($database_driver eq "influx" or
+	$database_driver eq "influxssl") {
+    ($batch_command,$interactive_command) =
+	influx_commands($database_driver,%dburl);
+}
+
+my $err;
+my $retries;
+$retries ||= defined $::opt_retries ? $::opt_retries : undef;
+$retries ||= defined $::opt_retry ? $::opt_retry * 3 : undef;
+$retries ||= 1;
+
+if(defined $::opt_processlist) {
+    unshift @ARGV, processlist($database_driver,%dburl);
+}
+
+if(defined $::opt_tablelist) {
+    unshift @ARGV, tablelist($database_driver,%dburl);
+}
+
+if(defined $::opt_dblist) {
+    unshift @ARGV, dblist($database_driver,%dburl);
+}
+
+if(defined $::opt_dbsize) {
+    unshift @ARGV, dbsize($database_driver,%dburl);
+}
+
+if(defined $::opt_tablesize) {
+    unshift @ARGV, tablesize($database_driver,%dburl);
+}
+
+my $queryfile = "";
+if($dburl{'query'}) {
+    my $fh;
+    ($fh,$queryfile) = tempfile(SUFFIX => ".sql");
+    print $fh $dburl{'query'},"\n";
+    close $fh;
+    $batch_command = "(cat $queryfile;rm $queryfile; cat) | $batch_command";
+}
+
+sub shell_quote($) {
+    # Quote for other shells (Bourne compatibles)
+    # Inputs:
+    #	$string = string to be quoted
+    # Returns:
+    #	$shell_quoted = string quoted as needed by the shell
+    my $s = $_[0];
+    if($s =~ /[^-_.+a-z0-9\/]/i) {
+	$s =~ s/'/'"'"'/g; # "-quote single quotes
+	$s = "'$s'";	   # '-quote entire string
+	$s =~ s/^''//;	   # Remove unneeded '' at ends
+	$s =~ s/''$//;	   # (faster than s/^''|''$//g)
+	return $s;
+    } elsif ($s eq "") {
+	return "''";
+    } else {
+	# No quoting needed
+	return $s;
+    }
+}
+
+do {
+    if(@ARGV) {
+	# SQL Commands given as arguments:
+	# Run those commands
+	$::opt_debug and print "[ | $batch_command]\n";
+	$::opt_verbose and print "[ | $batch_command]\n";
+	if($database_driver eq "influx" or $database_driver eq "influxssl") {
+	    # Influx currently cannot read commands from stdin
+	    for(@ARGV) {
+		s/\\n/\n/g;
+		s/\\x0a/\n/gi;
+		$::opt_debug and print "[$batch_command -execute $_]\n";
+		system("$batch_command -execute ".shell_quote($_));
+	    }
+	} else {
+	    open(M,"| $batch_command") ||
+		die("mysql/psql/sqlplus/influx not in path");
+	    for(@ARGV) {
+		s/\\n/\n/g;
+		s/\\x0a/\n/gi;
+		print M "$_\n";
+	    }
+	    close M;
+	}
+    } else {
+	if (is_stdin_terminal()) {
+	    # Run interactively
+	    $::opt_debug and print "[$interactive_command]\n";
+	    $::opt_verbose and print "[$interactive_command]\n";
+	    system("$interactive_command");
+	} else {
+	    # Let the command read from stdin
+	    $::opt_debug and print "[$batch_command]\n";
+	    $::opt_verbose and print "[$batch_command]\n";
+	    if($database_driver eq "influx" or $database_driver eq "influxssl") {
+		# Influx currently cannot read commands from stdin
+		while(<STDIN>) {
+		    s/\\n/\n/g;
+		    s/\\x0a/\n/gi;
+		    $::opt_debug and print "[$batch_command -execute $_]\n";
+		    system("$batch_command -execute ".shell_quote($_));
+		}
+	    } else{
+		system("$batch_command");
+	    }
+	}
+    }
+    $err = $?>>8;
+} while (--$retries and $err);
+
+$queryfile and unlink $queryfile;
+
+$Global::Initfile && unlink $Global::Initfile;
+exit ($err);
+
+sub parse_options {
+    $Global::version = 20221122;
+    $Global::progname = 'sql';
+
+    # This must be done first as this may exec myself
+    if(defined $ARGV[0] and ($ARGV[0]=~/^-Y/ or $ARGV[0]=~/^--shebang /)) {
+	# Program is called from #! line in script
+	$ARGV[0]=~s/^-Y //; # remove -Y if on its own
+	$ARGV[0]=~s/^-Y/-/; # remove -Y if bundled with other options
+	$ARGV[0]=~s/^--shebang //; # remove --shebang if it is set
+	my $argfile = pop @ARGV;
+	# exec myself to split @ARGV into separate fields
+	exec "$0 --skip-first-line < $argfile @ARGV";
+    }
+    Getopt::Long::Configure ("bundling","require_order");
+    GetOptions("passthrough|p=s@" => \$::opt_p,
+	       "sep|s=s" => \$::opt_s,
+	       "html" => \$::opt_html,
+	       "show-processlist|proclist|listproc|showqueries|show-queries"
+	       => \$::opt_processlist,
+	       "show-tables|showtables|listtables|list-tables|".
+	       "tablelist|table-list|show-measurements|showmeasurements|".
+	       "list-measurements|listmeasurements" => \$::opt_tablelist,
+	       "dblist|".
+	       "listdb|listdbs|list-db|list-dbs|list-database|".
+	       "list-databases|listdatabases|listdatabase|showdb|".
+	       "showdbs|show-db|show-dbs|show-database|show-databases|".
+	       "showdatabases|showdatabase" => \$::opt_dblist,
+	       "db-size|dbsize" => \$::opt_dbsize,
+	       "table-size|tablesize" => \$::opt_tablesize,
+	       "json|j" => \$::opt_json,
+	       "pretty" => \$::opt_pretty,
+	       "csv" => \$::opt_csv,
+	       "precision=s" => \$::opt_precision,
+	       "noheaders|no-headers|n" => \$::opt_n,
+	       "r" => \$::opt_retry,
+	       "retries=s" => \$::opt_retries,
+	       "debug|D" => \$::opt_debug,
+	       # Shebang #!/usr/bin/parallel -Yotheroptions
+	       "Y|shebang" => \$::opt_shebang,
+	       "skip-first-line" => \$::opt_skip_first_line,
+	       # GNU requirements
+	       "help|h" => \$::opt_help,
+	       "version|V" => \$::opt_version,
+	       "verbose|v" => \$::opt_verbose,
+	) || die_usage();
+
+    if(defined $::opt_help) { die_usage(); }
+    if(defined $::opt_version) { version(); exit(0); }
+    $Global::debug = $::opt_debug;
+}
+
+sub database_driver_alias {
+    my $driver = shift;
+    my %database_driver_alias = ("mysql" => "mysql",
+				 "mysqls" => "mysqlssl",
+				 "mysqlssl" => "mysqlssl",
+				 "oracle" => "oracle",
+				 "ora" => "oracle",
+				 "oracles" => "oraclessl",
+				 "oras" => "oraclessl",
+				 "oraclessl" => "oraclessl",
+				 "orassl" => "oraclessl",
+				 "postgresql" => "postgresql",
+				 "pgsql" => "postgresql",
+				 "postgres" => "postgresql",
+				 "pg" => "postgresql",
+				 "postgresqlssl" => "postgresqlssl",
+				 "pgsqlssl" => "postgresqlssl",
+				 "postgresssl" => "postgresqlssl",
+				 "pgssl" => "postgresqlssl",
+				 "postgresqls" => "postgresqlssl",
+				 "pgsqls" => "postgresqlssl",
+				 "postgress" => "postgresqlssl",
+				 "pgs" => "postgresqlssl",
+				 "sqlite" => "sqlite",
+				 "sqlite2" => "sqlite",
+				 "sqlite3" => "sqlite3",
+                                 "influx" => "influx",
+                                 "influxdb" => "influx",
+                                 "influxssl" => "influxssl",
+                                 "influxdbssl" => "influxssl",
+                                 "influxs" => "influxssl",
+                                 "influxdbs" => "influxssl",
+	);
+    return $database_driver_alias{$driver};
+}
+
+sub mysql_commands {
+    my ($database_driver,%opt) = (@_);
+    find_command_in_path("mysql") || die ("mysql not in path");
+    if(defined($::opt_s)) { die "Field separator not implemented for mysql" }
+    my $password = defined($opt{'password'}) ? "--password=".$opt{'password'} : "";
+    my $host = defined($opt{'host'}) ? "--host=".$opt{'host'} : "";
+    my $port = defined($opt{'port'}) ? "--port=".$opt{'port'} : "";
+    my $user = defined($opt{'user'}) ? "--user=".$opt{'user'} : "";
+    my $database = defined($opt{'database'}) ? $opt{'database'} : $ENV{'USER'};
+    my $html = defined($::opt_html) ? "--html" : "";
+    my $no_headers = defined($::opt_n) ? "--skip-column-names" : "";
+    my $ssl = "";
+    if ($database_driver eq "mysqlssl") { $ssl="--ssl"; }
+    my($credential_fh,$tmp) = tempfile(SUFFIX => ".sql");
+    chmod (0600,$tmp);
+    print $credential_fh ("[client]\n",
+			  $user && "user=$opt{'user'}\n",
+			  $password && "password=$opt{'password'}\n",
+			  $host && "host=$opt{'host'}\n");
+    close $credential_fh;
+
+    # Prepend with a remover of the credential tempfile
+    # -C: Compression if both ends support it
+    $batch_command =
+	"((sleep 1; rm $tmp) & ".
+	"mysql --defaults-extra-file=$tmp -C $pass_through_options ".
+	"$no_headers $html $ssl $host $user $port  $database)";
+    $interactive_command = $batch_command;
+    return($batch_command,$interactive_command);
+}
+
+sub postgresql_commands {
+    my ($database_driver,%opt) = (@_);
+    find_command_in_path("psql") || die ("psql not in path");
+    my $sep = ($::opt_s) ? "-A --field-separator '$::opt_s'" : "";
+    my $password = defined($opt{'password'}) ?
+	"PGPASSWORD=".$opt{'password'} : "";
+    my $host = defined($opt{'host'}) ? "-h ".$opt{'host'} : "";
+    my $port = defined($opt{'port'}) ? "-p ".$opt{'port'} : "";
+    my $user = defined($opt{'user'}) ? "-U ".$opt{'user'} : "";
+    my $database = defined($opt{'database'}) ? "-d ".$opt{'database'} : "";
+    my $html = defined($::opt_html) ? "--html" : "";
+    my $no_headers = defined($::opt_n) ? "--tuples-only" : "";
+    my $ssl = "";
+    if ($database_driver eq "postgresqlssl") { $ssl="PGSSLMODE=require"; }
+    $batch_command =
+	"$ssl $password psql $pass_through_options $sep $no_headers ".
+	"$html $host $user $port $database";
+    $interactive_command = $batch_command;
+
+    return($batch_command,$interactive_command);
+}
+
+sub oracle_commands {
+    my ($database_driver,%opt) = (@_);
+    # oracle://user:pass@grum:1521/XE becomes:
+    # sqlplus 'user/pass@(DESCRIPTION = (ADDRESS = (PROTOCOL = TCP)(HOST = grum)(PORT = 1521)) (CONNECT_DATA =(SERVER = DEDICATED)(SERVICE_NAME = XE) ))'
+    my $sqlplus = find_command_in_path("sqlplus") ||
+	find_command_in_path("sqlplus64") or
+	die("sqlplus/sqlplus64 not in path");
+
+    # Readline support: if rlwrap installed run rlwrap sqlplus
+    my $rlwrap = find_command_in_path("rlwrap");
+
+    # Set good defaults in the inifile
+    $Global::Initfile = "/tmp/$$.sql.init";
+    open(INIT,">".$Global::Initfile) || die;
+    print INIT "SET LINESIZE 32767\n";
+    $::opt_debug and print "SET LINESIZE 32767\n";
+    print INIT "SET WRAP OFF\n";
+    $::opt_debug and print "SET WRAP OFF\n";
+    if(defined($::opt_html)) {
+	print INIT "SET MARK HTML ON\n";
+	$::opt_debug and print "SET MARK HTML ON\n";
+    }
+    if(defined($::opt_n)) {
+	print INIT "SET PAGES 0\n";
+	$::opt_debug and print "SET PAGES 0\n";
+    } else {
+	print INIT "SET PAGES 50000\n";
+	$::opt_debug and print "SET PAGES 50000\n";
+    }
+    if(defined($::opt_s)) {
+	print INIT "SET COLSEP $::opt_s\n";
+	$::opt_debug and print "SET COLSEP $::opt_s\n";
+    }
+    close INIT;
+
+    my $password = defined($opt{'password'}) ? "/".$opt{'password'} : "";
+    my $host = defined($opt{'host'}) ? $opt{'host'} : "localhost";
+    my $port = defined($opt{'port'}) ? $opt{'port'} : "1521";
+    my $user = defined($opt{'user'}) ? $opt{'user'} : "";
+    # Database is called service in Oracle lingo
+    my $service = defined($opt{'database'}) ? "(SERVICE_NAME = ".$opt{'database'}.")" : "";
+    my $tns = "(DESCRIPTION = (ADDRESS = (PROTOCOL = TCP)(HOST = $host)(PORT = $port)) ".
+	"(CONNECT_DATA =(SERVER = DEDICATED)$service ))";
+    my $ssl = "";
+    # -L: Do not re-ask for password if it is wrong
+    my $common_options = "-L $pass_through_options ".
+	"'$user$password\@$tns' \@$Global::Initfile";
+    my $batch_command =	"$sqlplus -S ".$common_options;
+    my $interactive_command = "$rlwrap $sqlplus ".$common_options;
+    return($batch_command,$interactive_command);
+}
+
+sub sqlite_commands {
+    my ($database_driver,%opt) = (@_);
+    if(not find_command_in_path($database_driver)) {
+	print STDERR "Database driver '$database_driver' not supported\n";
+	exit -1;
+    }
+    my $sep = defined($::opt_s) ? "-separator '$::opt_s'" : "";
+    my $password = defined($opt{'password'}) ? "--password=".$opt{'password'} : "";
+    my $host = defined($opt{'host'}) ? "--host=".$opt{'host'} : "";
+    my $port = defined($opt{'port'}) ? "--port=".$opt{'port'} : "";
+    my $user = defined($opt{'user'}) ? "--user=".$opt{'user'} : "";
+    my $database = defined($opt{'database'}) ? $opt{'database'} : "";
+    my $html = defined($::opt_html) ? "-html" : "";
+    my $no_headers = defined($::opt_n) ? "-noheader" : "-header";
+    my $ssl = "";
+    $batch_command =
+	"$database_driver $pass_through_options $sep ".
+	"$no_headers $html $database";
+    $interactive_command = $batch_command;
+    return($batch_command,$interactive_command);
+}
+
+sub influx_commands {
+    my ($database_driver,%opt) = (@_);
+    my $influx = find_command_in_path("influx") ||
+	die ("influx not in path");
+    if(defined($::opt_s)) {
+	die "Field separator not implemented for influx";
+    }
+    my $password =
+	defined($opt{'password'}) ? "-password=".$opt{'password'} : "";
+    my $host = defined($opt{'host'}) ? "-host=".$opt{'host'} : "";
+    my $port = defined($opt{'port'}) ? "-port=".$opt{'port'} : "";
+    my $user = defined($opt{'user'}) ? "-username=".$opt{'user'} : "";
+    my $database = defined($opt{'database'}) ?
+	"-database $opt{'database'}" : "-database $ENV{'USER'}";
+
+    my $format = defined($::opt_json) ? "-format json" :
+                 defined($::opt_pretty) ? "-format json -pretty" :
+                 defined($::opt_csv) ? "-format csv" : "";
+    my $precision = defined($::opt_precision) ?
+	"-precision $::opt_precision" : "";
+
+    my $no_headers = defined($::opt_n) ? "--skip-column-names" : "";
+    my $ssl = "";
+    if($database_driver eq "influxssl") { $ssl="--ssl"; }
+
+    $batch_command =
+        "$influx $pass_through_options $no_headers $format ".
+	"$precision $ssl $host $user $password $port  $database";
+    $interactive_command = $batch_command;
+    return($batch_command,$interactive_command);
+}
+
+# Return the code for 'show processlist' in the chosen database dialect
+sub processlist {
+    my $dbdriver = shift;
+    my %dburl = @_;
+    my %statement =
+	("mysql" => "show processlist;",
+	 "postgresql" => ("SELECT ".
+			  "    datname AS database,".
+			  "    usename AS username,".
+			  "    now()-xact_start AS runtime,".
+			  "    current_query ".
+			  "FROM pg_stat_activity ".
+			  "ORDER BY runtime DESC;"),
+	 "oracle" => ("SELECT ".
+		      '    CPU_TIME/100000, SYS.V_$SQL.SQL_TEXT, USERNAME '.
+		      "FROM ".
+		      '    SYS.V_$SQL, SYS.V_$SESSION '.
+		      "WHERE ".
+		      '    SYS.V_$SQL.SQL_ID = SYS.V_$SESSION.SQL_ID(+) '.
+		      "AND username IS NOT NULL ".
+		      "ORDER BY CPU_TIME DESC;"),
+	 "influx" => "show queries;",
+	);
+    if($statement{$dbdriver}) {
+	return $statement{$dbdriver};
+    } else {
+	print STDERR "processlist is not implemented for $dbdriver\n";
+	exit 1;
+    }
+}
+
+# Return the code for 'show tables' in the chosen database dialect
+sub tablelist {
+    my $dbdriver = shift;
+    my %dburl = @_;
+    my %statement =
+	("mysql" => "show tables;",
+	 "postgresql" => '\dt',
+	 "oracle" => ("SELECT object_name ".
+		      "FROM user_objects ".
+		      "WHERE object_type = 'TABLE';"),
+	 "sqlite" => ".tables",
+	 "sqlite3" => ".tables",
+	 "influx" => "show measurements;",
+	);
+    if($statement{$dbdriver}) {
+	return $statement{$dbdriver};
+    } else {
+	print STDERR "tablelist is not implemented for $dbdriver\n";
+	exit 1;
+    }
+}
+
+# Return the code for 'show databases' in the chosen database dialect
+sub dblist {
+    my $dbdriver = shift;
+    my %dburl = @_;
+    my %statement =
+	("mysql" => "show databases;",
+	 "postgresql" => ("SELECT datname FROM pg_database ".
+			  "WHERE datname NOT IN ('template0','template1','postgres') ".
+			  "ORDER BY datname ASC;"),
+	 "oracle" => ("select * from user_tablespaces;"),
+	 "influx" => "show databases;",
+	);
+    if($statement{$dbdriver}) {
+	return $statement{$dbdriver};
+    } else {
+	print STDERR "dblist is not implemented for $dbdriver\n";
+	exit 1;
+    }
+}
+
+# Return the code for 'show database size' in the chosen database dialect
+sub dbsize {
+    my $dbdriver = shift;
+    my %dburl = @_;
+    my %statement;
+    if(defined $dburl{'database'}) {
+	%statement =
+	    ("mysql" => (
+		 'SELECT '.
+		 '    table_schema "database", '.
+		 '    SUM(data_length+index_length) "bytes", '.
+		 '    SUM(data_length+index_length)/1024/1024 "megabytes" '.
+		 'FROM information_schema.TABLES '.
+		 "WHERE table_schema = '$dburl{'database'}'".
+		 'GROUP BY table_schema;'),
+	     "postgresql" => (
+		 "SELECT '$dburl{'database'}' AS database, ".
+		 "pg_database_size('$dburl{'database'}') AS bytes, ".
+		 "pg_size_pretty(pg_database_size('$dburl{'database'}')) AS human_readabable "),
+	     "sqlite" => (
+		 "SELECT ".(undef_as_zero(-s $dburl{'database'}))." AS bytes;"),
+	     "sqlite3" => (
+		 "SELECT ".(undef_as_zero(-s $dburl{'database'}))." AS bytes;"),
+	    );
+    } else {
+	%statement =
+	    ("mysql" => (
+		 'SELECT '.
+		 '    table_schema "database", '.
+		 '    SUM(data_length+index_length) "bytes", '.
+		 '    SUM(data_length+index_length)/1024/1024 "megabytes" '.
+		 'FROM information_schema.TABLES '.
+		 'GROUP BY table_schema;'),
+	     "postgresql" => (
+		 'SELECT datname AS database, pg_database_size(datname) AS bytes, '.
+		 'pg_size_pretty(pg_database_size(datname)) AS human_readabable '.
+		 'FROM (SELECT datname FROM pg_database) a;'),
+	     "sqlite" => (
+		 "SELECT 0 AS bytes;"),
+	     "sqlite3" => (
+		 "SELECT 0 AS bytes;"),
+	    );
+    }
+    if($statement{$dbdriver}) {
+	return $statement{$dbdriver};
+    } else {
+	print STDERR "dbsize is not implemented for $dbdriver\n";
+	exit 1;
+    }
+}
+
+
+# Return the code for 'show table size' in the chosen database dialect
+sub tablesize {
+    my $dbdriver = shift;
+    my $database = shift;
+    my %statement =
+	("postgresql" => (
+	     "SELECT relname, relpages*8 AS kb, reltuples::int AS \"live+dead rows\" ".
+	     "FROM pg_class c ".
+	     "ORDER BY relpages DESC;"),
+	 "mysql" => (
+	     "select table_name, TABLE_ROWS, DATA_LENGTH,INDEX_LENGTH from INFORMATION_SCHEMA.tables;"),
+	);
+    if($statement{$dbdriver}) {
+	return $statement{$dbdriver};
+    } else {
+	print STDERR "table size is not implemented for $dbdriver\n";
+	exit 1;
+    }
+}
+
+sub is_stdin_terminal {
+    return (-t STDIN);
+}
+
+sub find_command_in_path {
+    # Find the command if it exists in the current path
+    my $command = shift;
+    my $path = `which $command`;
+    chomp $path;
+    return $path;
+}
+
+sub Usage {
+    if(@_) {
+	print "Error:\n";
+	print map{ "$_\n" } @_;
+	print "\n";
+    }
+    print "sql [-hnr] [--table-size] [--db-size] [-p pass-through] [-s string] dburl [command]\n";
+}
+
+sub get_alias {
+    my $alias = shift;
+    $alias =~ s/^(sql:)*//; # Accept aliases prepended with sql:
+    if ($alias !~ /^:/) {
+	return $alias;
+    }
+
+    # Find the alias
+    my $path;
+    if (-l $0) {
+	($path) = readlink($0) =~ m|^(.*)/|;
+    } else {
+	($path) = $0 =~ m|^(.*)/|;
+    }
+
+    my @deprecated = ("$ENV{HOME}/.dburl.aliases",
+		      "$path/dburl.aliases", "$path/dburl.aliases.dist");
+    for (@deprecated) {
+	if(-r $_) {
+	    print STDERR "$_ is deprecated. Use .sql/aliases instead (read man sql)\n";
+	}
+    }
+    my @urlalias=();
+    check_permissions("$ENV{HOME}/.sql/aliases");
+    check_permissions("$ENV{HOME}/.dburl.aliases");
+    my @search = ("$ENV{HOME}/.sql/aliases",
+		  "$ENV{HOME}/.dburl.aliases", "/etc/sql/aliases",
+		  "$path/dburl.aliases", "$path/dburl.aliases.dist");
+    for my $alias_file (@search) {
+	if(-r $alias_file) {
+	    push @urlalias, `cat "$alias_file"`;
+	}
+    }
+    my ($alias_part,$rest) = $alias=~/(:\w*)(.*)/;
+    # If we saw this before: we have an alias loop
+    if(grep {$_ eq $alias_part } @Private::seen_aliases) {
+	print STDERR "$alias_part is a cyclic alias\n";
+	exit -1;
+    } else {
+	push @Private::seen_aliases, $alias_part;
+    }
+
+    my $dburl;
+    for (@urlalias) {
+	/^$alias_part\s+(\S+.*)/ and do { $dburl = $1; last; }
+    }
+
+    if($dburl) {
+	return get_alias($dburl.$rest);
+    } else {
+	Usage("$alias is not defined in @search");
+	exit(-1);
+    }
+}
+
+sub check_permissions {
+    my $file = shift;
+
+    if(-e $file) {
+	if(not -o $file) {
+	    my $username = (getpwuid($<))[0];
+	    print STDERR "$file should be owned by $username: chown $username $file\n";
+	}
+	my ($dev,$ino,$mode,$nlink,$uid,$gid,$rdev,$size,
+	    $atime,$mtime,$ctime,$blksize,$blocks) = stat($file);
+	if($mode & 077) {
+	    my $username = (getpwuid($<))[0];
+	    print STDERR "$file should be only be readable by $username: chmod 600 $file\n";
+	}
+    }
+}
+
+sub parse_dburl {
+    my $url = shift;
+    my %options = ();
+    # sql:mysql://[[user][:password]@][host][:port]/[database[?sql query]]
+
+    if($url=~m!(?:sql:)? # You can prefix with 'sql:'
+               ((?:oracle|ora|mysql|pg|postgres|postgresql|influx|influxdb)(?:s|ssl|)|
+                 (?:sqlite|sqlite2|sqlite3)):// # Databasedriver ($1)
+               (?:
+                ([^:@/][^:@]*|) # Username ($2)
+                (?:
+                 :([^@]*) # Password ($3)
+                )?
+               @)?
+               ([^:/]*)? # Hostname ($4)
+               (?:
+                :
+                ([^/]*)? # Port ($5)
+               )?
+               (?:
+                /
+                ([^?/]*)? # Database ($6)
+               )?
+               (?:
+                /?
+                \?
+                (.*)? # Query ($7)
+               )?
+              !x) {
+	$options{databasedriver} = undef_if_empty(uri_unescape($1));
+	$options{user} = undef_if_empty(uri_unescape($2));
+	$options{password} = undef_if_empty(uri_unescape($3));
+	$options{host} = undef_if_empty(uri_unescape($4));
+	$options{port} = undef_if_empty(uri_unescape($5));
+	$options{database} = undef_if_empty(uri_unescape($6))
+	    || $options{user};
+	$options{query} = undef_if_empty(uri_unescape($7));
+	debug("dburl $url\n");
+	debug("databasedriver ",$options{databasedriver}, " user ", $options{user},
+	      " password ", $options{password}, " host ", $options{host},
+	      " port ", $options{port}, " database ", $options{database},
+	      " query ",$options{query}, "\n");
+    } else {
+	Usage("$url is not a valid DBURL");
+	exit -1;
+    }
+    return %options;
+}
+
+sub uri_unescape {
+    # Copied from http://cpansearch.perl.org/src/GAAS/URI-1.55/URI/Escape.pm
+    # to avoid depending on URI::Escape
+    # This section is (C) Gisle Aas.
+    # Note from RFC1630:  "Sequences which start with a percent sign
+    # but are not followed by two hexadecimal characters are reserved
+    # for future extension"
+    my $str = shift;
+    if (@_ && wantarray) {
+	# not executed for the common case of a single argument
+	my @str = ($str, @_);  # need to copy
+	foreach (@str) {
+	    s/%([0-9A-Fa-f]{2})/chr(hex($1))/eg;
+	}
+	return @str;
+    }
+    $str =~ s/%([0-9A-Fa-f]{2})/chr(hex($1))/eg if defined $str;
+    $str;
+}
+
+sub undef_if_empty {
+    if(defined($_[0]) and $_[0] eq "") {
+	return undef;
+    }
+    return $_[0];
+}
+
+sub undef_as_zero {
+    my $a = shift;
+    return $a ? $a : 0;
+}
+
+sub version {
+    # Returns: N/A
+    print join("\n",
+	       "GNU $Global::progname $Global::version",
+	       "Copyright (C) 2009,2010,2011,2012,2013,2014,2015,2016,2017",
+	       "Ole Tange and Free Software Foundation, Inc.",
+	       "License GPLv3+: GNU GPL version 3 or later <http://gnu.org/licenses/gpl.html>",
+	       "This is free software: you are free to change and redistribute it.",
+	       "GNU $Global::progname comes with no warranty.",
+	       "",
+	       "Web site: http://www.gnu.org/software/${Global::progname}\n",
+	       "When using GNU $Global::progname for a publication please cite:\n",
+	       "O. Tange (2011): GNU SQL - A Command Line Tool for Accessing Different",
+	       "Databases Using DBURLs, ;login: The USENIX Magazine, April 2011:29-32.\n"
+	);
+}
+
+sub die_usage {
+    # Returns: N/A
+    usage();
+    exit(255);
+}
+
+sub usage {
+    # Returns: N/A
+    print "Usage:\n";
+    print "$Global::progname [options] dburl [sqlcommand]\n";
+    print "$Global::progname [options] dburl < sql_command_file\n";
+    print "\n";
+    print "See 'man $Global::progname' for the options\n";
+}
+
+sub debug {
+    # Returns: N/A
+    $Global::debug or return;
+    @_ = grep { defined $_ ? $_ : "" } @_;
+    print @_;
+}
+
+$::opt_skip_first_line = $::opt_shebang = 0;