diff options
Diffstat (limited to 'tests/unit')
98 files changed, 32160 insertions, 0 deletions
diff --git a/tests/unit/acl-v2.tcl b/tests/unit/acl-v2.tcl new file mode 100644 index 0000000..d836f9c --- /dev/null +++ b/tests/unit/acl-v2.tcl @@ -0,0 +1,516 @@ +start_server {tags {"acl external:skip"}} { + set r2 [redis_client] + test {Test basic multiple selectors} { + r ACL SETUSER selector-1 on -@all resetkeys nopass + $r2 auth selector-1 password + catch {$r2 ping} err + assert_match "*NOPERM*command*" $err + catch {$r2 set write::foo bar} err + assert_match "*NOPERM*command*" $err + catch {$r2 get read::foo} err + assert_match "*NOPERM*command*" $err + + r ACL SETUSER selector-1 (+@write ~write::*) (+@read ~read::*) + catch {$r2 ping} err + assert_equal "OK" [$r2 set write::foo bar] + assert_equal "" [$r2 get read::foo] + catch {$r2 get write::foo} err + assert_match "*NOPERM*keys*" $err + catch {$r2 set read::foo bar} err + assert_match "*NOPERM*keys*" $err + } + + test {Test ACL selectors by default have no permissions} { + r ACL SETUSER selector-default reset () + set user [r ACL GETUSER "selector-default"] + assert_equal 1 [llength [dict get $user selectors]] + assert_equal "" [dict get [lindex [dict get $user selectors] 0] keys] + assert_equal "" [dict get [lindex [dict get $user selectors] 0] channels] + assert_equal "-@all" [dict get [lindex [dict get $user selectors] 0] commands] + } + + test {Test deleting selectors} { + r ACL SETUSER selector-del on "(~added-selector)" + set user [r ACL GETUSER "selector-del"] + assert_equal "~added-selector" [dict get [lindex [dict get $user selectors] 0] keys] + assert_equal [llength [dict get $user selectors]] 1 + + r ACL SETUSER selector-del clearselectors + set user [r ACL GETUSER "selector-del"] + assert_equal [llength [dict get $user selectors]] 0 + } + + test {Test selector syntax error reports the error in the selector context} { + catch {r ACL SETUSER selector-syntax on (this-is-invalid)} e + assert_match "*ERR Error in ACL SETUSER modifier '(*)*Syntax*" $e + + catch {r ACL SETUSER selector-syntax on (&* &fail)} e + assert_match "*ERR Error in ACL SETUSER modifier '(*)*Adding a pattern after the*" $e + + assert_equal "" [r ACL GETUSER selector-syntax] + } + + test {Test flexible selector definition} { + # Test valid selectors + r ACL SETUSER selector-2 "(~key1 +get )" "( ~key2 +get )" "( ~key3 +get)" "(~key4 +get)" + r ACL SETUSER selector-2 (~key5 +get ) ( ~key6 +get ) ( ~key7 +get) (~key8 +get) + set user [r ACL GETUSER "selector-2"] + assert_equal "~key1" [dict get [lindex [dict get $user selectors] 0] keys] + assert_equal "~key2" [dict get [lindex [dict get $user selectors] 1] keys] + assert_equal "~key3" [dict get [lindex [dict get $user selectors] 2] keys] + assert_equal "~key4" [dict get [lindex [dict get $user selectors] 3] keys] + assert_equal "~key5" [dict get [lindex [dict get $user selectors] 4] keys] + assert_equal "~key6" [dict get [lindex [dict get $user selectors] 5] keys] + assert_equal "~key7" [dict get [lindex [dict get $user selectors] 6] keys] + assert_equal "~key8" [dict get [lindex [dict get $user selectors] 7] keys] + + # Test invalid selector syntax + catch {r ACL SETUSER invalid-selector " () "} err + assert_match "*ERR*Syntax error*" $err + catch {r ACL SETUSER invalid-selector (} err + assert_match "*Unmatched parenthesis*" $err + catch {r ACL SETUSER invalid-selector )} err + assert_match "*ERR*Syntax error" $err + } + + test {Test separate read permission} { + r ACL SETUSER key-permission-R on nopass %R~read* +@all + $r2 auth key-permission-R password + assert_equal PONG [$r2 PING] + r set readstr bar + assert_equal bar [$r2 get readstr] + catch {$r2 set readstr bar} err + assert_match "*NOPERM*keys*" $err + catch {$r2 get notread} err + assert_match "*NOPERM*keys*" $err + } + + test {Test separate write permission} { + r ACL SETUSER key-permission-W on nopass %W~write* +@all + $r2 auth key-permission-W password + assert_equal PONG [$r2 PING] + # Note, SET is a RW command, so it's not used for testing + $r2 LPUSH writelist 10 + catch {$r2 GET writestr} err + assert_match "*NOPERM*keys*" $err + catch {$r2 LPUSH notwrite 10} err + assert_match "*NOPERM*keys*" $err + } + + test {Test separate read and write permissions} { + r ACL SETUSER key-permission-RW on nopass %R~read* %W~write* +@all + $r2 auth key-permission-RW password + assert_equal PONG [$r2 PING] + r set read bar + $r2 copy read write + catch {$r2 copy write read} err + assert_match "*NOPERM*keys*" $err + } + + test {Test separate read and write permissions on different selectors are not additive} { + r ACL SETUSER key-permission-RW-selector on nopass "(%R~read* +@all)" "(%W~write* +@all)" + $r2 auth key-permission-RW-selector password + assert_equal PONG [$r2 PING] + + # Verify write selector + $r2 LPUSH writelist 10 + catch {$r2 GET writestr} err + assert_match "*NOPERM*keys*" $err + catch {$r2 LPUSH notwrite 10} err + assert_match "*NOPERM*keys*" $err + + # Verify read selector + r set readstr bar + assert_equal bar [$r2 get readstr] + catch {$r2 set readstr bar} err + assert_match "*NOPERM*keys*" $err + catch {$r2 get notread} err + assert_match "*NOPERM*keys*" $err + + # Verify they don't combine + catch {$r2 copy read write} err + assert_match "*NOPERM*keys*" $err + catch {$r2 copy write read} err + assert_match "*NOPERM*keys*" $err + } + + test {Test SET with separate read permission} { + r del readstr + r ACL SETUSER set-key-permission-R on nopass %R~read* +@all + $r2 auth set-key-permission-R password + assert_equal PONG [$r2 PING] + assert_equal {} [$r2 get readstr] + + # We don't have the permission to WRITE key. + assert_error {*NOPERM*keys*} {$r2 set readstr bar} + assert_error {*NOPERM*keys*} {$r2 set readstr bar get} + assert_error {*NOPERM*keys*} {$r2 set readstr bar ex 100} + assert_error {*NOPERM*keys*} {$r2 set readstr bar keepttl nx} + } + + test {Test SET with separate write permission} { + r del writestr + r ACL SETUSER set-key-permission-W on nopass %W~write* +@all + $r2 auth set-key-permission-W password + assert_equal PONG [$r2 PING] + assert_equal {OK} [$r2 set writestr bar] + assert_equal {OK} [$r2 set writestr get] + + # We don't have the permission to READ key. + assert_error {*NOPERM*keys*} {$r2 set get writestr} + assert_error {*NOPERM*keys*} {$r2 set writestr bar get} + assert_error {*NOPERM*keys*} {$r2 set writestr bar get ex 100} + assert_error {*NOPERM*keys*} {$r2 set writestr bar get keepttl nx} + + # this probably should be `ERR value is not an integer or out of range` + assert_error {*NOPERM*keys*} {$r2 set writestr bar ex get} + } + + test {Test SET with read and write permissions} { + r del readwrite_str + r ACL SETUSER set-key-permission-RW-selector on nopass %RW~readwrite* +@all + $r2 auth set-key-permission-RW-selector password + assert_equal PONG [$r2 PING] + + assert_equal {} [$r2 get readwrite_str] + assert_error {ERR * not an integer *} {$r2 set readwrite_str bar ex get} + + assert_equal {OK} [$r2 set readwrite_str bar] + assert_equal {bar} [$r2 get readwrite_str] + + assert_equal {bar} [$r2 set readwrite_str bar2 get] + assert_equal {bar2} [$r2 get readwrite_str] + + assert_equal {bar2} [$r2 set readwrite_str bar3 get ex 10] + assert_equal {bar3} [$r2 get readwrite_str] + assert_range [$r2 ttl readwrite_str] 5 10 + } + + test {Test BITFIELD with separate read permission} { + r del readstr + r ACL SETUSER bitfield-key-permission-R on nopass %R~read* +@all + $r2 auth bitfield-key-permission-R password + assert_equal PONG [$r2 PING] + assert_equal {0} [$r2 bitfield readstr get u4 0] + + # We don't have the permission to WRITE key. + assert_error {*NOPERM*keys*} {$r2 bitfield readstr set u4 0 1} + assert_error {*NOPERM*keys*} {$r2 bitfield readstr get u4 0 set u4 0 1} + assert_error {*NOPERM*keys*} {$r2 bitfield readstr incrby u4 0 1} + } + + test {Test BITFIELD with separate write permission} { + r del writestr + r ACL SETUSER bitfield-key-permission-W on nopass %W~write* +@all + $r2 auth bitfield-key-permission-W password + assert_equal PONG [$r2 PING] + + # We don't have the permission to READ key. + assert_error {*NOPERM*keys*} {$r2 bitfield writestr get u4 0} + assert_error {*NOPERM*keys*} {$r2 bitfield writestr set u4 0 1} + assert_error {*NOPERM*keys*} {$r2 bitfield writestr incrby u4 0 1} + } + + test {Test BITFIELD with read and write permissions} { + r del readwrite_str + r ACL SETUSER bitfield-key-permission-RW-selector on nopass %RW~readwrite* +@all + $r2 auth bitfield-key-permission-RW-selector password + assert_equal PONG [$r2 PING] + + assert_equal {0} [$r2 bitfield readwrite_str get u4 0] + assert_equal {0} [$r2 bitfield readwrite_str set u4 0 1] + assert_equal {2} [$r2 bitfield readwrite_str incrby u4 0 1] + assert_equal {2} [$r2 bitfield readwrite_str get u4 0] + } + + test {Test ACL log correctly identifies the relevant item when selectors are used} { + r ACL SETUSER acl-log-test-selector on nopass + r ACL SETUSER acl-log-test-selector +mget ~key (+mget ~key ~otherkey) + $r2 auth acl-log-test-selector password + + # Test that command is shown only if none of the selectors match + r ACL LOG RESET + catch {$r2 GET key} err + assert_match "*NOPERM*command*" $err + set entry [lindex [r ACL LOG] 0] + assert_equal [dict get $entry username] "acl-log-test-selector" + assert_equal [dict get $entry context] "toplevel" + assert_equal [dict get $entry reason] "command" + assert_equal [dict get $entry object] "get" + + # Test two cases where the first selector matches less than the + # second selector. We should still show the logically first unmatched key. + r ACL LOG RESET + catch {$r2 MGET otherkey someotherkey} err + assert_match "*NOPERM*keys*" $err + set entry [lindex [r ACL LOG] 0] + assert_equal [dict get $entry username] "acl-log-test-selector" + assert_equal [dict get $entry context] "toplevel" + assert_equal [dict get $entry reason] "key" + assert_equal [dict get $entry object] "someotherkey" + + r ACL LOG RESET + catch {$r2 MGET key otherkey someotherkey} err + assert_match "*NOPERM*keys*" $err + set entry [lindex [r ACL LOG] 0] + assert_equal [dict get $entry username] "acl-log-test-selector" + assert_equal [dict get $entry context] "toplevel" + assert_equal [dict get $entry reason] "key" + assert_equal [dict get $entry object] "someotherkey" + } + + test {Test ACL GETUSER response information} { + r ACL setuser selector-info -@all +get resetchannels &channel1 %R~foo1 %W~bar1 ~baz1 + r ACL setuser selector-info (-@all +set resetchannels &channel2 %R~foo2 %W~bar2 ~baz2) + set user [r ACL GETUSER "selector-info"] + + # Root selector + assert_equal "%R~foo1 %W~bar1 ~baz1" [dict get $user keys] + assert_equal "&channel1" [dict get $user channels] + assert_equal "-@all +get" [dict get $user commands] + + # Added selector + set secondary_selector [lindex [dict get $user selectors] 0] + assert_equal "%R~foo2 %W~bar2 ~baz2" [dict get $secondary_selector keys] + assert_equal "&channel2" [dict get $secondary_selector channels] + assert_equal "-@all +set" [dict get $secondary_selector commands] + } + + test {Test ACL list idempotency} { + r ACL SETUSER user-idempotency off -@all +get resetchannels &channel1 %R~foo1 %W~bar1 ~baz1 (-@all +set resetchannels &channel2 %R~foo2 %W~bar2 ~baz2) + set response [lindex [r ACL LIST] [lsearch [r ACL LIST] "user user-idempotency*"]] + + assert_match "*-@all*+get*(*)*" $response + assert_match "*resetchannels*&channel1*(*)*" $response + assert_match "*%R~foo1*%W~bar1*~baz1*(*)*" $response + + assert_match "*(*-@all*+set*)*" $response + assert_match "*(*resetchannels*&channel2*)*" $response + assert_match "*(*%R~foo2*%W~bar2*~baz2*)*" $response + } + + test {Test R+W is the same as all permissions} { + r ACL setuser selector-rw-info %R~foo %W~foo %RW~bar + set user [r ACL GETUSER selector-rw-info] + assert_equal "~foo ~bar" [dict get $user keys] + } + + test {Test basic dry run functionality} { + r ACL setuser command-test +@all %R~read* %W~write* %RW~rw* + assert_equal "OK" [r ACL DRYRUN command-test GET read] + + catch {r ACL DRYRUN not-a-user GET read} e + assert_equal "ERR User 'not-a-user' not found" $e + + catch {r ACL DRYRUN command-test not-a-command read} e + assert_equal "ERR Command 'not-a-command' not found" $e + } + + test {Test various commands for command permissions} { + r ACL setuser command-test -@all + assert_equal "This user has no permissions to run the 'set' command" [r ACL DRYRUN command-test set somekey somevalue] + assert_equal "This user has no permissions to run the 'get' command" [r ACL DRYRUN command-test get somekey] + } + + test {Test various odd commands for key permissions} { + r ACL setuser command-test +@all %R~read* %W~write* %RW~rw* + + # Test migrate, which is marked with incomplete keys + assert_equal "OK" [r ACL DRYRUN command-test MIGRATE whatever whatever rw 0 500] + assert_equal "This user has no permissions to access the 'read' key" [r ACL DRYRUN command-test MIGRATE whatever whatever read 0 500] + assert_equal "This user has no permissions to access the 'write' key" [r ACL DRYRUN command-test MIGRATE whatever whatever write 0 500] + assert_equal "OK" [r ACL DRYRUN command-test MIGRATE whatever whatever "" 0 5000 KEYS rw] + assert_equal "This user has no permissions to access the 'read' key" [r ACL DRYRUN command-test MIGRATE whatever whatever "" 0 5000 KEYS read] + assert_equal "This user has no permissions to access the 'write' key" [r ACL DRYRUN command-test MIGRATE whatever whatever "" 0 5000 KEYS write] + assert_equal "OK" [r ACL DRYRUN command-test MIGRATE whatever whatever "" 0 5000 AUTH KEYS KEYS rw] + assert_equal "This user has no permissions to access the 'read' key" [r ACL DRYRUN command-test MIGRATE whatever whatever "" 0 5000 AUTH KEYS KEYS read] + assert_equal "This user has no permissions to access the 'write' key" [r ACL DRYRUN command-test MIGRATE whatever whatever "" 0 5000 AUTH KEYS KEYS write] + assert_equal "OK" [r ACL DRYRUN command-test MIGRATE whatever whatever "" 0 5000 AUTH2 KEYS 123 KEYS rw] + assert_equal "This user has no permissions to access the 'read' key" [r ACL DRYRUN command-test MIGRATE whatever whatever "" 0 5000 AUTH2 KEYS 123 KEYS read] + assert_equal "This user has no permissions to access the 'write' key" [r ACL DRYRUN command-test MIGRATE whatever whatever "" 0 5000 AUTH2 KEYS 123 KEYS write] + assert_equal "OK" [r ACL DRYRUN command-test MIGRATE whatever whatever "" 0 5000 AUTH2 USER KEYS KEYS rw] + assert_equal "This user has no permissions to access the 'read' key" [r ACL DRYRUN command-test MIGRATE whatever whatever "" 0 5000 AUTH2 USER KEYS KEYS read] + assert_equal "This user has no permissions to access the 'write' key" [r ACL DRYRUN command-test MIGRATE whatever whatever "" 0 5000 AUTH2 USER KEYS KEYS write] + + # Test SORT, which is marked with incomplete keys + assert_equal "OK" [r ACL DRYRUN command-test SORT read STORE write] + assert_equal "This user has no permissions to access the 'read' key" [r ACL DRYRUN command-test SORT read STORE read] + assert_equal "This user has no permissions to access the 'write' key" [r ACL DRYRUN command-test SORT write STORE write] + + # Test EVAL, which uses the numkey keyspec (Also test EVAL_RO) + assert_equal "OK" [r ACL DRYRUN command-test EVAL "" 1 rw1] + assert_equal "This user has no permissions to access the 'read' key" [r ACL DRYRUN command-test EVAL "" 1 read] + assert_equal "OK" [r ACL DRYRUN command-test EVAL_RO "" 1 rw1] + assert_equal "OK" [r ACL DRYRUN command-test EVAL_RO "" 1 read] + + # Read is an optional argument and not a key here, make sure we don't treat it as a key + assert_equal "OK" [r ACL DRYRUN command-test EVAL "" 0 read] + + # These are syntax errors, but it's 'OK' from an ACL perspective + assert_equal "OK" [r ACL DRYRUN command-test EVAL "" -1 read] + assert_equal "OK" [r ACL DRYRUN command-test EVAL "" 3 rw rw] + assert_equal "OK" [r ACL DRYRUN command-test EVAL "" 3 rw read] + + # Test GEORADIUS which uses the last type of keyspec, keyword + assert_equal "OK" [r ACL DRYRUN command-test GEORADIUS read longitude latitude radius M STOREDIST write] + assert_equal "OK" [r ACL DRYRUN command-test GEORADIUS read longitude latitude radius M] + assert_equal "This user has no permissions to access the 'read2' key" [r ACL DRYRUN command-test GEORADIUS read1 longitude latitude radius M STOREDIST read2] + assert_equal "This user has no permissions to access the 'write1' key" [r ACL DRYRUN command-test GEORADIUS write1 longitude latitude radius M STOREDIST write2] + assert_equal "OK" [r ACL DRYRUN command-test GEORADIUS read longitude latitude radius M STORE write] + assert_equal "OK" [r ACL DRYRUN command-test GEORADIUS read longitude latitude radius M] + assert_equal "This user has no permissions to access the 'read2' key" [r ACL DRYRUN command-test GEORADIUS read1 longitude latitude radius M STORE read2] + assert_equal "This user has no permissions to access the 'write1' key" [r ACL DRYRUN command-test GEORADIUS write1 longitude latitude radius M STORE write2] + } + + # Existence test commands are not marked as access since they are the result + # of a lot of write commands. We therefore make the claim they can be executed + # when either READ or WRITE flags are provided. + test {Existence test commands are not marked as access} { + assert_equal "OK" [r ACL DRYRUN command-test HEXISTS read foo] + assert_equal "OK" [r ACL DRYRUN command-test HEXISTS write foo] + assert_equal "This user has no permissions to access the 'nothing' key" [r ACL DRYRUN command-test HEXISTS nothing foo] + + assert_equal "OK" [r ACL DRYRUN command-test HSTRLEN read foo] + assert_equal "OK" [r ACL DRYRUN command-test HSTRLEN write foo] + assert_equal "This user has no permissions to access the 'nothing' key" [r ACL DRYRUN command-test HSTRLEN nothing foo] + + assert_equal "OK" [r ACL DRYRUN command-test SISMEMBER read foo] + assert_equal "OK" [r ACL DRYRUN command-test SISMEMBER write foo] + assert_equal "This user has no permissions to access the 'nothing' key" [r ACL DRYRUN command-test SISMEMBER nothing foo] + } + + # Unlike existence test commands, intersection cardinality commands process the data + # between keys and return an aggregated cardinality. therefore they have the access + # requirement. + test {Intersection cardinaltiy commands are access commands} { + assert_equal "OK" [r ACL DRYRUN command-test SINTERCARD 2 read read] + assert_equal "This user has no permissions to access the 'write' key" [r ACL DRYRUN command-test SINTERCARD 2 write read] + assert_equal "This user has no permissions to access the 'nothing' key" [r ACL DRYRUN command-test SINTERCARD 2 nothing read] + + assert_equal "OK" [r ACL DRYRUN command-test ZCOUNT read 0 1] + assert_equal "This user has no permissions to access the 'write' key" [r ACL DRYRUN command-test ZCOUNT write 0 1] + assert_equal "This user has no permissions to access the 'nothing' key" [r ACL DRYRUN command-test ZCOUNT nothing 0 1] + + assert_equal "OK" [r ACL DRYRUN command-test PFCOUNT read read] + assert_equal "This user has no permissions to access the 'write' key" [r ACL DRYRUN command-test PFCOUNT write read] + assert_equal "This user has no permissions to access the 'nothing' key" [r ACL DRYRUN command-test PFCOUNT nothing read] + + assert_equal "OK" [r ACL DRYRUN command-test ZINTERCARD 2 read read] + assert_equal "This user has no permissions to access the 'write' key" [r ACL DRYRUN command-test ZINTERCARD 2 write read] + assert_equal "This user has no permissions to access the 'nothing' key" [r ACL DRYRUN command-test ZINTERCARD 2 nothing read] + } + + test {Test general keyspace commands require some type of permission to execute} { + assert_equal "OK" [r ACL DRYRUN command-test touch read] + assert_equal "OK" [r ACL DRYRUN command-test touch write] + assert_equal "OK" [r ACL DRYRUN command-test touch rw] + assert_equal "This user has no permissions to access the 'nothing' key" [r ACL DRYRUN command-test touch nothing] + + assert_equal "OK" [r ACL DRYRUN command-test exists read] + assert_equal "OK" [r ACL DRYRUN command-test exists write] + assert_equal "OK" [r ACL DRYRUN command-test exists rw] + assert_equal "This user has no permissions to access the 'nothing' key" [r ACL DRYRUN command-test exists nothing] + + assert_equal "OK" [r ACL DRYRUN command-test MEMORY USAGE read] + assert_equal "OK" [r ACL DRYRUN command-test MEMORY USAGE write] + assert_equal "OK" [r ACL DRYRUN command-test MEMORY USAGE rw] + assert_equal "This user has no permissions to access the 'nothing' key" [r ACL DRYRUN command-test MEMORY USAGE nothing] + + assert_equal "OK" [r ACL DRYRUN command-test TYPE read] + assert_equal "OK" [r ACL DRYRUN command-test TYPE write] + assert_equal "OK" [r ACL DRYRUN command-test TYPE rw] + assert_equal "This user has no permissions to access the 'nothing' key" [r ACL DRYRUN command-test TYPE nothing] + } + + test {Cardinality commands require some type of permission to execute} { + set commands {STRLEN HLEN LLEN SCARD ZCARD XLEN} + foreach command $commands { + assert_equal "OK" [r ACL DRYRUN command-test $command read] + assert_equal "OK" [r ACL DRYRUN command-test $command write] + assert_equal "OK" [r ACL DRYRUN command-test $command rw] + assert_equal "This user has no permissions to access the 'nothing' key" [r ACL DRYRUN command-test $command nothing] + } + } + + test {Test sharded channel permissions} { + r ACL setuser test-channels +@all resetchannels &channel + assert_equal "OK" [r ACL DRYRUN test-channels spublish channel foo] + assert_equal "OK" [r ACL DRYRUN test-channels ssubscribe channel] + assert_equal "OK" [r ACL DRYRUN test-channels sunsubscribe] + assert_equal "OK" [r ACL DRYRUN test-channels sunsubscribe channel] + assert_equal "OK" [r ACL DRYRUN test-channels sunsubscribe otherchannel] + + assert_equal "This user has no permissions to access the 'otherchannel' channel" [r ACL DRYRUN test-channels spublish otherchannel foo] + assert_equal "This user has no permissions to access the 'otherchannel' channel" [r ACL DRYRUN test-channels ssubscribe otherchannel foo] + } + + test {Test sort with ACL permissions} { + r set v1 1 + r lpush mylist 1 + + r ACL setuser test-sort-acl on nopass (+sort ~mylist) + $r2 auth test-sort-acl nopass + + catch {$r2 sort mylist by v*} e + assert_equal "ERR BY option of SORT denied due to insufficient ACL permissions." $e + catch {$r2 sort mylist get v*} e + assert_equal "ERR GET option of SORT denied due to insufficient ACL permissions." $e + + r ACL setuser test-sort-acl (+sort ~mylist ~v*) + catch {$r2 sort mylist by v*} e + assert_equal "ERR BY option of SORT denied due to insufficient ACL permissions." $e + catch {$r2 sort mylist get v*} e + assert_equal "ERR GET option of SORT denied due to insufficient ACL permissions." $e + + r ACL setuser test-sort-acl (+sort ~mylist %W~*) + catch {$r2 sort mylist by v*} e + assert_equal "ERR BY option of SORT denied due to insufficient ACL permissions." $e + catch {$r2 sort mylist get v*} e + assert_equal "ERR GET option of SORT denied due to insufficient ACL permissions." $e + + r ACL setuser test-sort-acl (+sort ~mylist %R~*) + assert_equal "1" [$r2 sort mylist by v*] + + # cleanup + r ACL deluser test-sort-acl + r del v1 mylist + } + + test {Test DRYRUN with wrong number of arguments} { + r ACL setuser test-dry-run +@all ~v* + + assert_equal "OK" [r ACL DRYRUN test-dry-run SET v v] + + catch {r ACL DRYRUN test-dry-run SET v} e + assert_equal "ERR wrong number of arguments for 'set' command" $e + + catch {r ACL DRYRUN test-dry-run SET} e + assert_equal "ERR wrong number of arguments for 'set' command" $e + } + + $r2 close +} + +set server_path [tmpdir "selectors.acl"] +exec cp -f tests/assets/userwithselectors.acl $server_path +exec cp -f tests/assets/default.conf $server_path +start_server [list overrides [list "dir" $server_path "aclfile" "userwithselectors.acl"] tags [list "external:skip"]] { + + test {Test behavior of loading ACLs} { + set selectors [dict get [r ACL getuser alice] selectors] + assert_equal [llength $selectors] 1 + set test_selector [lindex $selectors 0] + assert_equal "-@all +get" [dict get $test_selector "commands"] + assert_equal "~rw*" [dict get $test_selector "keys"] + + set selectors [dict get [r ACL getuser bob] selectors] + assert_equal [llength $selectors] 2 + set test_selector [lindex $selectors 0] + assert_equal "-@all +set" [dict get $test_selector "commands"] + assert_equal "%W~w*" [dict get $test_selector "keys"] + + set test_selector [lindex $selectors 1] + assert_equal "-@all +get" [dict get $test_selector "commands"] + assert_equal "%R~r*" [dict get $test_selector "keys"] + } +} diff --git a/tests/unit/acl.tcl b/tests/unit/acl.tcl new file mode 100644 index 0000000..043aefc --- /dev/null +++ b/tests/unit/acl.tcl @@ -0,0 +1,959 @@ +start_server {tags {"acl external:skip"}} { + test {Connections start with the default user} { + r ACL WHOAMI + } {default} + + test {It is possible to create new users} { + r ACL setuser newuser + } + + test {Usernames can not contain spaces or null characters} { + catch {r ACL setuser "a a"} err + set err + } {*Usernames can't contain spaces or null characters*} + + test {New users start disabled} { + r ACL setuser newuser >passwd1 + catch {r AUTH newuser passwd1} err + set err + } {*WRONGPASS*} + + test {Enabling the user allows the login} { + r ACL setuser newuser on +acl + r AUTH newuser passwd1 + r ACL WHOAMI + } {newuser} + + test {Only the set of correct passwords work} { + r ACL setuser newuser >passwd2 + catch {r AUTH newuser passwd1} e + assert {$e eq "OK"} + catch {r AUTH newuser passwd2} e + assert {$e eq "OK"} + catch {r AUTH newuser passwd3} e + set e + } {*WRONGPASS*} + + test {It is possible to remove passwords from the set of valid ones} { + r ACL setuser newuser <passwd1 + catch {r AUTH newuser passwd1} e + set e + } {*WRONGPASS*} + + test {Test password hashes can be added} { + r ACL setuser newuser #34344e4d60c2b6d639b7bd22e18f2b0b91bc34bf0ac5f9952744435093cfb4e6 + catch {r AUTH newuser passwd4} e + assert {$e eq "OK"} + } + + test {Test password hashes validate input} { + # Validate Length + catch {r ACL setuser newuser #34344e4d60c2b6d639b7bd22e18f2b0b91bc34bf0ac5f9952744435093cfb4e} e + # Validate character outside set + catch {r ACL setuser newuser #34344e4d60c2b6d639b7bd22e18f2b0b91bc34bf0ac5f9952744435093cfb4eq} e + set e + } {*Error in ACL SETUSER modifier*} + + test {ACL GETUSER returns the password hash instead of the actual password} { + set passstr [dict get [r ACL getuser newuser] passwords] + assert_match {*34344e4d60c2b6d639b7bd22e18f2b0b91bc34bf0ac5f9952744435093cfb4e6*} $passstr + assert_no_match {*passwd4*} $passstr + } + + test {Test hashed passwords removal} { + r ACL setuser newuser !34344e4d60c2b6d639b7bd22e18f2b0b91bc34bf0ac5f9952744435093cfb4e6 + set passstr [dict get [r ACL getuser newuser] passwords] + assert_no_match {*34344e4d60c2b6d639b7bd22e18f2b0b91bc34bf0ac5f9952744435093cfb4e6*} $passstr + } + + test {By default users are not able to access any command} { + catch {r SET foo bar} e + set e + } {*NOPERM*set*} + + test {By default users are not able to access any key} { + r ACL setuser newuser +set + catch {r SET foo bar} e + set e + } {*NOPERM*key*} + + test {It's possible to allow the access of a subset of keys} { + r ACL setuser newuser allcommands ~foo:* ~bar:* + r SET foo:1 a + r SET bar:2 b + catch {r SET zap:3 c} e + r ACL setuser newuser allkeys; # Undo keys ACL + set e + } {*NOPERM*key*} + + test {By default, only default user is able to publish to any channel} { + r AUTH default pwd + r PUBLISH foo bar + r ACL setuser psuser on >pspass +acl +client +@pubsub + r AUTH psuser pspass + catch {r PUBLISH foo bar} e + set e + } {*NOPERM*channels*} + + test {By default, only default user is not able to publish to any shard channel} { + r AUTH default pwd + r SPUBLISH foo bar + r AUTH psuser pspass + catch {r SPUBLISH foo bar} e + set e + } {*NOPERM*channels*} + + test {By default, only default user is able to subscribe to any channel} { + set rd [redis_deferring_client] + $rd AUTH default pwd + $rd read + $rd SUBSCRIBE foo + assert_match {subscribe foo 1} [$rd read] + $rd UNSUBSCRIBE + $rd read + $rd AUTH psuser pspass + $rd read + $rd SUBSCRIBE foo + catch {$rd read} e + $rd close + set e + } {*NOPERM*channels*} + + test {By default, only default user is able to subscribe to any shard channel} { + set rd [redis_deferring_client] + $rd AUTH default pwd + $rd read + $rd SSUBSCRIBE foo + assert_match {ssubscribe foo 1} [$rd read] + $rd SUNSUBSCRIBE + $rd read + $rd AUTH psuser pspass + $rd read + $rd SSUBSCRIBE foo + catch {$rd read} e + $rd close + set e + } {*NOPERM*channels*} + + test {By default, only default user is able to subscribe to any pattern} { + set rd [redis_deferring_client] + $rd AUTH default pwd + $rd read + $rd PSUBSCRIBE bar* + assert_match {psubscribe bar\* 1} [$rd read] + $rd PUNSUBSCRIBE + $rd read + $rd AUTH psuser pspass + $rd read + $rd PSUBSCRIBE bar* + catch {$rd read} e + $rd close + set e + } {*NOPERM*channels*} + + test {It's possible to allow publishing to a subset of channels} { + r ACL setuser psuser resetchannels &foo:1 &bar:* + assert_equal {0} [r PUBLISH foo:1 somemessage] + assert_equal {0} [r PUBLISH bar:2 anothermessage] + catch {r PUBLISH zap:3 nosuchmessage} e + set e + } {*NOPERM*channel*} + + test {It's possible to allow publishing to a subset of shard channels} { + r ACL setuser psuser resetchannels &foo:1 &bar:* + assert_equal {0} [r SPUBLISH foo:1 somemessage] + assert_equal {0} [r SPUBLISH bar:2 anothermessage] + catch {r SPUBLISH zap:3 nosuchmessage} e + set e + } {*NOPERM*channel*} + + test {Validate subset of channels is prefixed with resetchannels flag} { + r ACL setuser hpuser on nopass resetchannels &foo +@all + + # Verify resetchannels flag is prefixed before the channel name(s) + set users [r ACL LIST] + set curruser "hpuser" + foreach user [lshuffle $users] { + if {[string first $curruser $user] != -1} { + assert_equal {user hpuser on nopass resetchannels &foo +@all} $user + } + } + + # authenticate as hpuser + r AUTH hpuser pass + + assert_equal {0} [r PUBLISH foo bar] + catch {r PUBLISH bar game} e + + # Falling back to psuser for the below tests + r AUTH psuser pspass + r ACL deluser hpuser + set e + } {*NOPERM*channel*} + + test {In transaction queue publish/subscribe/psubscribe to unauthorized channel will fail} { + r ACL setuser psuser +multi +discard + r MULTI + assert_error {*NOPERM*channel*} {r PUBLISH notexits helloworld} + r DISCARD + r MULTI + assert_error {*NOPERM*channel*} {r SUBSCRIBE notexits foo:1} + r DISCARD + r MULTI + assert_error {*NOPERM*channel*} {r PSUBSCRIBE notexits:* bar:*} + r DISCARD + } + + test {It's possible to allow subscribing to a subset of channels} { + set rd [redis_deferring_client] + $rd AUTH psuser pspass + $rd read + $rd SUBSCRIBE foo:1 + assert_match {subscribe foo:1 1} [$rd read] + $rd SUBSCRIBE bar:2 + assert_match {subscribe bar:2 2} [$rd read] + $rd SUBSCRIBE zap:3 + catch {$rd read} e + set e + } {*NOPERM*channel*} + + test {It's possible to allow subscribing to a subset of shard channels} { + set rd [redis_deferring_client] + $rd AUTH psuser pspass + $rd read + $rd SSUBSCRIBE foo:1 + assert_match {ssubscribe foo:1 1} [$rd read] + $rd SSUBSCRIBE bar:2 + assert_match {ssubscribe bar:2 2} [$rd read] + $rd SSUBSCRIBE zap:3 + catch {$rd read} e + set e + } {*NOPERM*channel*} + + test {It's possible to allow subscribing to a subset of channel patterns} { + set rd [redis_deferring_client] + $rd AUTH psuser pspass + $rd read + $rd PSUBSCRIBE foo:1 + assert_match {psubscribe foo:1 1} [$rd read] + $rd PSUBSCRIBE bar:* + assert_match {psubscribe bar:\* 2} [$rd read] + $rd PSUBSCRIBE bar:baz + catch {$rd read} e + set e + } {*NOPERM*channel*} + + test {Subscribers are killed when revoked of channel permission} { + set rd [redis_deferring_client] + r ACL setuser psuser resetchannels &foo:1 + $rd AUTH psuser pspass + $rd read + $rd CLIENT SETNAME deathrow + $rd read + $rd SUBSCRIBE foo:1 + $rd read + r ACL setuser psuser resetchannels + assert_no_match {*deathrow*} [r CLIENT LIST] + $rd close + } {0} + + test {Subscribers are killed when revoked of channel permission} { + set rd [redis_deferring_client] + r ACL setuser psuser resetchannels &foo:1 + $rd AUTH psuser pspass + $rd read + $rd CLIENT SETNAME deathrow + $rd read + $rd SSUBSCRIBE foo:1 + $rd read + r ACL setuser psuser resetchannels + assert_no_match {*deathrow*} [r CLIENT LIST] + $rd close + } {0} + + test {Subscribers are killed when revoked of pattern permission} { + set rd [redis_deferring_client] + r ACL setuser psuser resetchannels &bar:* + $rd AUTH psuser pspass + $rd read + $rd CLIENT SETNAME deathrow + $rd read + $rd PSUBSCRIBE bar:* + $rd read + r ACL setuser psuser resetchannels + assert_no_match {*deathrow*} [r CLIENT LIST] + $rd close + } {0} + + test {Subscribers are killed when revoked of allchannels permission} { + set rd [redis_deferring_client] + r ACL setuser psuser allchannels + $rd AUTH psuser pspass + $rd read + $rd CLIENT SETNAME deathrow + $rd read + $rd PSUBSCRIBE foo + $rd read + r ACL setuser psuser resetchannels + assert_no_match {*deathrow*} [r CLIENT LIST] + $rd close + } {0} + + test {Subscribers are pardoned if literal permissions are retained and/or gaining allchannels} { + set rd [redis_deferring_client] + r ACL setuser psuser resetchannels &foo:1 &bar:* &orders + $rd AUTH psuser pspass + $rd read + $rd CLIENT SETNAME pardoned + $rd read + $rd SUBSCRIBE foo:1 + $rd read + $rd SSUBSCRIBE orders + $rd read + $rd PSUBSCRIBE bar:* + $rd read + r ACL setuser psuser resetchannels &foo:1 &bar:* &orders &baz:qaz &zoo:* + assert_match {*pardoned*} [r CLIENT LIST] + r ACL setuser psuser allchannels + assert_match {*pardoned*} [r CLIENT LIST] + $rd close + } {0} + + test {Users can be configured to authenticate with any password} { + r ACL setuser newuser nopass + r AUTH newuser zipzapblabla + } {OK} + + test {ACLs can exclude single commands} { + r ACL setuser newuser -ping + r INCR mycounter ; # Should not raise an error + catch {r PING} e + set e + } {*NOPERM*ping*} + + test {ACLs can include or exclude whole classes of commands} { + r ACL setuser newuser -@all +@set +acl + r SADD myset a b c; # Should not raise an error + r ACL setuser newuser +@all -@string + r SADD myset a b c; # Again should not raise an error + # String commands instead should raise an error + catch {r SET foo bar} e + r ACL setuser newuser allcommands; # Undo commands ACL + set e + } {*NOPERM*set*} + + test {ACLs can include single subcommands} { + r ACL setuser newuser +@all -client + r ACL setuser newuser +client|id +client|setname + set cmdstr [dict get [r ACL getuser newuser] commands] + assert_match {+@all*-client*+client|id*} $cmdstr + assert_match {+@all*-client*+client|setname*} $cmdstr + r CLIENT ID; # Should not fail + r CLIENT SETNAME foo ; # Should not fail + catch {r CLIENT KILL type master} e + set e + } {*NOPERM*client|kill*} + + test {ACLs can exclude single subcommands, case 1} { + r ACL setuser newuser +@all -client|kill + set cmdstr [dict get [r ACL getuser newuser] commands] + assert_equal {+@all -client|kill} $cmdstr + r CLIENT ID; # Should not fail + r CLIENT SETNAME foo ; # Should not fail + catch {r CLIENT KILL type master} e + set e + } {*NOPERM*client|kill*} + + test {ACLs can exclude single subcommands, case 2} { + r ACL setuser newuser -@all +acl +config -config|set + set cmdstr [dict get [r ACL getuser newuser] commands] + assert_match {*+config*} $cmdstr + assert_match {*-config|set*} $cmdstr + r CONFIG GET loglevel; # Should not fail + catch {r CONFIG SET loglevel debug} e + set e + } {*NOPERM*config|set*} + + test {ACLs cannot include a subcommand with a specific arg} { + r ACL setuser newuser +@all -config|get + catch { r ACL setuser newuser +config|get|appendonly} e + set e + } {*Allowing first-arg of a subcommand is not supported*} + + test {ACLs cannot exclude or include a container commands with a specific arg} { + r ACL setuser newuser +@all +config|get + catch { r ACL setuser newuser +@all +config|asdf} e + assert_match "*Unknown command or category name in ACL*" $e + catch { r ACL setuser newuser +@all -config|asdf} e + assert_match "*Unknown command or category name in ACL*" $e + } {} + + test {ACLs cannot exclude or include a container command with two args} { + r ACL setuser newuser +@all +config|get + catch { r ACL setuser newuser +@all +get|key1|key2} e + assert_match "*Unknown command or category name in ACL*" $e + catch { r ACL setuser newuser +@all -get|key1|key2} e + assert_match "*Unknown command or category name in ACL*" $e + } {} + + test {ACLs including of a type includes also subcommands} { + r ACL setuser newuser -@all +acl +@stream + r XADD key * field value + r XINFO STREAM key + } + + test {ACLs can block SELECT of all but a specific DB} { + r ACL setuser newuser -@all +acl +select|0 + set cmdstr [dict get [r ACL getuser newuser] commands] + assert_match {*+select|0*} $cmdstr + r SELECT 0 + catch {r SELECT 1} e + set e + } {*NOPERM*select*} + + test {ACLs can block all DEBUG subcommands except one} { + r ACL setuser newuser -@all +acl +incr +debug|object + set cmdstr [dict get [r ACL getuser newuser] commands] + assert_match {*+debug|object*} $cmdstr + r INCR key + r DEBUG OBJECT key + catch {r DEBUG SEGFAULT} e + set e + } {*NOPERM*debug*} + + test {ACLs set can include subcommands, if already full command exists} { + r ACL setuser bob +memory|doctor + set cmdstr [dict get [r ACL getuser bob] commands] + assert_equal {-@all +memory|doctor} $cmdstr + + # Validate the commands have got engulfed to +memory. + r ACL setuser bob +memory + set cmdstr [dict get [r ACL getuser bob] commands] + assert_equal {-@all +memory} $cmdstr + + # Appending to the existing access string of bob. + r ACL setuser bob +@all +client|id + # Validate the new commands has got engulfed to +@all. + set cmdstr [dict get [r ACL getuser bob] commands] + assert_equal {+@all} $cmdstr + + r ACL setuser bob >passwd1 on + r AUTH bob passwd1 + r CLIENT ID; # Should not fail + r MEMORY DOCTOR; # Should not fail + } + + test {ACLs set can exclude subcommands, if already full command exists} { + r ACL setuser alice +@all -memory|doctor + set cmdstr [dict get [r ACL getuser alice] commands] + assert_equal {+@all -memory|doctor} $cmdstr + + r ACL setuser alice >passwd1 on + r AUTH alice passwd1 + + assert_error {*NOPERM*memory|doctor*} {r MEMORY DOCTOR} + r MEMORY STATS ;# should work + + # Validate the commands have got engulfed to -memory. + r ACL setuser alice +@all -memory + set cmdstr [dict get [r ACL getuser alice] commands] + assert_equal {+@all -memory} $cmdstr + + assert_error {*NOPERM*memory|doctor*} {r MEMORY DOCTOR} + assert_error {*NOPERM*memory|stats*} {r MEMORY STATS} + + # Appending to the existing access string of alice. + r ACL setuser alice -@all + + # Now, alice can't do anything, we need to auth newuser to execute ACL GETUSER + r AUTH newuser passwd1 + + # Validate the new commands has got engulfed to -@all. + set cmdstr [dict get [r ACL getuser alice] commands] + assert_equal {-@all} $cmdstr + + r AUTH alice passwd1 + + assert_error {*NOPERM*get*} {r GET key} + assert_error {*NOPERM*memory|stats*} {r MEMORY STATS} + + # Auth newuser before the next test + r AUTH newuser passwd1 + } + + # Note that the order of the generated ACL rules is not stable in Redis + # so we need to match the different parts and not as a whole string. + test {ACL GETUSER is able to translate back command permissions} { + # Subtractive + r ACL setuser newuser reset +@all ~* -@string +incr -debug +debug|digest + set cmdstr [dict get [r ACL getuser newuser] commands] + assert_match {*+@all*} $cmdstr + assert_match {*-@string*} $cmdstr + assert_match {*+incr*} $cmdstr + assert_match {*-debug +debug|digest**} $cmdstr + + # Additive + r ACL setuser newuser reset +@string -incr +acl +debug|digest +debug|segfault + set cmdstr [dict get [r ACL getuser newuser] commands] + assert_match {*-@all*} $cmdstr + assert_match {*+@string*} $cmdstr + assert_match {*-incr*} $cmdstr + assert_match {*+debug|digest*} $cmdstr + assert_match {*+debug|segfault*} $cmdstr + assert_match {*+acl*} $cmdstr + } + + # A regression test make sure that as long as there is a simple + # category defining the commands, that it will be used as is. + test {ACL GETUSER provides reasonable results} { + set categories [r ACL CAT] + + # Test that adding each single category will + # result in just that category with both +@all and -@all + foreach category $categories { + # Test for future commands where allowed + r ACL setuser additive reset +@all "-@$category" + set cmdstr [dict get [r ACL getuser additive] commands] + assert_equal "+@all -@$category" $cmdstr + + # Test for future commands where disallowed + r ACL setuser restrictive reset -@all "+@$category" + set cmdstr [dict get [r ACL getuser restrictive] commands] + assert_equal "-@all +@$category" $cmdstr + } + } + + test "ACL CAT with illegal arguments" { + assert_error {*Unknown category 'NON_EXISTS'} {r ACL CAT NON_EXISTS} + assert_error {*unknown subcommand or wrong number of arguments for 'CAT'*} {r ACL CAT NON_EXISTS NON_EXISTS2} + } + + test "ACL CAT without category - list all categories" { + set categories [r acl cat] + assert_not_equal [lsearch $categories "keyspace"] -1 + assert_not_equal [lsearch $categories "connection"] -1 + } + + test "ACL CAT category - list all commands/subcommands that belong to category" { + assert_not_equal [lsearch [r acl cat transaction] "multi"] -1 + assert_not_equal [lsearch [r acl cat scripting] "function|list"] -1 + + # Negative check to make sure it doesn't actually return all commands. + assert_equal [lsearch [r acl cat keyspace] "set"] -1 + assert_equal [lsearch [r acl cat stream] "get"] -1 + } + + test "ACL requires explicit permission for scripting for EVAL_RO, EVALSHA_RO and FCALL_RO" { + r ACL SETUSER scripter on nopass +readonly + assert_equal "This user has no permissions to run the 'eval_ro' command" [r ACL DRYRUN scripter EVAL_RO "" 0] + assert_equal "This user has no permissions to run the 'evalsha_ro' command" [r ACL DRYRUN scripter EVALSHA_RO "" 0] + assert_equal "This user has no permissions to run the 'fcall_ro' command" [r ACL DRYRUN scripter FCALL_RO "" 0] + } + + test {ACL #5998 regression: memory leaks adding / removing subcommands} { + r AUTH default "" + r ACL setuser newuser reset -debug +debug|a +debug|b +debug|c + r ACL setuser newuser -debug + # The test framework will detect a leak if any. + } + + test {ACL LOG shows failed command executions at toplevel} { + r ACL LOG RESET + r ACL setuser antirez >foo on +set ~object:1234 + r ACL setuser antirez +eval +multi +exec + r ACL setuser antirez resetchannels +publish + r AUTH antirez foo + assert_error "*NOPERM*get*" {r GET foo} + r AUTH default "" + set entry [lindex [r ACL LOG] 0] + assert {[dict get $entry username] eq {antirez}} + assert {[dict get $entry context] eq {toplevel}} + assert {[dict get $entry reason] eq {command}} + assert {[dict get $entry object] eq {get}} + } + + test "ACL LOG shows failed subcommand executions at toplevel" { + r ACL LOG RESET + r ACL DELUSER demo + r ACL SETUSER demo on nopass + r AUTH demo "" + assert_error "*NOPERM*script|help*" {r SCRIPT HELP} + r AUTH default "" + set entry [lindex [r ACL LOG] 0] + assert_equal [dict get $entry username] {demo} + assert_equal [dict get $entry context] {toplevel} + assert_equal [dict get $entry reason] {command} + assert_equal [dict get $entry object] {script|help} + } + + test {ACL LOG is able to test similar events} { + r ACL LOG RESET + r AUTH antirez foo + catch {r GET foo} + catch {r GET foo} + catch {r GET foo} + r AUTH default "" + set entry [lindex [r ACL LOG] 0] + assert {[dict get $entry count] == 3} + } + + test {ACL LOG is able to log keys access violations and key name} { + r AUTH antirez foo + catch {r SET somekeynotallowed 1234} + r AUTH default "" + set entry [lindex [r ACL LOG] 0] + assert {[dict get $entry reason] eq {key}} + assert {[dict get $entry object] eq {somekeynotallowed}} + } + + test {ACL LOG is able to log channel access violations and channel name} { + r AUTH antirez foo + catch {r PUBLISH somechannelnotallowed nullmsg} + r AUTH default "" + set entry [lindex [r ACL LOG] 0] + assert {[dict get $entry reason] eq {channel}} + assert {[dict get $entry object] eq {somechannelnotallowed}} + } + + test {ACL LOG RESET is able to flush the entries in the log} { + r ACL LOG RESET + assert {[llength [r ACL LOG]] == 0} + } + + test {ACL LOG can distinguish the transaction context (1)} { + r AUTH antirez foo + r MULTI + catch {r INCR foo} + catch {r EXEC} + r AUTH default "" + set entry [lindex [r ACL LOG] 0] + assert {[dict get $entry context] eq {multi}} + assert {[dict get $entry object] eq {incr}} + } + + test {ACL LOG can distinguish the transaction context (2)} { + set rd1 [redis_deferring_client] + r ACL SETUSER antirez +incr + + r AUTH antirez foo + r MULTI + r INCR object:1234 + $rd1 ACL SETUSER antirez -incr + $rd1 read + catch {r EXEC} + $rd1 close + r AUTH default "" + set entry [lindex [r ACL LOG] 0] + assert {[dict get $entry context] eq {multi}} + assert {[dict get $entry object] eq {incr}} + r ACL SETUSER antirez -incr + } + + test {ACL can log errors in the context of Lua scripting} { + r AUTH antirez foo + catch {r EVAL {redis.call('incr','foo')} 0} + r AUTH default "" + set entry [lindex [r ACL LOG] 0] + assert {[dict get $entry context] eq {lua}} + assert {[dict get $entry object] eq {incr}} + } + + test {ACL LOG can accept a numerical argument to show less entries} { + r AUTH antirez foo + catch {r INCR foo} + catch {r INCR foo} + catch {r INCR foo} + catch {r INCR foo} + r AUTH default "" + assert {[llength [r ACL LOG]] > 1} + assert {[llength [r ACL LOG 2]] == 2} + } + + test {ACL LOG can log failed auth attempts} { + catch {r AUTH antirez wrong-password} + set entry [lindex [r ACL LOG] 0] + assert {[dict get $entry context] eq {toplevel}} + assert {[dict get $entry reason] eq {auth}} + assert {[dict get $entry object] eq {AUTH}} + assert {[dict get $entry username] eq {antirez}} + } + + test {ACL LOG entries are limited to a maximum amount} { + r ACL LOG RESET + r CONFIG SET acllog-max-len 5 + r AUTH antirez foo + for {set j 0} {$j < 10} {incr j} { + catch {r SET obj:$j 123} + } + r AUTH default "" + assert {[llength [r ACL LOG]] == 5} + } + + test {When default user is off, new connections are not authenticated} { + r ACL setuser default off + catch {set rd1 [redis_deferring_client]} e + r ACL setuser default on + set e + } {*NOAUTH*} + + test {When default user has no command permission, hello command still works for other users} { + r ACL setuser secure-user >supass on +@all + r ACL setuser default -@all + r HELLO 2 AUTH secure-user supass + r ACL setuser default nopass +@all + r AUTH default "" + } + + test {ACL HELP should not have unexpected options} { + catch {r ACL help xxx} e + assert_match "*wrong number of arguments for 'acl|help' command" $e + } + + test {Delete a user that the client doesn't use} { + r ACL setuser not_used on >passwd + assert {[r ACL deluser not_used] == 1} + # The client is not closed + assert {[r ping] eq {PONG}} + } + + test {Delete a user that the client is using} { + r ACL setuser using on +acl >passwd + r AUTH using passwd + # The client will receive reply normally + assert {[r ACL deluser using] == 1} + # The client is closed + catch {[r ping]} e + assert_match "*I/O error*" $e + } + + test {ACL GENPASS command failed test} { + catch {r ACL genpass -236} err1 + catch {r ACL genpass 5000} err2 + assert_match "*ACL GENPASS argument must be the number*" $err1 + assert_match "*ACL GENPASS argument must be the number*" $err2 + } + + test {Default user can not be removed} { + catch {r ACL deluser default} err + set err + } {ERR The 'default' user cannot be removed} + + test {ACL load non-existing configured ACL file} { + catch {r ACL load} err + set err + } {*Redis instance is not configured to use an ACL file*} +} + +set server_path [tmpdir "server.acl"] +exec cp -f tests/assets/user.acl $server_path +start_server [list overrides [list "dir" $server_path "acl-pubsub-default" "allchannels" "aclfile" "user.acl"] tags [list "external:skip"]] { + # user alice on allcommands allkeys &* >alice + # user bob on -@all +@set +acl ~set* &* >bob + # user default on nopass ~* &* +@all + + test {default: load from include file, can access any channels} { + r SUBSCRIBE foo + r PSUBSCRIBE bar* + r UNSUBSCRIBE + r PUNSUBSCRIBE + r PUBLISH hello world + } + + test {default: with config acl-pubsub-default allchannels after reset, can access any channels} { + r ACL setuser default reset on nopass ~* +@all + r SUBSCRIBE foo + r PSUBSCRIBE bar* + r UNSUBSCRIBE + r PUNSUBSCRIBE + r PUBLISH hello world + } + + test {default: with config acl-pubsub-default resetchannels after reset, can not access any channels} { + r CONFIG SET acl-pubsub-default resetchannels + r ACL setuser default reset on nopass ~* +@all + assert_error {*NOPERM*channel*} {r SUBSCRIBE foo} + assert_error {*NOPERM*channel*} {r PSUBSCRIBE bar*} + assert_error {*NOPERM*channel*} {r PUBLISH hello world} + r CONFIG SET acl-pubsub-default resetchannels + } + + test {Alice: can execute all command} { + r AUTH alice alice + assert_equal "alice" [r acl whoami] + r SET key value + } + + test {Bob: just execute @set and acl command} { + r AUTH bob bob + assert_equal "bob" [r acl whoami] + assert_equal "3" [r sadd set 1 2 3] + catch {r SET key value} e + set e + } {*NOPERM*set*} + + test {ACL load and save} { + r ACL setuser eve +get allkeys >eve on + r ACL save + + # ACL load will free user and kill clients + r ACL load + catch {r ACL LIST} e + assert_match {*I/O error*} $e + + reconnect + r AUTH alice alice + r SET key value + r AUTH eve eve + r GET key + catch {r SET key value} e + set e + } {*NOPERM*set*} + + test {ACL load and save with restricted channels} { + r AUTH alice alice + r ACL setuser harry on nopass resetchannels &test +@all ~* + r ACL save + + # ACL load will free user and kill clients + r ACL load + catch {r ACL LIST} e + assert_match {*I/O error*} $e + + reconnect + r AUTH harry anything + r publish test bar + catch {r publish test1 bar} e + r ACL deluser harry + set e + } {*NOPERM*channel*} +} + +set server_path [tmpdir "resetchannels.acl"] +exec cp -f tests/assets/nodefaultuser.acl $server_path +exec cp -f tests/assets/default.conf $server_path +start_server [list overrides [list "dir" $server_path "aclfile" "nodefaultuser.acl"] tags [list "external:skip"]] { + + test {Default user has access to all channels irrespective of flag} { + set channelinfo [dict get [r ACL getuser default] channels] + assert_equal "&*" $channelinfo + set channelinfo [dict get [r ACL getuser alice] channels] + assert_equal "" $channelinfo + } + + test {Update acl-pubsub-default, existing users shouldn't get affected} { + set channelinfo [dict get [r ACL getuser default] channels] + assert_equal "&*" $channelinfo + r CONFIG set acl-pubsub-default allchannels + r ACL setuser mydefault + set channelinfo [dict get [r ACL getuser mydefault] channels] + assert_equal "&*" $channelinfo + r CONFIG set acl-pubsub-default resetchannels + set channelinfo [dict get [r ACL getuser mydefault] channels] + assert_equal "&*" $channelinfo + } + + test {Single channel is valid} { + r ACL setuser onechannel &test + set channelinfo [dict get [r ACL getuser onechannel] channels] + assert_equal "&test" $channelinfo + r ACL deluser onechannel + } + + test {Single channel is not valid with allchannels} { + r CONFIG set acl-pubsub-default allchannels + catch {r ACL setuser onechannel &test} err + r CONFIG set acl-pubsub-default resetchannels + set err + } {*start with an empty list of channels*} +} + +set server_path [tmpdir "resetchannels.acl"] +exec cp -f tests/assets/nodefaultuser.acl $server_path +exec cp -f tests/assets/default.conf $server_path +start_server [list overrides [list "dir" $server_path "acl-pubsub-default" "resetchannels" "aclfile" "nodefaultuser.acl"] tags [list "external:skip"]] { + + test {Only default user has access to all channels irrespective of flag} { + set channelinfo [dict get [r ACL getuser default] channels] + assert_equal "&*" $channelinfo + set channelinfo [dict get [r ACL getuser alice] channels] + assert_equal "" $channelinfo + } +} + + +start_server {overrides {user "default on nopass ~* +@all"} tags {"external:skip"}} { + test {default: load from config file, without channel permission default user can't access any channels} { + catch {r SUBSCRIBE foo} e + set e + } {*NOPERM*channel*} +} + +start_server {overrides {user "default on nopass ~* &* +@all"} tags {"external:skip"}} { + test {default: load from config file with all channels permissions} { + r SUBSCRIBE foo + r PSUBSCRIBE bar* + r UNSUBSCRIBE + r PUNSUBSCRIBE + r PUBLISH hello world + } +} + +set server_path [tmpdir "duplicate.acl"] +exec cp -f tests/assets/user.acl $server_path +exec cp -f tests/assets/default.conf $server_path +start_server [list overrides [list "dir" $server_path "aclfile" "user.acl"] tags [list "external:skip"]] { + + test {Test loading an ACL file with duplicate users} { + exec cp -f tests/assets/user.acl $server_path + + # Corrupt the ACL file + set corruption "\nuser alice on nopass ~* -@all" + exec echo $corruption >> $server_path/user.acl + catch {r ACL LOAD} err + assert_match {*Duplicate user 'alice' found*} $err + + # Verify the previous users still exist + # NOTE: A missing user evaluates to an empty + # string. + assert {[r ACL GETUSER alice] != ""} + assert_equal [dict get [r ACL GETUSER alice] commands] "+@all" + assert {[r ACL GETUSER bob] != ""} + assert {[r ACL GETUSER default] != ""} + } + + test {Test loading an ACL file with duplicate default user} { + exec cp -f tests/assets/user.acl $server_path + + # Corrupt the ACL file + set corruption "\nuser default on nopass ~* -@all" + exec echo $corruption >> $server_path/user.acl + catch {r ACL LOAD} err + assert_match {*Duplicate user 'default' found*} $err + + # Verify the previous users still exist + # NOTE: A missing user evaluates to an empty + # string. + assert {[r ACL GETUSER alice] != ""} + assert_equal [dict get [r ACL GETUSER alice] commands] "+@all" + assert {[r ACL GETUSER bob] != ""} + assert {[r ACL GETUSER default] != ""} + } + + test {Test loading duplicate users in config on startup} { + catch {exec src/redis-server --user foo --user foo} err + assert_match {*Duplicate user*} $err + + catch {exec src/redis-server --user default --user default} err + assert_match {*Duplicate user*} $err + } {} {external:skip} +} + +start_server {overrides {user "default on nopass ~* +@all -flushdb"} tags {acl external:skip}} { + test {ACL from config file and config rewrite} { + assert_error {NOPERM *} {r flushdb} + r config rewrite + restart_server 0 true false + assert_error {NOPERM *} {r flushdb} + } +} + diff --git a/tests/unit/aofrw.tcl b/tests/unit/aofrw.tcl new file mode 100644 index 0000000..45db193 --- /dev/null +++ b/tests/unit/aofrw.tcl @@ -0,0 +1,224 @@ +start_server {tags {"aofrw external:skip"}} { + # Enable the AOF + r config set appendonly yes + r config set auto-aof-rewrite-percentage 0 ; # Disable auto-rewrite. + waitForBgrewriteaof r + + foreach rdbpre {yes no} { + r config set aof-use-rdb-preamble $rdbpre + test "AOF rewrite during write load: RDB preamble=$rdbpre" { + # Start a write load for 10 seconds + set master [srv 0 client] + set master_host [srv 0 host] + set master_port [srv 0 port] + set load_handle0 [start_write_load $master_host $master_port 10] + set load_handle1 [start_write_load $master_host $master_port 10] + set load_handle2 [start_write_load $master_host $master_port 10] + set load_handle3 [start_write_load $master_host $master_port 10] + set load_handle4 [start_write_load $master_host $master_port 10] + + # Make sure the instance is really receiving data + wait_for_condition 50 100 { + [r dbsize] > 0 + } else { + fail "No write load detected." + } + + # After 3 seconds, start a rewrite, while the write load is still + # active. + after 3000 + r bgrewriteaof + waitForBgrewriteaof r + + # Let it run a bit more so that we'll append some data to the new + # AOF. + after 1000 + + # Stop the processes generating the load if they are still active + stop_write_load $load_handle0 + stop_write_load $load_handle1 + stop_write_load $load_handle2 + stop_write_load $load_handle3 + stop_write_load $load_handle4 + + # Make sure no more commands processed, before taking debug digest + wait_load_handlers_disconnected + + # Get the data set digest + set d1 [debug_digest] + + # Load the AOF + r debug loadaof + set d2 [debug_digest] + + # Make sure they are the same + assert {$d1 eq $d2} + } + } +} + +start_server {tags {"aofrw external:skip"} overrides {aof-use-rdb-preamble no}} { + test {Turning off AOF kills the background writing child if any} { + r config set appendonly yes + waitForBgrewriteaof r + + # start a slow AOFRW + r set k v + r config set rdb-key-save-delay 10000000 + r bgrewriteaof + + # disable AOF and wait for the child to be killed + r config set appendonly no + wait_for_condition 50 100 { + [string match {*Killing*AOF*child*} [exec tail -5 < [srv 0 stdout]]] + } else { + fail "Can't find 'Killing AOF child' into recent logs" + } + r config set rdb-key-save-delay 0 + } + + foreach d {string int} { + foreach e {quicklist} { + test "AOF rewrite of list with $e encoding, $d data" { + r flushall + set len 1000 + for {set j 0} {$j < $len} {incr j} { + if {$d eq {string}} { + set data [randstring 0 16 alpha] + } else { + set data [randomInt 4000000000] + } + r lpush key $data + } + assert_equal [r object encoding key] $e + set d1 [debug_digest] + r bgrewriteaof + waitForBgrewriteaof r + r debug loadaof + set d2 [debug_digest] + if {$d1 ne $d2} { + error "assertion:$d1 is not equal to $d2" + } + } + } + } + + foreach d {string int} { + foreach e {intset hashtable} { + test "AOF rewrite of set with $e encoding, $d data" { + r flushall + if {$e eq {intset}} {set len 10} else {set len 1000} + for {set j 0} {$j < $len} {incr j} { + if {$d eq {string}} { + set data [randstring 0 16 alpha] + } else { + set data [randomInt 4000000000] + } + r sadd key $data + } + if {$d ne {string}} { + assert_equal [r object encoding key] $e + } + set d1 [debug_digest] + r bgrewriteaof + waitForBgrewriteaof r + r debug loadaof + set d2 [debug_digest] + if {$d1 ne $d2} { + error "assertion:$d1 is not equal to $d2" + } + } + } + } + + foreach d {string int} { + foreach e {listpack hashtable} { + test "AOF rewrite of hash with $e encoding, $d data" { + r flushall + if {$e eq {listpack}} {set len 10} else {set len 1000} + for {set j 0} {$j < $len} {incr j} { + if {$d eq {string}} { + set data [randstring 0 16 alpha] + } else { + set data [randomInt 4000000000] + } + r hset key $data $data + } + assert_equal [r object encoding key] $e + set d1 [debug_digest] + r bgrewriteaof + waitForBgrewriteaof r + r debug loadaof + set d2 [debug_digest] + if {$d1 ne $d2} { + error "assertion:$d1 is not equal to $d2" + } + } + } + } + + foreach d {string int} { + foreach e {listpack skiplist} { + test "AOF rewrite of zset with $e encoding, $d data" { + r flushall + if {$e eq {listpack}} {set len 10} else {set len 1000} + for {set j 0} {$j < $len} {incr j} { + if {$d eq {string}} { + set data [randstring 0 16 alpha] + } else { + set data [randomInt 4000000000] + } + r zadd key [expr rand()] $data + } + assert_equal [r object encoding key] $e + set d1 [debug_digest] + r bgrewriteaof + waitForBgrewriteaof r + r debug loadaof + set d2 [debug_digest] + if {$d1 ne $d2} { + error "assertion:$d1 is not equal to $d2" + } + } + } + } + + test "AOF rewrite functions" { + r flushall + r FUNCTION LOAD {#!lua name=test + redis.register_function('test', function() return 1 end) + } + r bgrewriteaof + waitForBgrewriteaof r + r function flush + r debug loadaof + assert_equal [r fcall test 0] 1 + r FUNCTION LIST + } {{library_name test engine LUA functions {{name test description {} flags {}}}}} + + test {BGREWRITEAOF is delayed if BGSAVE is in progress} { + r flushall + r set k v + r config set rdb-key-save-delay 10000000 + r bgsave + assert_match {*scheduled*} [r bgrewriteaof] + assert_equal [s aof_rewrite_scheduled] 1 + r config set rdb-key-save-delay 0 + catch {exec kill -9 [get_child_pid 0]} + while {[s aof_rewrite_scheduled] eq 1} { + after 100 + } + } + + test {BGREWRITEAOF is refused if already in progress} { + r config set aof-use-rdb-preamble yes + r config set rdb-key-save-delay 10000000 + catch { + r bgrewriteaof + r bgrewriteaof + } e + assert_match {*ERR*already*} $e + r config set rdb-key-save-delay 0 + catch {exec kill -9 [get_child_pid 0]} + } +} diff --git a/tests/unit/auth.tcl b/tests/unit/auth.tcl new file mode 100644 index 0000000..26d1255 --- /dev/null +++ b/tests/unit/auth.tcl @@ -0,0 +1,89 @@ +start_server {tags {"auth external:skip"}} { + test {AUTH fails if there is no password configured server side} { + catch {r auth foo} err + set _ $err + } {ERR *any password*} + + test {Arity check for auth command} { + catch {r auth a b c} err + set _ $err + } {*syntax error*} +} + +start_server {tags {"auth external:skip"} overrides {requirepass foobar}} { + test {AUTH fails when a wrong password is given} { + catch {r auth wrong!} err + set _ $err + } {WRONGPASS*} + + test {Arbitrary command gives an error when AUTH is required} { + catch {r set foo bar} err + set _ $err + } {NOAUTH*} + + test {AUTH succeeds when the right password is given} { + r auth foobar + } {OK} + + test {Once AUTH succeeded we can actually send commands to the server} { + r set foo 100 + r incr foo + } {101} + + test {For unauthenticated clients multibulk and bulk length are limited} { + set rr [redis [srv "host"] [srv "port"] 0 $::tls] + $rr write "*100\r\n" + $rr flush + catch {[$rr read]} e + assert_match {*unauthenticated multibulk length*} $e + $rr close + + set rr [redis [srv "host"] [srv "port"] 0 $::tls] + $rr write "*1\r\n\$100000000\r\n" + $rr flush + catch {[$rr read]} e + assert_match {*unauthenticated bulk length*} $e + $rr close + } +} + +start_server {tags {"auth_binary_password external:skip"}} { + test {AUTH fails when binary password is wrong} { + r config set requirepass "abc\x00def" + catch {r auth abc} err + set _ $err + } {WRONGPASS*} + + test {AUTH succeeds when binary password is correct} { + r config set requirepass "abc\x00def" + r auth "abc\x00def" + } {OK} + + start_server {tags {"masterauth"}} { + set master [srv -1 client] + set master_host [srv -1 host] + set master_port [srv -1 port] + set slave [srv 0 client] + + test {MASTERAUTH test with binary password} { + $master config set requirepass "abc\x00def" + + # Configure the replica with masterauth + set loglines [count_log_lines 0] + $slave slaveof $master_host $master_port + $slave config set masterauth "abc" + + # Verify replica is not able to sync with master + wait_for_log_messages 0 {"*Unable to AUTH to MASTER*"} $loglines 1000 10 + assert_equal {down} [s 0 master_link_status] + + # Test replica with the correct masterauth + $slave config set masterauth "abc\x00def" + wait_for_condition 50 100 { + [s 0 master_link_status] eq {up} + } else { + fail "Can't turn the instance into a replica" + } + } + } +} diff --git a/tests/unit/bitfield.tcl b/tests/unit/bitfield.tcl new file mode 100644 index 0000000..6d153ed --- /dev/null +++ b/tests/unit/bitfield.tcl @@ -0,0 +1,253 @@ +start_server {tags {"bitops"}} { + test {BITFIELD signed SET and GET basics} { + r del bits + set results {} + lappend results [r bitfield bits set i8 0 -100] + lappend results [r bitfield bits set i8 0 101] + lappend results [r bitfield bits get i8 0] + set results + } {0 -100 101} + + test {BITFIELD unsigned SET and GET basics} { + r del bits + set results {} + lappend results [r bitfield bits set u8 0 255] + lappend results [r bitfield bits set u8 0 100] + lappend results [r bitfield bits get u8 0] + set results + } {0 255 100} + + test {BITFIELD signed SET and GET together} { + r del bits + set results [r bitfield bits set i8 0 255 set i8 0 100 get i8 0] + } {0 -1 100} + + test {BITFIELD unsigned with SET, GET and INCRBY arguments} { + r del bits + set results [r bitfield bits set u8 0 255 incrby u8 0 100 get u8 0] + } {0 99 99} + + test {BITFIELD with only key as argument} { + r del bits + set result [r bitfield bits] + assert {$result eq {}} + } + + test {BITFIELD #<idx> form} { + r del bits + set results {} + r bitfield bits set u8 #0 65 + r bitfield bits set u8 #1 66 + r bitfield bits set u8 #2 67 + r get bits + } {ABC} + + test {BITFIELD basic INCRBY form} { + r del bits + set results {} + r bitfield bits set u8 #0 10 + lappend results [r bitfield bits incrby u8 #0 100] + lappend results [r bitfield bits incrby u8 #0 100] + set results + } {110 210} + + test {BITFIELD chaining of multiple commands} { + r del bits + set results {} + r bitfield bits set u8 #0 10 + lappend results [r bitfield bits incrby u8 #0 100 incrby u8 #0 100] + set results + } {{110 210}} + + test {BITFIELD unsigned overflow wrap} { + r del bits + set results {} + r bitfield bits set u8 #0 100 + lappend results [r bitfield bits overflow wrap incrby u8 #0 257] + lappend results [r bitfield bits get u8 #0] + lappend results [r bitfield bits overflow wrap incrby u8 #0 255] + lappend results [r bitfield bits get u8 #0] + } {101 101 100 100} + + test {BITFIELD unsigned overflow sat} { + r del bits + set results {} + r bitfield bits set u8 #0 100 + lappend results [r bitfield bits overflow sat incrby u8 #0 257] + lappend results [r bitfield bits get u8 #0] + lappend results [r bitfield bits overflow sat incrby u8 #0 -255] + lappend results [r bitfield bits get u8 #0] + } {255 255 0 0} + + test {BITFIELD signed overflow wrap} { + r del bits + set results {} + r bitfield bits set i8 #0 100 + lappend results [r bitfield bits overflow wrap incrby i8 #0 257] + lappend results [r bitfield bits get i8 #0] + lappend results [r bitfield bits overflow wrap incrby i8 #0 255] + lappend results [r bitfield bits get i8 #0] + } {101 101 100 100} + + test {BITFIELD signed overflow sat} { + r del bits + set results {} + r bitfield bits set u8 #0 100 + lappend results [r bitfield bits overflow sat incrby i8 #0 257] + lappend results [r bitfield bits get i8 #0] + lappend results [r bitfield bits overflow sat incrby i8 #0 -255] + lappend results [r bitfield bits get i8 #0] + } {127 127 -128 -128} + + test {BITFIELD overflow detection fuzzing} { + for {set j 0} {$j < 1000} {incr j} { + set bits [expr {[randomInt 64]+1}] + set sign [randomInt 2] + set range [expr {2**$bits}] + if {$bits == 64} {set sign 1} ; # u64 is not supported by BITFIELD. + if {$sign} { + set min [expr {-($range/2)}] + set type "i$bits" + } else { + set min 0 + set type "u$bits" + } + set max [expr {$min+$range-1}] + + # Compare Tcl vs Redis + set range2 [expr {$range*2}] + set value [expr {($min*2)+[randomInt $range2]}] + set increment [expr {($min*2)+[randomInt $range2]}] + if {$value > 9223372036854775807} { + set value 9223372036854775807 + } + if {$value < -9223372036854775808} { + set value -9223372036854775808 + } + if {$increment > 9223372036854775807} { + set increment 9223372036854775807 + } + if {$increment < -9223372036854775808} { + set increment -9223372036854775808 + } + + set overflow 0 + if {$value > $max || $value < $min} {set overflow 1} + if {($value + $increment) > $max} {set overflow 1} + if {($value + $increment) < $min} {set overflow 1} + + r del bits + set res1 [r bitfield bits overflow fail set $type 0 $value] + set res2 [r bitfield bits overflow fail incrby $type 0 $increment] + + if {$overflow && [lindex $res1 0] ne {} && + [lindex $res2 0] ne {}} { + fail "OW not detected where needed: $type $value+$increment" + } + if {!$overflow && ([lindex $res1 0] eq {} || + [lindex $res2 0] eq {})} { + fail "OW detected where NOT needed: $type $value+$increment" + } + } + } + + test {BITFIELD overflow wrap fuzzing} { + for {set j 0} {$j < 1000} {incr j} { + set bits [expr {[randomInt 64]+1}] + set sign [randomInt 2] + set range [expr {2**$bits}] + if {$bits == 64} {set sign 1} ; # u64 is not supported by BITFIELD. + if {$sign} { + set min [expr {-($range/2)}] + set type "i$bits" + } else { + set min 0 + set type "u$bits" + } + set max [expr {$min+$range-1}] + + # Compare Tcl vs Redis + set range2 [expr {$range*2}] + set value [expr {($min*2)+[randomInt $range2]}] + set increment [expr {($min*2)+[randomInt $range2]}] + if {$value > 9223372036854775807} { + set value 9223372036854775807 + } + if {$value < -9223372036854775808} { + set value -9223372036854775808 + } + if {$increment > 9223372036854775807} { + set increment 9223372036854775807 + } + if {$increment < -9223372036854775808} { + set increment -9223372036854775808 + } + + r del bits + r bitfield bits overflow wrap set $type 0 $value + r bitfield bits overflow wrap incrby $type 0 $increment + set res [lindex [r bitfield bits get $type 0] 0] + + set expected 0 + if {$sign} {incr expected [expr {$max+1}]} + incr expected $value + incr expected $increment + set expected [expr {$expected % $range}] + if {$sign} {incr expected $min} + + if {$res != $expected} { + fail "WRAP error: $type $value+$increment = $res, should be $expected" + } + } + } + + test {BITFIELD regression for #3221} { + r set bits 1 + r bitfield bits get u1 0 + } {0} + + test {BITFIELD regression for #3564} { + for {set j 0} {$j < 10} {incr j} { + r del mystring + set res [r BITFIELD mystring SET i8 0 10 SET i8 64 10 INCRBY i8 10 99900] + assert {$res eq {0 0 60}} + } + r del mystring + } +} + +start_server {tags {"repl external:skip"}} { + start_server {} { + set master [srv -1 client] + set master_host [srv -1 host] + set master_port [srv -1 port] + set slave [srv 0 client] + + test {BITFIELD: setup slave} { + $slave slaveof $master_host $master_port + wait_for_condition 50 100 { + [s 0 master_link_status] eq {up} + } else { + fail "Replication not started." + } + } + + test {BITFIELD: write on master, read on slave} { + $master del bits + assert_equal 0 [$master bitfield bits set u8 0 255] + assert_equal 255 [$master bitfield bits set u8 0 100] + wait_for_ofs_sync $master $slave + assert_equal 100 [$slave bitfield_ro bits get u8 0] + } + + test {BITFIELD_RO with only key as argument} { + set res [$slave bitfield_ro bits] + assert {$res eq {}} + } + + test {BITFIELD_RO fails when write option is used} { + catch {$slave bitfield_ro bits set u8 0 100 get u8 0} err + assert_match {*ERR BITFIELD_RO only supports the GET subcommand*} $err + } + } +} diff --git a/tests/unit/bitops.tcl b/tests/unit/bitops.tcl new file mode 100644 index 0000000..1b7db40 --- /dev/null +++ b/tests/unit/bitops.tcl @@ -0,0 +1,593 @@ +# Compare Redis commands against Tcl implementations of the same commands. +proc count_bits s { + binary scan $s b* bits + string length [regsub -all {0} $bits {}] +} + +# start end are bit index +proc count_bits_start_end {s start end} { + binary scan $s B* bits + string length [regsub -all {0} [string range $bits $start $end] {}] +} + +proc simulate_bit_op {op args} { + set maxlen 0 + set j 0 + set count [llength $args] + foreach a $args { + binary scan $a b* bits + set b($j) $bits + if {[string length $bits] > $maxlen} { + set maxlen [string length $bits] + } + incr j + } + for {set j 0} {$j < $count} {incr j} { + if {[string length $b($j)] < $maxlen} { + append b($j) [string repeat 0 [expr $maxlen-[string length $b($j)]]] + } + } + set out {} + for {set x 0} {$x < $maxlen} {incr x} { + set bit [string range $b(0) $x $x] + if {$op eq {not}} {set bit [expr {!$bit}]} + for {set j 1} {$j < $count} {incr j} { + set bit2 [string range $b($j) $x $x] + switch $op { + and {set bit [expr {$bit & $bit2}]} + or {set bit [expr {$bit | $bit2}]} + xor {set bit [expr {$bit ^ $bit2}]} + } + } + append out $bit + } + binary format b* $out +} + +start_server {tags {"bitops"}} { + test {BITCOUNT returns 0 against non existing key} { + assert {[r bitcount no-key] == 0} + assert {[r bitcount no-key 0 1000 bit] == 0} + } + + test {BITCOUNT returns 0 with out of range indexes} { + r set str "xxxx" + assert {[r bitcount str 4 10] == 0} + assert {[r bitcount str 32 87 bit] == 0} + } + + test {BITCOUNT returns 0 with negative indexes where start > end} { + r set str "xxxx" + assert {[r bitcount str -6 -7] == 0} + assert {[r bitcount str -6 -15 bit] == 0} + } + + catch {unset num} + foreach vec [list "" "\xaa" "\x00\x00\xff" "foobar" "123"] { + incr num + test "BITCOUNT against test vector #$num" { + r set str $vec + set count [count_bits $vec] + assert {[r bitcount str] == $count} + assert {[r bitcount str 0 -1 bit] == $count} + } + } + + test {BITCOUNT fuzzing without start/end} { + for {set j 0} {$j < 100} {incr j} { + set str [randstring 0 3000] + r set str $str + set count [count_bits $str] + assert {[r bitcount str] == $count} + assert {[r bitcount str 0 -1 bit] == $count} + } + } + + test {BITCOUNT fuzzing with start/end} { + for {set j 0} {$j < 100} {incr j} { + set str [randstring 0 3000] + r set str $str + set l [string length $str] + set start [randomInt $l] + set end [randomInt $l] + if {$start > $end} { + # Swap start and end + lassign [list $end $start] start end + } + assert {[r bitcount str $start $end] == [count_bits [string range $str $start $end]]} + } + + for {set j 0} {$j < 100} {incr j} { + set str [randstring 0 3000] + r set str $str + set l [expr [string length $str] * 8] + set start [randomInt $l] + set end [randomInt $l] + if {$start > $end} { + # Swap start and end + lassign [list $end $start] start end + } + assert {[r bitcount str $start $end bit] == [count_bits_start_end $str $start $end]} + } + } + + test {BITCOUNT with start, end} { + set s "foobar" + r set s $s + assert_equal [r bitcount s 0 -1] [count_bits "foobar"] + assert_equal [r bitcount s 1 -2] [count_bits "ooba"] + assert_equal [r bitcount s -2 1] [count_bits ""] + assert_equal [r bitcount s 0 1000] [count_bits "foobar"] + + assert_equal [r bitcount s 0 -1 bit] [count_bits $s] + assert_equal [r bitcount s 10 14 bit] [count_bits_start_end $s 10 14] + assert_equal [r bitcount s 3 14 bit] [count_bits_start_end $s 3 14] + assert_equal [r bitcount s 3 29 bit] [count_bits_start_end $s 3 29] + assert_equal [r bitcount s 10 -34 bit] [count_bits_start_end $s 10 14] + assert_equal [r bitcount s 3 -34 bit] [count_bits_start_end $s 3 14] + assert_equal [r bitcount s 3 -19 bit] [count_bits_start_end $s 3 29] + assert_equal [r bitcount s -2 1 bit] 0 + assert_equal [r bitcount s 0 1000 bit] [count_bits $s] + } + + test {BITCOUNT syntax error #1} { + catch {r bitcount s 0} e + set e + } {ERR *syntax*} + + test {BITCOUNT syntax error #2} { + catch {r bitcount s 0 1 hello} e + set e + } {ERR *syntax*} + + test {BITCOUNT regression test for github issue #582} { + r del foo + r setbit foo 0 1 + if {[catch {r bitcount foo 0 4294967296} e]} { + assert_match {*ERR*out of range*} $e + set _ 1 + } else { + set e + } + } {1} + + test {BITCOUNT misaligned prefix} { + r del str + r set str ab + r bitcount str 1 -1 + } {3} + + test {BITCOUNT misaligned prefix + full words + remainder} { + r del str + r set str __PPxxxxxxxxxxxxxxxxRR__ + r bitcount str 2 -3 + } {74} + + test {BITOP NOT (empty string)} { + r set s{t} "" + r bitop not dest{t} s{t} + r get dest{t} + } {} + + test {BITOP NOT (known string)} { + r set s{t} "\xaa\x00\xff\x55" + r bitop not dest{t} s{t} + r get dest{t} + } "\x55\xff\x00\xaa" + + test {BITOP where dest and target are the same key} { + r set s "\xaa\x00\xff\x55" + r bitop not s s + r get s + } "\x55\xff\x00\xaa" + + test {BITOP AND|OR|XOR don't change the string with single input key} { + r set a{t} "\x01\x02\xff" + r bitop and res1{t} a{t} + r bitop or res2{t} a{t} + r bitop xor res3{t} a{t} + list [r get res1{t}] [r get res2{t}] [r get res3{t}] + } [list "\x01\x02\xff" "\x01\x02\xff" "\x01\x02\xff"] + + test {BITOP missing key is considered a stream of zero} { + r set a{t} "\x01\x02\xff" + r bitop and res1{t} no-suck-key{t} a{t} + r bitop or res2{t} no-suck-key{t} a{t} no-such-key{t} + r bitop xor res3{t} no-such-key{t} a{t} + list [r get res1{t}] [r get res2{t}] [r get res3{t}] + } [list "\x00\x00\x00" "\x01\x02\xff" "\x01\x02\xff"] + + test {BITOP shorter keys are zero-padded to the key with max length} { + r set a{t} "\x01\x02\xff\xff" + r set b{t} "\x01\x02\xff" + r bitop and res1{t} a{t} b{t} + r bitop or res2{t} a{t} b{t} + r bitop xor res3{t} a{t} b{t} + list [r get res1{t}] [r get res2{t}] [r get res3{t}] + } [list "\x01\x02\xff\x00" "\x01\x02\xff\xff" "\x00\x00\x00\xff"] + + foreach op {and or xor} { + test "BITOP $op fuzzing" { + for {set i 0} {$i < 10} {incr i} { + r flushall + set vec {} + set veckeys {} + set numvec [expr {[randomInt 10]+1}] + for {set j 0} {$j < $numvec} {incr j} { + set str [randstring 0 1000] + lappend vec $str + lappend veckeys vector_$j{t} + r set vector_$j{t} $str + } + r bitop $op target{t} {*}$veckeys + assert_equal [r get target{t}] [simulate_bit_op $op {*}$vec] + } + } + } + + test {BITOP NOT fuzzing} { + for {set i 0} {$i < 10} {incr i} { + r flushall + set str [randstring 0 1000] + r set str{t} $str + r bitop not target{t} str{t} + assert_equal [r get target{t}] [simulate_bit_op not $str] + } + } + + test {BITOP with integer encoded source objects} { + r set a{t} 1 + r set b{t} 2 + r bitop xor dest{t} a{t} b{t} a{t} + r get dest{t} + } {2} + + test {BITOP with non string source key} { + r del c{t} + r set a{t} 1 + r set b{t} 2 + r lpush c{t} foo + catch {r bitop xor dest{t} a{t} b{t} c{t} d{t}} e + set e + } {WRONGTYPE*} + + test {BITOP with empty string after non empty string (issue #529)} { + r flushdb + r set a{t} "\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00" + r bitop or x{t} a{t} b{t} + } {32} + + test {BITPOS bit=0 with empty key returns 0} { + r del str + assert {[r bitpos str 0] == 0} + assert {[r bitpos str 0 0 -1 bit] == 0} + } + + test {BITPOS bit=1 with empty key returns -1} { + r del str + assert {[r bitpos str 1] == -1} + assert {[r bitpos str 1 0 -1] == -1} + } + + test {BITPOS bit=0 with string less than 1 word works} { + r set str "\xff\xf0\x00" + assert {[r bitpos str 0] == 12} + assert {[r bitpos str 0 0 -1 bit] == 12} + } + + test {BITPOS bit=1 with string less than 1 word works} { + r set str "\x00\x0f\x00" + assert {[r bitpos str 1] == 12} + assert {[r bitpos str 1 0 -1 bit] == 12} + } + + test {BITPOS bit=0 starting at unaligned address} { + r set str "\xff\xf0\x00" + assert {[r bitpos str 0 1] == 12} + assert {[r bitpos str 0 1 -1 bit] == 12} + } + + test {BITPOS bit=1 starting at unaligned address} { + r set str "\x00\x0f\xff" + assert {[r bitpos str 1 1] == 12} + assert {[r bitpos str 1 1 -1 bit] == 12} + } + + test {BITPOS bit=0 unaligned+full word+reminder} { + r del str + r set str "\xff\xff\xff" ; # Prefix + # Followed by two (or four in 32 bit systems) full words + r append str "\xff\xff\xff\xff\xff\xff\xff\xff" + r append str "\xff\xff\xff\xff\xff\xff\xff\xff" + r append str "\xff\xff\xff\xff\xff\xff\xff\xff" + # First zero bit. + r append str "\x0f" + assert {[r bitpos str 0] == 216} + assert {[r bitpos str 0 1] == 216} + assert {[r bitpos str 0 2] == 216} + assert {[r bitpos str 0 3] == 216} + assert {[r bitpos str 0 4] == 216} + assert {[r bitpos str 0 5] == 216} + assert {[r bitpos str 0 6] == 216} + assert {[r bitpos str 0 7] == 216} + assert {[r bitpos str 0 8] == 216} + + assert {[r bitpos str 0 1 -1 bit] == 216} + assert {[r bitpos str 0 9 -1 bit] == 216} + assert {[r bitpos str 0 17 -1 bit] == 216} + assert {[r bitpos str 0 25 -1 bit] == 216} + assert {[r bitpos str 0 33 -1 bit] == 216} + assert {[r bitpos str 0 41 -1 bit] == 216} + assert {[r bitpos str 0 49 -1 bit] == 216} + assert {[r bitpos str 0 57 -1 bit] == 216} + assert {[r bitpos str 0 65 -1 bit] == 216} + } + + test {BITPOS bit=1 unaligned+full word+reminder} { + r del str + r set str "\x00\x00\x00" ; # Prefix + # Followed by two (or four in 32 bit systems) full words + r append str "\x00\x00\x00\x00\x00\x00\x00\x00" + r append str "\x00\x00\x00\x00\x00\x00\x00\x00" + r append str "\x00\x00\x00\x00\x00\x00\x00\x00" + # First zero bit. + r append str "\xf0" + assert {[r bitpos str 1] == 216} + assert {[r bitpos str 1 1] == 216} + assert {[r bitpos str 1 2] == 216} + assert {[r bitpos str 1 3] == 216} + assert {[r bitpos str 1 4] == 216} + assert {[r bitpos str 1 5] == 216} + assert {[r bitpos str 1 6] == 216} + assert {[r bitpos str 1 7] == 216} + assert {[r bitpos str 1 8] == 216} + + assert {[r bitpos str 1 1 -1 bit] == 216} + assert {[r bitpos str 1 9 -1 bit] == 216} + assert {[r bitpos str 1 17 -1 bit] == 216} + assert {[r bitpos str 1 25 -1 bit] == 216} + assert {[r bitpos str 1 33 -1 bit] == 216} + assert {[r bitpos str 1 41 -1 bit] == 216} + assert {[r bitpos str 1 49 -1 bit] == 216} + assert {[r bitpos str 1 57 -1 bit] == 216} + assert {[r bitpos str 1 65 -1 bit] == 216} + } + + test {BITPOS bit=1 returns -1 if string is all 0 bits} { + r set str "" + for {set j 0} {$j < 20} {incr j} { + assert {[r bitpos str 1] == -1} + assert {[r bitpos str 1 0 -1 bit] == -1} + r append str "\x00" + } + } + + test {BITPOS bit=0 works with intervals} { + r set str "\x00\xff\x00" + assert {[r bitpos str 0 0 -1] == 0} + assert {[r bitpos str 0 1 -1] == 16} + assert {[r bitpos str 0 2 -1] == 16} + assert {[r bitpos str 0 2 200] == 16} + assert {[r bitpos str 0 1 1] == -1} + + assert {[r bitpos str 0 0 -1 bit] == 0} + assert {[r bitpos str 0 8 -1 bit] == 16} + assert {[r bitpos str 0 16 -1 bit] == 16} + assert {[r bitpos str 0 16 200 bit] == 16} + assert {[r bitpos str 0 8 8 bit] == -1} + } + + test {BITPOS bit=1 works with intervals} { + r set str "\x00\xff\x00" + assert {[r bitpos str 1 0 -1] == 8} + assert {[r bitpos str 1 1 -1] == 8} + assert {[r bitpos str 1 2 -1] == -1} + assert {[r bitpos str 1 2 200] == -1} + assert {[r bitpos str 1 1 1] == 8} + + assert {[r bitpos str 1 0 -1 bit] == 8} + assert {[r bitpos str 1 8 -1 bit] == 8} + assert {[r bitpos str 1 16 -1 bit] == -1} + assert {[r bitpos str 1 16 200 bit] == -1} + assert {[r bitpos str 1 8 8 bit] == 8} + } + + test {BITPOS bit=0 changes behavior if end is given} { + r set str "\xff\xff\xff" + assert {[r bitpos str 0] == 24} + assert {[r bitpos str 0 0] == 24} + assert {[r bitpos str 0 0 -1] == -1} + assert {[r bitpos str 0 0 -1 bit] == -1} + } + + test {SETBIT/BITFIELD only increase dirty when the value changed} { + r del foo{t} foo2{t} foo3{t} + set dirty [s rdb_changes_since_last_save] + + # Create a new key, always increase the dirty. + r setbit foo{t} 0 0 + r bitfield foo2{t} set i5 0 0 + set dirty2 [s rdb_changes_since_last_save] + assert {$dirty2 == $dirty + 2} + + # No change. + r setbit foo{t} 0 0 + r bitfield foo2{t} set i5 0 0 + set dirty3 [s rdb_changes_since_last_save] + assert {$dirty3 == $dirty2} + + # Do a change and a no change. + r setbit foo{t} 0 1 + r setbit foo{t} 0 1 + r setbit foo{t} 0 0 + r setbit foo{t} 0 0 + r bitfield foo2{t} set i5 0 1 + r bitfield foo2{t} set i5 0 1 + r bitfield foo2{t} set i5 0 0 + r bitfield foo2{t} set i5 0 0 + set dirty4 [s rdb_changes_since_last_save] + assert {$dirty4 == $dirty3 + 4} + + # BITFIELD INCRBY always increase dirty. + r bitfield foo3{t} incrby i5 0 1 + r bitfield foo3{t} incrby i5 0 1 + set dirty5 [s rdb_changes_since_last_save] + assert {$dirty5 == $dirty4 + 2} + + # Change length only + r setbit foo{t} 90 0 + r bitfield foo2{t} set i5 90 0 + set dirty6 [s rdb_changes_since_last_save] + assert {$dirty6 == $dirty5 + 2} + } + + test {BITPOS bit=1 fuzzy testing using SETBIT} { + r del str + set max 524288; # 64k + set first_one_pos -1 + for {set j 0} {$j < 1000} {incr j} { + assert {[r bitpos str 1] == $first_one_pos} + assert {[r bitpos str 1 0 -1 bit] == $first_one_pos} + set pos [randomInt $max] + r setbit str $pos 1 + if {$first_one_pos == -1 || $first_one_pos > $pos} { + # Update the position of the first 1 bit in the array + # if the bit we set is on the left of the previous one. + set first_one_pos $pos + } + } + } + + test {BITPOS bit=0 fuzzy testing using SETBIT} { + set max 524288; # 64k + set first_zero_pos $max + r set str [string repeat "\xff" [expr $max/8]] + for {set j 0} {$j < 1000} {incr j} { + assert {[r bitpos str 0] == $first_zero_pos} + if {$first_zero_pos == $max} { + assert {[r bitpos str 0 0 -1 bit] == -1} + } else { + assert {[r bitpos str 0 0 -1 bit] == $first_zero_pos} + } + set pos [randomInt $max] + r setbit str $pos 0 + if {$first_zero_pos > $pos} { + # Update the position of the first 0 bit in the array + # if the bit we clear is on the left of the previous one. + set first_zero_pos $pos + } + } + } + + # This test creates a string of 10 bytes. It has two iterations. One clears + # all the bits and sets just one bit and another set all the bits and clears + # just one bit. Each iteration loops from bit offset 0 to 79 and uses SETBIT + # to set the bit to 0 or 1, and then use BITPOS and BITCOUNT on a few mutations. + test {BITPOS/BITCOUNT fuzzy testing using SETBIT} { + # We have two start and end ranges, each range used to select a random + # position, one for start position and one for end position. + proc test_one {start1 end1 start2 end2 pos bit pos_type} { + set start [randomRange $start1 $end1] + set end [randomRange $start2 $end2] + if {$start > $end} { + # Swap start and end + lassign [list $end $start] start end + } + set startbit $start + set endbit $end + # For byte index, we need to generate the real bit index + if {[string equal $pos_type byte]} { + set startbit [expr $start << 3] + set endbit [expr ($end << 3) + 7] + } + # This means whether the test bit index is in the range. + set inrange [expr ($pos >= $startbit && $pos <= $endbit) ? 1: 0] + # For bitcount, there are four different results. + # $inrange == 0 && $bit == 0, all bits in the range are set, so $endbit - $startbit + 1 + # $inrange == 0 && $bit == 1, all bits in the range are clear, so 0 + # $inrange == 1 && $bit == 0, all bits in the range are set but one, so $endbit - $startbit + # $inrange == 1 && $bit == 1, all bits in the range are clear but one, so 1 + set res_count [expr ($endbit - $startbit + 1) * (1 - $bit) + $inrange * [expr $bit ? 1 : -1]] + assert {[r bitpos str $bit $start $end $pos_type] == [expr $inrange ? $pos : -1]} + assert {[r bitcount str $start $end $pos_type] == $res_count} + } + + r del str + set max 80; + r setbit str [expr $max - 1] 0 + set bytes [expr $max >> 3] + # First iteration sets all bits to 1, then set bit to 0 from 0 to max - 1 + # Second iteration sets all bits to 0, then set bit to 1 from 0 to max - 1 + for {set bit 0} {$bit < 2} {incr bit} { + r bitop not str str + for {set j 0} {$j < $max} {incr j} { + r setbit str $j $bit + + # First iteration tests byte index and second iteration tests bit index. + foreach {curr end pos_type} [list [expr $j >> 3] $bytes byte $j $max bit] { + # start==end set to bit position + test_one $curr $curr $curr $curr $j $bit $pos_type + # Both start and end are before bit position + if {$curr > 0} { + test_one 0 $curr 0 $curr $j $bit $pos_type + } + # Both start and end are after bit position + if {$curr < [expr $end - 1]} { + test_one [expr $curr + 1] $end [expr $curr + 1] $end $j $bit $pos_type + } + # start is before and end is after bit position + if {$curr > 0 && $curr < [expr $end - 1]} { + test_one 0 $curr [expr $curr +1] $end $j $bit $pos_type + } + } + + # restore bit + r setbit str $j [expr 1 - $bit] + } + } + } +} + +run_solo {bitops-large-memory} { +start_server {tags {"bitops"}} { + test "BIT pos larger than UINT_MAX" { + set bytes [expr (1 << 29) + 1] + set bitpos [expr (1 << 32)] + set oldval [lindex [r config get proto-max-bulk-len] 1] + r config set proto-max-bulk-len $bytes + r setbit mykey $bitpos 1 + assert_equal $bytes [r strlen mykey] + assert_equal 1 [r getbit mykey $bitpos] + assert_equal [list 128 128 -1] [r bitfield mykey get u8 $bitpos set u8 $bitpos 255 get i8 $bitpos] + assert_equal $bitpos [r bitpos mykey 1] + assert_equal $bitpos [r bitpos mykey 1 [expr $bytes - 1]] + if {$::accurate} { + # set all bits to 1 + set mega [expr (1 << 23)] + set part [string repeat "\xFF" $mega] + for {set i 0} {$i < 64} {incr i} { + r setrange mykey [expr $i * $mega] $part + } + r setrange mykey [expr $bytes - 1] "\xFF" + assert_equal [expr $bitpos + 8] [r bitcount mykey] + assert_equal -1 [r bitpos mykey 0 0 [expr $bytes - 1]] + } + r config set proto-max-bulk-len $oldval + r del mykey + } {1} {large-memory} + + test "SETBIT values larger than UINT32_MAX and lzf_compress/lzf_decompress correctly" { + set bytes [expr (1 << 32) + 1] + set bitpos [expr (1 << 35)] + set oldval [lindex [r config get proto-max-bulk-len] 1] + r config set proto-max-bulk-len $bytes + r setbit mykey $bitpos 1 + assert_equal $bytes [r strlen mykey] + assert_equal 1 [r getbit mykey $bitpos] + r debug reload ;# lzf_compress/lzf_decompress when RDB saving/loading. + assert_equal 1 [r getbit mykey $bitpos] + r config set proto-max-bulk-len $oldval + r del mykey + } {1} {large-memory needs:debug} +} +} ;#run_solo diff --git a/tests/unit/client-eviction.tcl b/tests/unit/client-eviction.tcl new file mode 100644 index 0000000..ca6d902 --- /dev/null +++ b/tests/unit/client-eviction.tcl @@ -0,0 +1,582 @@ +tags {"external:skip"} { + +# Get info about a redis client connection: +# name - name of client we want to query +# f - field name from "CLIENT LIST" we want to get +proc client_field {name f} { + set clients [split [string trim [r client list]] "\r\n"] + set c [lsearch -inline $clients *name=$name*] + if {![regexp $f=(\[a-zA-Z0-9-\]+) $c - res]} { + error "no client named $name found with field $f" + } + return $res +} + +proc client_exists {name} { + if {[catch { client_field $name tot-mem } e]} { + return false + } + return true +} + +proc gen_client {} { + set rr [redis_client] + set name "tst_[randstring 4 4 simplealpha]" + $rr client setname $name + assert {[client_exists $name]} + return [list $rr $name] +} + +# Sum a value across all redis client connections: +# f - the field name from "CLIENT LIST" we want to sum +proc clients_sum {f} { + set sum 0 + set clients [split [string trim [r client list]] "\r\n"] + foreach c $clients { + if {![regexp $f=(\[a-zA-Z0-9-\]+) $c - res]} { + error "field $f not found in $c" + } + incr sum $res + } + return $sum +} + +proc mb {v} { + return [expr $v * 1024 * 1024] +} + +proc kb {v} { + return [expr $v * 1024] +} + +start_server {} { + set maxmemory_clients 3000000 + r config set maxmemory-clients $maxmemory_clients + + test "client evicted due to large argv" { + r flushdb + lassign [gen_client] rr cname + # Attempt a large multi-bulk command under eviction limit + $rr mset k v k2 [string repeat v 1000000] + assert_equal [$rr get k] v + # Attempt another command, now causing client eviction + catch { $rr mset k v k2 [string repeat v $maxmemory_clients] } e + assert {![client_exists $cname]} + $rr close + } + + test "client evicted due to large query buf" { + r flushdb + lassign [gen_client] rr cname + # Attempt to fill the query buff without completing the argument above the limit, causing client eviction + catch { + $rr write [join [list "*1\r\n\$$maxmemory_clients\r\n" [string repeat v $maxmemory_clients]] ""] + $rr flush + $rr read + } e + assert {![client_exists $cname]} + $rr close + } + + test "client evicted due to percentage of maxmemory" { + set maxmemory [mb 6] + r config set maxmemory $maxmemory + # Set client eviction threshold to 7% of maxmemory + set maxmemory_clients_p 7 + r config set maxmemory-clients $maxmemory_clients_p% + r flushdb + + set maxmemory_clients_actual [expr $maxmemory * $maxmemory_clients_p / 100] + + lassign [gen_client] rr cname + # Attempt to fill the query buff with only half the percentage threshold verify we're not disconnected + set n [expr $maxmemory_clients_actual / 2] + $rr write [join [list "*1\r\n\$$n\r\n" [string repeat v $n]] ""] + $rr flush + set tot_mem [client_field $cname tot-mem] + assert {$tot_mem >= $n && $tot_mem < $maxmemory_clients_actual} + + # Attempt to fill the query buff with the percentage threshold of maxmemory and verify we're evicted + $rr close + lassign [gen_client] rr cname + catch { + $rr write [join [list "*1\r\n\$$maxmemory_clients_actual\r\n" [string repeat v $maxmemory_clients_actual]] ""] + $rr flush + } e + assert {![client_exists $cname]} + $rr close + + # Restore settings + r config set maxmemory 0 + r config set maxmemory-clients $maxmemory_clients + } + + test "client evicted due to large multi buf" { + r flushdb + lassign [gen_client] rr cname + + # Attempt a multi-exec where sum of commands is less than maxmemory_clients + $rr multi + $rr set k [string repeat v [expr $maxmemory_clients / 4]] + $rr set k [string repeat v [expr $maxmemory_clients / 4]] + assert_equal [$rr exec] {OK OK} + + # Attempt a multi-exec where sum of commands is more than maxmemory_clients, causing client eviction + $rr multi + catch { + for {set j 0} {$j < 5} {incr j} { + $rr set k [string repeat v [expr $maxmemory_clients / 4]] + } + } e + assert {![client_exists $cname]} + $rr close + } + + test "client evicted due to watched key list" { + r flushdb + set rr [redis_client] + + # Since watched key list is a small overheatd this test uses a minimal maxmemory-clients config + set temp_maxmemory_clients 200000 + r config set maxmemory-clients $temp_maxmemory_clients + + # Append watched keys until list maxes out maxmemory clients and causes client eviction + catch { + for {set j 0} {$j < $temp_maxmemory_clients} {incr j} { + $rr watch $j + } + } e + assert_match {I/O error reading reply} $e + $rr close + + # Restore config for next tests + r config set maxmemory-clients $maxmemory_clients + } + + test "client evicted due to pubsub subscriptions" { + r flushdb + + # Since pubsub subscriptions cause a small overhead this test uses a minimal maxmemory-clients config + set temp_maxmemory_clients 200000 + r config set maxmemory-clients $temp_maxmemory_clients + + # Test eviction due to pubsub patterns + set rr [redis_client] + # Add patterns until list maxes out maxmemory clients and causes client eviction + catch { + for {set j 0} {$j < $temp_maxmemory_clients} {incr j} { + $rr psubscribe $j + } + } e + assert_match {I/O error reading reply} $e + $rr close + + # Test eviction due to pubsub channels + set rr [redis_client] + # Subscribe to global channels until list maxes out maxmemory clients and causes client eviction + catch { + for {set j 0} {$j < $temp_maxmemory_clients} {incr j} { + $rr subscribe $j + } + } e + assert_match {I/O error reading reply} $e + $rr close + + # Test eviction due to sharded pubsub channels + set rr [redis_client] + # Subscribe to sharded pubsub channels until list maxes out maxmemory clients and causes client eviction + catch { + for {set j 0} {$j < $temp_maxmemory_clients} {incr j} { + $rr ssubscribe $j + } + } e + assert_match {I/O error reading reply} $e + $rr close + + # Restore config for next tests + r config set maxmemory-clients $maxmemory_clients + } + + test "client evicted due to tracking redirection" { + r flushdb + set rr [redis_client] + set redirected_c [redis_client] + $redirected_c client setname redirected_client + set redir_id [$redirected_c client id] + $redirected_c SUBSCRIBE __redis__:invalidate + $rr client tracking on redirect $redir_id bcast + # Use a big key name to fill the redirected tracking client's buffer quickly + set key_length [expr 1024*200] + set long_key [string repeat k $key_length] + # Use a script so we won't need to pass the long key name when dirtying it in the loop + set script_sha [$rr script load "redis.call('incr', '$long_key')"] + + # Pause serverCron so it won't update memory usage since we're testing the update logic when + # writing tracking redirection output + r debug pause-cron 1 + + # Read and write to same (long) key until redirected_client's buffers cause it to be evicted + catch { + while true { + set mem [client_field redirected_client tot-mem] + assert {$mem < $maxmemory_clients} + $rr evalsha $script_sha 0 + } + } e + assert_match {no client named redirected_client found*} $e + + r debug pause-cron 0 + $rr close + $redirected_c close + } {0} {needs:debug} + + test "client evicted due to client tracking prefixes" { + r flushdb + set rr [redis_client] + + # Since tracking prefixes list is a small overheatd this test uses a minimal maxmemory-clients config + set temp_maxmemory_clients 200000 + r config set maxmemory-clients $temp_maxmemory_clients + + # Append tracking prefixes until list maxes out maxmemroy clients and causes client eviction + catch { + for {set j 0} {$j < $temp_maxmemory_clients} {incr j} { + $rr client tracking on prefix [format %012s $j] bcast + } + } e + assert_match {I/O error reading reply} $e + $rr close + + # Restore config for next tests + r config set maxmemory-clients $maxmemory_clients + } + + test "client evicted due to output buf" { + r flushdb + r setrange k 200000 v + set rr [redis_deferring_client] + $rr client setname test_client + $rr flush + assert {[$rr read] == "OK"} + # Attempt a large response under eviction limit + $rr get k + $rr flush + assert {[string length [$rr read]] == 200001} + set mem [client_field test_client tot-mem] + assert {$mem < $maxmemory_clients} + + # Fill output buff in loop without reading it and make sure + # we're eventually disconnected, but before reaching maxmemory_clients + while true { + if { [catch { + set mem [client_field test_client tot-mem] + assert {$mem < $maxmemory_clients} + $rr get k + $rr flush + } e]} { + assert {![client_exists test_client]} + break + } + } + $rr close + } + + foreach {no_evict} {on off} { + test "client no-evict $no_evict" { + r flushdb + r client setname control + r client no-evict on ;# Avoid evicting the main connection + lassign [gen_client] rr cname + $rr client no-evict $no_evict + + # Overflow maxmemory-clients + set qbsize [expr {$maxmemory_clients + 1}] + if {[catch { + $rr write [join [list "*1\r\n\$$qbsize\r\n" [string repeat v $qbsize]] ""] + $rr flush + wait_for_condition 200 10 { + [client_field $cname qbuf] == $qbsize + } else { + fail "Failed to fill qbuf for test" + } + } e] && $no_evict == off} { + assert {![client_exists $cname]} + } elseif {$no_evict == on} { + assert {[client_field $cname tot-mem] > $maxmemory_clients} + } + $rr close + } + } +} + +start_server {} { + set server_pid [s process_id] + set maxmemory_clients [mb 10] + set obuf_limit [mb 3] + r config set maxmemory-clients $maxmemory_clients + r config set client-output-buffer-limit "normal $obuf_limit 0 0" + + test "avoid client eviction when client is freed by output buffer limit" { + r flushdb + set obuf_size [expr {$obuf_limit + [mb 1]}] + r setrange k $obuf_size v + set rr1 [redis_client] + $rr1 client setname "qbuf-client" + set rr2 [redis_deferring_client] + $rr2 client setname "obuf-client1" + assert_equal [$rr2 read] OK + set rr3 [redis_deferring_client] + $rr3 client setname "obuf-client2" + assert_equal [$rr3 read] OK + + # Occupy client's query buff with less than output buffer limit left to exceed maxmemory-clients + set qbsize [expr {$maxmemory_clients - $obuf_size}] + $rr1 write [join [list "*1\r\n\$$qbsize\r\n" [string repeat v $qbsize]] ""] + $rr1 flush + # Wait for qbuff to be as expected + wait_for_condition 200 10 { + [client_field qbuf-client qbuf] == $qbsize + } else { + fail "Failed to fill qbuf for test" + } + + # Make the other two obuf-clients pass obuf limit and also pass maxmemory-clients + # We use two obuf-clients to make sure that even if client eviction is attempted + # between two command processing (with no sleep) we don't perform any client eviction + # because the obuf limit is enforced with precedence. + exec kill -SIGSTOP $server_pid + $rr2 get k + $rr2 flush + $rr3 get k + $rr3 flush + exec kill -SIGCONT $server_pid + + # Validate obuf-clients were disconnected (because of obuf limit) + catch {client_field obuf-client1 name} e + assert_match {no client named obuf-client1 found*} $e + catch {client_field obuf-client2 name} e + assert_match {no client named obuf-client2 found*} $e + + # Validate qbuf-client is still connected and wasn't evicted + assert_equal [client_field qbuf-client name] {qbuf-client} + + $rr1 close + $rr2 close + $rr3 close + } +} + +start_server {} { + test "decrease maxmemory-clients causes client eviction" { + set maxmemory_clients [mb 4] + set client_count 10 + set qbsize [expr ($maxmemory_clients - [mb 1]) / $client_count] + r config set maxmemory-clients $maxmemory_clients + + + # Make multiple clients consume together roughly 1mb less than maxmemory_clients + set rrs {} + for {set j 0} {$j < $client_count} {incr j} { + set rr [redis_client] + lappend rrs $rr + $rr client setname client$j + $rr write [join [list "*2\r\n\$$qbsize\r\n" [string repeat v $qbsize]] ""] + $rr flush + wait_for_condition 200 10 { + [client_field client$j qbuf] >= $qbsize + } else { + fail "Failed to fill qbuf for test" + } + } + + # Make sure all clients are still connected + set connected_clients [llength [lsearch -all [split [string trim [r client list]] "\r\n"] *name=client*]] + assert {$connected_clients == $client_count} + + # Decrease maxmemory_clients and expect client eviction + r config set maxmemory-clients [expr $maxmemory_clients / 2] + set connected_clients [llength [lsearch -all [split [string trim [r client list]] "\r\n"] *name=client*]] + assert {$connected_clients > 0 && $connected_clients < $client_count} + + foreach rr $rrs {$rr close} + } +} + +start_server {} { + test "evict clients only until below limit" { + set client_count 10 + set client_mem [mb 1] + r debug replybuffer resizing 0 + r config set maxmemory-clients 0 + r client setname control + r client no-evict on + + # Make multiple clients consume together roughly 1mb less than maxmemory_clients + set total_client_mem 0 + set max_client_mem 0 + set rrs {} + for {set j 0} {$j < $client_count} {incr j} { + set rr [redis_client] + lappend rrs $rr + $rr client setname client$j + $rr write [join [list "*2\r\n\$$client_mem\r\n" [string repeat v $client_mem]] ""] + $rr flush + wait_for_condition 200 10 { + [client_field client$j tot-mem] >= $client_mem + } else { + fail "Failed to fill qbuf for test" + } + # In theory all these clients should use the same amount of memory (~1mb). But in practice + # some allocators (libc) can return different allocation sizes for the same malloc argument causing + # some clients to use slightly more memory than others. We find the largest client and make sure + # all clients are roughly the same size (+-1%). Then we can safely set the client eviction limit and + # expect consistent results in the test. + set cmem [client_field client$j tot-mem] + if {$max_client_mem > 0} { + set size_ratio [expr $max_client_mem.0/$cmem.0] + assert_range $size_ratio 0.99 1.01 + } + if {$cmem > $max_client_mem} { + set max_client_mem $cmem + } + } + + # Make sure all clients are still connected + set connected_clients [llength [lsearch -all [split [string trim [r client list]] "\r\n"] *name=client*]] + assert {$connected_clients == $client_count} + + # Set maxmemory-clients to accommodate half our clients (taking into account the control client) + set maxmemory_clients [expr ($max_client_mem * $client_count) / 2 + [client_field control tot-mem]] + r config set maxmemory-clients $maxmemory_clients + + # Make sure total used memory is below maxmemory_clients + set total_client_mem [clients_sum tot-mem] + assert {$total_client_mem <= $maxmemory_clients} + + # Make sure we have only half of our clients now + set connected_clients [llength [lsearch -all [split [string trim [r client list]] "\r\n"] *name=client*]] + assert {$connected_clients == [expr $client_count / 2]} + + # Restore the reply buffer resize to default + r debug replybuffer resizing 1 + + foreach rr $rrs {$rr close} + } {} {needs:debug} +} + +start_server {} { + test "evict clients in right order (large to small)" { + # Note that each size step needs to be at least x2 larger than previous step + # because of how the client-eviction size bucketing works + set sizes [list [kb 128] [mb 1] [mb 3]] + set clients_per_size 3 + r client setname control + r client no-evict on + r config set maxmemory-clients 0 + r debug replybuffer resizing 0 + + # Run over all sizes and create some clients using up that size + set total_client_mem 0 + set rrs {} + for {set i 0} {$i < [llength $sizes]} {incr i} { + set size [lindex $sizes $i] + + for {set j 0} {$j < $clients_per_size} {incr j} { + set rr [redis_client] + lappend rrs $rr + $rr client setname client-$i + $rr write [join [list "*2\r\n\$$size\r\n" [string repeat v $size]] ""] + $rr flush + } + set client_mem [client_field client-$i tot-mem] + + # Update our size list based on actual used up size (this is usually + # slightly more than expected because of allocator bins + assert {$client_mem >= $size} + set sizes [lreplace $sizes $i $i $client_mem] + + # Account total client memory usage + incr total_mem [expr $clients_per_size * $client_mem] + } + + # Make sure all clients are connected + set clients [split [string trim [r client list]] "\r\n"] + for {set i 0} {$i < [llength $sizes]} {incr i} { + assert_equal [llength [lsearch -all $clients "*name=client-$i *"]] $clients_per_size + } + + # For each size reduce maxmemory-clients so relevant clients should be evicted + # do this from largest to smallest + foreach size [lreverse $sizes] { + set control_mem [client_field control tot-mem] + set total_mem [expr $total_mem - $clients_per_size * $size] + r config set maxmemory-clients [expr $total_mem + $control_mem] + set clients [split [string trim [r client list]] "\r\n"] + # Verify only relevant clients were evicted + for {set i 0} {$i < [llength $sizes]} {incr i} { + set verify_size [lindex $sizes $i] + set count [llength [lsearch -all $clients "*name=client-$i *"]] + if {$verify_size < $size} { + assert_equal $count $clients_per_size + } else { + assert_equal $count 0 + } + } + } + + # Restore the reply buffer resize to default + r debug replybuffer resizing 1 + + foreach rr $rrs {$rr close} + } {} {needs:debug} +} + +start_server {} { + foreach type {"client no-evict" "maxmemory-clients disabled"} { + r flushall + r client no-evict on + r config set maxmemory-clients 0 + + test "client total memory grows during $type" { + r setrange k [mb 1] v + set rr [redis_client] + $rr client setname test_client + if {$type eq "client no-evict"} { + $rr client no-evict on + r config set maxmemory-clients 1 + } + $rr deferred 1 + + # Fill output buffer in loop without reading it and make sure + # the tot-mem of client has increased (OS buffers didn't swallow it) + # and eviction not occurring. + while {true} { + $rr get k + $rr flush + after 10 + if {[client_field test_client tot-mem] > [mb 10]} { + break + } + } + + # Trigger the client eviction, by flipping the no-evict flag to off + if {$type eq "client no-evict"} { + $rr client no-evict off + } else { + r config set maxmemory-clients 1 + } + + # wait for the client to be disconnected + wait_for_condition 5000 50 { + ![client_exists test_client] + } else { + puts [r client list] + fail "client was not disconnected" + } + $rr close + } + } +} + +} ;# tags + diff --git a/tests/unit/cluster-scripting.tcl b/tests/unit/cluster-scripting.tcl new file mode 100644 index 0000000..72fc028 --- /dev/null +++ b/tests/unit/cluster-scripting.tcl @@ -0,0 +1,64 @@ +# make sure the test infra won't use SELECT +set old_singledb $::singledb +set ::singledb 1 + +start_server {overrides {cluster-enabled yes} tags {external:skip cluster}} { + r 0 cluster addslotsrange 0 16383 + wait_for_condition 50 100 { + [csi 0 cluster_state] eq "ok" + } else { + fail "Cluster never became 'ok'" + } + + test {Eval scripts with shebangs and functions default to no cross slots} { + # Test that scripts with shebang block cross slot operations + assert_error "ERR Script attempted to access keys that do not hash to the same slot*" { + r 0 eval {#!lua + redis.call('set', 'foo', 'bar') + redis.call('set', 'bar', 'foo') + return 'OK' + } 0} + + # Test the functions by default block cross slot operations + r 0 function load REPLACE {#!lua name=crossslot + local function test_cross_slot(keys, args) + redis.call('set', 'foo', 'bar') + redis.call('set', 'bar', 'foo') + return 'OK' + end + + redis.register_function('test_cross_slot', test_cross_slot)} + assert_error "ERR Script attempted to access keys that do not hash to the same slot*" {r FCALL test_cross_slot 0} + } + + test {Cross slot commands are allowed by default for eval scripts and with allow-cross-slot-keys flag} { + # Old style lua scripts are allowed to access cross slot operations + r 0 eval "redis.call('set', 'foo', 'bar'); redis.call('set', 'bar', 'foo')" 0 + + # scripts with allow-cross-slot-keys flag are allowed + r 0 eval {#!lua flags=allow-cross-slot-keys + redis.call('set', 'foo', 'bar'); redis.call('set', 'bar', 'foo') + } 0 + + # Functions with allow-cross-slot-keys flag are allowed + r 0 function load REPLACE {#!lua name=crossslot + local function test_cross_slot(keys, args) + redis.call('set', 'foo', 'bar') + redis.call('set', 'bar', 'foo') + return 'OK' + end + + redis.register_function{function_name='test_cross_slot', callback=test_cross_slot, flags={ 'allow-cross-slot-keys' }}} + r FCALL test_cross_slot 0 + } + + test {Cross slot commands are also blocked if they disagree with pre-declared keys} { + assert_error "ERR Script attempted to access keys that do not hash to the same slot*" { + r 0 eval {#!lua + redis.call('set', 'foo', 'bar') + return 'OK' + } 1 bar} + } +} + +set ::singledb $old_singledb diff --git a/tests/unit/cluster.tcl b/tests/unit/cluster.tcl new file mode 100644 index 0000000..05df220 --- /dev/null +++ b/tests/unit/cluster.tcl @@ -0,0 +1,413 @@ +# Primitive tests on cluster-enabled redis using redis-cli + +source tests/support/cli.tcl + +proc cluster_info {r field} { + set _ [getInfoProperty [$r cluster info] $field] +} + +# Provide easy access to CLUSTER INFO properties. Same semantic as "proc s". +proc csi {args} { + set level 0 + if {[string is integer [lindex $args 0]]} { + set level [lindex $args 0] + set args [lrange $args 1 end] + } + cluster_info [srv $level "client"] [lindex $args 0] +} + +# make sure the test infra won't use SELECT +set old_singledb $::singledb +set ::singledb 1 + +# cluster creation is complicated with TLS, and the current tests don't really need that coverage +tags {tls:skip external:skip cluster} { + +# start three servers +set base_conf [list cluster-enabled yes cluster-node-timeout 1000] +start_multiple_servers 3 [list overrides $base_conf] { + + set node1 [srv 0 client] + set node2 [srv -1 client] + set node3 [srv -2 client] + set node3_pid [srv -2 pid] + set node3_rd [redis_deferring_client -2] + + test {Create 3 node cluster} { + exec src/redis-cli --cluster-yes --cluster create \ + 127.0.0.1:[srv 0 port] \ + 127.0.0.1:[srv -1 port] \ + 127.0.0.1:[srv -2 port] + + wait_for_condition 1000 50 { + [csi 0 cluster_state] eq {ok} && + [csi -1 cluster_state] eq {ok} && + [csi -2 cluster_state] eq {ok} + } else { + fail "Cluster doesn't stabilize" + } + } + + test "Run blocking command on cluster node3" { + # key9184688 is mapped to slot 10923 (first slot of node 3) + $node3_rd brpop key9184688 0 + $node3_rd flush + + wait_for_condition 50 100 { + [s -2 blocked_clients] eq {1} + } else { + fail "Client not blocked" + } + } + + test "Perform a Resharding" { + exec src/redis-cli --cluster-yes --cluster reshard 127.0.0.1:[srv -2 port] \ + --cluster-to [$node1 cluster myid] \ + --cluster-from [$node3 cluster myid] \ + --cluster-slots 1 + } + + test "Verify command got unblocked after resharding" { + # this (read) will wait for the node3 to realize the new topology + assert_error {*MOVED*} {$node3_rd read} + + # verify there are no blocked clients + assert_equal [s 0 blocked_clients] {0} + assert_equal [s -1 blocked_clients] {0} + assert_equal [s -2 blocked_clients] {0} + } + + test "Wait for cluster to be stable" { + # Cluster check just verifies the the config state is self-consistent, + # waiting for cluster_state to be okay is an independent check that all the + # nodes actually believe each other are healthy, prevent cluster down error. + wait_for_condition 1000 50 { + [catch {exec src/redis-cli --cluster check 127.0.0.1:[srv 0 port]}] == 0 && + [catch {exec src/redis-cli --cluster check 127.0.0.1:[srv -1 port]}] == 0 && + [catch {exec src/redis-cli --cluster check 127.0.0.1:[srv -2 port]}] == 0 && + [CI 0 cluster_state] eq {ok} && + [CI 1 cluster_state] eq {ok} && + [CI 2 cluster_state] eq {ok} + } else { + fail "Cluster doesn't stabilize" + } + } + + set node1_rd [redis_deferring_client 0] + + test "Sanity test push cmd after resharding" { + assert_error {*MOVED*} {$node3 lpush key9184688 v1} + + $node1_rd brpop key9184688 0 + $node1_rd flush + + wait_for_condition 50 100 { + [s 0 blocked_clients] eq {1} + } else { + puts "Client not blocked" + puts "read from blocked client: [$node1_rd read]" + fail "Client not blocked" + } + + $node1 lpush key9184688 v2 + assert_equal {key9184688 v2} [$node1_rd read] + } + + $node3_rd close + + test "Run blocking command again on cluster node1" { + $node1 del key9184688 + # key9184688 is mapped to slot 10923 which has been moved to node1 + $node1_rd brpop key9184688 0 + $node1_rd flush + + wait_for_condition 50 100 { + [s 0 blocked_clients] eq {1} + } else { + fail "Client not blocked" + } + } + + test "Kill a cluster node and wait for fail state" { + # kill node3 in cluster + exec kill -SIGSTOP $node3_pid + + wait_for_condition 1000 50 { + [csi 0 cluster_state] eq {fail} && + [csi -1 cluster_state] eq {fail} + } else { + fail "Cluster doesn't fail" + } + } + + test "Verify command got unblocked after cluster failure" { + assert_error {*CLUSTERDOWN*} {$node1_rd read} + + # verify there are no blocked clients + assert_equal [s 0 blocked_clients] {0} + assert_equal [s -1 blocked_clients] {0} + } + + exec kill -SIGCONT $node3_pid + $node1_rd close + +} ;# stop servers + +# Test redis-cli -- cluster create, add-node, call. +# Test that functions are propagated on add-node +start_multiple_servers 5 [list overrides $base_conf] { + + set node4_rd [redis_client -3] + set node5_rd [redis_client -4] + + test {Functions are added to new node on redis-cli cluster add-node} { + exec src/redis-cli --cluster-yes --cluster create \ + 127.0.0.1:[srv 0 port] \ + 127.0.0.1:[srv -1 port] \ + 127.0.0.1:[srv -2 port] + + + wait_for_condition 1000 50 { + [csi 0 cluster_state] eq {ok} && + [csi -1 cluster_state] eq {ok} && + [csi -2 cluster_state] eq {ok} + } else { + fail "Cluster doesn't stabilize" + } + + # upload a function to all the cluster + exec src/redis-cli --cluster-yes --cluster call 127.0.0.1:[srv 0 port] \ + FUNCTION LOAD {#!lua name=TEST + redis.register_function('test', function() return 'hello' end) + } + + # adding node to the cluster + exec src/redis-cli --cluster-yes --cluster add-node \ + 127.0.0.1:[srv -3 port] \ + 127.0.0.1:[srv 0 port] + + wait_for_cluster_size 4 + + wait_for_condition 1000 50 { + [csi 0 cluster_state] eq {ok} && + [csi -1 cluster_state] eq {ok} && + [csi -2 cluster_state] eq {ok} && + [csi -3 cluster_state] eq {ok} + } else { + fail "Cluster doesn't stabilize" + } + + # make sure 'test' function was added to the new node + assert_equal {{library_name TEST engine LUA functions {{name test description {} flags {}}}}} [$node4_rd FUNCTION LIST] + + # add function to node 5 + assert_equal {TEST} [$node5_rd FUNCTION LOAD {#!lua name=TEST + redis.register_function('test', function() return 'hello' end) + }] + + # make sure functions was added to node 5 + assert_equal {{library_name TEST engine LUA functions {{name test description {} flags {}}}}} [$node5_rd FUNCTION LIST] + + # adding node 5 to the cluster should failed because it already contains the 'test' function + catch { + exec src/redis-cli --cluster-yes --cluster add-node \ + 127.0.0.1:[srv -4 port] \ + 127.0.0.1:[srv 0 port] + } e + assert_match {*node already contains functions*} $e + } +} ;# stop servers + +# Test redis-cli --cluster create, add-node. +# Test that one slot can be migrated to and then away from the new node. +test {Migrate the last slot away from a node using redis-cli} { + start_multiple_servers 4 [list overrides $base_conf] { + + # Create a cluster of 3 nodes + exec src/redis-cli --cluster-yes --cluster create \ + 127.0.0.1:[srv 0 port] \ + 127.0.0.1:[srv -1 port] \ + 127.0.0.1:[srv -2 port] + + wait_for_condition 1000 50 { + [csi 0 cluster_state] eq {ok} && + [csi -1 cluster_state] eq {ok} && + [csi -2 cluster_state] eq {ok} + } else { + fail "Cluster doesn't stabilize" + } + + # Insert some data + assert_equal OK [exec src/redis-cli -c -p [srv 0 port] SET foo bar] + set slot [exec src/redis-cli -c -p [srv 0 port] CLUSTER KEYSLOT foo] + + # Add new node to the cluster + exec src/redis-cli --cluster-yes --cluster add-node \ + 127.0.0.1:[srv -3 port] \ + 127.0.0.1:[srv 0 port] + + # First we wait for new node to be recognized by entire cluster + wait_for_cluster_size 4 + + wait_for_condition 1000 50 { + [csi 0 cluster_state] eq {ok} && + [csi -1 cluster_state] eq {ok} && + [csi -2 cluster_state] eq {ok} && + [csi -3 cluster_state] eq {ok} + } else { + fail "Cluster doesn't stabilize" + } + + set newnode_r [redis_client -3] + set newnode_id [$newnode_r CLUSTER MYID] + + # Find out which node has the key "foo" by asking the new node for a + # redirect. + catch { $newnode_r get foo } e + assert_match "MOVED $slot *" $e + lassign [split [lindex $e 2] :] owner_host owner_port + set owner_r [redis $owner_host $owner_port 0 $::tls] + set owner_id [$owner_r CLUSTER MYID] + + # Move slot to new node using plain Redis commands + assert_equal OK [$newnode_r CLUSTER SETSLOT $slot IMPORTING $owner_id] + assert_equal OK [$owner_r CLUSTER SETSLOT $slot MIGRATING $newnode_id] + assert_equal {foo} [$owner_r CLUSTER GETKEYSINSLOT $slot 10] + assert_equal OK [$owner_r MIGRATE 127.0.0.1 [srv -3 port] "" 0 5000 KEYS foo] + assert_equal OK [$newnode_r CLUSTER SETSLOT $slot NODE $newnode_id] + assert_equal OK [$owner_r CLUSTER SETSLOT $slot NODE $newnode_id] + + # Using --cluster check make sure we won't get `Not all slots are covered by nodes`. + # Wait for the cluster to become stable make sure the cluster is up during MIGRATE. + wait_for_condition 1000 50 { + [catch {exec src/redis-cli --cluster check 127.0.0.1:[srv 0 port]}] == 0 && + [catch {exec src/redis-cli --cluster check 127.0.0.1:[srv -1 port]}] == 0 && + [catch {exec src/redis-cli --cluster check 127.0.0.1:[srv -2 port]}] == 0 && + [catch {exec src/redis-cli --cluster check 127.0.0.1:[srv -3 port]}] == 0 && + [csi 0 cluster_state] eq {ok} && + [csi -1 cluster_state] eq {ok} && + [csi -2 cluster_state] eq {ok} && + [csi -3 cluster_state] eq {ok} + } else { + fail "Cluster doesn't stabilize" + } + + # Move the only slot back to original node using redis-cli + exec src/redis-cli --cluster reshard 127.0.0.1:[srv -3 port] \ + --cluster-from $newnode_id \ + --cluster-to $owner_id \ + --cluster-slots 1 \ + --cluster-yes + + # The empty node will become a replica of the new owner before the + # `MOVED` check, so let's wait for the cluster to become stable. + wait_for_condition 1000 50 { + [csi 0 cluster_state] eq {ok} && + [csi -1 cluster_state] eq {ok} && + [csi -2 cluster_state] eq {ok} && + [csi -3 cluster_state] eq {ok} + } else { + fail "Cluster doesn't stabilize" + } + + # Check that the key foo has been migrated back to the original owner. + catch { $newnode_r get foo } e + assert_equal "MOVED $slot $owner_host:$owner_port" $e + + # Check that the empty node has turned itself into a replica of the new + # owner and that the new owner knows that. + wait_for_condition 1000 50 { + [string match "*slave*" [$owner_r CLUSTER REPLICAS $owner_id]] + } else { + fail "Empty node didn't turn itself into a replica." + } + } +} + +# Test redis-cli --cluster create, add-node with cluster-port. +# Create five nodes, three with custom cluster_port and two with default values. +start_server [list overrides [list cluster-enabled yes cluster-node-timeout 1 cluster-port [find_available_port $::baseport $::portcount]]] { +start_server [list overrides [list cluster-enabled yes cluster-node-timeout 1]] { +start_server [list overrides [list cluster-enabled yes cluster-node-timeout 1 cluster-port [find_available_port $::baseport $::portcount]]] { +start_server [list overrides [list cluster-enabled yes cluster-node-timeout 1]] { +start_server [list overrides [list cluster-enabled yes cluster-node-timeout 1 cluster-port [find_available_port $::baseport $::portcount]]] { + + # The first three are used to test --cluster create. + # The last two are used to test --cluster add-node + set node1_rd [redis_client 0] + set node2_rd [redis_client -1] + set node3_rd [redis_client -2] + set node4_rd [redis_client -3] + set node5_rd [redis_client -4] + + test {redis-cli --cluster create with cluster-port} { + exec src/redis-cli --cluster-yes --cluster create \ + 127.0.0.1:[srv 0 port] \ + 127.0.0.1:[srv -1 port] \ + 127.0.0.1:[srv -2 port] + + wait_for_condition 1000 50 { + [csi 0 cluster_state] eq {ok} && + [csi -1 cluster_state] eq {ok} && + [csi -2 cluster_state] eq {ok} + } else { + fail "Cluster doesn't stabilize" + } + + # Make sure each node can meet other nodes + assert_equal 3 [csi 0 cluster_known_nodes] + assert_equal 3 [csi -1 cluster_known_nodes] + assert_equal 3 [csi -2 cluster_known_nodes] + } + + test {redis-cli --cluster add-node with cluster-port} { + # Adding node to the cluster (without cluster-port) + exec src/redis-cli --cluster-yes --cluster add-node \ + 127.0.0.1:[srv -3 port] \ + 127.0.0.1:[srv 0 port] + + wait_for_cluster_size 4 + + wait_for_condition 1000 50 { + [csi 0 cluster_state] eq {ok} && + [csi -1 cluster_state] eq {ok} && + [csi -2 cluster_state] eq {ok} && + [csi -3 cluster_state] eq {ok} + } else { + fail "Cluster doesn't stabilize" + } + + # Adding node to the cluster (with cluster-port) + exec src/redis-cli --cluster-yes --cluster add-node \ + 127.0.0.1:[srv -4 port] \ + 127.0.0.1:[srv 0 port] + + wait_for_cluster_size 5 + + wait_for_condition 1000 50 { + [csi 0 cluster_state] eq {ok} && + [csi -1 cluster_state] eq {ok} && + [csi -2 cluster_state] eq {ok} && + [csi -3 cluster_state] eq {ok} && + [csi -4 cluster_state] eq {ok} + } else { + fail "Cluster doesn't stabilize" + } + + # Make sure each node can meet other nodes + assert_equal 5 [csi 0 cluster_known_nodes] + assert_equal 5 [csi -1 cluster_known_nodes] + assert_equal 5 [csi -2 cluster_known_nodes] + assert_equal 5 [csi -3 cluster_known_nodes] + assert_equal 5 [csi -4 cluster_known_nodes] + } +# stop 5 servers +} +} +} +} +} + +} ;# tags + +set ::singledb $old_singledb diff --git a/tests/unit/cluster/announced-endpoints.tcl b/tests/unit/cluster/announced-endpoints.tcl new file mode 100644 index 0000000..941a8e0 --- /dev/null +++ b/tests/unit/cluster/announced-endpoints.tcl @@ -0,0 +1,42 @@ +start_cluster 2 2 {tags {external:skip cluster}} { + + test "Test change cluster-announce-port and cluster-announce-tls-port at runtime" { + set baseport [lindex [R 0 config get port] 1] + set count [expr [llength $::servers] +1 ] + set used_port [find_available_port $baseport $count] + + R 0 config set cluster-announce-tls-port $used_port + R 0 config set cluster-announce-port $used_port + + assert_match "*:$used_port@*" [R 0 CLUSTER NODES] + wait_for_condition 50 100 { + [string match "*:$used_port@*" [R 1 CLUSTER NODES]] + } else { + fail "Cluster announced port was not propagated via gossip" + } + + R 0 config set cluster-announce-tls-port 0 + R 0 config set cluster-announce-port 0 + assert_match "*:$baseport@*" [R 0 CLUSTER NODES] + } + + test "Test change cluster-announce-bus-port at runtime" { + set baseport [lindex [R 0 config get port] 1] + set count [expr [llength $::servers] +1 ] + set used_port [find_available_port $baseport $count] + + # Verify config set cluster-announce-bus-port + R 0 config set cluster-announce-bus-port $used_port + assert_match "*@$used_port *" [R 0 CLUSTER NODES] + wait_for_condition 50 100 { + [string match "*@$used_port *" [R 1 CLUSTER NODES]] + } else { + fail "Cluster announced port was not propagated via gossip" + } + + # Verify restore default cluster-announce-port + set base_bus_port [expr $baseport + 10000] + R 0 config set cluster-announce-bus-port 0 + assert_match "*@$base_bus_port *" [R 0 CLUSTER NODES] + } +} diff --git a/tests/unit/cluster/links.tcl b/tests/unit/cluster/links.tcl new file mode 100644 index 0000000..0d17b91 --- /dev/null +++ b/tests/unit/cluster/links.tcl @@ -0,0 +1,70 @@ + +proc number_of_peers {id} { + expr [llength $::servers] - 1 +} + +proc number_of_links {id} { + llength [R $id cluster links] +} + +proc publish_messages {server num_msgs msg_size} { + for {set i 0} {$i < $num_msgs} {incr i} { + $server PUBLISH channel [string repeat "x" $msg_size] + } +} + +start_cluster 1 2 {tags {external:skip cluster}} { + set primary_id 0 + set replica1_id 1 + + set primary [Rn $primary_id] + set replica1 [Rn $replica1_id] + + test "Broadcast message across a cluster shard while a cluster link is down" { + set replica1_node_id [$replica1 CLUSTER MYID] + + set channelname ch3 + + # subscribe on replica1 + set subscribeclient1 [redis_deferring_client -1] + $subscribeclient1 deferred 1 + $subscribeclient1 SSUBSCRIBE $channelname + $subscribeclient1 read + + # subscribe on replica2 + set subscribeclient2 [redis_deferring_client -2] + $subscribeclient2 deferred 1 + $subscribeclient2 SSUBSCRIBE $channelname + $subscribeclient2 read + + # Verify number of links with cluster stable state + assert_equal [expr [number_of_peers $primary_id]*2] [number_of_links $primary_id] + + # Disconnect the cluster between primary and replica1 and publish a message. + $primary MULTI + $primary DEBUG CLUSTERLINK KILL TO $replica1_node_id + $primary SPUBLISH $channelname hello + set res [$primary EXEC] + + # Verify no client exists on the primary to receive the published message. + assert_equal $res {OK 0} + + # Wait for all the cluster links are healthy + wait_for_condition 50 100 { + [number_of_peers $primary_id]*2 == [number_of_links $primary_id] + } else { + fail "All peer links couldn't be established" + } + + # Publish a message afterwards. + $primary SPUBLISH $channelname world + + # Verify replica1 has received only (world) / hello is lost. + assert_equal "smessage ch3 world" [$subscribeclient1 read] + + # Verify replica2 has received both messages (hello/world) + assert_equal "smessage ch3 hello" [$subscribeclient2 read] + assert_equal "smessage ch3 world" [$subscribeclient2 read] + } {} {needs:debug} +} + diff --git a/tests/unit/cluster/misc.tcl b/tests/unit/cluster/misc.tcl new file mode 100644 index 0000000..35308b8 --- /dev/null +++ b/tests/unit/cluster/misc.tcl @@ -0,0 +1,16 @@ +start_cluster 2 2 {tags {external:skip cluster}} { + test {Key lazy expires during key migration} { + R 0 DEBUG SET-ACTIVE-EXPIRE 0 + + set key_slot [R 0 CLUSTER KEYSLOT FOO] + R 0 set FOO BAR PX 10 + set src_id [R 0 CLUSTER MYID] + set trg_id [R 1 CLUSTER MYID] + R 0 CLUSTER SETSLOT $key_slot MIGRATING $trg_id + R 1 CLUSTER SETSLOT $key_slot IMPORTING $src_id + after 11 + assert_error {ASK*} {R 0 GET FOO} + R 0 ping + } {PONG} +} + diff --git a/tests/unit/dump.tcl b/tests/unit/dump.tcl new file mode 100644 index 0000000..2e940bd --- /dev/null +++ b/tests/unit/dump.tcl @@ -0,0 +1,382 @@ +start_server {tags {"dump"}} { + test {DUMP / RESTORE are able to serialize / unserialize a simple key} { + r set foo bar + set encoded [r dump foo] + r del foo + list [r exists foo] [r restore foo 0 $encoded] [r ttl foo] [r get foo] + } {0 OK -1 bar} + + test {RESTORE can set an arbitrary expire to the materialized key} { + r set foo bar + set encoded [r dump foo] + r del foo + r restore foo 5000 $encoded + set ttl [r pttl foo] + assert_range $ttl 3000 5000 + r get foo + } {bar} + + test {RESTORE can set an expire that overflows a 32 bit integer} { + r set foo bar + set encoded [r dump foo] + r del foo + r restore foo 2569591501 $encoded + set ttl [r pttl foo] + assert_range $ttl (2569591501-3000) 2569591501 + r get foo + } {bar} + + test {RESTORE can set an absolute expire} { + r set foo bar + set encoded [r dump foo] + r del foo + set now [clock milliseconds] + r restore foo [expr $now+3000] $encoded absttl + set ttl [r pttl foo] + assert_range $ttl 2000 3100 + r get foo + } {bar} + + test {RESTORE with ABSTTL in the past} { + r set foo bar + set encoded [r dump foo] + set now [clock milliseconds] + r debug set-active-expire 0 + r restore foo [expr $now-3000] $encoded absttl REPLACE + catch {r debug object foo} e + r debug set-active-expire 1 + set e + } {ERR no such key} {needs:debug} + + test {RESTORE can set LRU} { + r set foo bar + set encoded [r dump foo] + r del foo + r config set maxmemory-policy allkeys-lru + r restore foo 0 $encoded idletime 1000 + set idle [r object idletime foo] + assert {$idle >= 1000 && $idle <= 1010} + assert_equal [r get foo] {bar} + r config set maxmemory-policy noeviction + } {OK} {needs:config-maxmemory} + + test {RESTORE can set LFU} { + r set foo bar + set encoded [r dump foo] + r del foo + r config set maxmemory-policy allkeys-lfu + r restore foo 0 $encoded freq 100 + set freq [r object freq foo] + assert {$freq == 100} + r get foo + assert_equal [r get foo] {bar} + r config set maxmemory-policy noeviction + } {OK} {needs:config-maxmemory} + + test {RESTORE returns an error of the key already exists} { + r set foo bar + set e {} + catch {r restore foo 0 "..."} e + set e + } {*BUSYKEY*} + + test {RESTORE can overwrite an existing key with REPLACE} { + r set foo bar1 + set encoded1 [r dump foo] + r set foo bar2 + set encoded2 [r dump foo] + r del foo + r restore foo 0 $encoded1 + r restore foo 0 $encoded2 replace + r get foo + } {bar2} + + test {RESTORE can detect a syntax error for unrecongized options} { + catch {r restore foo 0 "..." invalid-option} e + set e + } {*syntax*} + + test {DUMP of non existing key returns nil} { + r dump nonexisting_key + } {} + + test {MIGRATE is caching connections} { + # Note, we run this as first test so that the connection cache + # is empty. + set first [srv 0 client] + r set key "Some Value" + start_server {tags {"repl"}} { + set second [srv 0 client] + set second_host [srv 0 host] + set second_port [srv 0 port] + + assert_match {*migrate_cached_sockets:0*} [r -1 info] + r -1 migrate $second_host $second_port key 9 1000 + assert_match {*migrate_cached_sockets:1*} [r -1 info] + } + } {} {external:skip} + + test {MIGRATE cached connections are released after some time} { + after 15000 + assert_match {*migrate_cached_sockets:0*} [r info] + } + + test {MIGRATE is able to migrate a key between two instances} { + set first [srv 0 client] + r set key "Some Value" + start_server {tags {"repl"}} { + set second [srv 0 client] + set second_host [srv 0 host] + set second_port [srv 0 port] + + assert {[$first exists key] == 1} + assert {[$second exists key] == 0} + set ret [r -1 migrate $second_host $second_port key 9 5000] + assert {$ret eq {OK}} + assert {[$first exists key] == 0} + assert {[$second exists key] == 1} + assert {[$second get key] eq {Some Value}} + assert {[$second ttl key] == -1} + } + } {} {external:skip} + + test {MIGRATE is able to copy a key between two instances} { + set first [srv 0 client] + r del list + r lpush list a b c d + start_server {tags {"repl"}} { + set second [srv 0 client] + set second_host [srv 0 host] + set second_port [srv 0 port] + + assert {[$first exists list] == 1} + assert {[$second exists list] == 0} + set ret [r -1 migrate $second_host $second_port list 9 5000 copy] + assert {$ret eq {OK}} + assert {[$first exists list] == 1} + assert {[$second exists list] == 1} + assert {[$first lrange list 0 -1] eq [$second lrange list 0 -1]} + } + } {} {external:skip} + + test {MIGRATE will not overwrite existing keys, unless REPLACE is used} { + set first [srv 0 client] + r del list + r lpush list a b c d + start_server {tags {"repl"}} { + set second [srv 0 client] + set second_host [srv 0 host] + set second_port [srv 0 port] + + assert {[$first exists list] == 1} + assert {[$second exists list] == 0} + $second set list somevalue + catch {r -1 migrate $second_host $second_port list 9 5000 copy} e + assert_match {ERR*} $e + set ret [r -1 migrate $second_host $second_port list 9 5000 copy replace] + assert {$ret eq {OK}} + assert {[$first exists list] == 1} + assert {[$second exists list] == 1} + assert {[$first lrange list 0 -1] eq [$second lrange list 0 -1]} + } + } {} {external:skip} + + test {MIGRATE propagates TTL correctly} { + set first [srv 0 client] + r set key "Some Value" + start_server {tags {"repl"}} { + set second [srv 0 client] + set second_host [srv 0 host] + set second_port [srv 0 port] + + assert {[$first exists key] == 1} + assert {[$second exists key] == 0} + $first expire key 10 + set ret [r -1 migrate $second_host $second_port key 9 5000] + assert {$ret eq {OK}} + assert {[$first exists key] == 0} + assert {[$second exists key] == 1} + assert {[$second get key] eq {Some Value}} + assert {[$second ttl key] >= 7 && [$second ttl key] <= 10} + } + } {} {external:skip} + + test {MIGRATE can correctly transfer large values} { + set first [srv 0 client] + r del key + for {set j 0} {$j < 40000} {incr j} { + r rpush key 1 2 3 4 5 6 7 8 9 10 + r rpush key "item 1" "item 2" "item 3" "item 4" "item 5" \ + "item 6" "item 7" "item 8" "item 9" "item 10" + } + assert {[string length [r dump key]] > (1024*64)} + start_server {tags {"repl"}} { + set second [srv 0 client] + set second_host [srv 0 host] + set second_port [srv 0 port] + + assert {[$first exists key] == 1} + assert {[$second exists key] == 0} + set ret [r -1 migrate $second_host $second_port key 9 10000] + assert {$ret eq {OK}} + assert {[$first exists key] == 0} + assert {[$second exists key] == 1} + assert {[$second ttl key] == -1} + assert {[$second llen key] == 40000*20} + } + } {} {external:skip} + + test {MIGRATE can correctly transfer hashes} { + set first [srv 0 client] + r del key + r hmset key field1 "item 1" field2 "item 2" field3 "item 3" \ + field4 "item 4" field5 "item 5" field6 "item 6" + start_server {tags {"repl"}} { + set second [srv 0 client] + set second_host [srv 0 host] + set second_port [srv 0 port] + + assert {[$first exists key] == 1} + assert {[$second exists key] == 0} + set ret [r -1 migrate $second_host $second_port key 9 10000] + assert {$ret eq {OK}} + assert {[$first exists key] == 0} + assert {[$second exists key] == 1} + assert {[$second ttl key] == -1} + } + } {} {external:skip} + + test {MIGRATE timeout actually works} { + set first [srv 0 client] + r set key "Some Value" + start_server {tags {"repl"}} { + set second [srv 0 client] + set second_host [srv 0 host] + set second_port [srv 0 port] + + assert {[$first exists key] == 1} + assert {[$second exists key] == 0} + + set rd [redis_deferring_client] + $rd debug sleep 1.0 ; # Make second server unable to reply. + set e {} + catch {r -1 migrate $second_host $second_port key 9 500} e + assert_match {IOERR*} $e + } + } {} {external:skip} + + test {MIGRATE can migrate multiple keys at once} { + set first [srv 0 client] + r set key1 "v1" + r set key2 "v2" + r set key3 "v3" + start_server {tags {"repl"}} { + set second [srv 0 client] + set second_host [srv 0 host] + set second_port [srv 0 port] + + assert {[$first exists key1] == 1} + assert {[$second exists key1] == 0} + set ret [r -1 migrate $second_host $second_port "" 9 5000 keys key1 key2 key3] + assert {$ret eq {OK}} + assert {[$first exists key1] == 0} + assert {[$first exists key2] == 0} + assert {[$first exists key3] == 0} + assert {[$second get key1] eq {v1}} + assert {[$second get key2] eq {v2}} + assert {[$second get key3] eq {v3}} + } + } {} {external:skip} + + test {MIGRATE with multiple keys must have empty key arg} { + catch {r MIGRATE 127.0.0.1 6379 NotEmpty 9 5000 keys a b c} e + set e + } {*empty string*} {external:skip} + + test {MIGRATE with multiple keys migrate just existing ones} { + set first [srv 0 client] + r set key1 "v1" + r set key2 "v2" + r set key3 "v3" + start_server {tags {"repl"}} { + set second [srv 0 client] + set second_host [srv 0 host] + set second_port [srv 0 port] + + set ret [r -1 migrate $second_host $second_port "" 9 5000 keys nokey-1 nokey-2 nokey-2] + assert {$ret eq {NOKEY}} + + assert {[$first exists key1] == 1} + assert {[$second exists key1] == 0} + set ret [r -1 migrate $second_host $second_port "" 9 5000 keys nokey-1 key1 nokey-2 key2 nokey-3 key3] + assert {$ret eq {OK}} + assert {[$first exists key1] == 0} + assert {[$first exists key2] == 0} + assert {[$first exists key3] == 0} + assert {[$second get key1] eq {v1}} + assert {[$second get key2] eq {v2}} + assert {[$second get key3] eq {v3}} + } + } {} {external:skip} + + test {MIGRATE with multiple keys: stress command rewriting} { + set first [srv 0 client] + r flushdb + r mset a 1 b 2 c 3 d 4 c 5 e 6 f 7 g 8 h 9 i 10 l 11 m 12 n 13 o 14 p 15 q 16 + start_server {tags {"repl"}} { + set second [srv 0 client] + set second_host [srv 0 host] + set second_port [srv 0 port] + + set ret [r -1 migrate $second_host $second_port "" 9 5000 keys a b c d e f g h i l m n o p q] + + assert {[$first dbsize] == 0} + assert {[$second dbsize] == 15} + } + } {} {external:skip} + + test {MIGRATE with multiple keys: delete just ack keys} { + set first [srv 0 client] + r flushdb + r mset a 1 b 2 c 3 d 4 c 5 e 6 f 7 g 8 h 9 i 10 l 11 m 12 n 13 o 14 p 15 q 16 + start_server {tags {"repl"}} { + set second [srv 0 client] + set second_host [srv 0 host] + set second_port [srv 0 port] + + $second mset c _ d _; # Two busy keys and no REPLACE used + + catch {r -1 migrate $second_host $second_port "" 9 5000 keys a b c d e f g h i l m n o p q} e + + assert {[$first dbsize] == 2} + assert {[$second dbsize] == 15} + assert {[$first exists c] == 1} + assert {[$first exists d] == 1} + } + } {} {external:skip} + + test {MIGRATE AUTH: correct and wrong password cases} { + set first [srv 0 client] + r del list + r lpush list a b c d + start_server {tags {"repl"}} { + set second [srv 0 client] + set second_host [srv 0 host] + set second_port [srv 0 port] + $second config set requirepass foobar + $second auth foobar + + assert {[$first exists list] == 1} + assert {[$second exists list] == 0} + set ret [r -1 migrate $second_host $second_port list 9 5000 AUTH foobar] + assert {$ret eq {OK}} + assert {[$second exists list] == 1} + assert {[$second lrange list 0 -1] eq {d c b a}} + + r -1 lpush list a b c d + $second config set requirepass foobar2 + catch {r -1 migrate $second_host $second_port list 9 5000 AUTH foobar} err + assert_match {*WRONGPASS*} $err + } + } {} {external:skip} +} diff --git a/tests/unit/expire.tcl b/tests/unit/expire.tcl new file mode 100644 index 0000000..322c544 --- /dev/null +++ b/tests/unit/expire.tcl @@ -0,0 +1,807 @@ +start_server {tags {"expire"}} { + test {EXPIRE - set timeouts multiple times} { + r set x foobar + set v1 [r expire x 5] + set v2 [r ttl x] + set v3 [r expire x 10] + set v4 [r ttl x] + r expire x 2 + list $v1 $v2 $v3 $v4 + } {1 [45] 1 10} + + test {EXPIRE - It should be still possible to read 'x'} { + r get x + } {foobar} + + tags {"slow"} { + test {EXPIRE - After 2.1 seconds the key should no longer be here} { + after 2100 + list [r get x] [r exists x] + } {{} 0} + } + + test {EXPIRE - write on expire should work} { + r del x + r lpush x foo + r expire x 1000 + r lpush x bar + r lrange x 0 -1 + } {bar foo} + + test {EXPIREAT - Check for EXPIRE alike behavior} { + r del x + r set x foo + r expireat x [expr [clock seconds]+15] + r ttl x + } {1[345]} + + test {SETEX - Set + Expire combo operation. Check for TTL} { + r setex x 12 test + r ttl x + } {1[012]} + + test {SETEX - Check value} { + r get x + } {test} + + test {SETEX - Overwrite old key} { + r setex y 1 foo + r get y + } {foo} + + tags {"slow"} { + test {SETEX - Wait for the key to expire} { + after 1100 + r get y + } {} + } + + test {SETEX - Wrong time parameter} { + catch {r setex z -10 foo} e + set _ $e + } {*invalid expire*} + + test {PERSIST can undo an EXPIRE} { + r set x foo + r expire x 50 + list [r ttl x] [r persist x] [r ttl x] [r get x] + } {50 1 -1 foo} + + test {PERSIST returns 0 against non existing or non volatile keys} { + r set x foo + list [r persist foo] [r persist nokeyatall] + } {0 0} + + test {EXPIRE precision is now the millisecond} { + # This test is very likely to do a false positive if the + # server is under pressure, so if it does not work give it a few more + # chances. + for {set j 0} {$j < 10} {incr j} { + r del x + r setex x 1 somevalue + after 900 + set a [r get x] + after 1100 + set b [r get x] + if {$a eq {somevalue} && $b eq {}} break + } + if {$::verbose} { + puts "millisecond expire test attempts: $j" + } + list $a $b + } {somevalue {}} + + test "PSETEX can set sub-second expires" { + # This test is very likely to do a false positive if the server is + # under pressure, so if it does not work give it a few more chances. + for {set j 0} {$j < 50} {incr j} { + r del x + r psetex x 100 somevalue + set a [r get x] + after 101 + set b [r get x] + + if {$a eq {somevalue} && $b eq {}} break + } + if {$::verbose} { puts "PSETEX sub-second expire test attempts: $j" } + list $a $b + } {somevalue {}} + + test "PEXPIRE can set sub-second expires" { + # This test is very likely to do a false positive if the server is + # under pressure, so if it does not work give it a few more chances. + for {set j 0} {$j < 50} {incr j} { + r set x somevalue + r pexpire x 100 + set c [r get x] + after 101 + set d [r get x] + + if {$c eq {somevalue} && $d eq {}} break + } + if {$::verbose} { puts "PEXPIRE sub-second expire test attempts: $j" } + list $c $d + } {somevalue {}} + + test "PEXPIREAT can set sub-second expires" { + # This test is very likely to do a false positive if the server is + # under pressure, so if it does not work give it a few more chances. + for {set j 0} {$j < 50} {incr j} { + r set x somevalue + set now [r time] + r pexpireat x [expr ([lindex $now 0]*1000)+([lindex $now 1]/1000)+200] + set e [r get x] + after 201 + set f [r get x] + + if {$e eq {somevalue} && $f eq {}} break + } + if {$::verbose} { puts "PEXPIREAT sub-second expire test attempts: $j" } + list $e $f + } {somevalue {}} + + test {TTL returns time to live in seconds} { + r del x + r setex x 10 somevalue + set ttl [r ttl x] + assert {$ttl > 8 && $ttl <= 10} + } + + test {PTTL returns time to live in milliseconds} { + r del x + r setex x 1 somevalue + set ttl [r pttl x] + assert {$ttl > 900 && $ttl <= 1000} + } + + test {TTL / PTTL / EXPIRETIME / PEXPIRETIME return -1 if key has no expire} { + r del x + r set x hello + list [r ttl x] [r pttl x] [r expiretime x] [r pexpiretime x] + } {-1 -1 -1 -1} + + test {TTL / PTTL / EXPIRETIME / PEXPIRETIME return -2 if key does not exit} { + r del x + list [r ttl x] [r pttl x] [r expiretime x] [r pexpiretime x] + } {-2 -2 -2 -2} + + test {EXPIRETIME returns absolute expiration time in seconds} { + r del x + set abs_expire [expr [clock seconds] + 100] + r set x somevalue exat $abs_expire + assert_equal [r expiretime x] $abs_expire + } + + test {PEXPIRETIME returns absolute expiration time in milliseconds} { + r del x + set abs_expire [expr [clock milliseconds] + 100000] + r set x somevalue pxat $abs_expire + assert_equal [r pexpiretime x] $abs_expire + } + + test {Redis should actively expire keys incrementally} { + r flushdb + r psetex key1 500 a + r psetex key2 500 a + r psetex key3 500 a + assert_equal 3 [r dbsize] + # Redis expires random keys ten times every second so we are + # fairly sure that all the three keys should be evicted after + # two seconds. + wait_for_condition 20 100 { + [r dbsize] eq 0 + } fail { + "Keys did not actively expire." + } + } + + test {Redis should lazy expire keys} { + r flushdb + r debug set-active-expire 0 + r psetex key1{t} 500 a + r psetex key2{t} 500 a + r psetex key3{t} 500 a + set size1 [r dbsize] + # Redis expires random keys ten times every second so we are + # fairly sure that all the three keys should be evicted after + # one second. + after 1000 + set size2 [r dbsize] + r mget key1{t} key2{t} key3{t} + set size3 [r dbsize] + r debug set-active-expire 1 + list $size1 $size2 $size3 + } {3 3 0} {needs:debug} + + test {EXPIRE should not resurrect keys (issue #1026)} { + r debug set-active-expire 0 + r set foo bar + r pexpire foo 500 + after 1000 + r expire foo 10 + r debug set-active-expire 1 + r exists foo + } {0} {needs:debug} + + test {5 keys in, 5 keys out} { + r flushdb + r set a c + r expire a 5 + r set t c + r set e c + r set s c + r set foo b + assert_equal [lsort [r keys *]] {a e foo s t} + r del a ; # Do not leak volatile keys to other tests + } + + test {EXPIRE with empty string as TTL should report an error} { + r set foo bar + catch {r expire foo ""} e + set e + } {*not an integer*} + + test {SET with EX with big integer should report an error} { + catch {r set foo bar EX 10000000000000000} e + set e + } {ERR invalid expire time in 'set' command} + + test {SET with EX with smallest integer should report an error} { + catch {r SET foo bar EX -9999999999999999} e + set e + } {ERR invalid expire time in 'set' command} + + test {GETEX with big integer should report an error} { + r set foo bar + catch {r GETEX foo EX 10000000000000000} e + set e + } {ERR invalid expire time in 'getex' command} + + test {GETEX with smallest integer should report an error} { + r set foo bar + catch {r GETEX foo EX -9999999999999999} e + set e + } {ERR invalid expire time in 'getex' command} + + test {EXPIRE with big integer overflows when converted to milliseconds} { + r set foo bar + + # Hit `when > LLONG_MAX - basetime` + assert_error "ERR invalid expire time in 'expire' command" {r EXPIRE foo 9223370399119966} + + # Hit `when > LLONG_MAX / 1000` + assert_error "ERR invalid expire time in 'expire' command" {r EXPIRE foo 9223372036854776} + assert_error "ERR invalid expire time in 'expire' command" {r EXPIRE foo 10000000000000000} + assert_error "ERR invalid expire time in 'expire' command" {r EXPIRE foo 18446744073709561} + + assert_equal {-1} [r ttl foo] + } + + test {PEXPIRE with big integer overflow when basetime is added} { + r set foo bar + catch {r PEXPIRE foo 9223372036854770000} e + set e + } {ERR invalid expire time in 'pexpire' command} + + test {EXPIRE with big negative integer} { + r set foo bar + + # Hit `when < LLONG_MIN / 1000` + assert_error "ERR invalid expire time in 'expire' command" {r EXPIRE foo -9223372036854776} + assert_error "ERR invalid expire time in 'expire' command" {r EXPIRE foo -9999999999999999} + + r ttl foo + } {-1} + + test {PEXPIREAT with big integer works} { + r set foo bar + r PEXPIREAT foo 9223372036854770000 + } {1} + + test {PEXPIREAT with big negative integer works} { + r set foo bar + r PEXPIREAT foo -9223372036854770000 + r ttl foo + } {-2} + + # Start a new server with empty data and AOF file. + start_server {overrides {appendonly {yes} appendfsync always} tags {external:skip}} { + test {All time-to-live(TTL) in commands are propagated as absolute timestamp in milliseconds in AOF} { + # This test makes sure that expire times are propagated as absolute + # times to the AOF file and not as relative time, so that when the AOF + # is reloaded the TTLs are not being shifted forward to the future. + # We want the time to logically pass when the server is restarted! + + set aof [get_last_incr_aof_path r] + + # Apply each TTL-related command to a unique key + # SET commands + r set foo1 bar ex 100 + r set foo2 bar px 100000 + r set foo3 bar exat [expr [clock seconds]+100] + r set foo4 bar pxat [expr [clock milliseconds]+100000] + r setex foo5 100 bar + r psetex foo6 100000 bar + # EXPIRE-family commands + r set foo7 bar + r expire foo7 100 + r set foo8 bar + r pexpire foo8 100000 + r set foo9 bar + r expireat foo9 [expr [clock seconds]+100] + r set foo10 bar + r pexpireat foo10 [expr [clock seconds]*1000+100000] + r set foo11 bar + r expireat foo11 [expr [clock seconds]-100] + # GETEX commands + r set foo12 bar + r getex foo12 ex 100 + r set foo13 bar + r getex foo13 px 100000 + r set foo14 bar + r getex foo14 exat [expr [clock seconds]+100] + r set foo15 bar + r getex foo15 pxat [expr [clock milliseconds]+100000] + # RESTORE commands + r set foo16 bar + set encoded [r dump foo16] + r restore foo17 100000 $encoded + r restore foo18 [expr [clock milliseconds]+100000] $encoded absttl + + # Assert that each TTL-relatd command are persisted with absolute timestamps in AOF + assert_aof_content $aof { + {select *} + {set foo1 bar PXAT *} + {set foo2 bar PXAT *} + {set foo3 bar PXAT *} + {set foo4 bar PXAT *} + {set foo5 bar PXAT *} + {set foo6 bar PXAT *} + {set foo7 bar} + {pexpireat foo7 *} + {set foo8 bar} + {pexpireat foo8 *} + {set foo9 bar} + {pexpireat foo9 *} + {set foo10 bar} + {pexpireat foo10 *} + {set foo11 bar} + {del foo11} + {set foo12 bar} + {pexpireat foo12 *} + {set foo13 bar} + {pexpireat foo13 *} + {set foo14 bar} + {pexpireat foo14 *} + {set foo15 bar} + {pexpireat foo15 *} + {set foo16 bar} + {restore foo17 * {*} ABSTTL} + {restore foo18 * {*} absttl} + } + + # Remember the absolute TTLs of all the keys + set ttl1 [r pexpiretime foo1] + set ttl2 [r pexpiretime foo2] + set ttl3 [r pexpiretime foo3] + set ttl4 [r pexpiretime foo4] + set ttl5 [r pexpiretime foo5] + set ttl6 [r pexpiretime foo6] + set ttl7 [r pexpiretime foo7] + set ttl8 [r pexpiretime foo8] + set ttl9 [r pexpiretime foo9] + set ttl10 [r pexpiretime foo10] + assert_equal "-2" [r pexpiretime foo11] ; # foo11 is gone + set ttl12 [r pexpiretime foo12] + set ttl13 [r pexpiretime foo13] + set ttl14 [r pexpiretime foo14] + set ttl15 [r pexpiretime foo15] + assert_equal "-1" [r pexpiretime foo16] ; # foo16 has no TTL + set ttl17 [r pexpiretime foo17] + set ttl18 [r pexpiretime foo18] + + # Let some time pass and reload data from AOF + after 2000 + r debug loadaof + + # Assert that relative TTLs are roughly the same + assert_range [r ttl foo1] 90 98 + assert_range [r ttl foo2] 90 98 + assert_range [r ttl foo3] 90 98 + assert_range [r ttl foo4] 90 98 + assert_range [r ttl foo5] 90 98 + assert_range [r ttl foo6] 90 98 + assert_range [r ttl foo7] 90 98 + assert_range [r ttl foo8] 90 98 + assert_range [r ttl foo9] 90 98 + assert_range [r ttl foo10] 90 98 + assert_equal [r ttl foo11] "-2" ; # foo11 is gone + assert_range [r ttl foo12] 90 98 + assert_range [r ttl foo13] 90 98 + assert_range [r ttl foo14] 90 98 + assert_range [r ttl foo15] 90 98 + assert_equal [r ttl foo16] "-1" ; # foo16 has no TTL + assert_range [r ttl foo17] 90 98 + assert_range [r ttl foo18] 90 98 + + # Assert that all keys have restored the same absolute TTLs from AOF + assert_equal [r pexpiretime foo1] $ttl1 + assert_equal [r pexpiretime foo2] $ttl2 + assert_equal [r pexpiretime foo3] $ttl3 + assert_equal [r pexpiretime foo4] $ttl4 + assert_equal [r pexpiretime foo5] $ttl5 + assert_equal [r pexpiretime foo6] $ttl6 + assert_equal [r pexpiretime foo7] $ttl7 + assert_equal [r pexpiretime foo8] $ttl8 + assert_equal [r pexpiretime foo9] $ttl9 + assert_equal [r pexpiretime foo10] $ttl10 + assert_equal [r pexpiretime foo11] "-2" ; # foo11 is gone + assert_equal [r pexpiretime foo12] $ttl12 + assert_equal [r pexpiretime foo13] $ttl13 + assert_equal [r pexpiretime foo14] $ttl14 + assert_equal [r pexpiretime foo15] $ttl15 + assert_equal [r pexpiretime foo16] "-1" ; # foo16 has no TTL + assert_equal [r pexpiretime foo17] $ttl17 + assert_equal [r pexpiretime foo18] $ttl18 + } {} {needs:debug} + } + + test {All TTL in commands are propagated as absolute timestamp in replication stream} { + # Make sure that both relative and absolute expire commands are propagated + # as absolute to replicas for two reasons: + # 1) We want to avoid replicas retaining data much longer than primary due + # to replication lag. + # 2) We want to unify the way TTLs are replicated in both RDB and replication + # stream, which is as absolute timestamps. + # See: https://github.com/redis/redis/issues/8433 + + r flushall ; # Clean up keyspace to avoid interference by keys from other tests + set repl [attach_to_replication_stream] + # SET commands + r set foo1 bar ex 200 + r set foo1 bar px 100000 + r set foo1 bar exat [expr [clock seconds]+100] + r set foo1 bar pxat [expr [clock milliseconds]+100000] + r setex foo1 100 bar + r psetex foo1 100000 bar + r set foo2 bar + # EXPIRE-family commands + r expire foo2 100 + r pexpire foo2 100000 + r set foo3 bar + r expireat foo3 [expr [clock seconds]+100] + r pexpireat foo3 [expr [clock seconds]*1000+100000] + r expireat foo3 [expr [clock seconds]-100] + # GETEX-family commands + r set foo4 bar + r getex foo4 ex 200 + r getex foo4 px 200000 + r getex foo4 exat [expr [clock seconds]+100] + r getex foo4 pxat [expr [clock milliseconds]+100000] + # RESTORE commands + r set foo5 bar + set encoded [r dump foo5] + r restore foo6 100000 $encoded + r restore foo7 [expr [clock milliseconds]+100000] $encoded absttl + + assert_replication_stream $repl { + {select *} + {set foo1 bar PXAT *} + {set foo1 bar PXAT *} + {set foo1 bar PXAT *} + {set foo1 bar PXAT *} + {set foo1 bar PXAT *} + {set foo1 bar PXAT *} + {set foo2 bar} + {pexpireat foo2 *} + {pexpireat foo2 *} + {set foo3 bar} + {pexpireat foo3 *} + {pexpireat foo3 *} + {del foo3} + {set foo4 bar} + {pexpireat foo4 *} + {pexpireat foo4 *} + {pexpireat foo4 *} + {pexpireat foo4 *} + {set foo5 bar} + {restore foo6 * {*} ABSTTL} + {restore foo7 * {*} absttl} + } + close_replication_stream $repl + } {} {needs:repl} + + # Start another server to test replication of TTLs + start_server {tags {needs:repl external:skip}} { + # Set the outer layer server as primary + set primary [srv -1 client] + set primary_host [srv -1 host] + set primary_port [srv -1 port] + # Set this inner layer server as replica + set replica [srv 0 client] + + test {First server should have role slave after REPLICAOF} { + $replica replicaof $primary_host $primary_port + wait_for_condition 50 100 { + [s 0 role] eq {slave} + } else { + fail "Replication not started." + } + } + + test {For all replicated TTL-related commands, absolute expire times are identical on primary and replica} { + # Apply each TTL-related command to a unique key on primary + # SET commands + $primary set foo1 bar ex 100 + $primary set foo2 bar px 100000 + $primary set foo3 bar exat [expr [clock seconds]+100] + $primary set foo4 bar pxat [expr [clock milliseconds]+100000] + $primary setex foo5 100 bar + $primary psetex foo6 100000 bar + # EXPIRE-family commands + $primary set foo7 bar + $primary expire foo7 100 + $primary set foo8 bar + $primary pexpire foo8 100000 + $primary set foo9 bar + $primary expireat foo9 [expr [clock seconds]+100] + $primary set foo10 bar + $primary pexpireat foo10 [expr [clock milliseconds]+100000] + # GETEX commands + $primary set foo11 bar + $primary getex foo11 ex 100 + $primary set foo12 bar + $primary getex foo12 px 100000 + $primary set foo13 bar + $primary getex foo13 exat [expr [clock seconds]+100] + $primary set foo14 bar + $primary getex foo14 pxat [expr [clock milliseconds]+100000] + # RESTORE commands + $primary set foo15 bar + set encoded [$primary dump foo15] + $primary restore foo16 100000 $encoded + $primary restore foo17 [expr [clock milliseconds]+100000] $encoded absttl + + # Wait for replica to get the keys and TTLs + assert {[$primary wait 1 0] == 1} + + # Verify absolute TTLs are identical on primary and replica for all keys + # This is because TTLs are always replicated as absolute values + foreach key [$primary keys *] { + assert_equal [$primary pexpiretime $key] [$replica pexpiretime $key] + } + } + + test {expired key which is created in writeable replicas should be deleted by active expiry} { + $primary flushall + $replica config set replica-read-only no + foreach {yes_or_no} {yes no} { + $replica config set appendonly $yes_or_no + waitForBgrewriteaof $replica + set prev_expired [s expired_keys] + $replica set foo bar PX 1 + wait_for_condition 100 10 { + [s expired_keys] eq $prev_expired + 1 + } else { + fail "key not expired" + } + assert_equal {} [$replica get foo] + } + } + } + + test {SET command will remove expire} { + r set foo bar EX 100 + r set foo bar + r ttl foo + } {-1} + + test {SET - use KEEPTTL option, TTL should not be removed} { + r set foo bar EX 100 + r set foo bar KEEPTTL + set ttl [r ttl foo] + assert {$ttl <= 100 && $ttl > 90} + } + + test {SET - use KEEPTTL option, TTL should not be removed after loadaof} { + r config set appendonly yes + r set foo bar EX 100 + r set foo bar2 KEEPTTL + after 2000 + r debug loadaof + set ttl [r ttl foo] + assert {$ttl <= 98 && $ttl > 90} + } {} {needs:debug} + + test {GETEX use of PERSIST option should remove TTL} { + r set foo bar EX 100 + r getex foo PERSIST + r ttl foo + } {-1} + + test {GETEX use of PERSIST option should remove TTL after loadaof} { + r set foo bar EX 100 + r getex foo PERSIST + after 2000 + r debug loadaof + r ttl foo + } {-1} {needs:debug} + + test {GETEX propagate as to replica as PERSIST, DEL, or nothing} { + set repl [attach_to_replication_stream] + r set foo bar EX 100 + r getex foo PERSIST + r getex foo + r getex foo exat [expr [clock seconds]-100] + assert_replication_stream $repl { + {select *} + {set foo bar PXAT *} + {persist foo} + {del foo} + } + close_replication_stream $repl + } {} {needs:repl} + + test {EXPIRE with NX option on a key with ttl} { + r SET foo bar EX 100 + assert_equal [r EXPIRE foo 200 NX] 0 + assert_range [r TTL foo] 50 100 + } {} + + test {EXPIRE with NX option on a key without ttl} { + r SET foo bar + assert_equal [r EXPIRE foo 200 NX] 1 + assert_range [r TTL foo] 100 200 + } {} + + test {EXPIRE with XX option on a key with ttl} { + r SET foo bar EX 100 + assert_equal [r EXPIRE foo 200 XX] 1 + assert_range [r TTL foo] 100 200 + } {} + + test {EXPIRE with XX option on a key without ttl} { + r SET foo bar + assert_equal [r EXPIRE foo 200 XX] 0 + assert_equal [r TTL foo] -1 + } {} + + test {EXPIRE with GT option on a key with lower ttl} { + r SET foo bar EX 100 + assert_equal [r EXPIRE foo 200 GT] 1 + assert_range [r TTL foo] 100 200 + } {} + + test {EXPIRE with GT option on a key with higher ttl} { + r SET foo bar EX 200 + assert_equal [r EXPIRE foo 100 GT] 0 + assert_range [r TTL foo] 100 200 + } {} + + test {EXPIRE with GT option on a key without ttl} { + r SET foo bar + assert_equal [r EXPIRE foo 200 GT] 0 + assert_equal [r TTL foo] -1 + } {} + + test {EXPIRE with LT option on a key with higher ttl} { + r SET foo bar EX 100 + assert_equal [r EXPIRE foo 200 LT] 0 + assert_range [r TTL foo] 50 100 + } {} + + test {EXPIRE with LT option on a key with lower ttl} { + r SET foo bar EX 200 + assert_equal [r EXPIRE foo 100 LT] 1 + assert_range [r TTL foo] 50 100 + } {} + + test {EXPIRE with LT option on a key without ttl} { + r SET foo bar + assert_equal [r EXPIRE foo 100 LT] 1 + assert_range [r TTL foo] 50 100 + } {} + + test {EXPIRE with LT and XX option on a key with ttl} { + r SET foo bar EX 200 + assert_equal [r EXPIRE foo 100 LT XX] 1 + assert_range [r TTL foo] 50 100 + } {} + + test {EXPIRE with LT and XX option on a key without ttl} { + r SET foo bar + assert_equal [r EXPIRE foo 200 LT XX] 0 + assert_equal [r TTL foo] -1 + } {} + + test {EXPIRE with conflicting options: LT GT} { + catch {r EXPIRE foo 200 LT GT} e + set e + } {ERR GT and LT options at the same time are not compatible} + + test {EXPIRE with conflicting options: NX GT} { + catch {r EXPIRE foo 200 NX GT} e + set e + } {ERR NX and XX, GT or LT options at the same time are not compatible} + + test {EXPIRE with conflicting options: NX LT} { + catch {r EXPIRE foo 200 NX LT} e + set e + } {ERR NX and XX, GT or LT options at the same time are not compatible} + + test {EXPIRE with conflicting options: NX XX} { + catch {r EXPIRE foo 200 NX XX} e + set e + } {ERR NX and XX, GT or LT options at the same time are not compatible} + + test {EXPIRE with unsupported options} { + catch {r EXPIRE foo 200 AB} e + set e + } {ERR Unsupported option AB} + + test {EXPIRE with unsupported options} { + catch {r EXPIRE foo 200 XX AB} e + set e + } {ERR Unsupported option AB} + + test {EXPIRE with negative expiry} { + r SET foo bar EX 100 + assert_equal [r EXPIRE foo -10 LT] 1 + assert_equal [r TTL foo] -2 + } {} + + test {EXPIRE with negative expiry on a non-valitale key} { + r SET foo bar + assert_equal [r EXPIRE foo -10 LT] 1 + assert_equal [r TTL foo] -2 + } {} + + test {EXPIRE with non-existed key} { + assert_equal [r EXPIRE none 100 NX] 0 + assert_equal [r EXPIRE none 100 XX] 0 + assert_equal [r EXPIRE none 100 GT] 0 + assert_equal [r EXPIRE none 100 LT] 0 + } {} + + test {SCAN: Lazy-expire should not be wrapped in MULTI/EXEC} { + r debug set-active-expire 0 + r flushall + + r set foo1 bar PX 1 + r set foo2 bar PX 1 + after 2 + + set repl [attach_to_replication_stream] + + r scan 0 + + assert_replication_stream $repl { + {select *} + {del foo*} + {del foo*} + } + close_replication_stream $repl + assert_equal [r debug set-active-expire 1] {OK} + } {} {needs:debug} + + test {RANDOMKEY: Lazy-expire should not be wrapped in MULTI/EXEC} { + r debug set-active-expire 0 + r flushall + + r set foo1 bar PX 1 + r set foo2 bar PX 1 + after 2 + + set repl [attach_to_replication_stream] + + r randomkey + + assert_replication_stream $repl { + {select *} + {del foo*} + {del foo*} + } + close_replication_stream $repl + assert_equal [r debug set-active-expire 1] {OK} + } {} {needs:debug} +} diff --git a/tests/unit/functions.tcl b/tests/unit/functions.tcl new file mode 100644 index 0000000..a907bad --- /dev/null +++ b/tests/unit/functions.tcl @@ -0,0 +1,1224 @@ +proc get_function_code {args} { + return [format "#!%s name=%s\nredis.register_function('%s', function(KEYS, ARGV)\n %s \nend)" [lindex $args 0] [lindex $args 1] [lindex $args 2] [lindex $args 3]] +} + +proc get_no_writes_function_code {args} { + return [format "#!%s name=%s\nredis.register_function{function_name='%s', callback=function(KEYS, ARGV)\n %s \nend, flags={'no-writes'}}" [lindex $args 0] [lindex $args 1] [lindex $args 2] [lindex $args 3]] +} + +start_server {tags {"scripting"}} { + test {FUNCTION - Basic usage} { + r function load [get_function_code LUA test test {return 'hello'}] + r fcall test 0 + } {hello} + + test {FUNCTION - Load with unknown argument} { + catch { + r function load foo bar [get_function_code LUA test test {return 'hello'}] + } e + set _ $e + } {*Unknown option given*} + + test {FUNCTION - Create an already exiting library raise error} { + catch { + r function load [get_function_code LUA test test {return 'hello1'}] + } e + set _ $e + } {*already exists*} + + test {FUNCTION - Create an already exiting library raise error (case insensitive)} { + catch { + r function load [get_function_code LUA test test {return 'hello1'}] + } e + set _ $e + } {*already exists*} + + test {FUNCTION - Create a library with wrong name format} { + catch { + r function load [get_function_code LUA {bad\0foramat} test {return 'hello1'}] + } e + set _ $e + } {*Library names can only contain letters, numbers, or underscores(_)*} + + test {FUNCTION - Create library with unexisting engine} { + catch { + r function load [get_function_code bad_engine test test {return 'hello1'}] + } e + set _ $e + } {*Engine 'bad_engine' not found*} + + test {FUNCTION - Test uncompiled script} { + catch { + r function load replace [get_function_code LUA test test {bad script}] + } e + set _ $e + } {*Error compiling function*} + + test {FUNCTION - test replace argument} { + r function load REPLACE [get_function_code LUA test test {return 'hello1'}] + r fcall test 0 + } {hello1} + + test {FUNCTION - test function case insensitive} { + r fcall TEST 0 + } {hello1} + + test {FUNCTION - test replace argument with failure keeps old libraries} { + catch {r function create LUA test REPLACE {error}} + r fcall test 0 + } {hello1} + + test {FUNCTION - test function delete} { + r function delete test + catch { + r fcall test 0 + } e + set _ $e + } {*Function not found*} + + test {FUNCTION - test fcall bad arguments} { + r function load [get_function_code LUA test test {return 'hello'}] + catch { + r fcall test bad_arg + } e + set _ $e + } {*Bad number of keys provided*} + + test {FUNCTION - test fcall bad number of keys arguments} { + catch { + r fcall test 10 key1 + } e + set _ $e + } {*Number of keys can't be greater than number of args*} + + test {FUNCTION - test fcall negative number of keys} { + catch { + r fcall test -1 key1 + } e + set _ $e + } {*Number of keys can't be negative*} + + test {FUNCTION - test delete on not exiting library} { + catch { + r function delete test1 + } e + set _ $e + } {*Library not found*} + + test {FUNCTION - test function kill when function is not running} { + catch { + r function kill + } e + set _ $e + } {*No scripts in execution*} + + test {FUNCTION - test wrong subcommand} { + catch { + r function bad_subcommand + } e + set _ $e + } {*unknown subcommand*} + + test {FUNCTION - test loading from rdb} { + r debug reload + r fcall test 0 + } {hello} {needs:debug} + + test {FUNCTION - test debug reload different options} { + catch {r debug reload noflush} e + assert_match "*Error trying to load the RDB*" $e + r debug reload noflush merge + r function list + } {{library_name test engine LUA functions {{name test description {} flags {}}}}} {needs:debug} + + test {FUNCTION - test debug reload with nosave and noflush} { + r function delete test + r set x 1 + r function load [get_function_code LUA test1 test1 {return 'hello'}] + r debug reload + r function load [get_function_code LUA test2 test2 {return 'hello'}] + r debug reload nosave noflush merge + assert_equal [r fcall test1 0] {hello} + assert_equal [r fcall test2 0] {hello} + } {} {needs:debug} + + test {FUNCTION - test flushall and flushdb do not clean functions} { + r function flush + r function load REPLACE [get_function_code lua test test {return redis.call('set', 'x', '1')}] + r flushall + r flushdb + r function list + } {{library_name test engine LUA functions {{name test description {} flags {}}}}} + + test {FUNCTION - test function dump and restore} { + r function flush + r function load [get_function_code lua test test {return 'hello'}] + set e [r function dump] + r function delete test + assert_match {} [r function list] + r function restore $e + r function list + } {{library_name test engine LUA functions {{name test description {} flags {}}}}} + + test {FUNCTION - test function dump and restore with flush argument} { + set e [r function dump] + r function flush + assert_match {} [r function list] + r function restore $e FLUSH + r function list + } {{library_name test engine LUA functions {{name test description {} flags {}}}}} + + test {FUNCTION - test function dump and restore with append argument} { + set e [r function dump] + r function flush + assert_match {} [r function list] + r function load [get_function_code lua test test {return 'hello1'}] + catch {r function restore $e APPEND} err + assert_match {*already exists*} $err + r function flush + r function load [get_function_code lua test1 test1 {return 'hello1'}] + r function restore $e APPEND + assert_match {hello} [r fcall test 0] + assert_match {hello1} [r fcall test1 0] + } + + test {FUNCTION - test function dump and restore with replace argument} { + r function flush + r function load [get_function_code LUA test test {return 'hello'}] + set e [r function dump] + r function flush + assert_match {} [r function list] + r function load [get_function_code lua test test {return 'hello1'}] + assert_match {hello1} [r fcall test 0] + r function restore $e REPLACE + assert_match {hello} [r fcall test 0] + } + + test {FUNCTION - test function restore with bad payload do not drop existing functions} { + r function flush + r function load [get_function_code LUA test test {return 'hello'}] + catch {r function restore bad_payload} e + assert_match {*payload version or checksum are wrong*} $e + r function list + } {{library_name test engine LUA functions {{name test description {} flags {}}}}} + + test {FUNCTION - test function restore with wrong number of arguments} { + catch {r function restore arg1 args2 arg3} e + set _ $e + } {*unknown subcommand or wrong number of arguments for 'restore'. Try FUNCTION HELP.} + + test {FUNCTION - test fcall_ro with write command} { + r function load REPLACE [get_no_writes_function_code lua test test {return redis.call('set', 'x', '1')}] + catch { r fcall_ro test 0 } e + set _ $e + } {*Write commands are not allowed from read-only scripts*} + + test {FUNCTION - test fcall_ro with read only commands} { + r function load REPLACE [get_no_writes_function_code lua test test {return redis.call('get', 'x')}] + r set x 1 + r fcall_ro test 0 + } {1} + + test {FUNCTION - test keys and argv} { + r function load REPLACE [get_function_code lua test test {return redis.call('set', KEYS[1], ARGV[1])}] + r fcall test 1 x foo + r get x + } {foo} + + test {FUNCTION - test command get keys on fcall} { + r COMMAND GETKEYS fcall test 1 x foo + } {x} + + test {FUNCTION - test command get keys on fcall_ro} { + r COMMAND GETKEYS fcall_ro test 1 x foo + } {x} + + test {FUNCTION - test function kill} { + set rd [redis_deferring_client] + r config set busy-reply-threshold 10 + r function load REPLACE [get_function_code lua test test {local a = 1 while true do a = a + 1 end}] + $rd fcall test 0 + after 200 + catch {r ping} e + assert_match {BUSY*} $e + assert_match {running_script {name test command {fcall test 0} duration_ms *} engines {*}} [r FUNCTION STATS] + r function kill + after 200 ; # Give some time to Lua to call the hook again... + assert_equal [r ping] "PONG" + } + + test {FUNCTION - test script kill not working on function} { + set rd [redis_deferring_client] + r config set busy-reply-threshold 10 + r function load REPLACE [get_function_code lua test test {local a = 1 while true do a = a + 1 end}] + $rd fcall test 0 + after 200 + catch {r ping} e + assert_match {BUSY*} $e + catch {r script kill} e + assert_match {BUSY*} $e + r function kill + after 200 ; # Give some time to Lua to call the hook again... + assert_equal [r ping] "PONG" + } + + test {FUNCTION - test function kill not working on eval} { + set rd [redis_deferring_client] + r config set busy-reply-threshold 10 + $rd eval {local a = 1 while true do a = a + 1 end} 0 + after 200 + catch {r ping} e + assert_match {BUSY*} $e + catch {r function kill} e + assert_match {BUSY*} $e + r script kill + after 200 ; # Give some time to Lua to call the hook again... + assert_equal [r ping] "PONG" + } + + test {FUNCTION - test function flush} { + r function load REPLACE [get_function_code lua test test {local a = 1 while true do a = a + 1 end}] + assert_match {{library_name test engine LUA functions {{name test description {} flags {}}}}} [r function list] + r function flush + assert_match {} [r function list] + + r function load REPLACE [get_function_code lua test test {local a = 1 while true do a = a + 1 end}] + assert_match {{library_name test engine LUA functions {{name test description {} flags {}}}}} [r function list] + r function flush async + assert_match {} [r function list] + + r function load REPLACE [get_function_code lua test test {local a = 1 while true do a = a + 1 end}] + assert_match {{library_name test engine LUA functions {{name test description {} flags {}}}}} [r function list] + r function flush sync + assert_match {} [r function list] + } + + test {FUNCTION - test function wrong argument} { + catch {r function flush bad_arg} e + assert_match {*only supports SYNC|ASYNC*} $e + + catch {r function flush sync extra_arg} e + assert_match {*unknown subcommand or wrong number of arguments for 'flush'. Try FUNCTION HELP.} $e + } +} + +start_server {tags {"scripting repl external:skip"}} { + start_server {} { + test "Connect a replica to the master instance" { + r -1 slaveof [srv 0 host] [srv 0 port] + wait_for_condition 150 100 { + [s -1 role] eq {slave} && + [string match {*master_link_status:up*} [r -1 info replication]] + } else { + fail "Can't turn the instance into a replica" + } + } + + test {FUNCTION - creation is replicated to replica} { + r function load [get_no_writes_function_code LUA test test {return 'hello'}] + wait_for_condition 150 100 { + [r -1 function list] eq {{library_name test engine LUA functions {{name test description {} flags no-writes}}}} + } else { + fail "Failed waiting for function to replicate to replica" + } + } + + test {FUNCTION - call on replica} { + r -1 fcall test 0 + } {hello} + + test {FUNCTION - restore is replicated to replica} { + set e [r function dump] + + r function delete test + wait_for_condition 150 100 { + [r -1 function list] eq {} + } else { + fail "Failed waiting for function to replicate to replica" + } + + assert_equal [r function restore $e] {OK} + + wait_for_condition 150 100 { + [r -1 function list] eq {{library_name test engine LUA functions {{name test description {} flags no-writes}}}} + } else { + fail "Failed waiting for function to replicate to replica" + } + } + + test {FUNCTION - delete is replicated to replica} { + r function delete test + wait_for_condition 150 100 { + [r -1 function list] eq {} + } else { + fail "Failed waiting for function to replicate to replica" + } + } + + test {FUNCTION - flush is replicated to replica} { + r function load [get_function_code LUA test test {return 'hello'}] + wait_for_condition 150 100 { + [r -1 function list] eq {{library_name test engine LUA functions {{name test description {} flags {}}}}} + } else { + fail "Failed waiting for function to replicate to replica" + } + r function flush + wait_for_condition 150 100 { + [r -1 function list] eq {} + } else { + fail "Failed waiting for function to replicate to replica" + } + } + + test "Disconnecting the replica from master instance" { + r -1 slaveof no one + # creating a function after disconnect to make sure function + # is replicated on rdb phase + r function load [get_no_writes_function_code LUA test test {return 'hello'}] + + # reconnect the replica + r -1 slaveof [srv 0 host] [srv 0 port] + wait_for_condition 150 100 { + [s -1 role] eq {slave} && + [string match {*master_link_status:up*} [r -1 info replication]] + } else { + fail "Can't turn the instance into a replica" + } + } + + test "FUNCTION - test replication to replica on rdb phase" { + r -1 fcall test 0 + } {hello} + + test "FUNCTION - test replication to replica on rdb phase info command" { + r -1 function list + } {{library_name test engine LUA functions {{name test description {} flags no-writes}}}} + + test "FUNCTION - create on read only replica" { + catch { + r -1 function load [get_function_code LUA test test {return 'hello'}] + } e + set _ $e + } {*can't write against a read only replica*} + + test "FUNCTION - delete on read only replica" { + catch { + r -1 function delete test + } e + set _ $e + } {*can't write against a read only replica*} + + test "FUNCTION - function effect is replicated to replica" { + r function load REPLACE [get_function_code LUA test test {return redis.call('set', 'x', '1')}] + r fcall test 0 + assert {[r get x] eq {1}} + wait_for_condition 150 100 { + [r -1 get x] eq {1} + } else { + fail "Failed waiting function effect to be replicated to replica" + } + } + + test "FUNCTION - modify key space of read only replica" { + catch { + r -1 fcall test 0 + } e + set _ $e + } {READONLY You can't write against a read only replica.} + } +} + +test {FUNCTION can processes create, delete and flush commands in AOF when doing "debug loadaof" in read-only slaves} { + start_server {} { + r config set appendonly yes + waitForBgrewriteaof r + r FUNCTION LOAD "#!lua name=test\nredis.register_function('test', function() return 'hello' end)" + r config set slave-read-only yes + r slaveof 127.0.0.1 0 + r debug loadaof + r slaveof no one + assert_equal [r function list] {{library_name test engine LUA functions {{name test description {} flags {}}}}} + + r FUNCTION DELETE test + + r slaveof 127.0.0.1 0 + r debug loadaof + r slaveof no one + assert_equal [r function list] {} + + r FUNCTION LOAD "#!lua name=test\nredis.register_function('test', function() return 'hello' end)" + r FUNCTION FLUSH + + r slaveof 127.0.0.1 0 + r debug loadaof + r slaveof no one + assert_equal [r function list] {} + } +} {} {needs:debug external:skip} + +start_server {tags {"scripting"}} { + test {LIBRARIES - test shared function can access default globals} { + r function load {#!lua name=lib1 + local function ping() + return redis.call('ping') + end + redis.register_function( + 'f1', + function(keys, args) + return ping() + end + ) + } + r fcall f1 0 + } {PONG} + + test {LIBRARIES - usage and code sharing} { + r function load REPLACE {#!lua name=lib1 + local function add1(a) + return a + 1 + end + redis.register_function( + 'f1', + function(keys, args) + return add1(1) + end + ) + redis.register_function( + 'f2', + function(keys, args) + return add1(2) + end + ) + } + assert_equal [r fcall f1 0] {2} + assert_equal [r fcall f2 0] {3} + r function list + } {{library_name lib1 engine LUA functions {*}}} + + test {LIBRARIES - test registration failure revert the entire load} { + catch { + r function load replace {#!lua name=lib1 + local function add1(a) + return a + 2 + end + redis.register_function( + 'f1', + function(keys, args) + return add1(1) + end + ) + redis.register_function( + 'f2', + 'not a function' + ) + } + } e + assert_match {*second argument to redis.register_function must be a function*} $e + assert_equal [r fcall f1 0] {2} + assert_equal [r fcall f2 0] {3} + } + + test {LIBRARIES - test registration function name collision} { + catch { + r function load replace {#!lua name=lib2 + redis.register_function( + 'f1', + function(keys, args) + return 1 + end + ) + } + } e + assert_match {*Function f1 already exists*} $e + assert_equal [r fcall f1 0] {2} + assert_equal [r fcall f2 0] {3} + } + + test {LIBRARIES - test registration function name collision on same library} { + catch { + r function load replace {#!lua name=lib2 + redis.register_function( + 'f1', + function(keys, args) + return 1 + end + ) + redis.register_function( + 'f1', + function(keys, args) + return 1 + end + ) + } + } e + set _ $e + } {*Function already exists in the library*} + + test {LIBRARIES - test registration with no argument} { + catch { + r function load replace {#!lua name=lib2 + redis.register_function() + } + } e + set _ $e + } {*wrong number of arguments to redis.register_function*} + + test {LIBRARIES - test registration with only name} { + catch { + r function load replace {#!lua name=lib2 + redis.register_function('f1') + } + } e + set _ $e + } {*calling redis.register_function with a single argument is only applicable to Lua table*} + + test {LIBRARIES - test registration with to many arguments} { + catch { + r function load replace {#!lua name=lib2 + redis.register_function('f1', function() return 1 end, {}, 'description', 'extra arg') + } + } e + set _ $e + } {*wrong number of arguments to redis.register_function*} + + test {LIBRARIES - test registration with no string name} { + catch { + r function load replace {#!lua name=lib2 + redis.register_function(nil, function() return 1 end) + } + } e + set _ $e + } {*first argument to redis.register_function must be a string*} + + test {LIBRARIES - test registration with wrong name format} { + catch { + r function load replace {#!lua name=lib2 + redis.register_function('test\0test', function() return 1 end) + } + } e + set _ $e + } {*Library names can only contain letters, numbers, or underscores(_) and must be at least one character long*} + + test {LIBRARIES - test registration with empty name} { + catch { + r function load replace {#!lua name=lib2 + redis.register_function('', function() return 1 end) + } + } e + set _ $e + } {*Library names can only contain letters, numbers, or underscores(_) and must be at least one character long*} + + test {LIBRARIES - math.random from function load} { + catch { + r function load replace {#!lua name=lib2 + return math.random() + } + } e + set _ $e + } {*attempted to access nonexistent global variable 'math'*} + + test {LIBRARIES - redis.call from function load} { + catch { + r function load replace {#!lua name=lib2 + return redis.call('ping') + } + } e + set _ $e + } {*attempted to access nonexistent global variable 'call'*} + + test {LIBRARIES - redis.setresp from function load} { + catch { + r function load replace {#!lua name=lib2 + return redis.setresp(3) + } + } e + set _ $e + } {*attempted to access nonexistent global variable 'setresp'*} + + test {LIBRARIES - redis.set_repl from function load} { + catch { + r function load replace {#!lua name=lib2 + return redis.set_repl(redis.REPL_NONE) + } + } e + set _ $e + } {*attempted to access nonexistent global variable 'set_repl'*} + + test {LIBRARIES - malicious access test} { + # the 'library' API is not exposed inside a + # function context and the 'redis' API is not + # expose on the library registration context. + # But a malicious user might find a way to hack it + # (as demonstrated in this test). This is why we + # have another level of protection on the C + # code itself and we want to test it and verify + # that it works properly. + r function load replace {#!lua name=lib1 + local lib = redis + lib.register_function('f1', function () + lib.redis = redis + lib.math = math + return {ok='OK'} + end) + + lib.register_function('f2', function () + lib.register_function('f1', function () + lib.redis = redis + lib.math = math + return {ok='OK'} + end) + end) + } + catch {[r fcall f1 0]} e + assert_match {*Attempt to modify a readonly table*} $e + + catch {[r function load {#!lua name=lib2 + redis.math.random() + }]} e + assert_match {*Script attempted to access nonexistent global variable 'math'*} $e + + catch {[r function load {#!lua name=lib2 + redis.redis.call('ping') + }]} e + assert_match {*Script attempted to access nonexistent global variable 'redis'*} $e + + catch {[r fcall f2 0]} e + assert_match {*can only be called on FUNCTION LOAD command*} $e + } + + test {LIBRARIES - delete removed all functions on library} { + r function delete lib1 + r function list + } {} + + test {LIBRARIES - register function inside a function} { + r function load {#!lua name=lib + redis.register_function( + 'f1', + function(keys, args) + redis.register_function( + 'f2', + function(key, args) + return 2 + end + ) + return 1 + end + ) + } + catch {r fcall f1 0} e + set _ $e + } {*attempt to call field 'register_function' (a nil value)*} + + test {LIBRARIES - register library with no functions} { + r function flush + catch { + r function load {#!lua name=lib + return 1 + } + } e + set _ $e + } {*No functions registered*} + + test {LIBRARIES - load timeout} { + catch { + r function load {#!lua name=lib + local a = 1 + while 1 do a = a + 1 end + } + } e + set _ $e + } {*FUNCTION LOAD timeout*} + + test {LIBRARIES - verify global protection on the load run} { + catch { + r function load {#!lua name=lib + a = 1 + } + } e + set _ $e + } {*Attempt to modify a readonly table*} + + test {LIBRARIES - named arguments} { + r function load {#!lua name=lib + redis.register_function{ + function_name='f1', + callback=function() + return 'hello' + end, + description='some desc' + } + } + r function list + } {{library_name lib engine LUA functions {{name f1 description {some desc} flags {}}}}} + + test {LIBRARIES - named arguments, bad function name} { + catch { + r function load replace {#!lua name=lib + redis.register_function{ + function_name=function() return 1 end, + callback=function() + return 'hello' + end, + description='some desc' + } + } + } e + set _ $e + } {*function_name argument given to redis.register_function must be a string*} + + test {LIBRARIES - named arguments, bad callback type} { + catch { + r function load replace {#!lua name=lib + redis.register_function{ + function_name='f1', + callback='bad', + description='some desc' + } + } + } e + set _ $e + } {*callback argument given to redis.register_function must be a function*} + + test {LIBRARIES - named arguments, bad description} { + catch { + r function load replace {#!lua name=lib + redis.register_function{ + function_name='f1', + callback=function() + return 'hello' + end, + description=function() return 1 end + } + } + } e + set _ $e + } {*description argument given to redis.register_function must be a string*} + + test {LIBRARIES - named arguments, unknown argument} { + catch { + r function load replace {#!lua name=lib + redis.register_function{ + function_name='f1', + callback=function() + return 'hello' + end, + description='desc', + some_unknown='unknown' + } + } + } e + set _ $e + } {*unknown argument given to redis.register_function*} + + test {LIBRARIES - named arguments, missing function name} { + catch { + r function load replace {#!lua name=lib + redis.register_function{ + callback=function() + return 'hello' + end, + description='desc' + } + } + } e + set _ $e + } {*redis.register_function must get a function name argument*} + + test {LIBRARIES - named arguments, missing callback} { + catch { + r function load replace {#!lua name=lib + redis.register_function{ + function_name='f1', + description='desc' + } + } + } e + set _ $e + } {*redis.register_function must get a callback argument*} + + test {FUNCTION - test function restore with function name collision} { + r function flush + r function load {#!lua name=lib1 + local function add1(a) + return a + 1 + end + redis.register_function( + 'f1', + function(keys, args) + return add1(1) + end + ) + redis.register_function( + 'f2', + function(keys, args) + return add1(2) + end + ) + redis.register_function( + 'f3', + function(keys, args) + return add1(3) + end + ) + } + set e [r function dump] + r function flush + + # load a library with different name but with the same function name + r function load {#!lua name=lib1 + redis.register_function( + 'f6', + function(keys, args) + return 7 + end + ) + } + r function load {#!lua name=lib2 + local function add1(a) + return a + 1 + end + redis.register_function( + 'f4', + function(keys, args) + return add1(4) + end + ) + redis.register_function( + 'f5', + function(keys, args) + return add1(5) + end + ) + redis.register_function( + 'f3', + function(keys, args) + return add1(3) + end + ) + } + + catch {r function restore $e} error + assert_match {*Library lib1 already exists*} $error + assert_equal [r fcall f3 0] {4} + assert_equal [r fcall f4 0] {5} + assert_equal [r fcall f5 0] {6} + assert_equal [r fcall f6 0] {7} + + catch {r function restore $e replace} error + assert_match {*Function f3 already exists*} $error + assert_equal [r fcall f3 0] {4} + assert_equal [r fcall f4 0] {5} + assert_equal [r fcall f5 0] {6} + assert_equal [r fcall f6 0] {7} + } + + test {FUNCTION - test function list with code} { + r function flush + r function load {#!lua name=library1 + redis.register_function('f6', function(keys, args) return 7 end) + } + r function list withcode + } {{library_name library1 engine LUA functions {{name f6 description {} flags {}}} library_code {*redis.register_function('f6', function(keys, args) return 7 end)*}}} + + test {FUNCTION - test function list with pattern} { + r function load {#!lua name=lib1 + redis.register_function('f7', function(keys, args) return 7 end) + } + r function list libraryname library* + } {{library_name library1 engine LUA functions {{name f6 description {} flags {}}}}} + + test {FUNCTION - test function list wrong argument} { + catch {r function list bad_argument} e + set _ $e + } {*Unknown argument bad_argument*} + + test {FUNCTION - test function list with bad argument to library name} { + catch {r function list libraryname} e + set _ $e + } {*library name argument was not given*} + + test {FUNCTION - test function list withcode multiple times} { + catch {r function list withcode withcode} e + set _ $e + } {*Unknown argument withcode*} + + test {FUNCTION - test function list libraryname multiple times} { + catch {r function list withcode libraryname foo libraryname foo} e + set _ $e + } {*Unknown argument libraryname*} + + test {FUNCTION - verify OOM on function load and function restore} { + r function flush + r function load replace {#!lua name=test + redis.register_function('f1', function() return 1 end) + } + set payload [r function dump] + r config set maxmemory 1 + + r function flush + catch {r function load replace {#!lua name=test + redis.register_function('f1', function() return 1 end) + }} e + assert_match {*command not allowed when used memory*} $e + + r function flush + catch {r function restore $payload} e + assert_match {*command not allowed when used memory*} $e + + r config set maxmemory 0 + } {OK} {needs:config-maxmemory} + + test {FUNCTION - verify allow-omm allows running any command} { + r FUNCTION load replace {#!lua name=f1 + redis.register_function{ + function_name='f1', + callback=function() return redis.call('set', 'x', '1') end, + flags={'allow-oom'} + } + } + + r config set maxmemory 1 + + assert_match {OK} [r fcall f1 1 x] + assert_match {1} [r get x] + + r config set maxmemory 0 + } {OK} {needs:config-maxmemory} +} + +start_server {tags {"scripting"}} { + test {FUNCTION - wrong flags type named arguments} { + catch {r function load replace {#!lua name=test + redis.register_function{ + function_name = 'f1', + callback = function() return 1 end, + flags = 'bad flags type' + } + }} e + set _ $e + } {*flags argument to redis.register_function must be a table representing function flags*} + + test {FUNCTION - wrong flag type} { + catch {r function load replace {#!lua name=test + redis.register_function{ + function_name = 'f1', + callback = function() return 1 end, + flags = {function() return 1 end} + } + }} e + set _ $e + } {*unknown flag given*} + + test {FUNCTION - unknown flag} { + catch {r function load replace {#!lua name=test + redis.register_function{ + function_name = 'f1', + callback = function() return 1 end, + flags = {'unknown'} + } + }} e + set _ $e + } {*unknown flag given*} + + test {FUNCTION - write script on fcall_ro} { + r function load replace {#!lua name=test + redis.register_function{ + function_name = 'f1', + callback = function() return redis.call('set', 'x', 1) end + } + } + catch {r fcall_ro f1 0} e + set _ $e + } {*Can not execute a script with write flag using \*_ro command*} + + test {FUNCTION - write script with no-writes flag} { + r function load replace {#!lua name=test + redis.register_function{ + function_name = 'f1', + callback = function() return redis.call('set', 'x', 1) end, + flags = {'no-writes'} + } + } + catch {r fcall f1 0} e + set _ $e + } {*Write commands are not allowed from read-only scripts*} + + test {FUNCTION - deny oom} { + r FUNCTION load replace {#!lua name=test + redis.register_function('f1', function() return redis.call('set', 'x', '1') end) + } + + r config set maxmemory 1 + + catch {[r fcall f1 1 k]} e + assert_match {OOM *when used memory > 'maxmemory'*} $e + + r config set maxmemory 0 + } {OK} {needs:config-maxmemory} + + test {FUNCTION - deny oom on no-writes function} { + r FUNCTION load replace {#!lua name=test + redis.register_function{function_name='f1', callback=function() return 'hello' end, flags={'no-writes'}} + } + + r config set maxmemory 1 + + assert_equal [r fcall f1 1 k] hello + assert_equal [r fcall_ro f1 1 k] hello + + r config set maxmemory 0 + } {OK} {needs:config-maxmemory} + + test {FUNCTION - allow stale} { + r FUNCTION load replace {#!lua name=test + redis.register_function{function_name='f1', callback=function() return 'hello' end, flags={'no-writes'}} + redis.register_function{function_name='f2', callback=function() return 'hello' end, flags={'allow-stale', 'no-writes'}} + redis.register_function{function_name='f3', callback=function() return redis.call('get', 'x') end, flags={'allow-stale', 'no-writes'}} + redis.register_function{function_name='f4', callback=function() return redis.call('info', 'server') end, flags={'allow-stale', 'no-writes'}} + } + + r config set replica-serve-stale-data no + r replicaof 127.0.0.1 1 + + catch {[r fcall f1 0]} e + assert_match {MASTERDOWN *} $e + + assert_equal {hello} [r fcall f2 0] + + catch {[r fcall f3 0]} e + assert_match {ERR *Can not execute the command on a stale replica*} $e + + assert_match {*redis_version*} [r fcall f4 0] + + r replicaof no one + r config set replica-serve-stale-data yes + set _ {} + } {} {external:skip} + + test {FUNCTION - redis version api} { + r FUNCTION load replace {#!lua name=test + local version = redis.REDIS_VERSION_NUM + + redis.register_function{function_name='get_version_v1', callback=function() + return string.format('%s.%s.%s', + bit.band(bit.rshift(version, 16), 0x000000ff), + bit.band(bit.rshift(version, 8), 0x000000ff), + bit.band(version, 0x000000ff)) + end} + redis.register_function{function_name='get_version_v2', callback=function() return redis.REDIS_VERSION end} + } + + catch {[r fcall f1 0]} e + assert_equal [r fcall get_version_v1 0] [r fcall get_version_v2 0] + } + + test {FUNCTION - function stats} { + r FUNCTION FLUSH + + r FUNCTION load {#!lua name=test1 + redis.register_function('f1', function() return 1 end) + redis.register_function('f2', function() return 1 end) + } + + r FUNCTION load {#!lua name=test2 + redis.register_function('f3', function() return 1 end) + } + + r function stats + } {running_script {} engines {LUA {libraries_count 2 functions_count 3}}} + + test {FUNCTION - function stats reloaded correctly from rdb} { + r debug reload + r function stats + } {running_script {} engines {LUA {libraries_count 2 functions_count 3}}} {needs:debug} + + test {FUNCTION - function stats delete library} { + r function delete test1 + r function stats + } {running_script {} engines {LUA {libraries_count 1 functions_count 1}}} + + test {FUNCTION - test function stats on loading failure} { + r FUNCTION FLUSH + + r FUNCTION load {#!lua name=test1 + redis.register_function('f1', function() return 1 end) + redis.register_function('f2', function() return 1 end) + } + + catch {r FUNCTION load {#!lua name=test1 + redis.register_function('f3', function() return 1 end) + }} e + assert_match "*Library 'test1' already exists*" $e + + + r function stats + } {running_script {} engines {LUA {libraries_count 1 functions_count 2}}} + + test {FUNCTION - function stats cleaned after flush} { + r function flush + r function stats + } {running_script {} engines {LUA {libraries_count 0 functions_count 0}}} + + test {FUNCTION - function test empty engine} { + catch {r function load replace {#! name=test + redis.register_function('foo', function() return 1 end) + }} e + set _ $e + } {ERR Engine '' not found} + + test {FUNCTION - function test unknown metadata value} { + catch {r function load replace {#!lua name=test foo=bar + redis.register_function('foo', function() return 1 end) + }} e + set _ $e + } {ERR Invalid metadata value given: foo=bar} + + test {FUNCTION - function test no name} { + catch {r function load replace {#!lua + redis.register_function('foo', function() return 1 end) + }} e + set _ $e + } {ERR Library name was not given} + + test {FUNCTION - function test multiple names} { + catch {r function load replace {#!lua name=foo name=bar + redis.register_function('foo', function() return 1 end) + }} e + set _ $e + } {ERR Invalid metadata value, name argument was given multiple times} + + test {FUNCTION - function test name with quotes} { + r function load replace {#!lua name="foo" + redis.register_function('foo', function() return 1 end) + } + } {foo} + + test {FUNCTION - trick global protection 1} { + r FUNCTION FLUSH + + r FUNCTION load {#!lua name=test1 + redis.register_function('f1', function() + mt = getmetatable(_G) + original_globals = mt.__index + original_globals['redis'] = function() return 1 end + end) + } + + catch {[r fcall f1 0]} e + set _ $e + } {*Attempt to modify a readonly table*} + + test {FUNCTION - test getmetatable on script load} { + r FUNCTION FLUSH + + catch { + r FUNCTION load {#!lua name=test1 + mt = getmetatable(_G) + } + } e + + set _ $e + } {*Script attempted to access nonexistent global variable 'getmetatable'*} + +} diff --git a/tests/unit/geo.tcl b/tests/unit/geo.tcl new file mode 100644 index 0000000..aa74855 --- /dev/null +++ b/tests/unit/geo.tcl @@ -0,0 +1,727 @@ +# Helper functions to simulate search-in-radius in the Tcl side in order to +# verify the Redis implementation with a fuzzy test. +proc geo_degrad deg {expr {$deg*(atan(1)*8/360)}} +proc geo_raddeg rad {expr {$rad/(atan(1)*8/360)}} + +proc geo_distance {lon1d lat1d lon2d lat2d} { + set lon1r [geo_degrad $lon1d] + set lat1r [geo_degrad $lat1d] + set lon2r [geo_degrad $lon2d] + set lat2r [geo_degrad $lat2d] + set v [expr {sin(($lon2r - $lon1r) / 2)}] + set u [expr {sin(($lat2r - $lat1r) / 2)}] + expr {2.0 * 6372797.560856 * \ + asin(sqrt($u * $u + cos($lat1r) * cos($lat2r) * $v * $v))} +} + +proc geo_random_point {lonvar latvar} { + upvar 1 $lonvar lon + upvar 1 $latvar lat + # Note that the actual latitude limit should be -85 to +85, we restrict + # the test to -70 to +70 since in this range the algorithm is more precise + # while outside this range occasionally some element may be missing. + set lon [expr {-180 + rand()*360}] + set lat [expr {-70 + rand()*140}] +} + +# Return elements non common to both the lists. +# This code is from http://wiki.tcl.tk/15489 +proc compare_lists {List1 List2} { + set DiffList {} + foreach Item $List1 { + if {[lsearch -exact $List2 $Item] == -1} { + lappend DiffList $Item + } + } + foreach Item $List2 { + if {[lsearch -exact $List1 $Item] == -1} { + if {[lsearch -exact $DiffList $Item] == -1} { + lappend DiffList $Item + } + } + } + return $DiffList +} + +# return true If a point in circle. +# search_lon and search_lat define the center of the circle, +# and lon, lat define the point being searched. +proc pointInCircle {radius_km lon lat search_lon search_lat} { + set radius_m [expr {$radius_km*1000}] + set distance [geo_distance $lon $lat $search_lon $search_lat] + if {$distance < $radius_m} { + return true + } + return false +} + +# return true If a point in rectangle. +# search_lon and search_lat define the center of the rectangle, +# and lon, lat define the point being searched. +# error: can adjust the width and height of the rectangle according to the error +proc pointInRectangle {width_km height_km lon lat search_lon search_lat error} { + set width_m [expr {$width_km*1000*$error/2}] + set height_m [expr {$height_km*1000*$error/2}] + set lon_distance [geo_distance $lon $lat $search_lon $lat] + set lat_distance [geo_distance $lon $lat $lon $search_lat] + + if {$lon_distance > $width_m || $lat_distance > $height_m} { + return false + } + return true +} + +proc verify_geo_edge_response_bylonlat {expected_response expected_store_response} { + catch {r georadius src{t} 1 1 1 km} response + assert_match $expected_response $response + + catch {r georadius src{t} 1 1 1 km store dest{t}} response + assert_match $expected_store_response $response + + catch {r geosearch src{t} fromlonlat 0 0 byradius 1 km} response + assert_match $expected_response $response + + catch {r geosearchstore dest{t} src{t} fromlonlat 0 0 byradius 1 km} response + assert_match $expected_store_response $response +} + +proc verify_geo_edge_response_bymember {expected_response expected_store_response} { + catch {r georadiusbymember src{t} member 1 km} response + assert_match $expected_response $response + + catch {r georadiusbymember src{t} member 1 km store dest{t}} response + assert_match $expected_store_response $response + + catch {r geosearch src{t} frommember member bybox 1 1 km} response + assert_match $expected_response $response + + catch {r geosearchstore dest{t} src{t} frommember member bybox 1 1 m} response + assert_match $expected_store_response $response +} + +# The following list represents sets of random seed, search position +# and radius that caused bugs in the past. It is used by the randomized +# test later as a starting point. When the regression vectors are scanned +# the code reverts to using random data. +# +# The format is: seed km lon lat +set regression_vectors { + {1482225976969 7083 81.634948934258375 30.561509253718668} + {1482340074151 5416 -70.863281847379767 -46.347003465679947} + {1499014685896 6064 -89.818768962202014 -40.463868561416803} + {1412 156 149.29737817929004 15.95807862745508} + {441574 143 59.235461856813856 66.269555127373678} + {160645 187 -101.88575239939883 49.061997951502917} + {750269 154 -90.187939661642517 66.615930412251487} + {342880 145 163.03472387745728 64.012747720821181} + {729955 143 137.86663517256579 63.986745399416776} + {939895 151 59.149620271823181 65.204186651485145} + {1412 156 149.29737817929004 15.95807862745508} + {564862 149 84.062063109158544 -65.685403922426232} + {1546032440391 16751 -1.8175081637769495 20.665668878082954} +} +set rv_idx 0 + +start_server {tags {"geo"}} { + test {GEO with wrong type src key} { + r set src{t} wrong_type + + verify_geo_edge_response_bylonlat "WRONGTYPE*" "WRONGTYPE*" + verify_geo_edge_response_bymember "WRONGTYPE*" "WRONGTYPE*" + } + + test {GEO with non existing src key} { + r del src{t} + + verify_geo_edge_response_bylonlat {} 0 + verify_geo_edge_response_bymember {} 0 + } + + test {GEO BYLONLAT with empty search} { + r del src{t} + r geoadd src{t} 13.361389 38.115556 "Palermo" 15.087269 37.502669 "Catania" + + verify_geo_edge_response_bylonlat {} 0 + } + + test {GEO BYMEMBER with non existing member} { + r del src{t} + r geoadd src{t} 13.361389 38.115556 "Palermo" 15.087269 37.502669 "Catania" + + verify_geo_edge_response_bymember "ERR*" "ERR*" + } + + test {GEOADD create} { + r geoadd nyc -73.9454966 40.747533 "lic market" + } {1} + + test {GEOADD update} { + r geoadd nyc -73.9454966 40.747533 "lic market" + } {0} + + test {GEOADD update with CH option} { + assert_equal 1 [r geoadd nyc CH 40.747533 -73.9454966 "lic market"] + lassign [lindex [r geopos nyc "lic market"] 0] x1 y1 + assert {abs($x1) - 40.747 < 0.001} + assert {abs($y1) - 73.945 < 0.001} + } {} + + test {GEOADD update with NX option} { + assert_equal 0 [r geoadd nyc NX -73.9454966 40.747533 "lic market"] + lassign [lindex [r geopos nyc "lic market"] 0] x1 y1 + assert {abs($x1) - 40.747 < 0.001} + assert {abs($y1) - 73.945 < 0.001} + } {} + + test {GEOADD update with XX option} { + assert_equal 0 [r geoadd nyc XX -83.9454966 40.747533 "lic market"] + lassign [lindex [r geopos nyc "lic market"] 0] x1 y1 + assert {abs($x1) - 83.945 < 0.001} + assert {abs($y1) - 40.747 < 0.001} + } {} + + test {GEOADD update with CH NX option} { + r geoadd nyc CH NX -73.9454966 40.747533 "lic market" + } {0} + + test {GEOADD update with CH XX option} { + r geoadd nyc CH XX -73.9454966 40.747533 "lic market" + } {1} + + test {GEOADD update with XX NX option will return syntax error} { + catch { + r geoadd nyc xx nx -73.9454966 40.747533 "lic market" + } err + set err + } {ERR *syntax*} + + test {GEOADD update with invalid option} { + catch { + r geoadd nyc ch xx foo -73.9454966 40.747533 "lic market" + } err + set err + } {ERR *syntax*} + + test {GEOADD invalid coordinates} { + catch { + r geoadd nyc -73.9454966 40.747533 "lic market" \ + foo bar "luck market" + } err + set err + } {*valid*} + + test {GEOADD multi add} { + r geoadd nyc -73.9733487 40.7648057 "central park n/q/r" -73.9903085 40.7362513 "union square" -74.0131604 40.7126674 "wtc one" -73.7858139 40.6428986 "jfk" -73.9375699 40.7498929 "q4" -73.9564142 40.7480973 4545 + } {6} + + test {Check geoset values} { + r zrange nyc 0 -1 withscores + } {{wtc one} 1791873972053020 {union square} 1791875485187452 {central park n/q/r} 1791875761332224 4545 1791875796750882 {lic market} 1791875804419201 q4 1791875830079666 jfk 1791895905559723} + + test {GEORADIUS simple (sorted)} { + r georadius nyc -73.9798091 40.7598464 3 km asc + } {{central park n/q/r} 4545 {union square}} + + test {GEOSEARCH simple (sorted)} { + r geosearch nyc fromlonlat -73.9798091 40.7598464 bybox 6 6 km asc + } {{central park n/q/r} 4545 {union square} {lic market}} + + test {GEOSEARCH FROMLONLAT and FROMMEMBER cannot exist at the same time} { + catch {r geosearch nyc fromlonlat -73.9798091 40.7598464 frommember xxx bybox 6 6 km asc} e + set e + } {ERR *syntax*} + + test {GEOSEARCH FROMLONLAT and FROMMEMBER one must exist} { + catch {r geosearch nyc bybox 3 3 km asc desc withhash withdist withcoord} e + set e + } {ERR *exactly one of FROMMEMBER or FROMLONLAT*} + + test {GEOSEARCH BYRADIUS and BYBOX cannot exist at the same time} { + catch {r geosearch nyc fromlonlat -73.9798091 40.7598464 byradius 3 km bybox 3 3 km asc} e + set e + } {ERR *syntax*} + + test {GEOSEARCH BYRADIUS and BYBOX one must exist} { + catch {r geosearch nyc fromlonlat -73.9798091 40.7598464 asc desc withhash withdist withcoord} e + set e + } {ERR *exactly one of BYRADIUS and BYBOX*} + + test {GEOSEARCH with STOREDIST option} { + catch {r geosearch nyc fromlonlat -73.9798091 40.7598464 bybox 6 6 km asc storedist} e + set e + } {ERR *syntax*} + + test {GEORADIUS withdist (sorted)} { + r georadius nyc -73.9798091 40.7598464 3 km withdist asc + } {{{central park n/q/r} 0.7750} {4545 2.3651} {{union square} 2.7697}} + + test {GEOSEARCH withdist (sorted)} { + r geosearch nyc fromlonlat -73.9798091 40.7598464 bybox 6 6 km withdist asc + } {{{central park n/q/r} 0.7750} {4545 2.3651} {{union square} 2.7697} {{lic market} 3.1991}} + + test {GEORADIUS with COUNT} { + r georadius nyc -73.9798091 40.7598464 10 km COUNT 3 + } {{central park n/q/r} 4545 {union square}} + + test {GEORADIUS with ANY not sorted by default} { + r georadius nyc -73.9798091 40.7598464 10 km COUNT 3 ANY + } {{wtc one} {union square} {central park n/q/r}} + + test {GEORADIUS with ANY sorted by ASC} { + r georadius nyc -73.9798091 40.7598464 10 km COUNT 3 ANY ASC + } {{central park n/q/r} {union square} {wtc one}} + + test {GEORADIUS with ANY but no COUNT} { + catch {r georadius nyc -73.9798091 40.7598464 10 km ANY ASC} e + set e + } {ERR *ANY*requires*COUNT*} + + test {GEORADIUS with COUNT but missing integer argument} { + catch {r georadius nyc -73.9798091 40.7598464 10 km COUNT} e + set e + } {ERR *syntax*} + + test {GEORADIUS with COUNT DESC} { + r georadius nyc -73.9798091 40.7598464 10 km COUNT 2 DESC + } {{wtc one} q4} + + test {GEORADIUS HUGE, issue #2767} { + r geoadd users -47.271613776683807 -54.534504198047678 user_000000 + llength [r GEORADIUS users 0 0 50000 km WITHCOORD] + } {1} + + test {GEORADIUSBYMEMBER simple (sorted)} { + r georadiusbymember nyc "wtc one" 7 km + } {{wtc one} {union square} {central park n/q/r} 4545 {lic market}} + + test {GEORADIUSBYMEMBER search areas contain satisfied points in oblique direction} { + r del k1 + + r geoadd k1 -0.15307903289794921875 85 n1 0.3515625 85.00019260486917005437 n2 + set ret1 [r GEORADIUSBYMEMBER k1 n1 4891.94 m] + assert_equal $ret1 {n1 n2} + + r zrem k1 n1 n2 + r geoadd k1 -4.95211958885192871094 85 n3 11.25 85.0511 n4 + set ret2 [r GEORADIUSBYMEMBER k1 n3 156544 m] + assert_equal $ret2 {n3 n4} + + r zrem k1 n3 n4 + r geoadd k1 -45 65.50900022111811438208 n5 90 85.0511 n6 + set ret3 [r GEORADIUSBYMEMBER k1 n5 5009431 m] + assert_equal $ret3 {n5 n6} + } + + test {GEORADIUSBYMEMBER crossing pole search} { + r del k1 + r geoadd k1 45 65 n1 -135 85.05 n2 + set ret [r GEORADIUSBYMEMBER k1 n1 5009431 m] + assert_equal $ret {n1 n2} + } + + test {GEOSEARCH FROMMEMBER simple (sorted)} { + r geosearch nyc frommember "wtc one" bybox 14 14 km + } {{wtc one} {union square} {central park n/q/r} 4545 {lic market} q4} + + test {GEOSEARCH vs GEORADIUS} { + r del Sicily + r geoadd Sicily 13.361389 38.115556 "Palermo" 15.087269 37.502669 "Catania" + r geoadd Sicily 12.758489 38.788135 "edge1" 17.241510 38.788135 "eage2" + set ret1 [r georadius Sicily 15 37 200 km asc] + assert_equal $ret1 {Catania Palermo} + set ret2 [r geosearch Sicily fromlonlat 15 37 bybox 400 400 km asc] + assert_equal $ret2 {Catania Palermo eage2 edge1} + } + + test {GEOSEARCH non square, long and narrow} { + r del Sicily + r geoadd Sicily 12.75 36.995 "test1" + r geoadd Sicily 12.75 36.50 "test2" + r geoadd Sicily 13.00 36.50 "test3" + # box height=2km width=400km + set ret1 [r geosearch Sicily fromlonlat 15 37 bybox 400 2 km] + assert_equal $ret1 {test1} + + # Add a western Hemisphere point + r geoadd Sicily -1 37.00 "test3" + set ret2 [r geosearch Sicily fromlonlat 15 37 bybox 3000 2 km asc] + assert_equal $ret2 {test1 test3} + } + + test {GEOSEARCH corner point test} { + r del Sicily + r geoadd Sicily 12.758489 38.788135 edge1 17.241510 38.788135 edge2 17.250000 35.202000 edge3 12.750000 35.202000 edge4 12.748489955781654 37 edge5 15 38.798135872540925 edge6 17.251510044218346 37 edge7 15 35.201864127459075 edge8 12.692799634687903 38.798135872540925 corner1 12.692799634687903 38.798135872540925 corner2 17.200560937451133 35.201864127459075 corner3 12.799439062548865 35.201864127459075 corner4 + set ret [lsort [r geosearch Sicily fromlonlat 15 37 bybox 400 400 km asc]] + assert_equal $ret {edge1 edge2 edge5 edge7} + } + + test {GEORADIUSBYMEMBER withdist (sorted)} { + r georadiusbymember nyc "wtc one" 7 km withdist + } {{{wtc one} 0.0000} {{union square} 3.2544} {{central park n/q/r} 6.7000} {4545 6.1975} {{lic market} 6.8969}} + + test {GEOHASH is able to return geohash strings} { + # Example from Wikipedia. + r del points + r geoadd points -5.6 42.6 test + lindex [r geohash points test] 0 + } {ezs42e44yx0} + + test {GEOPOS simple} { + r del points + r geoadd points 10 20 a 30 40 b + lassign [lindex [r geopos points a b] 0] x1 y1 + lassign [lindex [r geopos points a b] 1] x2 y2 + assert {abs($x1 - 10) < 0.001} + assert {abs($y1 - 20) < 0.001} + assert {abs($x2 - 30) < 0.001} + assert {abs($y2 - 40) < 0.001} + } + + test {GEOPOS missing element} { + r del points + r geoadd points 10 20 a 30 40 b + lindex [r geopos points a x b] 1 + } {} + + test {GEODIST simple & unit} { + r del points + r geoadd points 13.361389 38.115556 "Palermo" \ + 15.087269 37.502669 "Catania" + set m [r geodist points Palermo Catania] + assert {$m > 166274 && $m < 166275} + set km [r geodist points Palermo Catania km] + assert {$km > 166.2 && $km < 166.3} + set dist [r geodist points Palermo Palermo] + assert {$dist eq 0.0000} + } + + test {GEODIST missing elements} { + r del points + r geoadd points 13.361389 38.115556 "Palermo" \ + 15.087269 37.502669 "Catania" + set m [r geodist points Palermo Agrigento] + assert {$m eq {}} + set m [r geodist points Ragusa Agrigento] + assert {$m eq {}} + set m [r geodist empty_key Palermo Catania] + assert {$m eq {}} + } + + test {GEORADIUS STORE option: syntax error} { + r del points{t} + r geoadd points{t} 13.361389 38.115556 "Palermo" \ + 15.087269 37.502669 "Catania" + catch {r georadius points{t} 13.361389 38.115556 50 km store} e + set e + } {*ERR*syntax*} + + test {GEOSEARCHSTORE STORE option: syntax error} { + catch {r geosearchstore abc{t} points{t} fromlonlat 13.361389 38.115556 byradius 50 km store abc{t}} e + set e + } {*ERR*syntax*} + + test {GEORANGE STORE option: incompatible options} { + r del points{t} + r geoadd points{t} 13.361389 38.115556 "Palermo" \ + 15.087269 37.502669 "Catania" + catch {r georadius points{t} 13.361389 38.115556 50 km store points2{t} withdist} e + assert_match {*ERR*} $e + catch {r georadius points{t} 13.361389 38.115556 50 km store points2{t} withhash} e + assert_match {*ERR*} $e + catch {r georadius points{t} 13.361389 38.115556 50 km store points2{t} withcoords} e + assert_match {*ERR*} $e + } + + test {GEORANGE STORE option: plain usage} { + r del points{t} + r geoadd points{t} 13.361389 38.115556 "Palermo" \ + 15.087269 37.502669 "Catania" + r georadius points{t} 13.361389 38.115556 500 km store points2{t} + assert_equal [r zrange points{t} 0 -1] [r zrange points2{t} 0 -1] + } + + test {GEORADIUSBYMEMBER STORE/STOREDIST option: plain usage} { + r del points{t} + r geoadd points{t} 13.361389 38.115556 "Palermo" 15.087269 37.502669 "Catania" + + r georadiusbymember points{t} Palermo 500 km store points2{t} + assert_equal {Palermo Catania} [r zrange points2{t} 0 -1] + + r georadiusbymember points{t} Catania 500 km storedist points2{t} + assert_equal {Catania Palermo} [r zrange points2{t} 0 -1] + + set res [r zrange points2{t} 0 -1 withscores] + assert {[lindex $res 1] < 1} + assert {[lindex $res 3] > 166} + } + + test {GEOSEARCHSTORE STORE option: plain usage} { + r geosearchstore points2{t} points{t} fromlonlat 13.361389 38.115556 byradius 500 km + assert_equal [r zrange points{t} 0 -1] [r zrange points2{t} 0 -1] + } + + test {GEORANGE STOREDIST option: plain usage} { + r del points{t} + r geoadd points{t} 13.361389 38.115556 "Palermo" \ + 15.087269 37.502669 "Catania" + r georadius points{t} 13.361389 38.115556 500 km storedist points2{t} + set res [r zrange points2{t} 0 -1 withscores] + assert {[lindex $res 1] < 1} + assert {[lindex $res 3] > 166} + assert {[lindex $res 3] < 167} + } + + test {GEOSEARCHSTORE STOREDIST option: plain usage} { + r geosearchstore points2{t} points{t} fromlonlat 13.361389 38.115556 byradius 500 km storedist + set res [r zrange points2{t} 0 -1 withscores] + assert {[lindex $res 1] < 1} + assert {[lindex $res 3] > 166} + assert {[lindex $res 3] < 167} + } + + test {GEORANGE STOREDIST option: COUNT ASC and DESC} { + r del points{t} + r geoadd points{t} 13.361389 38.115556 "Palermo" \ + 15.087269 37.502669 "Catania" + r georadius points{t} 13.361389 38.115556 500 km storedist points2{t} asc count 1 + assert {[r zcard points2{t}] == 1} + set res [r zrange points2{t} 0 -1 withscores] + assert {[lindex $res 0] eq "Palermo"} + + r georadius points{t} 13.361389 38.115556 500 km storedist points2{t} desc count 1 + assert {[r zcard points2{t}] == 1} + set res [r zrange points2{t} 0 -1 withscores] + assert {[lindex $res 0] eq "Catania"} + } + + test {GEOSEARCH the box spans -180° or 180°} { + r del points + r geoadd points 179.5 36 point1 + r geoadd points -179.5 36 point2 + assert_equal {point1 point2} [r geosearch points fromlonlat 179 37 bybox 400 400 km asc] + assert_equal {point2 point1} [r geosearch points fromlonlat -179 37 bybox 400 400 km asc] + } + + test {GEOSEARCH with small distance} { + r del points + r geoadd points -122.407107 37.794300 1 + r geoadd points -122.227336 37.794300 2 + assert_equal {{1 0.0001} {2 9.8182}} [r GEORADIUS points -122.407107 37.794300 30 mi ASC WITHDIST] + } + + foreach {type} {byradius bybox} { + test "GEOSEARCH fuzzy test - $type" { + if {$::accurate} { set attempt 300 } else { set attempt 30 } + while {[incr attempt -1]} { + set rv [lindex $regression_vectors $rv_idx] + incr rv_idx + + set radius_km 0; set width_km 0; set height_km 0 + unset -nocomplain debuginfo + set srand_seed [clock milliseconds] + if {$rv ne {}} {set srand_seed [lindex $rv 0]} + lappend debuginfo "srand_seed is $srand_seed" + expr {srand($srand_seed)} ; # If you need a reproducible run + r del mypoints + + if {[randomInt 10] == 0} { + # From time to time use very big radiuses + if {$type == "byradius"} { + set radius_km [expr {[randomInt 5000]+10}] + } elseif {$type == "bybox"} { + set width_km [expr {[randomInt 5000]+10}] + set height_km [expr {[randomInt 5000]+10}] + } + } else { + # Normally use a few - ~200km radiuses to stress + # test the code the most in edge cases. + if {$type == "byradius"} { + set radius_km [expr {[randomInt 200]+10}] + } elseif {$type == "bybox"} { + set width_km [expr {[randomInt 200]+10}] + set height_km [expr {[randomInt 200]+10}] + } + } + if {$rv ne {}} { + set radius_km [lindex $rv 1] + set width_km [lindex $rv 1] + set height_km [lindex $rv 1] + } + geo_random_point search_lon search_lat + if {$rv ne {}} { + set search_lon [lindex $rv 2] + set search_lat [lindex $rv 3] + } + lappend debuginfo "Search area: $search_lon,$search_lat $radius_km $width_km $height_km km" + set tcl_result {} + set argv {} + for {set j 0} {$j < 20000} {incr j} { + geo_random_point lon lat + lappend argv $lon $lat "place:$j" + if {$type == "byradius"} { + if {[pointInCircle $radius_km $lon $lat $search_lon $search_lat]} { + lappend tcl_result "place:$j" + } + } elseif {$type == "bybox"} { + if {[pointInRectangle $width_km $height_km $lon $lat $search_lon $search_lat 1]} { + lappend tcl_result "place:$j" + } + } + lappend debuginfo "place:$j $lon $lat" + } + r geoadd mypoints {*}$argv + if {$type == "byradius"} { + set res [lsort [r geosearch mypoints fromlonlat $search_lon $search_lat byradius $radius_km km]] + } elseif {$type == "bybox"} { + set res [lsort [r geosearch mypoints fromlonlat $search_lon $search_lat bybox $width_km $height_km km]] + } + set res2 [lsort $tcl_result] + set test_result OK + + if {$res != $res2} { + set rounding_errors 0 + set diff [compare_lists $res $res2] + foreach place $diff { + lassign [lindex [r geopos mypoints $place] 0] lon lat + set mydist [geo_distance $lon $lat $search_lon $search_lat] + set mydist [expr $mydist/1000] + if {$type == "byradius"} { + if {($mydist / $radius_km) > 0.999} { + incr rounding_errors + continue + } + if {$mydist < [expr {$radius_km*1000}]} { + # This is a false positive for redis since given the + # same points the higher precision calculation provided + # by TCL shows the point within range + incr rounding_errors + continue + } + } elseif {$type == "bybox"} { + # we add 0.1% error for floating point calculation error + if {[pointInRectangle $width_km $height_km $lon $lat $search_lon $search_lat 1.001]} { + incr rounding_errors + continue + } + } + } + + # Make sure this is a real error and not a rounidng issue. + if {[llength $diff] == $rounding_errors} { + set res $res2; # Error silenced + } + } + + if {$res != $res2} { + set diff [compare_lists $res $res2] + puts "*** Possible problem in GEO radius query ***" + puts "Redis: $res" + puts "Tcl : $res2" + puts "Diff : $diff" + puts [join $debuginfo "\n"] + foreach place $diff { + if {[lsearch -exact $res2 $place] != -1} { + set where "(only in Tcl)" + } else { + set where "(only in Redis)" + } + lassign [lindex [r geopos mypoints $place] 0] lon lat + set mydist [geo_distance $lon $lat $search_lon $search_lat] + set mydist [expr $mydist/1000] + puts "$place -> [r geopos mypoints $place] $mydist $where" + } + set test_result FAIL + } + unset -nocomplain debuginfo + if {$test_result ne {OK}} break + } + set test_result + } {OK} + } + + test {GEOSEARCH box edges fuzzy test} { + if {$::accurate} { set attempt 300 } else { set attempt 30 } + while {[incr attempt -1]} { + unset -nocomplain debuginfo + set srand_seed [clock milliseconds] + lappend debuginfo "srand_seed is $srand_seed" + expr {srand($srand_seed)} ; # If you need a reproducible run + r del mypoints + + geo_random_point search_lon search_lat + set width_m [expr {[randomInt 10000]+10}] + set height_m [expr {[randomInt 10000]+10}] + set lat_delta [geo_raddeg [expr {$height_m/2/6372797.560856}]] + set long_delta_top [geo_raddeg [expr {$width_m/2/6372797.560856/cos([geo_degrad [expr {$search_lat+$lat_delta}]])}]] + set long_delta_middle [geo_raddeg [expr {$width_m/2/6372797.560856/cos([geo_degrad $search_lat])}]] + set long_delta_bottom [geo_raddeg [expr {$width_m/2/6372797.560856/cos([geo_degrad [expr {$search_lat-$lat_delta}]])}]] + + # Total of 8 points are generated, which are located at each vertex and the center of each side + set points(north) [list $search_lon [expr {$search_lat+$lat_delta}]] + set points(south) [list $search_lon [expr {$search_lat-$lat_delta}]] + set points(east) [list [expr {$search_lon+$long_delta_middle}] $search_lat] + set points(west) [list [expr {$search_lon-$long_delta_middle}] $search_lat] + set points(north_east) [list [expr {$search_lon+$long_delta_top}] [expr {$search_lat+$lat_delta}]] + set points(north_west) [list [expr {$search_lon-$long_delta_top}] [expr {$search_lat+$lat_delta}]] + set points(south_east) [list [expr {$search_lon+$long_delta_bottom}] [expr {$search_lat-$lat_delta}]] + set points(south_west) [list [expr {$search_lon-$long_delta_bottom}] [expr {$search_lat-$lat_delta}]] + + lappend debuginfo "Search area: geosearch mypoints fromlonlat $search_lon $search_lat bybox $width_m $height_m m" + set tcl_result {} + foreach name [array names points] { + set x [lindex $points($name) 0] + set y [lindex $points($name) 1] + # If longitude crosses -180° or 180°, we need to convert it. + # latitude doesn't have this problem, because it's scope is -70~70, see geo_random_point + if {$x > 180} { + set x [expr {$x-360}] + } elseif {$x < -180} { + set x [expr {$x+360}] + } + r geoadd mypoints $x $y place:$name + lappend tcl_result "place:$name" + lappend debuginfo "geoadd mypoints $x $y place:$name" + } + + set res2 [lsort $tcl_result] + + # make the box larger by two meter in each direction to put the coordinate slightly inside the box. + set height_new [expr {$height_m+4}] + set width_new [expr {$width_m+4}] + set res [lsort [r geosearch mypoints fromlonlat $search_lon $search_lat bybox $width_new $height_new m]] + if {$res != $res2} { + set diff [compare_lists $res $res2] + lappend debuginfo "res: $res, res2: $res2, diff: $diff" + fail "place should be found, debuginfo: $debuginfo, height_new: $height_new width_new: $width_new" + } + + # The width decreases and the height increases. Only north and south are found + set width_new [expr {$width_m-4}] + set height_new [expr {$height_m+4}] + set res [lsort [r geosearch mypoints fromlonlat $search_lon $search_lat bybox $width_new $height_new m]] + if {$res != {place:north place:south}} { + lappend debuginfo "res: $res" + fail "place should not be found, debuginfo: $debuginfo, height_new: $height_new width_new: $width_new" + } + + # The width increases and the height decreases. Only ease and west are found + set width_new [expr {$width_m+4}] + set height_new [expr {$height_m-4}] + set res [lsort [r geosearch mypoints fromlonlat $search_lon $search_lat bybox $width_new $height_new m]] + if {$res != {place:east place:west}} { + lappend debuginfo "res: $res" + fail "place should not be found, debuginfo: $debuginfo, height_new: $height_new width_new: $width_new" + } + + # make the box smaller by two meter in each direction to put the coordinate slightly outside the box. + set height_new [expr {$height_m-4}] + set width_new [expr {$width_m-4}] + set res [r geosearch mypoints fromlonlat $search_lon $search_lat bybox $width_new $height_new m] + if {$res != ""} { + lappend debuginfo "res: $res" + fail "place should not be found, debuginfo: $debuginfo, height_new: $height_new width_new: $width_new" + } + unset -nocomplain debuginfo + } + } +} diff --git a/tests/unit/hyperloglog.tcl b/tests/unit/hyperloglog.tcl new file mode 100644 index 0000000..ed09dac --- /dev/null +++ b/tests/unit/hyperloglog.tcl @@ -0,0 +1,214 @@ +start_server {tags {"hll"}} { + test {HyperLogLog self test passes} { + catch {r pfselftest} e + set e + } {OK} {needs:pfdebug} + + test {PFADD without arguments creates an HLL value} { + r pfadd hll + r exists hll + } {1} + + test {Approximated cardinality after creation is zero} { + r pfcount hll + } {0} + + test {PFADD returns 1 when at least 1 reg was modified} { + r pfadd hll a b c + } {1} + + test {PFADD returns 0 when no reg was modified} { + r pfadd hll a b c + } {0} + + test {PFADD works with empty string (regression)} { + r pfadd hll "" + } + + # Note that the self test stresses much better the + # cardinality estimation error. We are testing just the + # command implementation itself here. + test {PFCOUNT returns approximated cardinality of set} { + r del hll + set res {} + r pfadd hll 1 2 3 4 5 + lappend res [r pfcount hll] + # Call it again to test cached value invalidation. + r pfadd hll 6 7 8 8 9 10 + lappend res [r pfcount hll] + set res + } {5 10} + + test {HyperLogLogs are promote from sparse to dense} { + r del hll + r config set hll-sparse-max-bytes 3000 + set n 0 + while {$n < 100000} { + set elements {} + for {set j 0} {$j < 100} {incr j} {lappend elements [expr rand()]} + incr n 100 + r pfadd hll {*}$elements + set card [r pfcount hll] + set err [expr {abs($card-$n)}] + assert {$err < (double($card)/100)*5} + if {$n < 1000} { + assert {[r pfdebug encoding hll] eq {sparse}} + } elseif {$n > 10000} { + assert {[r pfdebug encoding hll] eq {dense}} + } + } + } {} {needs:pfdebug} + + test {HyperLogLog sparse encoding stress test} { + for {set x 0} {$x < 1000} {incr x} { + r del hll1 + r del hll2 + set numele [randomInt 100] + set elements {} + for {set j 0} {$j < $numele} {incr j} { + lappend elements [expr rand()] + } + # Force dense representation of hll2 + r pfadd hll2 + r pfdebug todense hll2 + r pfadd hll1 {*}$elements + r pfadd hll2 {*}$elements + assert {[r pfdebug encoding hll1] eq {sparse}} + assert {[r pfdebug encoding hll2] eq {dense}} + # Cardinality estimated should match exactly. + assert {[r pfcount hll1] eq [r pfcount hll2]} + } + } {} {needs:pfdebug} + + test {Corrupted sparse HyperLogLogs are detected: Additional at tail} { + r del hll + r pfadd hll a b c + r append hll "hello" + set e {} + catch {r pfcount hll} e + set e + } {*INVALIDOBJ*} + + test {Corrupted sparse HyperLogLogs are detected: Broken magic} { + r del hll + r pfadd hll a b c + r setrange hll 0 "0123" + set e {} + catch {r pfcount hll} e + set e + } {*WRONGTYPE*} + + test {Corrupted sparse HyperLogLogs are detected: Invalid encoding} { + r del hll + r pfadd hll a b c + r setrange hll 4 "x" + set e {} + catch {r pfcount hll} e + set e + } {*WRONGTYPE*} + + test {Corrupted dense HyperLogLogs are detected: Wrong length} { + r del hll + r pfadd hll a b c + r setrange hll 4 "\x00" + set e {} + catch {r pfcount hll} e + set e + } {*WRONGTYPE*} + + test {Fuzzing dense/sparse encoding: Redis should always detect errors} { + for {set j 0} {$j < 1000} {incr j} { + r del hll + set items {} + set numitems [randomInt 3000] + for {set i 0} {$i < $numitems} {incr i} { + lappend items [expr {rand()}] + } + r pfadd hll {*}$items + + # Corrupt it in some random way. + for {set i 0} {$i < 5} {incr i} { + set len [r strlen hll] + set pos [randomInt $len] + set byte [randstring 1 1 binary] + r setrange hll $pos $byte + # Don't modify more bytes 50% of times + if {rand() < 0.5} break + } + + # Use the hyperloglog to check if it crashes + # Redis in some way. + catch { + r pfcount hll + } + } + } + + test {PFADD, PFCOUNT, PFMERGE type checking works} { + r set foo{t} bar + catch {r pfadd foo{t} 1} e + assert_match {*WRONGTYPE*} $e + catch {r pfcount foo{t}} e + assert_match {*WRONGTYPE*} $e + catch {r pfmerge bar{t} foo{t}} e + assert_match {*WRONGTYPE*} $e + catch {r pfmerge foo{t} bar{t}} e + assert_match {*WRONGTYPE*} $e + } + + test {PFMERGE results on the cardinality of union of sets} { + r del hll{t} hll1{t} hll2{t} hll3{t} + r pfadd hll1{t} a b c + r pfadd hll2{t} b c d + r pfadd hll3{t} c d e + r pfmerge hll{t} hll1{t} hll2{t} hll3{t} + r pfcount hll{t} + } {5} + + test {PFCOUNT multiple-keys merge returns cardinality of union #1} { + r del hll1{t} hll2{t} hll3{t} + for {set x 1} {$x < 10000} {incr x} { + r pfadd hll1{t} "foo-$x" + r pfadd hll2{t} "bar-$x" + r pfadd hll3{t} "zap-$x" + + set card [r pfcount hll1{t} hll2{t} hll3{t}] + set realcard [expr {$x*3}] + set err [expr {abs($card-$realcard)}] + assert {$err < (double($card)/100)*5} + } + } + + test {PFCOUNT multiple-keys merge returns cardinality of union #2} { + r del hll1{t} hll2{t} hll3{t} + set elements {} + for {set x 1} {$x < 10000} {incr x} { + for {set j 1} {$j <= 3} {incr j} { + set rint [randomInt 20000] + r pfadd hll$j{t} $rint + lappend elements $rint + } + } + set realcard [llength [lsort -unique $elements]] + set card [r pfcount hll1{t} hll2{t} hll3{t}] + set err [expr {abs($card-$realcard)}] + assert {$err < (double($card)/100)*5} + } + + test {PFDEBUG GETREG returns the HyperLogLog raw registers} { + r del hll + r pfadd hll 1 2 3 + llength [r pfdebug getreg hll] + } {16384} {needs:pfdebug} + + test {PFADD / PFCOUNT cache invalidation works} { + r del hll + r pfadd hll a b c + r pfcount hll + assert {[r getrange hll 15 15] eq "\x00"} + r pfadd hll a b c + assert {[r getrange hll 15 15] eq "\x00"} + r pfadd hll 1 2 3 + assert {[r getrange hll 15 15] eq "\x80"} + } +} diff --git a/tests/unit/info-command.tcl b/tests/unit/info-command.tcl new file mode 100644 index 0000000..bc24ed2 --- /dev/null +++ b/tests/unit/info-command.tcl @@ -0,0 +1,62 @@ +start_server {tags {"info and its relative command"}} { + test "info command with at most one sub command" { + foreach arg {"" "all" "default" "everything"} { + if {$arg == ""} { + set info [r 0 info] + } else { + set info [r 0 info $arg] + } + + assert { [string match "*redis_version*" $info] } + assert { [string match "*used_cpu_user*" $info] } + assert { ![string match "*sentinel_tilt*" $info] } + assert { [string match "*used_memory*" $info] } + if {$arg == "" || $arg == "default"} { + assert { ![string match "*rejected_calls*" $info] } + } else { + assert { [string match "*rejected_calls*" $info] } + } + } + } + + test "info command with one sub-section" { + set info [r info cpu] + assert { [string match "*used_cpu_user*" $info] } + assert { ![string match "*sentinel_tilt*" $info] } + assert { ![string match "*used_memory*" $info] } + + set info [r info sentinel] + assert { ![string match "*sentinel_tilt*" $info] } + assert { ![string match "*used_memory*" $info] } + + set info [r info commandSTATS] ;# test case insensitive compare + assert { ![string match "*used_memory*" $info] } + assert { [string match "*rejected_calls*" $info] } + } + + test "info command with multiple sub-sections" { + set info [r info cpu sentinel] + assert { [string match "*used_cpu_user*" $info] } + assert { ![string match "*sentinel_tilt*" $info] } + assert { ![string match "*master_repl_offset*" $info] } + + set info [r info cpu all] + assert { [string match "*used_cpu_user*" $info] } + assert { ![string match "*sentinel_tilt*" $info] } + assert { [string match "*used_memory*" $info] } + assert { [string match "*master_repl_offset*" $info] } + assert { [string match "*rejected_calls*" $info] } + # check that we didn't get the same info twice + assert { ![string match "*used_cpu_user_children*used_cpu_user_children*" $info] } + + set info [r info cpu default] + assert { [string match "*used_cpu_user*" $info] } + assert { ![string match "*sentinel_tilt*" $info] } + assert { [string match "*used_memory*" $info] } + assert { [string match "*master_repl_offset*" $info] } + assert { ![string match "*rejected_calls*" $info] } + # check that we didn't get the same info twice + assert { ![string match "*used_cpu_user_children*used_cpu_user_children*" $info] } + } + +} diff --git a/tests/unit/info.tcl b/tests/unit/info.tcl new file mode 100644 index 0000000..759e5bc --- /dev/null +++ b/tests/unit/info.tcl @@ -0,0 +1,278 @@ +proc cmdstat {cmd} { + return [cmdrstat $cmd r] +} + +proc errorstat {cmd} { + return [errorrstat $cmd r] +} + +proc latency_percentiles_usec {cmd} { + return [latencyrstat_percentiles $cmd r] +} + +start_server {tags {"info" "external:skip"}} { + start_server {} { + + test {latencystats: disable/enable} { + r config resetstat + r CONFIG SET latency-tracking no + r set a b + assert_match {} [latency_percentiles_usec set] + r CONFIG SET latency-tracking yes + r set a b + assert_match {*p50=*,p99=*,p99.9=*} [latency_percentiles_usec set] + r config resetstat + assert_match {} [latency_percentiles_usec set] + } + + test {latencystats: configure percentiles} { + r config resetstat + assert_match {} [latency_percentiles_usec set] + r CONFIG SET latency-tracking yes + r SET a b + r GET a + assert_match {*p50=*,p99=*,p99.9=*} [latency_percentiles_usec set] + assert_match {*p50=*,p99=*,p99.9=*} [latency_percentiles_usec get] + r CONFIG SET latency-tracking-info-percentiles "0.0 50.0 100.0" + assert_match [r config get latency-tracking-info-percentiles] {latency-tracking-info-percentiles {0 50 100}} + assert_match {*p0=*,p50=*,p100=*} [latency_percentiles_usec set] + assert_match {*p0=*,p50=*,p100=*} [latency_percentiles_usec get] + r config resetstat + assert_match {} [latency_percentiles_usec set] + } + + test {latencystats: bad configure percentiles} { + r config resetstat + set configlatencyline [r config get latency-tracking-info-percentiles] + catch {r CONFIG SET latency-tracking-info-percentiles "10.0 50.0 a"} e + assert_match {ERR CONFIG SET failed*} $e + assert_equal [s total_error_replies] 1 + assert_match [r config get latency-tracking-info-percentiles] $configlatencyline + catch {r CONFIG SET latency-tracking-info-percentiles "10.0 50.0 101.0"} e + assert_match {ERR CONFIG SET failed*} $e + assert_equal [s total_error_replies] 2 + assert_match [r config get latency-tracking-info-percentiles] $configlatencyline + r config resetstat + assert_match {} [errorstat ERR] + } + + test {latencystats: blocking commands} { + r config resetstat + r CONFIG SET latency-tracking yes + r CONFIG SET latency-tracking-info-percentiles "50.0 99.0 99.9" + set rd [redis_deferring_client] + r del list1{t} + + $rd blpop list1{t} 0 + wait_for_blocked_client + r lpush list1{t} a + assert_equal [$rd read] {list1{t} a} + $rd blpop list1{t} 0 + wait_for_blocked_client + r lpush list1{t} b + assert_equal [$rd read] {list1{t} b} + assert_match {*p50=*,p99=*,p99.9=*} [latency_percentiles_usec blpop] + $rd close + } + + test {latencystats: subcommands} { + r config resetstat + r CONFIG SET latency-tracking yes + r CONFIG SET latency-tracking-info-percentiles "50.0 99.0 99.9" + r client id + + assert_match {*p50=*,p99=*,p99.9=*} [latency_percentiles_usec client\\|id] + assert_match {*p50=*,p99=*,p99.9=*} [latency_percentiles_usec config\\|set] + } + + test {latencystats: measure latency} { + r config resetstat + r CONFIG SET latency-tracking yes + r CONFIG SET latency-tracking-info-percentiles "50.0" + r DEBUG sleep 0.05 + r SET k v + set latencystatline_debug [latency_percentiles_usec debug] + set latencystatline_set [latency_percentiles_usec set] + regexp "p50=(.+\..+)" $latencystatline_debug -> p50_debug + regexp "p50=(.+\..+)" $latencystatline_set -> p50_set + assert {$p50_debug >= 50000} + assert {$p50_set >= 0} + assert {$p50_debug >= $p50_set} + } {} {needs:debug} + + test {errorstats: failed call authentication error} { + r config resetstat + assert_match {} [errorstat ERR] + assert_equal [s total_error_replies] 0 + catch {r auth k} e + assert_match {ERR AUTH*} $e + assert_match {*count=1*} [errorstat ERR] + assert_match {*calls=1,*,rejected_calls=0,failed_calls=1} [cmdstat auth] + assert_equal [s total_error_replies] 1 + r config resetstat + assert_match {} [errorstat ERR] + } + + test {errorstats: failed call within MULTI/EXEC} { + r config resetstat + assert_match {} [errorstat ERR] + assert_equal [s total_error_replies] 0 + r multi + r set a b + r auth a + catch {r exec} e + assert_match {ERR AUTH*} $e + assert_match {*count=1*} [errorstat ERR] + assert_match {*calls=1,*,rejected_calls=0,failed_calls=0} [cmdstat set] + assert_match {*calls=1,*,rejected_calls=0,failed_calls=1} [cmdstat auth] + assert_match {*calls=1,*,rejected_calls=0,failed_calls=0} [cmdstat exec] + assert_equal [s total_error_replies] 1 + + # MULTI/EXEC command errors should still be pinpointed to him + catch {r exec} e + assert_match {ERR EXEC without MULTI} $e + assert_match {*calls=2,*,rejected_calls=0,failed_calls=1} [cmdstat exec] + assert_match {*count=2*} [errorstat ERR] + assert_equal [s total_error_replies] 2 + } + + test {errorstats: failed call within LUA} { + r config resetstat + assert_match {} [errorstat ERR] + assert_equal [s total_error_replies] 0 + catch {r eval {redis.pcall('XGROUP', 'CREATECONSUMER', 's1', 'mygroup', 'consumer') return } 0} e + assert_match {*count=1*} [errorstat ERR] + assert_match {*calls=1,*,rejected_calls=0,failed_calls=1} [cmdstat xgroup\\|createconsumer] + assert_match {*calls=1,*,rejected_calls=0,failed_calls=0} [cmdstat eval] + + # EVAL command errors should still be pinpointed to him + catch {r eval a} e + assert_match {ERR wrong*} $e + assert_match {*calls=1,*,rejected_calls=1,failed_calls=0} [cmdstat eval] + assert_match {*count=2*} [errorstat ERR] + assert_equal [s total_error_replies] 2 + } + + test {errorstats: failed call NOSCRIPT error} { + r config resetstat + assert_equal [s total_error_replies] 0 + assert_match {} [errorstat NOSCRIPT] + catch {r evalsha NotValidShaSUM 0} e + assert_match {NOSCRIPT*} $e + assert_match {*count=1*} [errorstat NOSCRIPT] + assert_match {*calls=1,*,rejected_calls=0,failed_calls=1} [cmdstat evalsha] + assert_equal [s total_error_replies] 1 + r config resetstat + assert_match {} [errorstat NOSCRIPT] + } + + test {errorstats: failed call NOGROUP error} { + r config resetstat + assert_match {} [errorstat NOGROUP] + r del mystream + r XADD mystream * f v + catch {r XGROUP CREATECONSUMER mystream mygroup consumer} e + assert_match {NOGROUP*} $e + assert_match {*count=1*} [errorstat NOGROUP] + assert_match {*calls=1,*,rejected_calls=0,failed_calls=1} [cmdstat xgroup\\|createconsumer] + r config resetstat + assert_match {} [errorstat NOGROUP] + } + + test {errorstats: rejected call unknown command} { + r config resetstat + assert_equal [s total_error_replies] 0 + assert_match {} [errorstat ERR] + catch {r asdf} e + assert_match {ERR unknown*} $e + assert_match {*count=1*} [errorstat ERR] + assert_equal [s total_error_replies] 1 + r config resetstat + assert_match {} [errorstat ERR] + } + + test {errorstats: rejected call within MULTI/EXEC} { + r config resetstat + assert_equal [s total_error_replies] 0 + assert_match {} [errorstat ERR] + r multi + catch {r set} e + assert_match {ERR wrong number of arguments for 'set' command} $e + catch {r exec} e + assert_match {EXECABORT*} $e + assert_match {*count=1*} [errorstat ERR] + assert_match {*count=1*} [errorstat EXECABORT] + assert_equal [s total_error_replies] 2 + assert_match {*calls=0,*,rejected_calls=1,failed_calls=0} [cmdstat set] + assert_match {*calls=1,*,rejected_calls=0,failed_calls=0} [cmdstat multi] + assert_match {*calls=1,*,rejected_calls=0,failed_calls=1} [cmdstat exec] + assert_equal [s total_error_replies] 2 + r config resetstat + assert_match {} [errorstat ERR] + } + + test {errorstats: rejected call due to wrong arity} { + r config resetstat + assert_equal [s total_error_replies] 0 + assert_match {} [errorstat ERR] + catch {r set k} e + assert_match {ERR wrong number of arguments for 'set' command} $e + assert_match {*count=1*} [errorstat ERR] + assert_match {*calls=0,*,rejected_calls=1,failed_calls=0} [cmdstat set] + # ensure that after a rejected command, valid ones are counted properly + r set k1 v1 + r set k2 v2 + assert_match {calls=2,*,rejected_calls=1,failed_calls=0} [cmdstat set] + assert_equal [s total_error_replies] 1 + } + + test {errorstats: rejected call by OOM error} { + r config resetstat + assert_equal [s total_error_replies] 0 + assert_match {} [errorstat OOM] + r config set maxmemory 1 + catch {r set a b} e + assert_match {OOM*} $e + assert_match {*count=1*} [errorstat OOM] + assert_match {*calls=0,*,rejected_calls=1,failed_calls=0} [cmdstat set] + assert_equal [s total_error_replies] 1 + r config resetstat + assert_match {} [errorstat OOM] + r config set maxmemory 0 + } + + test {errorstats: rejected call by authorization error} { + r config resetstat + assert_equal [s total_error_replies] 0 + assert_match {} [errorstat NOPERM] + r ACL SETUSER alice on >p1pp0 ~cached:* +get +info +config + r auth alice p1pp0 + catch {r set a b} e + assert_match {NOPERM*} $e + assert_match {*count=1*} [errorstat NOPERM] + assert_match {*calls=0,*,rejected_calls=1,failed_calls=0} [cmdstat set] + assert_equal [s total_error_replies] 1 + r config resetstat + assert_match {} [errorstat NOPERM] + r auth default "" + } + + test {errorstats: blocking commands} { + r config resetstat + set rd [redis_deferring_client] + $rd client id + set rd_id [$rd read] + r del list1{t} + + $rd blpop list1{t} 0 + wait_for_blocked_client + r client unblock $rd_id error + assert_error {UNBLOCKED*} {$rd read} + assert_match {*count=1*} [errorstat UNBLOCKED] + assert_match {*calls=1,*,rejected_calls=0,failed_calls=1} [cmdstat blpop] + assert_equal [s total_error_replies] 1 + $rd close + } + + } +} diff --git a/tests/unit/introspection-2.tcl b/tests/unit/introspection-2.tcl new file mode 100644 index 0000000..116ae0b --- /dev/null +++ b/tests/unit/introspection-2.tcl @@ -0,0 +1,209 @@ +proc cmdstat {cmd} { + return [cmdrstat $cmd r] +} + +start_server {tags {"introspection"}} { + test {TTL, TYPE and EXISTS do not alter the last access time of a key} { + r set foo bar + after 3000 + r ttl foo + r type foo + r exists foo + assert {[r object idletime foo] >= 2} + } + + test {TOUCH alters the last access time of a key} { + r set foo bar + after 3000 + r touch foo + assert {[r object idletime foo] < 2} + } + + test {TOUCH returns the number of existing keys specified} { + r flushdb + r set key1{t} 1 + r set key2{t} 2 + r touch key0{t} key1{t} key2{t} key3{t} + } 2 + + test {command stats for GEOADD} { + r config resetstat + r GEOADD foo 0 0 bar + assert_match {*calls=1,*} [cmdstat geoadd] + assert_match {} [cmdstat zadd] + } {} {needs:config-resetstat} + + test {errors stats for GEOADD} { + r config resetstat + # make sure geo command will failed + r set foo 1 + assert_error {WRONGTYPE Operation against a key holding the wrong kind of value*} {r GEOADD foo 0 0 bar} + assert_match {*calls=1*,rejected_calls=0,failed_calls=1*} [cmdstat geoadd] + assert_match {} [cmdstat zadd] + } {} {needs:config-resetstat} + + test {command stats for EXPIRE} { + r config resetstat + r SET foo bar + r EXPIRE foo 0 + assert_match {*calls=1,*} [cmdstat expire] + assert_match {} [cmdstat del] + } {} {needs:config-resetstat} + + test {command stats for BRPOP} { + r config resetstat + r LPUSH list foo + r BRPOP list 0 + assert_match {*calls=1,*} [cmdstat brpop] + assert_match {} [cmdstat rpop] + } {} {needs:config-resetstat} + + test {command stats for MULTI} { + r config resetstat + r MULTI + r set foo{t} bar + r GEOADD foo2{t} 0 0 bar + r EXPIRE foo2{t} 0 + r EXEC + assert_match {*calls=1,*} [cmdstat multi] + assert_match {*calls=1,*} [cmdstat exec] + assert_match {*calls=1,*} [cmdstat set] + assert_match {*calls=1,*} [cmdstat expire] + assert_match {*calls=1,*} [cmdstat geoadd] + } {} {needs:config-resetstat} + + test {command stats for scripts} { + r config resetstat + r set mykey myval + r eval { + redis.call('set', KEYS[1], 0) + redis.call('expire', KEYS[1], 0) + redis.call('geoadd', KEYS[1], 0, 0, "bar") + } 1 mykey + assert_match {*calls=1,*} [cmdstat eval] + assert_match {*calls=2,*} [cmdstat set] + assert_match {*calls=1,*} [cmdstat expire] + assert_match {*calls=1,*} [cmdstat geoadd] + } {} {needs:config-resetstat} + + test {COMMAND GETKEYS GET} { + assert_equal {key} [r command getkeys get key] + } + + test {COMMAND GETKEYSANDFLAGS} { + assert_equal {{k1 {OW update}}} [r command getkeysandflags set k1 v1] + assert_equal {{k1 {OW update}} {k2 {OW update}}} [r command getkeysandflags mset k1 v1 k2 v2] + assert_equal {{k1 {RW access delete}} {k2 {RW insert}}} [r command getkeysandflags LMOVE k1 k2 left right] + assert_equal {{k1 {RO access}} {k2 {OW update}}} [r command getkeysandflags sort k1 store k2] + } + + test {COMMAND GETKEYS MEMORY USAGE} { + assert_equal {key} [r command getkeys memory usage key] + } + + test {COMMAND GETKEYS XGROUP} { + assert_equal {key} [r command getkeys xgroup create key groupname $] + } + + test {COMMAND GETKEYS EVAL with keys} { + assert_equal {key} [r command getkeys eval "return 1" 1 key] + } + + test {COMMAND GETKEYS EVAL without keys} { + assert_equal {} [r command getkeys eval "return 1" 0] + } + + test {COMMAND GETKEYS LCS} { + assert_equal {key1 key2} [r command getkeys lcs key1 key2] + } + + test {COMMAND GETKEYS MORE THAN 256 KEYS} { + set all_keys [list] + set numkeys 260 + for {set i 1} {$i <= $numkeys} {incr i} { + lappend all_keys "key$i" + } + set all_keys_with_target [linsert $all_keys 0 target] + # we are using ZUNIONSTORE command since in order to reproduce allocation of a new buffer in getKeysPrepareResult + # when numkeys in result > 0 + # we need a command that the final number of keys is not known in the first call to getKeysPrepareResult + # before the fix in that case data of old buffer was not copied to the new result buffer + # causing all previous keys (numkeys) data to be uninitialize + assert_equal $all_keys_with_target [r command getkeys ZUNIONSTORE target $numkeys {*}$all_keys] + } + + test "COMMAND LIST syntax error" { + assert_error "ERR syntax error*" {r command list bad_arg} + assert_error "ERR syntax error*" {r command list filterby bad_arg} + assert_error "ERR syntax error*" {r command list filterby bad_arg bad_arg2} + } + + test "COMMAND LIST WITHOUT FILTERBY" { + set commands [r command list] + assert_not_equal [lsearch $commands "set"] -1 + assert_not_equal [lsearch $commands "client|list"] -1 + } + + test "COMMAND LIST FILTERBY ACLCAT against non existing category" { + assert_equal {} [r command list filterby aclcat non_existing_category] + } + + test "COMMAND LIST FILTERBY ACLCAT - list all commands/subcommands" { + set commands [r command list filterby aclcat scripting] + assert_not_equal [lsearch $commands "eval"] -1 + assert_not_equal [lsearch $commands "script|kill"] -1 + + # Negative check, a command that should not be here + assert_equal [lsearch $commands "set"] -1 + } + + test "COMMAND LIST FILTERBY PATTERN - list all commands/subcommands" { + # Exact command match. + assert_equal {set} [r command list filterby pattern set] + assert_equal {get} [r command list filterby pattern get] + + # Return the parent command and all the subcommands below it. + set commands [r command list filterby pattern config*] + assert_not_equal [lsearch $commands "config"] -1 + assert_not_equal [lsearch $commands "config|get"] -1 + + # We can filter subcommands under a parent command. + set commands [r command list filterby pattern config|*re*] + assert_not_equal [lsearch $commands "config|resetstat"] -1 + assert_not_equal [lsearch $commands "config|rewrite"] -1 + + # We can filter subcommands across parent commands. + set commands [r command list filterby pattern cl*help] + assert_not_equal [lsearch $commands "client|help"] -1 + assert_not_equal [lsearch $commands "cluster|help"] -1 + + # Negative check, command that doesn't exist. + assert_equal {} [r command list filterby pattern non_exists] + assert_equal {} [r command list filterby pattern non_exists*] + } + + test "COMMAND LIST FILTERBY MODULE against non existing module" { + # This should be empty, the real one is in subcommands.tcl + assert_equal {} [r command list filterby module non_existing_module] + } + + test {COMMAND INFO of invalid subcommands} { + assert_equal {{}} [r command info get|key] + assert_equal {{}} [r command info config|get|key] + } + + foreach cmd {SET GET MSET BITFIELD LMOVE LPOP BLPOP PING MEMORY MEMORY|USAGE RENAME GEORADIUS_RO} { + test "$cmd command will not be marked with movablekeys" { + set info [lindex [r command info $cmd] 0] + assert_no_match {*movablekeys*} [lindex $info 2] + } + } + + foreach cmd {ZUNIONSTORE XREAD EVAL SORT SORT_RO MIGRATE GEORADIUS} { + test "$cmd command is marked with movablekeys" { + set info [lindex [r command info $cmd] 0] + assert_match {*movablekeys*} [lindex $info 2] + } + } + +} diff --git a/tests/unit/introspection.tcl b/tests/unit/introspection.tcl new file mode 100644 index 0000000..460e7e2 --- /dev/null +++ b/tests/unit/introspection.tcl @@ -0,0 +1,714 @@ +start_server {tags {"introspection"}} { + test "PING" { + assert_equal {PONG} [r ping] + assert_equal {redis} [r ping redis] + assert_error {*wrong number of arguments for 'ping' command} {r ping hello redis} + } + + test {CLIENT LIST} { + r client list + } {id=* addr=*:* laddr=*:* fd=* name=* age=* idle=* flags=N db=* sub=0 psub=0 ssub=0 multi=-1 qbuf=26 qbuf-free=* argv-mem=* multi-mem=0 rbs=* rbp=* obl=0 oll=0 omem=0 tot-mem=* events=r cmd=client|list user=* redir=-1 resp=2*} + + test {CLIENT LIST with IDs} { + set myid [r client id] + set cl [split [r client list id $myid] "\r\n"] + assert_match "id=$myid * cmd=client|list *" [lindex $cl 0] + } + + test {CLIENT INFO} { + r client info + } {id=* addr=*:* laddr=*:* fd=* name=* age=* idle=* flags=N db=* sub=0 psub=0 ssub=0 multi=-1 qbuf=26 qbuf-free=* argv-mem=* multi-mem=0 rbs=* rbp=* obl=0 oll=0 omem=0 tot-mem=* events=r cmd=client|info user=* redir=-1 resp=2*} + + test {CLIENT KILL with illegal arguments} { + assert_error "ERR wrong number of arguments for 'client|kill' command" {r client kill} + assert_error "ERR syntax error*" {r client kill id 10 wrong_arg} + + assert_error "ERR *greater than 0*" {r client kill id str} + assert_error "ERR *greater than 0*" {r client kill id -1} + assert_error "ERR *greater than 0*" {r client kill id 0} + + assert_error "ERR Unknown client type*" {r client kill type wrong_type} + + assert_error "ERR No such user*" {r client kill user wrong_user} + + assert_error "ERR syntax error*" {r client kill skipme yes_or_no} + } + + test {CLIENT KILL SKIPME YES/NO will kill all clients} { + # Kill all clients except `me` + set rd1 [redis_deferring_client] + set rd2 [redis_deferring_client] + set connected_clients [s connected_clients] + assert {$connected_clients >= 3} + set res [r client kill skipme yes] + assert {$res == $connected_clients - 1} + + # Kill all clients, including `me` + set rd3 [redis_deferring_client] + set rd4 [redis_deferring_client] + set connected_clients [s connected_clients] + assert {$connected_clients == 3} + set res [r client kill skipme no] + assert_equal $res $connected_clients + + # After killing `me`, the first ping will throw an error + assert_error "*I/O error*" {r ping} + assert_equal "PONG" [r ping] + } + + test "CLIENT REPLY OFF/ON: disable all commands reply" { + set rd [redis_deferring_client] + + # These replies were silenced. + $rd client reply off + $rd ping pong + $rd ping pong2 + + $rd client reply on + assert_equal {OK} [$rd read] + $rd ping pong3 + assert_equal {pong3} [$rd read] + + $rd close + } + + test "CLIENT REPLY SKIP: skip the next command reply" { + set rd [redis_deferring_client] + + # The first pong reply was silenced. + $rd client reply skip + $rd ping pong + + $rd ping pong2 + assert_equal {pong2} [$rd read] + + $rd close + } + + test "CLIENT REPLY ON: unset SKIP flag" { + set rd [redis_deferring_client] + + $rd client reply skip + $rd client reply on + assert_equal {OK} [$rd read] ;# OK from CLIENT REPLY ON command + + $rd ping + assert_equal {PONG} [$rd read] + + $rd close + } + + test {MONITOR can log executed commands} { + set rd [redis_deferring_client] + $rd monitor + assert_match {*OK*} [$rd read] + r set foo bar + r get foo + set res [list [$rd read] [$rd read]] + $rd close + set _ $res + } {*"set" "foo"*"get" "foo"*} + + test {MONITOR can log commands issued by the scripting engine} { + set rd [redis_deferring_client] + $rd monitor + $rd read ;# Discard the OK + r eval {redis.call('set',KEYS[1],ARGV[1])} 1 foo bar + assert_match {*eval*} [$rd read] + assert_match {*lua*"set"*"foo"*"bar"*} [$rd read] + $rd close + } + + test {MONITOR can log commands issued by functions} { + r function load replace {#!lua name=test + redis.register_function('test', function() return redis.call('set', 'foo', 'bar') end) + } + set rd [redis_deferring_client] + $rd monitor + $rd read ;# Discard the OK + r fcall test 0 + assert_match {*fcall*test*} [$rd read] + assert_match {*lua*"set"*"foo"*"bar"*} [$rd read] + $rd close + } + + test {MONITOR supports redacting command arguments} { + set rd [redis_deferring_client] + $rd monitor + $rd read ; # Discard the OK + + r migrate [srv 0 host] [srv 0 port] key 9 5000 + r migrate [srv 0 host] [srv 0 port] key 9 5000 AUTH user + r migrate [srv 0 host] [srv 0 port] key 9 5000 AUTH2 user password + catch {r auth not-real} _ + catch {r auth not-real not-a-password} _ + catch {r hello 2 AUTH not-real not-a-password} _ + + assert_match {*"key"*"9"*"5000"*} [$rd read] + assert_match {*"key"*"9"*"5000"*"(redacted)"*} [$rd read] + assert_match {*"key"*"9"*"5000"*"(redacted)"*"(redacted)"*} [$rd read] + assert_match {*"auth"*"(redacted)"*} [$rd read] + assert_match {*"auth"*"(redacted)"*"(redacted)"*} [$rd read] + assert_match {*"hello"*"2"*"AUTH"*"(redacted)"*"(redacted)"*} [$rd read] + $rd close + } {0} {needs:repl} + + test {MONITOR correctly handles multi-exec cases} { + set rd [redis_deferring_client] + $rd monitor + $rd read ; # Discard the OK + + # Make sure multi-exec statements are ordered + # correctly + r multi + r set foo bar + r exec + assert_match {*"multi"*} [$rd read] + assert_match {*"set"*"foo"*"bar"*} [$rd read] + assert_match {*"exec"*} [$rd read] + + # Make sure we close multi statements on errors + r multi + catch {r syntax error} _ + catch {r exec} _ + + assert_match {*"multi"*} [$rd read] + assert_match {*"exec"*} [$rd read] + + $rd close + } + + test {CLIENT GETNAME should return NIL if name is not assigned} { + r client getname + } {} + + test {CLIENT LIST shows empty fields for unassigned names} { + r client list + } {*name= *} + + test {CLIENT SETNAME does not accept spaces} { + catch {r client setname "foo bar"} e + set e + } {ERR*} + + test {CLIENT SETNAME can assign a name to this connection} { + assert_equal [r client setname myname] {OK} + r client list + } {*name=myname*} + + test {CLIENT SETNAME can change the name of an existing connection} { + assert_equal [r client setname someothername] {OK} + r client list + } {*name=someothername*} + + test {After CLIENT SETNAME, connection can still be closed} { + set rd [redis_deferring_client] + $rd client setname foobar + assert_equal [$rd read] "OK" + assert_match {*foobar*} [r client list] + $rd close + # Now the client should no longer be listed + wait_for_condition 50 100 { + [string match {*foobar*} [r client list]] == 0 + } else { + fail "Client still listed in CLIENT LIST after SETNAME." + } + } + + test {CONFIG save params special case handled properly} { + # No "save" keyword - defaults should apply + start_server {config "minimal.conf"} { + assert_match [r config get save] {save {3600 1 300 100 60 10000}} + } + + # First "save" keyword overrides hard coded defaults + start_server {config "minimal.conf" overrides {save {100 100}}} { + # Defaults + assert_match [r config get save] {save {100 100}} + } + + # First "save" keyword in default config file + start_server {config "default.conf"} { + assert_match [r config get save] {save {900 1}} + } + + # First "save" keyword appends default from config file + start_server {config "default.conf" args {--save 100 100}} { + assert_match [r config get save] {save {900 1 100 100}} + } + + # Empty "save" keyword resets all + start_server {config "default.conf" args {--save {}}} { + assert_match [r config get save] {save {}} + } + } {} {external:skip} + + test {CONFIG sanity} { + # Do CONFIG GET, CONFIG SET and then CONFIG GET again + # Skip immutable configs, one with no get, and other complicated configs + set skip_configs { + rdbchecksum + daemonize + io-threads-do-reads + tcp-backlog + always-show-logo + syslog-enabled + cluster-enabled + disable-thp + aclfile + unixsocket + pidfile + syslog-ident + appendfilename + appenddirname + supervised + syslog-facility + databases + io-threads + logfile + unixsocketperm + replicaof + slaveof + requirepass + server_cpulist + bio_cpulist + aof_rewrite_cpulist + bgsave_cpulist + set-proc-title + cluster-config-file + cluster-port + oom-score-adj + oom-score-adj-values + enable-protected-configs + enable-debug-command + enable-module-command + dbfilename + logfile + dir + socket-mark-id + } + + if {!$::tls} { + append skip_configs { + tls-prefer-server-ciphers + tls-session-cache-timeout + tls-session-cache-size + tls-session-caching + tls-cert-file + tls-key-file + tls-client-cert-file + tls-client-key-file + tls-dh-params-file + tls-ca-cert-file + tls-ca-cert-dir + tls-protocols + tls-ciphers + tls-ciphersuites + tls-port + } + } + + set configs {} + foreach {k v} [r config get *] { + if {[lsearch $skip_configs $k] != -1} { + continue + } + dict set configs $k $v + # try to set the config to the same value it already has + r config set $k $v + } + + set newconfigs {} + foreach {k v} [r config get *] { + if {[lsearch $skip_configs $k] != -1} { + continue + } + dict set newconfigs $k $v + } + + dict for {k v} $configs { + set vv [dict get $newconfigs $k] + if {$v != $vv} { + fail "config $k mismatch, expecting $v but got $vv" + } + + } + } + + # Do a force-all config rewrite and make sure we're able to parse + # it. + test {CONFIG REWRITE sanity} { + # Capture state of config before + set configs {} + foreach {k v} [r config get *] { + dict set configs $k $v + } + + # Rewrite entire configuration, restart and confirm the + # server is able to parse it and start. + assert_equal [r debug config-rewrite-force-all] "OK" + restart_server 0 true false + wait_done_loading r + + # Verify no changes were introduced + dict for {k v} $configs { + assert_equal $v [lindex [r config get $k] 1] + } + } {} {external:skip} + + test {CONFIG REWRITE handles save and shutdown properly} { + r config set save "3600 1 300 100 60 10000" + r config set shutdown-on-sigterm "nosave now" + r config set shutdown-on-sigint "save" + r config rewrite + restart_server 0 true false + assert_equal [r config get save] {save {3600 1 300 100 60 10000}} + assert_equal [r config get shutdown-on-sigterm] {shutdown-on-sigterm {nosave now}} + assert_equal [r config get shutdown-on-sigint] {shutdown-on-sigint save} + + r config set save "" + r config set shutdown-on-sigterm "default" + r config rewrite + restart_server 0 true false + assert_equal [r config get save] {save {}} + assert_equal [r config get shutdown-on-sigterm] {shutdown-on-sigterm default} + + start_server {config "minimal.conf"} { + assert_equal [r config get save] {save {3600 1 300 100 60 10000}} + r config set save "" + r config rewrite + restart_server 0 true false + assert_equal [r config get save] {save {}} + } + } {} {external:skip} + + test {CONFIG SET with multiple args} { + set some_configs {maxmemory 10000001 repl-backlog-size 10000002 save {3000 5}} + + # Backup + set backups {} + foreach c [dict keys $some_configs] { + lappend backups $c [lindex [r config get $c] 1] + } + + # multi config set and veirfy + assert_equal [eval "r config set $some_configs"] "OK" + dict for {c val} $some_configs { + assert_equal [lindex [r config get $c] 1] $val + } + + # Restore backup + assert_equal [eval "r config set $backups"] "OK" + } + + test {CONFIG SET rollback on set error} { + # This test passes an invalid percent value to maxmemory-clients which should cause an + # input verification failure during the "set" phase before trying to apply the + # configuration. We want to make sure the correct failure happens and everything + # is rolled back. + # backup maxmemory config + set mm_backup [lindex [r config get maxmemory] 1] + set mmc_backup [lindex [r config get maxmemory-clients] 1] + set qbl_backup [lindex [r config get client-query-buffer-limit] 1] + # Set some value to maxmemory + assert_equal [r config set maxmemory 10000002] "OK" + # Set another value to maxmeory together with another invalid config + assert_error "ERR CONFIG SET failed (possibly related to argument 'maxmemory-clients') - percentage argument must be less or equal to 100" { + r config set maxmemory 10000001 maxmemory-clients 200% client-query-buffer-limit invalid + } + # Validate we rolled back to original values + assert_equal [lindex [r config get maxmemory] 1] 10000002 + assert_equal [lindex [r config get maxmemory-clients] 1] $mmc_backup + assert_equal [lindex [r config get client-query-buffer-limit] 1] $qbl_backup + # Make sure we revert back to the previous maxmemory + assert_equal [r config set maxmemory $mm_backup] "OK" + } + + test {CONFIG SET rollback on apply error} { + # This test tries to configure a used port number in redis. This is expected + # to pass the `CONFIG SET` validity checking implementation but fail on + # actual "apply" of the setting. This will validate that after an "apply" + # failure we rollback to the previous values. + proc dummy_accept {chan addr port} {} + + set some_configs {maxmemory 10000001 port 0 client-query-buffer-limit 10m} + + # On Linux we also set the oom score adj which has an apply function. This is + # used to verify that even successful applies are rolled back if some other + # config's apply fails. + set oom_adj_avail [expr {!$::external && [exec uname] == "Linux"}] + if {$oom_adj_avail} { + proc get_oom_score_adj {} { + set pid [srv 0 pid] + set fd [open "/proc/$pid/oom_score_adj" "r"] + set val [gets $fd] + close $fd + return $val + } + set some_configs [linsert $some_configs 0 oom-score-adj yes oom-score-adj-values {1 1 1}] + set read_oom_adj [get_oom_score_adj] + } + + # Backup + set backups {} + foreach c [dict keys $some_configs] { + lappend backups $c [lindex [r config get $c] 1] + } + + set used_port [find_available_port $::baseport $::portcount] + dict set some_configs port $used_port + + # Run a dummy server on used_port so we know we can't configure redis to + # use it. It's ok for this to fail because that means used_port is invalid + # anyway + catch {socket -server dummy_accept -myaddr 127.0.0.1 $used_port} e + if {$::verbose} { puts "dummy_accept: $e" } + + # Try to listen on the used port, pass some more configs to make sure the + # returned failure message is for the first bad config and everything is rolled back. + assert_error "ERR CONFIG SET failed (possibly related to argument 'port') - Unable to listen on this port*" { + eval "r config set $some_configs" + } + + # Make sure we reverted back to previous configs + dict for {conf val} $backups { + assert_equal [lindex [r config get $conf] 1] $val + } + + if {$oom_adj_avail} { + assert_equal [get_oom_score_adj] $read_oom_adj + } + + # Make sure we can still communicate with the server (on the original port) + set r1 [redis_client] + assert_equal [$r1 ping] "PONG" + $r1 close + } + + test {CONFIG SET duplicate configs} { + assert_error "ERR *duplicate*" {r config set maxmemory 10000001 maxmemory 10000002} + } + + test {CONFIG SET set immutable} { + assert_error "ERR *immutable*" {r config set daemonize yes} + } + + test {CONFIG GET hidden configs} { + set hidden_config "key-load-delay" + + # When we use a pattern we shouldn't get the hidden config + assert {![dict exists [r config get *] $hidden_config]} + + # When we explicitly request the hidden config we should get it + assert {[dict exists [r config get $hidden_config] "$hidden_config"]} + } + + test {CONFIG GET multiple args} { + set res [r config get maxmemory maxmemory* bind *of] + + # Verify there are no duplicates in the result + assert_equal [expr [llength [dict keys $res]]*2] [llength $res] + + # Verify we got both name and alias in result + assert {[dict exists $res slaveof] && [dict exists $res replicaof]} + + # Verify pattern found multiple maxmemory* configs + assert {[dict exists $res maxmemory] && [dict exists $res maxmemory-samples] && [dict exists $res maxmemory-clients]} + + # Verify we also got the explicit config + assert {[dict exists $res bind]} + } + + test {redis-server command line arguments - error cases} { + catch {exec src/redis-server --port} err + assert_match {*'port'*wrong number of arguments*} $err + + catch {exec src/redis-server --port 6380 --loglevel} err + assert_match {*'loglevel'*wrong number of arguments*} $err + + # Take `6379` and `6380` as the port option value. + catch {exec src/redis-server --port 6379 6380} err + assert_match {*'port "6379" "6380"'*wrong number of arguments*} $err + + # Take `--loglevel` and `verbose` as the port option value. + catch {exec src/redis-server --port --loglevel verbose} err + assert_match {*'port "--loglevel" "verbose"'*wrong number of arguments*} $err + + # Take `--bla` as the port option value. + catch {exec src/redis-server --port --bla --loglevel verbose} err + assert_match {*'port "--bla"'*argument couldn't be parsed into an integer*} $err + + # Take `--bla` as the loglevel option value. + catch {exec src/redis-server --logfile --my--log--file --loglevel --bla} err + assert_match {*'loglevel "--bla"'*argument(s) must be one of the following*} $err + + # Using MULTI_ARG's own check, empty option value + catch {exec src/redis-server --shutdown-on-sigint} err + assert_match {*'shutdown-on-sigint'*argument(s) must be one of the following*} $err + catch {exec src/redis-server --shutdown-on-sigint "now force" --shutdown-on-sigterm} err + assert_match {*'shutdown-on-sigterm'*argument(s) must be one of the following*} $err + + # Something like `redis-server --some-config --config-value1 --config-value2 --loglevel debug` would break, + # because if you want to pass a value to a config starting with `--`, it can only be a single value. + catch {exec src/redis-server --replicaof 127.0.0.1 abc} err + assert_match {*'replicaof "127.0.0.1" "abc"'*Invalid master port*} $err + catch {exec src/redis-server --replicaof --127.0.0.1 abc} err + assert_match {*'replicaof "--127.0.0.1" "abc"'*Invalid master port*} $err + catch {exec src/redis-server --replicaof --127.0.0.1 --abc} err + assert_match {*'replicaof "--127.0.0.1"'*wrong number of arguments*} $err + } {} {external:skip} + + test {redis-server command line arguments - allow passing option name and option value in the same arg} { + start_server {config "default.conf" args {"--maxmemory 700mb" "--maxmemory-policy volatile-lru"}} { + assert_match [r config get maxmemory] {maxmemory 734003200} + assert_match [r config get maxmemory-policy] {maxmemory-policy volatile-lru} + } + } {} {external:skip} + + test {redis-server command line arguments - wrong usage that we support anyway} { + start_server {config "default.conf" args {loglevel verbose "--maxmemory '700mb'" "--maxmemory-policy 'volatile-lru'"}} { + assert_match [r config get loglevel] {loglevel verbose} + assert_match [r config get maxmemory] {maxmemory 734003200} + assert_match [r config get maxmemory-policy] {maxmemory-policy volatile-lru} + } + } {} {external:skip} + + test {redis-server command line arguments - allow option value to use the `--` prefix} { + start_server {config "default.conf" args {--proc-title-template --my--title--template --loglevel verbose}} { + assert_match [r config get proc-title-template] {proc-title-template --my--title--template} + assert_match [r config get loglevel] {loglevel verbose} + } + } {} {external:skip} + + test {redis-server command line arguments - option name and option value in the same arg and `--` prefix} { + start_server {config "default.conf" args {"--proc-title-template --my--title--template" "--loglevel verbose"}} { + assert_match [r config get proc-title-template] {proc-title-template --my--title--template} + assert_match [r config get loglevel] {loglevel verbose} + } + } {} {external:skip} + + test {redis-server command line arguments - save with empty input} { + start_server {config "default.conf" args {--save --loglevel verbose}} { + assert_match [r config get save] {save {}} + assert_match [r config get loglevel] {loglevel verbose} + } + + start_server {config "default.conf" args {--loglevel verbose --save}} { + assert_match [r config get save] {save {}} + assert_match [r config get loglevel] {loglevel verbose} + } + + start_server {config "default.conf" args {--save {} --loglevel verbose}} { + assert_match [r config get save] {save {}} + assert_match [r config get loglevel] {loglevel verbose} + } + + start_server {config "default.conf" args {--loglevel verbose --save {}}} { + assert_match [r config get save] {save {}} + assert_match [r config get loglevel] {loglevel verbose} + } + + start_server {config "default.conf" args {--proc-title-template --save --save {} --loglevel verbose}} { + assert_match [r config get proc-title-template] {proc-title-template --save} + assert_match [r config get save] {save {}} + assert_match [r config get loglevel] {loglevel verbose} + } + + } {} {external:skip} + + test {redis-server command line arguments - take one bulk string with spaces for MULTI_ARG configs parsing} { + start_server {config "default.conf" args {--shutdown-on-sigint nosave force now --shutdown-on-sigterm "nosave force"}} { + assert_match [r config get shutdown-on-sigint] {shutdown-on-sigint {nosave now force}} + assert_match [r config get shutdown-on-sigterm] {shutdown-on-sigterm {nosave force}} + } + } {} {external:skip} + + # Config file at this point is at a weird state, and includes all + # known keywords. Might be a good idea to avoid adding tests here. +} + +start_server {tags {"introspection external:skip"} overrides {enable-protected-configs {no} enable-debug-command {no}}} { + test {cannot modify protected configuration - no} { + assert_error "ERR *protected*" {r config set dir somedir} + assert_error "ERR *DEBUG command not allowed*" {r DEBUG HELP} + } {} {needs:debug} +} + +start_server {config "minimal.conf" tags {"introspection external:skip"} overrides {protected-mode {no} enable-protected-configs {local} enable-debug-command {local}}} { + test {cannot modify protected configuration - local} { + # verify that for local connection it doesn't error + r config set dbfilename somename + r DEBUG HELP + + # Get a non-loopback address of this instance for this test. + set myaddr [get_nonloopback_addr] + if {$myaddr != "" && ![string match {127.*} $myaddr]} { + # Non-loopback client should fail + set r2 [get_nonloopback_client] + assert_error "ERR *protected*" {$r2 config set dir somedir} + assert_error "ERR *DEBUG command not allowed*" {$r2 DEBUG HELP} + } + } {} {needs:debug} +} + +test {config during loading} { + start_server [list overrides [list key-load-delay 50 loading-process-events-interval-bytes 1024 rdbcompression no]] { + # create a big rdb that will take long to load. it is important + # for keys to be big since the server processes events only once in 2mb. + # 100mb of rdb, 100k keys will load in more than 5 seconds + r debug populate 100000 key 1000 + + restart_server 0 false false + + # make sure it's still loading + assert_equal [s loading] 1 + + # verify some configs are allowed during loading + r config set loglevel debug + assert_equal [lindex [r config get loglevel] 1] debug + + # verify some configs are forbidden during loading + assert_error {LOADING*} {r config set dir asdf} + + # make sure it's still loading + assert_equal [s loading] 1 + + # no need to keep waiting for loading to complete + exec kill [srv 0 pid] + } +} {} {external:skip} + +test {CONFIG REWRITE handles rename-command properly} { + start_server {tags {"introspection"} overrides {rename-command {flushdb badger}}} { + assert_error {ERR unknown command*} {r flushdb} + + r config rewrite + restart_server 0 true false + + assert_error {ERR unknown command*} {r flushdb} + } +} {} {external:skip} + +test {CONFIG REWRITE handles alias config properly} { + start_server {tags {"introspection"} overrides {hash-max-listpack-entries 20 hash-max-ziplist-entries 21}} { + assert_equal [r config get hash-max-listpack-entries] {hash-max-listpack-entries 21} + assert_equal [r config get hash-max-ziplist-entries] {hash-max-ziplist-entries 21} + r config set hash-max-listpack-entries 100 + + r config rewrite + restart_server 0 true false + + assert_equal [r config get hash-max-listpack-entries] {hash-max-listpack-entries 100} + } + # test the order doesn't matter + start_server {tags {"introspection"} overrides {hash-max-ziplist-entries 20 hash-max-listpack-entries 21}} { + assert_equal [r config get hash-max-listpack-entries] {hash-max-listpack-entries 21} + assert_equal [r config get hash-max-ziplist-entries] {hash-max-ziplist-entries 21} + r config set hash-max-listpack-entries 100 + + r config rewrite + restart_server 0 true false + + assert_equal [r config get hash-max-listpack-entries] {hash-max-listpack-entries 100} + } +} {} {external:skip} diff --git a/tests/unit/keyspace.tcl b/tests/unit/keyspace.tcl new file mode 100644 index 0000000..437f71f --- /dev/null +++ b/tests/unit/keyspace.tcl @@ -0,0 +1,498 @@ +start_server {tags {"keyspace"}} { + test {DEL against a single item} { + r set x foo + assert {[r get x] eq "foo"} + r del x + r get x + } {} + + test {Vararg DEL} { + r set foo1{t} a + r set foo2{t} b + r set foo3{t} c + list [r del foo1{t} foo2{t} foo3{t} foo4{t}] [r mget foo1{t} foo2{t} foo3{t}] + } {3 {{} {} {}}} + + test {Untagged multi-key commands} { + r mset foo1 a foo2 b foo3 c + assert_equal {a b c {}} [r mget foo1 foo2 foo3 foo4] + r del foo1 foo2 foo3 foo4 + } {3} {cluster:skip} + + test {KEYS with pattern} { + foreach key {key_x key_y key_z foo_a foo_b foo_c} { + r set $key hello + } + lsort [r keys foo*] + } {foo_a foo_b foo_c} + + test {KEYS to get all keys} { + lsort [r keys *] + } {foo_a foo_b foo_c key_x key_y key_z} + + test {DBSIZE} { + r dbsize + } {6} + + test {DEL all keys} { + foreach key [r keys *] {r del $key} + r dbsize + } {0} + + test "DEL against expired key" { + r debug set-active-expire 0 + r setex keyExpire 1 valExpire + after 1100 + assert_equal 0 [r del keyExpire] + r debug set-active-expire 1 + } {OK} {needs:debug} + + test {EXISTS} { + set res {} + r set newkey test + append res [r exists newkey] + r del newkey + append res [r exists newkey] + } {10} + + test {Zero length value in key. SET/GET/EXISTS} { + r set emptykey {} + set res [r get emptykey] + append res [r exists emptykey] + r del emptykey + append res [r exists emptykey] + } {10} + + test {Commands pipelining} { + set fd [r channel] + puts -nonewline $fd "SET k1 xyzk\r\nGET k1\r\nPING\r\n" + flush $fd + set res {} + append res [string match OK* [r read]] + append res [r read] + append res [string match PONG* [r read]] + format $res + } {1xyzk1} + + test {Non existing command} { + catch {r foobaredcommand} err + string match ERR* $err + } {1} + + test {RENAME basic usage} { + r set mykey{t} hello + r rename mykey{t} mykey1{t} + r rename mykey1{t} mykey2{t} + r get mykey2{t} + } {hello} + + test {RENAME source key should no longer exist} { + r exists mykey + } {0} + + test {RENAME against already existing key} { + r set mykey{t} a + r set mykey2{t} b + r rename mykey2{t} mykey{t} + set res [r get mykey{t}] + append res [r exists mykey2{t}] + } {b0} + + test {RENAMENX basic usage} { + r del mykey{t} + r del mykey2{t} + r set mykey{t} foobar + r renamenx mykey{t} mykey2{t} + set res [r get mykey2{t}] + append res [r exists mykey{t}] + } {foobar0} + + test {RENAMENX against already existing key} { + r set mykey{t} foo + r set mykey2{t} bar + r renamenx mykey{t} mykey2{t} + } {0} + + test {RENAMENX against already existing key (2)} { + set res [r get mykey{t}] + append res [r get mykey2{t}] + } {foobar} + + test {RENAME against non existing source key} { + catch {r rename nokey{t} foobar{t}} err + format $err + } {ERR*} + + test {RENAME where source and dest key are the same (existing)} { + r set mykey foo + r rename mykey mykey + } {OK} + + test {RENAMENX where source and dest key are the same (existing)} { + r set mykey foo + r renamenx mykey mykey + } {0} + + test {RENAME where source and dest key are the same (non existing)} { + r del mykey + catch {r rename mykey mykey} err + format $err + } {ERR*} + + test {RENAME with volatile key, should move the TTL as well} { + r del mykey{t} mykey2{t} + r set mykey{t} foo + r expire mykey{t} 100 + assert {[r ttl mykey{t}] > 95 && [r ttl mykey{t}] <= 100} + r rename mykey{t} mykey2{t} + assert {[r ttl mykey2{t}] > 95 && [r ttl mykey2{t}] <= 100} + } + + test {RENAME with volatile key, should not inherit TTL of target key} { + r del mykey{t} mykey2{t} + r set mykey{t} foo + r set mykey2{t} bar + r expire mykey2{t} 100 + assert {[r ttl mykey{t}] == -1 && [r ttl mykey2{t}] > 0} + r rename mykey{t} mykey2{t} + r ttl mykey2{t} + } {-1} + + test {DEL all keys again (DB 0)} { + foreach key [r keys *] { + r del $key + } + r dbsize + } {0} + + test {DEL all keys again (DB 1)} { + r select 10 + foreach key [r keys *] { + r del $key + } + set res [r dbsize] + r select 9 + format $res + } {0} {singledb:skip} + + test {COPY basic usage for string} { + r set mykey{t} foobar + set res {} + r copy mykey{t} mynewkey{t} + lappend res [r get mynewkey{t}] + lappend res [r dbsize] + if {$::singledb} { + assert_equal [list foobar 2] [format $res] + } else { + r copy mykey{t} mynewkey{t} DB 10 + r select 10 + lappend res [r get mynewkey{t}] + lappend res [r dbsize] + r select 9 + assert_equal [list foobar 2 foobar 1] [format $res] + } + } + + test {COPY for string does not replace an existing key without REPLACE option} { + r set mykey2{t} hello + catch {r copy mykey2{t} mynewkey{t} DB 10} e + set e + } {0} {singledb:skip} + + test {COPY for string can replace an existing key with REPLACE option} { + r copy mykey2{t} mynewkey{t} DB 10 REPLACE + r select 10 + r get mynewkey{t} + } {hello} {singledb:skip} + + test {COPY for string ensures that copied data is independent of copying data} { + r flushdb + r select 9 + r set mykey{t} foobar + set res {} + r copy mykey{t} mynewkey{t} DB 10 + r select 10 + lappend res [r get mynewkey{t}] + r set mynewkey{t} hoge + lappend res [r get mynewkey{t}] + r select 9 + lappend res [r get mykey{t}] + r select 10 + r flushdb + r select 9 + format $res + } [list foobar hoge foobar] {singledb:skip} + + test {COPY for string does not copy data to no-integer DB} { + r set mykey{t} foobar + catch {r copy mykey{t} mynewkey{t} DB notanumber} e + set e + } {ERR value is not an integer or out of range} + + test {COPY can copy key expire metadata as well} { + r set mykey{t} foobar ex 100 + r copy mykey{t} mynewkey{t} REPLACE + assert {[r ttl mynewkey{t}] > 0 && [r ttl mynewkey{t}] <= 100} + assert {[r get mynewkey{t}] eq "foobar"} + } + + test {COPY does not create an expire if it does not exist} { + r set mykey{t} foobar + assert {[r ttl mykey{t}] == -1} + r copy mykey{t} mynewkey{t} REPLACE + assert {[r ttl mynewkey{t}] == -1} + assert {[r get mynewkey{t}] eq "foobar"} + } + + test {COPY basic usage for list} { + r del mylist{t} mynewlist{t} + r lpush mylist{t} a b c d + r copy mylist{t} mynewlist{t} + set digest [debug_digest_value mylist{t}] + assert_equal $digest [debug_digest_value mynewlist{t}] + assert_refcount 1 mylist{t} + assert_refcount 1 mynewlist{t} + r del mylist{t} + assert_equal $digest [debug_digest_value mynewlist{t}] + } + + test {COPY basic usage for intset set} { + r del set1{t} newset1{t} + r sadd set1{t} 1 2 3 + assert_encoding intset set1{t} + r copy set1{t} newset1{t} + set digest [debug_digest_value set1{t}] + assert_equal $digest [debug_digest_value newset1{t}] + assert_refcount 1 set1{t} + assert_refcount 1 newset1{t} + r del set1{t} + assert_equal $digest [debug_digest_value newset1{t}] + } + + test {COPY basic usage for hashtable set} { + r del set2{t} newset2{t} + r sadd set2{t} 1 2 3 a + assert_encoding hashtable set2{t} + r copy set2{t} newset2{t} + set digest [debug_digest_value set2{t}] + assert_equal $digest [debug_digest_value newset2{t}] + assert_refcount 1 set2{t} + assert_refcount 1 newset2{t} + r del set2{t} + assert_equal $digest [debug_digest_value newset2{t}] + } + + test {COPY basic usage for listpack sorted set} { + r del zset1{t} newzset1{t} + r zadd zset1{t} 123 foobar + assert_encoding listpack zset1{t} + r copy zset1{t} newzset1{t} + set digest [debug_digest_value zset1{t}] + assert_equal $digest [debug_digest_value newzset1{t}] + assert_refcount 1 zset1{t} + assert_refcount 1 newzset1{t} + r del zset1{t} + assert_equal $digest [debug_digest_value newzset1{t}] + } + + test {COPY basic usage for skiplist sorted set} { + r del zset2{t} newzset2{t} + set original_max [lindex [r config get zset-max-ziplist-entries] 1] + r config set zset-max-ziplist-entries 0 + for {set j 0} {$j < 130} {incr j} { + r zadd zset2{t} [randomInt 50] ele-[randomInt 10] + } + assert_encoding skiplist zset2{t} + r copy zset2{t} newzset2{t} + set digest [debug_digest_value zset2{t}] + assert_equal $digest [debug_digest_value newzset2{t}] + assert_refcount 1 zset2{t} + assert_refcount 1 newzset2{t} + r del zset2{t} + assert_equal $digest [debug_digest_value newzset2{t}] + r config set zset-max-ziplist-entries $original_max + } + + test {COPY basic usage for listpack hash} { + r del hash1{t} newhash1{t} + r hset hash1{t} tmp 17179869184 + assert_encoding listpack hash1{t} + r copy hash1{t} newhash1{t} + set digest [debug_digest_value hash1{t}] + assert_equal $digest [debug_digest_value newhash1{t}] + assert_refcount 1 hash1{t} + assert_refcount 1 newhash1{t} + r del hash1{t} + assert_equal $digest [debug_digest_value newhash1{t}] + } + + test {COPY basic usage for hashtable hash} { + r del hash2{t} newhash2{t} + set original_max [lindex [r config get hash-max-ziplist-entries] 1] + r config set hash-max-ziplist-entries 0 + for {set i 0} {$i < 64} {incr i} { + r hset hash2{t} [randomValue] [randomValue] + } + assert_encoding hashtable hash2{t} + r copy hash2{t} newhash2{t} + set digest [debug_digest_value hash2{t}] + assert_equal $digest [debug_digest_value newhash2{t}] + assert_refcount 1 hash2{t} + assert_refcount 1 newhash2{t} + r del hash2{t} + assert_equal $digest [debug_digest_value newhash2{t}] + r config set hash-max-ziplist-entries $original_max + } + + test {COPY basic usage for stream} { + r del mystream{t} mynewstream{t} + for {set i 0} {$i < 1000} {incr i} { + r XADD mystream{t} * item 2 value b + } + r copy mystream{t} mynewstream{t} + set digest [debug_digest_value mystream{t}] + assert_equal $digest [debug_digest_value mynewstream{t}] + assert_refcount 1 mystream{t} + assert_refcount 1 mynewstream{t} + r del mystream{t} + assert_equal $digest [debug_digest_value mynewstream{t}] + } + + test {COPY basic usage for stream-cgroups} { + r del x{t} + r XADD x{t} 100 a 1 + set id [r XADD x{t} 101 b 1] + r XADD x{t} 102 c 1 + r XADD x{t} 103 e 1 + r XADD x{t} 104 f 1 + r XADD x{t} 105 g 1 + r XGROUP CREATE x{t} g1 0 + r XGROUP CREATE x{t} g2 0 + r XREADGROUP GROUP g1 Alice COUNT 1 STREAMS x{t} > + r XREADGROUP GROUP g1 Bob COUNT 1 STREAMS x{t} > + r XREADGROUP GROUP g1 Bob NOACK COUNT 1 STREAMS x{t} > + r XREADGROUP GROUP g2 Charlie COUNT 4 STREAMS x{t} > + r XGROUP SETID x{t} g1 $id + r XREADGROUP GROUP g1 Dave COUNT 3 STREAMS x{t} > + r XDEL x{t} 103 + + r copy x{t} newx{t} + set info [r xinfo stream x{t} full] + assert_equal $info [r xinfo stream newx{t} full] + assert_refcount 1 x{t} + assert_refcount 1 newx{t} + r del x{t} + assert_equal $info [r xinfo stream newx{t} full] + r flushdb + } + + test {MOVE basic usage} { + r set mykey foobar + r move mykey 10 + set res {} + lappend res [r exists mykey] + lappend res [r dbsize] + r select 10 + lappend res [r get mykey] + lappend res [r dbsize] + r select 9 + format $res + } [list 0 0 foobar 1] {singledb:skip} + + test {MOVE against key existing in the target DB} { + r set mykey hello + r move mykey 10 + } {0} {singledb:skip} + + test {MOVE against non-integer DB (#1428)} { + r set mykey hello + catch {r move mykey notanumber} e + set e + } {ERR value is not an integer or out of range} {singledb:skip} + + test {MOVE can move key expire metadata as well} { + r select 10 + r flushdb + r select 9 + r set mykey foo ex 100 + r move mykey 10 + assert {[r ttl mykey] == -2} + r select 10 + assert {[r ttl mykey] > 0 && [r ttl mykey] <= 100} + assert {[r get mykey] eq "foo"} + r select 9 + } {OK} {singledb:skip} + + test {MOVE does not create an expire if it does not exist} { + r select 10 + r flushdb + r select 9 + r set mykey foo + r move mykey 10 + assert {[r ttl mykey] == -2} + r select 10 + assert {[r ttl mykey] == -1} + assert {[r get mykey] eq "foo"} + r select 9 + } {OK} {singledb:skip} + + test {SET/GET keys in different DBs} { + r set a hello + r set b world + r select 10 + r set a foo + r set b bared + r select 9 + set res {} + lappend res [r get a] + lappend res [r get b] + r select 10 + lappend res [r get a] + lappend res [r get b] + r select 9 + format $res + } {hello world foo bared} {singledb:skip} + + test {RANDOMKEY} { + r flushdb + r set foo x + r set bar y + set foo_seen 0 + set bar_seen 0 + for {set i 0} {$i < 100} {incr i} { + set rkey [r randomkey] + if {$rkey eq {foo}} { + set foo_seen 1 + } + if {$rkey eq {bar}} { + set bar_seen 1 + } + } + list $foo_seen $bar_seen + } {1 1} + + test {RANDOMKEY against empty DB} { + r flushdb + r randomkey + } {} + + test {RANDOMKEY regression 1} { + r flushdb + r set x 10 + r del x + r randomkey + } {} + + test {KEYS * two times with long key, Github issue #1208} { + r flushdb + r set dlskeriewrioeuwqoirueioqwrueoqwrueqw test + r keys * + r keys * + } {dlskeriewrioeuwqoirueioqwrueoqwrueqw} + + test {Regression for pattern matching long nested loops} { + r flushdb + r SET aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa 1 + r KEYS "a*a*a*a*a*a*a*a*a*a*a*a*a*a*a*a*a*a*a*a*b" + } {} +} diff --git a/tests/unit/latency-monitor.tcl b/tests/unit/latency-monitor.tcl new file mode 100644 index 0000000..39d404d --- /dev/null +++ b/tests/unit/latency-monitor.tcl @@ -0,0 +1,147 @@ +start_server {tags {"latency-monitor needs:latency"}} { + # Set a threshold high enough to avoid spurious latency events. + r config set latency-monitor-threshold 200 + r latency reset + + test {LATENCY HISTOGRAM with empty histogram} { + r config resetstat + set histo [dict create {*}[r latency histogram]] + # Config resetstat is recorded + assert_equal [dict size $histo] 1 + assert_match {*config|resetstat*} $histo + } + + test {LATENCY HISTOGRAM all commands} { + r config resetstat + r set a b + r set c d + set histo [dict create {*}[r latency histogram]] + assert_match {calls 2 histogram_usec *} [dict get $histo set] + assert_match {calls 1 histogram_usec *} [dict get $histo "config|resetstat"] + } + + test {LATENCY HISTOGRAM sub commands} { + r config resetstat + r client id + r client list + # parent command reply with its sub commands + set histo [dict create {*}[r latency histogram client]] + assert {[dict size $histo] == 2} + assert_match {calls 1 histogram_usec *} [dict get $histo "client|id"] + assert_match {calls 1 histogram_usec *} [dict get $histo "client|list"] + + # explicitly ask for one sub-command + set histo [dict create {*}[r latency histogram "client|id"]] + assert {[dict size $histo] == 1} + assert_match {calls 1 histogram_usec *} [dict get $histo "client|id"] + } + + test {LATENCY HISTOGRAM with a subset of commands} { + r config resetstat + r set a b + r set c d + r get a + r hset f k v + r hgetall f + set histo [dict create {*}[r latency histogram set hset]] + assert_match {calls 2 histogram_usec *} [dict get $histo set] + assert_match {calls 1 histogram_usec *} [dict get $histo hset] + assert_equal [dict size $histo] 2 + set histo [dict create {*}[r latency histogram hgetall get zadd]] + assert_match {calls 1 histogram_usec *} [dict get $histo hgetall] + assert_match {calls 1 histogram_usec *} [dict get $histo get] + assert_equal [dict size $histo] 2 + } + + test {LATENCY HISTOGRAM command} { + r config resetstat + r set a b + r get a + assert {[llength [r latency histogram set get]] == 4} + } + + test {LATENCY HISTOGRAM with wrong command name skips the invalid one} { + r config resetstat + assert {[llength [r latency histogram blabla]] == 0} + assert {[llength [r latency histogram blabla blabla2 set get]] == 0} + r set a b + r get a + assert_match {calls 1 histogram_usec *} [lindex [r latency histogram blabla blabla2 set get] 1] + assert_match {calls 1 histogram_usec *} [lindex [r latency histogram blabla blabla2 set get] 3] + assert {[string length [r latency histogram blabla set get]] > 0} + } + + test {Test latency events logging} { + r debug sleep 0.3 + after 1100 + r debug sleep 0.4 + after 1100 + r debug sleep 0.5 + assert {[r latency history command] >= 3} + } {} {needs:debug} + + test {LATENCY HISTORY output is ok} { + set min 250 + set max 450 + foreach event [r latency history command] { + lassign $event time latency + if {!$::no_latency} { + assert {$latency >= $min && $latency <= $max} + } + incr min 100 + incr max 100 + set last_time $time ; # Used in the next test + } + } + + test {LATENCY LATEST output is ok} { + foreach event [r latency latest] { + lassign $event eventname time latency max + assert {$eventname eq "command"} + if {!$::no_latency} { + assert {$max >= 450 & $max <= 650} + assert {$time == $last_time} + } + break + } + } + + test {LATENCY of expire events are correctly collected} { + r config set latency-monitor-threshold 20 + r flushdb + if {$::valgrind} {set count 100000} else {set count 1000000} + r eval { + local i = 0 + while (i < tonumber(ARGV[1])) do + redis.call('sadd',KEYS[1],i) + i = i+1 + end + } 1 mybigkey $count + r pexpire mybigkey 50 + wait_for_condition 5 100 { + [r dbsize] == 0 + } else { + fail "key wasn't expired" + } + assert_match {*expire-cycle*} [r latency latest] + } + + test {LATENCY HISTORY / RESET with wrong event name is fine} { + assert {[llength [r latency history blabla]] == 0} + assert {[r latency reset blabla] == 0} + } + + test {LATENCY DOCTOR produces some output} { + assert {[string length [r latency doctor]] > 0} + } + + test {LATENCY RESET is able to reset events} { + assert {[r latency reset] > 0} + assert {[r latency latest] eq {}} + } + + test {LATENCY HELP should not have unexpected options} { + catch {r LATENCY help xxx} e + assert_match "*wrong number of arguments for 'latency|help' command" $e + } +} diff --git a/tests/unit/lazyfree.tcl b/tests/unit/lazyfree.tcl new file mode 100644 index 0000000..17f4600 --- /dev/null +++ b/tests/unit/lazyfree.tcl @@ -0,0 +1,90 @@ +start_server {tags {"lazyfree"}} { + test "UNLINK can reclaim memory in background" { + set orig_mem [s used_memory] + set args {} + for {set i 0} {$i < 100000} {incr i} { + lappend args $i + } + r sadd myset {*}$args + assert {[r scard myset] == 100000} + set peak_mem [s used_memory] + assert {[r unlink myset] == 1} + assert {$peak_mem > $orig_mem+1000000} + wait_for_condition 50 100 { + [s used_memory] < $peak_mem && + [s used_memory] < $orig_mem*2 + } else { + fail "Memory is not reclaimed by UNLINK" + } + } + + test "FLUSHDB ASYNC can reclaim memory in background" { + # make the previous test is really done before sampling used_memory + wait_lazyfree_done r + + set orig_mem [s used_memory] + set args {} + for {set i 0} {$i < 100000} {incr i} { + lappend args $i + } + r sadd myset {*}$args + assert {[r scard myset] == 100000} + set peak_mem [s used_memory] + r flushdb async + assert {$peak_mem > $orig_mem+1000000} + wait_for_condition 50 100 { + [s used_memory] < $peak_mem && + [s used_memory] < $orig_mem*2 + } else { + fail "Memory is not reclaimed by FLUSHDB ASYNC" + } + } + + test "lazy free a stream with all types of metadata" { + # make the previous test is really done before doing RESETSTAT + wait_for_condition 50 100 { + [s lazyfree_pending_objects] == 0 + } else { + fail "lazyfree isn't done" + } + + r config resetstat + r config set stream-node-max-entries 5 + for {set j 0} {$j < 1000} {incr j} { + if {rand() < 0.9} { + r xadd stream * foo $j + } else { + r xadd stream * bar $j + } + } + r xgroup create stream mygroup 0 + set records [r xreadgroup GROUP mygroup Alice COUNT 2 STREAMS stream >] + r xdel stream [lindex [lindex [lindex [lindex $records 0] 1] 1] 0] + r xack stream mygroup [lindex [lindex [lindex [lindex $records 0] 1] 0] 0] + r unlink stream + + # make sure it was lazy freed + wait_for_condition 50 100 { + [s lazyfree_pending_objects] == 0 + } else { + fail "lazyfree isn't done" + } + assert_equal [s lazyfreed_objects] 1 + } {} {needs:config-resetstat} + + test "lazy free a stream with deleted cgroup" { + r config resetstat + r xadd s * a b + r xgroup create s bla $ + r xgroup destroy s bla + r unlink s + + # make sure it was not lazy freed + wait_for_condition 50 100 { + [s lazyfree_pending_objects] == 0 + } else { + fail "lazyfree isn't done" + } + assert_equal [s lazyfreed_objects] 0 + } {} {needs:config-resetstat} +} diff --git a/tests/unit/limits.tcl b/tests/unit/limits.tcl new file mode 100644 index 0000000..3af1519 --- /dev/null +++ b/tests/unit/limits.tcl @@ -0,0 +1,21 @@ +start_server {tags {"limits network external:skip"} overrides {maxclients 10}} { + if {$::tls} { + set expected_code "*I/O error*" + } else { + set expected_code "*ERR max*reached*" + } + test {Check if maxclients works refusing connections} { + set c 0 + catch { + while {$c < 50} { + incr c + set rd [redis_deferring_client] + $rd ping + $rd read + after 100 + } + } e + assert {$c > 8 && $c <= 10} + set e + } $expected_code +} diff --git a/tests/unit/maxmemory.tcl b/tests/unit/maxmemory.tcl new file mode 100644 index 0000000..8b0e504 --- /dev/null +++ b/tests/unit/maxmemory.tcl @@ -0,0 +1,573 @@ +start_server {tags {"maxmemory" "external:skip"}} { + r config set maxmemory 11mb + r config set maxmemory-policy allkeys-lru + set server_pid [s process_id] + + proc init_test {client_eviction} { + r flushdb + + set prev_maxmemory_clients [r config get maxmemory-clients] + if $client_eviction { + r config set maxmemory-clients 3mb + r client no-evict on + } else { + r config set maxmemory-clients 0 + } + + r config resetstat + # fill 5mb using 50 keys of 100kb + for {set j 0} {$j < 50} {incr j} { + r setrange $j 100000 x + } + assert_equal [r dbsize] 50 + } + + # Return true if the eviction occurred (client or key) based on argument + proc check_eviction_test {client_eviction} { + set evicted_keys [s evicted_keys] + set evicted_clients [s evicted_clients] + set dbsize [r dbsize] + + if $client_eviction { + return [expr $evicted_clients > 0 && $evicted_keys == 0 && $dbsize == 50] + } else { + return [expr $evicted_clients == 0 && $evicted_keys > 0 && $dbsize < 50] + } + } + + # Assert the eviction test passed (and prints some debug info on verbose) + proc verify_eviction_test {client_eviction} { + set evicted_keys [s evicted_keys] + set evicted_clients [s evicted_clients] + set dbsize [r dbsize] + + if $::verbose { + puts "evicted keys: $evicted_keys" + puts "evicted clients: $evicted_clients" + puts "dbsize: $dbsize" + } + + assert [check_eviction_test $client_eviction] + } + + foreach {client_eviction} {false true} { + set clients {} + test "eviction due to output buffers of many MGET clients, client eviction: $client_eviction" { + init_test $client_eviction + + for {set j 0} {$j < 20} {incr j} { + set rr [redis_deferring_client] + lappend clients $rr + } + + # Generate client output buffers via MGET until we can observe some effect on + # keys / client eviction, or we time out. + set t [clock seconds] + while {![check_eviction_test $client_eviction] && [expr [clock seconds] - $t] < 20} { + foreach rr $clients { + if {[catch { + $rr mget 1 + $rr flush + } err]} { + lremove clients $rr + } + } + } + + verify_eviction_test $client_eviction + } + foreach rr $clients { + $rr close + } + + set clients {} + test "eviction due to input buffer of a dead client, client eviction: $client_eviction" { + init_test $client_eviction + + for {set j 0} {$j < 30} {incr j} { + set rr [redis_deferring_client] + lappend clients $rr + } + + foreach rr $clients { + if {[catch { + $rr write "*250\r\n" + for {set j 0} {$j < 249} {incr j} { + $rr write "\$1000\r\n" + $rr write [string repeat x 1000] + $rr write "\r\n" + $rr flush + } + }]} { + lremove clients $rr + } + } + + verify_eviction_test $client_eviction + } + foreach rr $clients { + $rr close + } + + set clients {} + test "eviction due to output buffers of pubsub, client eviction: $client_eviction" { + init_test $client_eviction + + for {set j 0} {$j < 20} {incr j} { + set rr [redis_client] + lappend clients $rr + } + + foreach rr $clients { + $rr subscribe bla + } + + # Generate client output buffers via PUBLISH until we can observe some effect on + # keys / client eviction, or we time out. + set bigstr [string repeat x 100000] + set t [clock seconds] + while {![check_eviction_test $client_eviction] && [expr [clock seconds] - $t] < 20} { + if {[catch { r publish bla $bigstr } err]} { + if $::verbose { + puts "Error publishing: $err" + } + } + } + + verify_eviction_test $client_eviction + } + foreach rr $clients { + $rr close + } + } + +} + +start_server {tags {"maxmemory external:skip"}} { + test "Without maxmemory small integers are shared" { + r config set maxmemory 0 + r set a 1 + assert {[r object refcount a] > 1} + } + + test "With maxmemory and non-LRU policy integers are still shared" { + r config set maxmemory 1073741824 + r config set maxmemory-policy allkeys-random + r set a 1 + assert {[r object refcount a] > 1} + } + + test "With maxmemory and LRU policy integers are not shared" { + r config set maxmemory 1073741824 + r config set maxmemory-policy allkeys-lru + r set a 1 + r config set maxmemory-policy volatile-lru + r set b 1 + assert {[r object refcount a] == 1} + assert {[r object refcount b] == 1} + r config set maxmemory 0 + } + + foreach policy { + allkeys-random allkeys-lru allkeys-lfu volatile-lru volatile-lfu volatile-random volatile-ttl + } { + test "maxmemory - is the memory limit honoured? (policy $policy)" { + # make sure to start with a blank instance + r flushall + # Get the current memory limit and calculate a new limit. + # We just add 100k to the current memory size so that it is + # fast for us to reach that limit. + set used [s used_memory] + set limit [expr {$used+100*1024}] + r config set maxmemory $limit + r config set maxmemory-policy $policy + # Now add keys until the limit is almost reached. + set numkeys 0 + while 1 { + r setex [randomKey] 10000 x + incr numkeys + if {[s used_memory]+4096 > $limit} { + assert {$numkeys > 10} + break + } + } + # If we add the same number of keys already added again, we + # should still be under the limit. + for {set j 0} {$j < $numkeys} {incr j} { + r setex [randomKey] 10000 x + } + assert {[s used_memory] < ($limit+4096)} + } + } + + foreach policy { + allkeys-random allkeys-lru volatile-lru volatile-random volatile-ttl + } { + test "maxmemory - only allkeys-* should remove non-volatile keys ($policy)" { + # make sure to start with a blank instance + r flushall + # Get the current memory limit and calculate a new limit. + # We just add 100k to the current memory size so that it is + # fast for us to reach that limit. + set used [s used_memory] + set limit [expr {$used+100*1024}] + r config set maxmemory $limit + r config set maxmemory-policy $policy + # Now add keys until the limit is almost reached. + set numkeys 0 + while 1 { + r set [randomKey] x + incr numkeys + if {[s used_memory]+4096 > $limit} { + assert {$numkeys > 10} + break + } + } + # If we add the same number of keys already added again and + # the policy is allkeys-* we should still be under the limit. + # Otherwise we should see an error reported by Redis. + set err 0 + for {set j 0} {$j < $numkeys} {incr j} { + if {[catch {r set [randomKey] x} e]} { + if {[string match {*used memory*} $e]} { + set err 1 + } + } + } + if {[string match allkeys-* $policy]} { + assert {[s used_memory] < ($limit+4096)} + } else { + assert {$err == 1} + } + } + } + + foreach policy { + volatile-lru volatile-lfu volatile-random volatile-ttl + } { + test "maxmemory - policy $policy should only remove volatile keys." { + # make sure to start with a blank instance + r flushall + # Get the current memory limit and calculate a new limit. + # We just add 100k to the current memory size so that it is + # fast for us to reach that limit. + set used [s used_memory] + set limit [expr {$used+100*1024}] + r config set maxmemory $limit + r config set maxmemory-policy $policy + # Now add keys until the limit is almost reached. + set numkeys 0 + while 1 { + # Odd keys are volatile + # Even keys are non volatile + if {$numkeys % 2} { + r setex "key:$numkeys" 10000 x + } else { + r set "key:$numkeys" x + } + if {[s used_memory]+4096 > $limit} { + assert {$numkeys > 10} + break + } + incr numkeys + } + # Now we add the same number of volatile keys already added. + # We expect Redis to evict only volatile keys in order to make + # space. + set err 0 + for {set j 0} {$j < $numkeys} {incr j} { + catch {r setex "foo:$j" 10000 x} + } + # We should still be under the limit. + assert {[s used_memory] < ($limit+4096)} + # However all our non volatile keys should be here. + for {set j 0} {$j < $numkeys} {incr j 2} { + assert {[r exists "key:$j"]} + } + } + } +} + +# Calculate query buffer memory of slave +proc slave_query_buffer {srv} { + set clients [split [$srv client list] "\r\n"] + set c [lsearch -inline $clients *flags=S*] + if {[string length $c] > 0} { + assert {[regexp {qbuf=([0-9]+)} $c - qbuf]} + assert {[regexp {qbuf-free=([0-9]+)} $c - qbuf_free]} + return [expr $qbuf + $qbuf_free] + } + return 0 +} + +proc test_slave_buffers {test_name cmd_count payload_len limit_memory pipeline} { + start_server {tags {"maxmemory external:skip"}} { + start_server {} { + set slave_pid [s process_id] + test "$test_name" { + set slave [srv 0 client] + set slave_host [srv 0 host] + set slave_port [srv 0 port] + set master [srv -1 client] + set master_host [srv -1 host] + set master_port [srv -1 port] + + # Disable slow log for master to avoid memory growth in slow env. + $master config set slowlog-log-slower-than -1 + + # add 100 keys of 100k (10MB total) + for {set j 0} {$j < 100} {incr j} { + $master setrange "key:$j" 100000 asdf + } + + # make sure master doesn't disconnect slave because of timeout + $master config set repl-timeout 1200 ;# 20 minutes (for valgrind and slow machines) + $master config set maxmemory-policy allkeys-random + $master config set client-output-buffer-limit "replica 100000000 100000000 300" + $master config set repl-backlog-size [expr {10*1024}] + + # disable latency tracking + $master config set latency-tracking no + $slave config set latency-tracking no + + $slave slaveof $master_host $master_port + wait_for_condition 50 100 { + [s 0 master_link_status] eq {up} + } else { + fail "Replication not started." + } + + # measure used memory after the slave connected and set maxmemory + set orig_used [s -1 used_memory] + set orig_client_buf [s -1 mem_clients_normal] + set orig_mem_not_counted_for_evict [s -1 mem_not_counted_for_evict] + set orig_used_no_repl [expr {$orig_used - $orig_mem_not_counted_for_evict}] + set limit [expr {$orig_used - $orig_mem_not_counted_for_evict + 32*1024}] + + if {$limit_memory==1} { + $master config set maxmemory $limit + } + + # put the slave to sleep + set rd_slave [redis_deferring_client] + exec kill -SIGSTOP $slave_pid + + # send some 10mb worth of commands that don't increase the memory usage + if {$pipeline == 1} { + set rd_master [redis_deferring_client -1] + for {set k 0} {$k < $cmd_count} {incr k} { + $rd_master setrange key:0 0 [string repeat A $payload_len] + } + for {set k 0} {$k < $cmd_count} {incr k} { + $rd_master read + } + } else { + for {set k 0} {$k < $cmd_count} {incr k} { + $master setrange key:0 0 [string repeat A $payload_len] + } + } + + set new_used [s -1 used_memory] + set slave_buf [s -1 mem_clients_slaves] + set client_buf [s -1 mem_clients_normal] + set mem_not_counted_for_evict [s -1 mem_not_counted_for_evict] + set used_no_repl [expr {$new_used - $mem_not_counted_for_evict - [slave_query_buffer $master]}] + # we need to exclude replies buffer and query buffer of replica from used memory. + # removing the replica (output) buffers is done so that we are able to measure any other + # changes to the used memory and see that they're insignificant (the test's purpose is to check that + # the replica buffers are counted correctly, so the used memory growth after deducting them + # should be nearly 0). + # we remove the query buffers because on slow test platforms, they can accumulate many ACKs. + set delta [expr {($used_no_repl - $client_buf) - ($orig_used_no_repl - $orig_client_buf)}] + + assert {[$master dbsize] == 100} + assert {$slave_buf > 2*1024*1024} ;# some of the data may have been pushed to the OS buffers + set delta_max [expr {$cmd_count / 2}] ;# 1 byte unaccounted for, with 1M commands will consume some 1MB + assert {$delta < $delta_max && $delta > -$delta_max} + + $master client kill type slave + set info_str [$master info memory] + set killed_used [getInfoProperty $info_str used_memory] + set killed_mem_not_counted_for_evict [getInfoProperty $info_str mem_not_counted_for_evict] + set killed_slave_buf [s -1 mem_clients_slaves] + # we need to exclude replies buffer and query buffer of slave from used memory after kill slave + set killed_used_no_repl [expr {$killed_used - $killed_mem_not_counted_for_evict - [slave_query_buffer $master]}] + set delta_no_repl [expr {$killed_used_no_repl - $used_no_repl}] + assert {[$master dbsize] == 100} + assert {$killed_slave_buf == 0} + assert {$delta_no_repl > -$delta_max && $delta_no_repl < $delta_max} + + } + # unfreeze slave process (after the 'test' succeeded or failed, but before we attempt to terminate the server + exec kill -SIGCONT $slave_pid + } + } +} + +# test that slave buffer are counted correctly +# we wanna use many small commands, and we don't wanna wait long +# so we need to use a pipeline (redis_deferring_client) +# that may cause query buffer to fill and induce eviction, so we disable it +test_slave_buffers {slave buffer are counted correctly} 1000000 10 0 1 + +# test that slave buffer don't induce eviction +# test again with fewer (and bigger) commands without pipeline, but with eviction +test_slave_buffers "replica buffer don't induce eviction" 100000 100 1 0 + +start_server {tags {"maxmemory external:skip"}} { + test {Don't rehash if used memory exceeds maxmemory after rehash} { + r config set latency-tracking no + r config set maxmemory 0 + r config set maxmemory-policy allkeys-random + + # Next rehash size is 8192, that will eat 64k memory + populate 4096 "" 1 + + set used [s used_memory] + set limit [expr {$used + 10*1024}] + r config set maxmemory $limit + r set k1 v1 + # Next writing command will trigger evicting some keys if last + # command trigger DB dict rehash + r set k2 v2 + # There must be 4098 keys because redis doesn't evict keys. + r dbsize + } {4098} +} + +start_server {tags {"maxmemory external:skip"}} { + test {client tracking don't cause eviction feedback loop} { + r config set latency-tracking no + r config set maxmemory 0 + r config set maxmemory-policy allkeys-lru + r config set maxmemory-eviction-tenacity 100 + + # 10 clients listening on tracking messages + set clients {} + for {set j 0} {$j < 10} {incr j} { + lappend clients [redis_deferring_client] + } + foreach rd $clients { + $rd HELLO 3 + $rd read ; # Consume the HELLO reply + $rd CLIENT TRACKING on + $rd read ; # Consume the CLIENT reply + } + + # populate 300 keys, with long key name and short value + for {set j 0} {$j < 300} {incr j} { + set key $j[string repeat x 1000] + r set $key x + + # for each key, enable caching for this key + foreach rd $clients { + $rd get $key + $rd read + } + } + + # we need to wait one second for the client querybuf excess memory to be + # trimmed by cron, otherwise the INFO used_memory and CONFIG maxmemory + # below (on slow machines) won't be "atomic" and won't trigger eviction. + after 1100 + + # set the memory limit which will cause a few keys to be evicted + # we need to make sure to evict keynames of a total size of more than + # 16kb since the (PROTO_REPLY_CHUNK_BYTES), only after that the + # invalidation messages have a chance to trigger further eviction. + set used [s used_memory] + set limit [expr {$used - 40000}] + r config set maxmemory $limit + + # make sure some eviction happened + set evicted [s evicted_keys] + if {$::verbose} { puts "evicted: $evicted" } + + # make sure we didn't drain the database + assert_range [r dbsize] 200 300 + + assert_range $evicted 10 50 + foreach rd $clients { + $rd read ;# make sure we have some invalidation message waiting + $rd close + } + + # eviction continues (known problem described in #8069) + # for now this test only make sures the eviction loop itself doesn't + # have feedback loop + set evicted [s evicted_keys] + if {$::verbose} { puts "evicted: $evicted" } + } +} + +start_server {tags {"maxmemory" "external:skip"}} { + test {propagation with eviction} { + set repl [attach_to_replication_stream] + + r set asdf1 1 + r set asdf2 2 + r set asdf3 3 + + r config set maxmemory-policy allkeys-lru + r config set maxmemory 1 + + wait_for_condition 5000 10 { + [r dbsize] eq 0 + } else { + fail "Not all keys have been evicted" + } + + r config set maxmemory 0 + r config set maxmemory-policy noeviction + + r set asdf4 4 + + assert_replication_stream $repl { + {select *} + {set asdf1 1} + {set asdf2 2} + {set asdf3 3} + {del asdf*} + {del asdf*} + {del asdf*} + {set asdf4 4} + } + close_replication_stream $repl + + r config set maxmemory 0 + r config set maxmemory-policy noeviction + } +} + +start_server {tags {"maxmemory" "external:skip"}} { + test {propagation with eviction in MULTI} { + set repl [attach_to_replication_stream] + + r config set maxmemory-policy allkeys-lru + + r multi + r incr x + r config set maxmemory 1 + r incr x + assert_equal [r exec] {1 OK 2} + + wait_for_condition 5000 10 { + [r dbsize] eq 0 + } else { + fail "Not all keys have been evicted" + } + + assert_replication_stream $repl { + {select *} + {multi} + {incr x} + {incr x} + {exec} + {del x} + } + close_replication_stream $repl + + r config set maxmemory 0 + r config set maxmemory-policy noeviction + } +} diff --git a/tests/unit/memefficiency.tcl b/tests/unit/memefficiency.tcl new file mode 100644 index 0000000..cef4b8f --- /dev/null +++ b/tests/unit/memefficiency.tcl @@ -0,0 +1,578 @@ +proc test_memory_efficiency {range} { + r flushall + set rd [redis_deferring_client] + set base_mem [s used_memory] + set written 0 + for {set j 0} {$j < 10000} {incr j} { + set key key:$j + set val [string repeat A [expr {int(rand()*$range)}]] + $rd set $key $val + incr written [string length $key] + incr written [string length $val] + incr written 2 ;# A separator is the minimum to store key-value data. + } + for {set j 0} {$j < 10000} {incr j} { + $rd read ; # Discard replies + } + + set current_mem [s used_memory] + set used [expr {$current_mem-$base_mem}] + set efficiency [expr {double($written)/$used}] + return $efficiency +} + +start_server {tags {"memefficiency external:skip"}} { + foreach {size_range expected_min_efficiency} { + 32 0.15 + 64 0.25 + 128 0.35 + 1024 0.75 + 16384 0.82 + } { + test "Memory efficiency with values in range $size_range" { + set efficiency [test_memory_efficiency $size_range] + assert {$efficiency >= $expected_min_efficiency} + } + } +} + +run_solo {defrag} { +start_server {tags {"defrag external:skip"} overrides {appendonly yes auto-aof-rewrite-percentage 0 save ""}} { + if {[string match {*jemalloc*} [s mem_allocator]] && [r debug mallctl arenas.page] <= 8192} { + test "Active defrag" { + r config set hz 100 + r config set activedefrag no + r config set active-defrag-threshold-lower 5 + r config set active-defrag-cycle-min 65 + r config set active-defrag-cycle-max 75 + r config set active-defrag-ignore-bytes 2mb + r config set maxmemory 100mb + r config set maxmemory-policy allkeys-lru + + populate 700000 asdf1 150 + populate 170000 asdf2 300 + after 120 ;# serverCron only updates the info once in 100ms + set frag [s allocator_frag_ratio] + if {$::verbose} { + puts "frag $frag" + } + assert {$frag >= 1.4} + + r config set latency-monitor-threshold 5 + r latency reset + r config set maxmemory 110mb ;# prevent further eviction (not to fail the digest test) + set digest [debug_digest] + catch {r config set activedefrag yes} e + if {[r config get activedefrag] eq "activedefrag yes"} { + # Wait for the active defrag to start working (decision once a + # second). + wait_for_condition 50 100 { + [s active_defrag_running] ne 0 + } else { + fail "defrag not started." + } + + # Wait for the active defrag to stop working. + wait_for_condition 2000 100 { + [s active_defrag_running] eq 0 + } else { + after 120 ;# serverCron only updates the info once in 100ms + puts [r info memory] + puts [r memory malloc-stats] + fail "defrag didn't stop." + } + + # Test the fragmentation is lower. + after 120 ;# serverCron only updates the info once in 100ms + set frag [s allocator_frag_ratio] + set max_latency 0 + foreach event [r latency latest] { + lassign $event eventname time latency max + if {$eventname == "active-defrag-cycle"} { + set max_latency $max + } + } + if {$::verbose} { + puts "frag $frag" + set misses [s active_defrag_misses] + set hits [s active_defrag_hits] + puts "hits: $hits" + puts "misses: $misses" + puts "max latency $max_latency" + puts [r latency latest] + puts [r latency history active-defrag-cycle] + } + assert {$frag < 1.1} + # due to high fragmentation, 100hz, and active-defrag-cycle-max set to 75, + # we expect max latency to be not much higher than 7.5ms but due to rare slowness threshold is set higher + if {!$::no_latency} { + assert {$max_latency <= 30} + } + } + # verify the data isn't corrupted or changed + set newdigest [debug_digest] + assert {$digest eq $newdigest} + r save ;# saving an rdb iterates over all the data / pointers + + # if defrag is supported, test AOF loading too + if {[r config get activedefrag] eq "activedefrag yes"} { + # reset stats and load the AOF file + r config resetstat + r config set key-load-delay -50 ;# sleep on average 1/50 usec + r debug loadaof + r config set activedefrag no + # measure hits and misses right after aof loading + set misses [s active_defrag_misses] + set hits [s active_defrag_hits] + + after 120 ;# serverCron only updates the info once in 100ms + set frag [s allocator_frag_ratio] + set max_latency 0 + foreach event [r latency latest] { + lassign $event eventname time latency max + if {$eventname == "while-blocked-cron"} { + set max_latency $max + } + } + if {$::verbose} { + puts "AOF loading:" + puts "frag $frag" + puts "hits: $hits" + puts "misses: $misses" + puts "max latency $max_latency" + puts [r latency latest] + puts [r latency history "while-blocked-cron"] + } + # make sure we had defrag hits during AOF loading + assert {$hits > 100000} + # make sure the defragger did enough work to keep the fragmentation low during loading. + # we cannot check that it went all the way down, since we don't wait for full defrag cycle to complete. + assert {$frag < 1.4} + # since the AOF contains simple (fast) SET commands (and the cron during loading runs every 1000 commands), + # it'll still not block the loading for long periods of time. + if {!$::no_latency} { + assert {$max_latency <= 30} + } + } + } + r config set appendonly no + r config set key-load-delay 0 + + test "Active defrag eval scripts" { + r flushdb + r script flush sync + r config resetstat + r config set hz 100 + r config set activedefrag no + r config set active-defrag-threshold-lower 5 + r config set active-defrag-cycle-min 65 + r config set active-defrag-cycle-max 75 + r config set active-defrag-ignore-bytes 1500kb + r config set maxmemory 0 + + set n 50000 + + # Populate memory with interleaving script-key pattern of same size + set dummy_script "--[string repeat x 400]\nreturn " + set rd [redis_deferring_client] + for {set j 0} {$j < $n} {incr j} { + set val "$dummy_script[format "%06d" $j]" + $rd script load $val + $rd set k$j $val + } + for {set j 0} {$j < $n} {incr j} { + $rd read ; # Discard script load replies + $rd read ; # Discard set replies + } + after 120 ;# serverCron only updates the info once in 100ms + if {$::verbose} { + puts "used [s allocator_allocated]" + puts "rss [s allocator_active]" + puts "frag [s allocator_frag_ratio]" + puts "frag_bytes [s allocator_frag_bytes]" + } + assert_lessthan [s allocator_frag_ratio] 1.05 + + # Delete all the keys to create fragmentation + for {set j 0} {$j < $n} {incr j} { $rd del k$j } + for {set j 0} {$j < $n} {incr j} { $rd read } ; # Discard del replies + $rd close + after 120 ;# serverCron only updates the info once in 100ms + if {$::verbose} { + puts "used [s allocator_allocated]" + puts "rss [s allocator_active]" + puts "frag [s allocator_frag_ratio]" + puts "frag_bytes [s allocator_frag_bytes]" + } + assert_morethan [s allocator_frag_ratio] 1.4 + + catch {r config set activedefrag yes} e + if {[r config get activedefrag] eq "activedefrag yes"} { + + # wait for the active defrag to start working (decision once a second) + wait_for_condition 50 100 { + [s active_defrag_running] ne 0 + } else { + fail "defrag not started." + } + + # wait for the active defrag to stop working + wait_for_condition 500 100 { + [s active_defrag_running] eq 0 + } else { + after 120 ;# serverCron only updates the info once in 100ms + puts [r info memory] + puts [r memory malloc-stats] + fail "defrag didn't stop." + } + + # test the fragmentation is lower + after 120 ;# serverCron only updates the info once in 100ms + if {$::verbose} { + puts "used [s allocator_allocated]" + puts "rss [s allocator_active]" + puts "frag [s allocator_frag_ratio]" + puts "frag_bytes [s allocator_frag_bytes]" + } + assert_lessthan_equal [s allocator_frag_ratio] 1.05 + } + # Flush all script to make sure we don't crash after defragging them + r script flush sync + } {OK} + + test "Active defrag big keys" { + r flushdb + r config resetstat + r config set hz 100 + r config set activedefrag no + r config set active-defrag-max-scan-fields 1000 + r config set active-defrag-threshold-lower 5 + r config set active-defrag-cycle-min 65 + r config set active-defrag-cycle-max 75 + r config set active-defrag-ignore-bytes 2mb + r config set maxmemory 0 + r config set list-max-ziplist-size 5 ;# list of 10k items will have 2000 quicklist nodes + r config set stream-node-max-entries 5 + r hmset hash h1 v1 h2 v2 h3 v3 + r lpush list a b c d + r zadd zset 0 a 1 b 2 c 3 d + r sadd set a b c d + r xadd stream * item 1 value a + r xadd stream * item 2 value b + r xgroup create stream mygroup 0 + r xreadgroup GROUP mygroup Alice COUNT 1 STREAMS stream > + + # create big keys with 10k items + set rd [redis_deferring_client] + for {set j 0} {$j < 10000} {incr j} { + $rd hset bighash $j [concat "asdfasdfasdf" $j] + $rd lpush biglist [concat "asdfasdfasdf" $j] + $rd zadd bigzset $j [concat "asdfasdfasdf" $j] + $rd sadd bigset [concat "asdfasdfasdf" $j] + $rd xadd bigstream * item 1 value a + } + for {set j 0} {$j < 50000} {incr j} { + $rd read ; # Discard replies + } + + set expected_frag 1.7 + if {$::accurate} { + # scale the hash to 1m fields in order to have a measurable the latency + for {set j 10000} {$j < 1000000} {incr j} { + $rd hset bighash $j [concat "asdfasdfasdf" $j] + } + for {set j 10000} {$j < 1000000} {incr j} { + $rd read ; # Discard replies + } + # creating that big hash, increased used_memory, so the relative frag goes down + set expected_frag 1.3 + } + + # add a mass of string keys + for {set j 0} {$j < 500000} {incr j} { + $rd setrange $j 150 a + } + for {set j 0} {$j < 500000} {incr j} { + $rd read ; # Discard replies + } + assert_equal [r dbsize] 500010 + + # create some fragmentation + for {set j 0} {$j < 500000} {incr j 2} { + $rd del $j + } + for {set j 0} {$j < 500000} {incr j 2} { + $rd read ; # Discard replies + } + assert_equal [r dbsize] 250010 + + # start defrag + after 120 ;# serverCron only updates the info once in 100ms + set frag [s allocator_frag_ratio] + if {$::verbose} { + puts "frag $frag" + } + assert {$frag >= $expected_frag} + r config set latency-monitor-threshold 5 + r latency reset + + set digest [debug_digest] + catch {r config set activedefrag yes} e + if {[r config get activedefrag] eq "activedefrag yes"} { + # wait for the active defrag to start working (decision once a second) + wait_for_condition 50 100 { + [s active_defrag_running] ne 0 + } else { + fail "defrag not started." + } + + # wait for the active defrag to stop working + wait_for_condition 500 100 { + [s active_defrag_running] eq 0 + } else { + after 120 ;# serverCron only updates the info once in 100ms + puts [r info memory] + puts [r memory malloc-stats] + fail "defrag didn't stop." + } + + # test the fragmentation is lower + after 120 ;# serverCron only updates the info once in 100ms + set frag [s allocator_frag_ratio] + set max_latency 0 + foreach event [r latency latest] { + lassign $event eventname time latency max + if {$eventname == "active-defrag-cycle"} { + set max_latency $max + } + } + if {$::verbose} { + puts "frag $frag" + set misses [s active_defrag_misses] + set hits [s active_defrag_hits] + puts "hits: $hits" + puts "misses: $misses" + puts "max latency $max_latency" + puts [r latency latest] + puts [r latency history active-defrag-cycle] + } + assert {$frag < 1.1} + # due to high fragmentation, 100hz, and active-defrag-cycle-max set to 75, + # we expect max latency to be not much higher than 7.5ms but due to rare slowness threshold is set higher + if {!$::no_latency} { + assert {$max_latency <= 30} + } + } + # verify the data isn't corrupted or changed + set newdigest [debug_digest] + assert {$digest eq $newdigest} + r save ;# saving an rdb iterates over all the data / pointers + } {OK} + + test "Active defrag big list" { + r flushdb + r config resetstat + r config set hz 100 + r config set activedefrag no + r config set active-defrag-max-scan-fields 1000 + r config set active-defrag-threshold-lower 5 + r config set active-defrag-cycle-min 65 + r config set active-defrag-cycle-max 75 + r config set active-defrag-ignore-bytes 2mb + r config set maxmemory 0 + r config set list-max-ziplist-size 5 ;# list of 500k items will have 100k quicklist nodes + + # create big keys with 10k items + set rd [redis_deferring_client] + + set expected_frag 1.7 + # add a mass of list nodes to two lists (allocations are interlaced) + set val [string repeat A 100] ;# 5 items of 100 bytes puts us in the 640 bytes bin, which has 32 regs, so high potential for fragmentation + set elements 500000 + for {set j 0} {$j < $elements} {incr j} { + $rd lpush biglist1 $val + $rd lpush biglist2 $val + } + for {set j 0} {$j < $elements} {incr j} { + $rd read ; # Discard replies + $rd read ; # Discard replies + } + + # create some fragmentation + r del biglist2 + + # start defrag + after 120 ;# serverCron only updates the info once in 100ms + set frag [s allocator_frag_ratio] + if {$::verbose} { + puts "frag $frag" + } + + assert {$frag >= $expected_frag} + r config set latency-monitor-threshold 5 + r latency reset + + set digest [debug_digest] + catch {r config set activedefrag yes} e + if {[r config get activedefrag] eq "activedefrag yes"} { + # wait for the active defrag to start working (decision once a second) + wait_for_condition 50 100 { + [s active_defrag_running] ne 0 + } else { + fail "defrag not started." + } + + # wait for the active defrag to stop working + wait_for_condition 500 100 { + [s active_defrag_running] eq 0 + } else { + after 120 ;# serverCron only updates the info once in 100ms + puts [r info memory] + puts [r info stats] + puts [r memory malloc-stats] + fail "defrag didn't stop." + } + + # test the fragmentation is lower + after 120 ;# serverCron only updates the info once in 100ms + set misses [s active_defrag_misses] + set hits [s active_defrag_hits] + set frag [s allocator_frag_ratio] + set max_latency 0 + foreach event [r latency latest] { + lassign $event eventname time latency max + if {$eventname == "active-defrag-cycle"} { + set max_latency $max + } + } + if {$::verbose} { + puts "frag $frag" + puts "misses: $misses" + puts "hits: $hits" + puts "max latency $max_latency" + puts [r latency latest] + puts [r latency history active-defrag-cycle] + } + assert {$frag < 1.1} + # due to high fragmentation, 100hz, and active-defrag-cycle-max set to 75, + # we expect max latency to be not much higher than 7.5ms but due to rare slowness threshold is set higher + if {!$::no_latency} { + assert {$max_latency <= 30} + } + + # in extreme cases of stagnation, we see over 20m misses before the tests aborts with "defrag didn't stop", + # in normal cases we only see 100k misses out of 500k elements + assert {$misses < $elements} + } + # verify the data isn't corrupted or changed + set newdigest [debug_digest] + assert {$digest eq $newdigest} + r save ;# saving an rdb iterates over all the data / pointers + r del biglist1 ;# coverage for quicklistBookmarksClear + } {1} + + test "Active defrag edge case" { + # there was an edge case in defrag where all the slabs of a certain bin are exact the same + # % utilization, with the exception of the current slab from which new allocations are made + # if the current slab is lower in utilization the defragger would have ended up in stagnation, + # kept running and not move any allocation. + # this test is more consistent on a fresh server with no history + start_server {tags {"defrag"} overrides {save ""}} { + r flushdb + r config resetstat + r config set hz 100 + r config set activedefrag no + r config set active-defrag-max-scan-fields 1000 + r config set active-defrag-threshold-lower 5 + r config set active-defrag-cycle-min 65 + r config set active-defrag-cycle-max 75 + r config set active-defrag-ignore-bytes 1mb + r config set maxmemory 0 + set expected_frag 1.3 + + r debug mallctl-str thread.tcache.flush VOID + # fill the first slab containin 32 regs of 640 bytes. + for {set j 0} {$j < 32} {incr j} { + r setrange "_$j" 600 x + r debug mallctl-str thread.tcache.flush VOID + } + + # add a mass of keys with 600 bytes values, fill the bin of 640 bytes which has 32 regs per slab. + set rd [redis_deferring_client] + set keys 640000 + for {set j 0} {$j < $keys} {incr j} { + $rd setrange $j 600 x + } + for {set j 0} {$j < $keys} {incr j} { + $rd read ; # Discard replies + } + + # create some fragmentation of 50% + set sent 0 + for {set j 0} {$j < $keys} {incr j 1} { + $rd del $j + incr sent + incr j 1 + } + for {set j 0} {$j < $sent} {incr j} { + $rd read ; # Discard replies + } + + # create higher fragmentation in the first slab + for {set j 10} {$j < 32} {incr j} { + r del "_$j" + } + + # start defrag + after 120 ;# serverCron only updates the info once in 100ms + set frag [s allocator_frag_ratio] + if {$::verbose} { + puts "frag $frag" + } + + assert {$frag >= $expected_frag} + + set digest [debug_digest] + catch {r config set activedefrag yes} e + if {[r config get activedefrag] eq "activedefrag yes"} { + # wait for the active defrag to start working (decision once a second) + wait_for_condition 50 100 { + [s active_defrag_running] ne 0 + } else { + fail "defrag not started." + } + + # wait for the active defrag to stop working + wait_for_condition 500 100 { + [s active_defrag_running] eq 0 + } else { + after 120 ;# serverCron only updates the info once in 100ms + puts [r info memory] + puts [r info stats] + puts [r memory malloc-stats] + fail "defrag didn't stop." + } + + # test the fragmentation is lower + after 120 ;# serverCron only updates the info once in 100ms + set misses [s active_defrag_misses] + set hits [s active_defrag_hits] + set frag [s allocator_frag_ratio] + if {$::verbose} { + puts "frag $frag" + puts "hits: $hits" + puts "misses: $misses" + } + assert {$frag < 1.1} + assert {$misses < 10000000} ;# when defrag doesn't stop, we have some 30m misses, when it does, we have 2m misses + } + + # verify the data isn't corrupted or changed + set newdigest [debug_digest] + assert {$digest eq $newdigest} + r save ;# saving an rdb iterates over all the data / pointers + } + } + } +} +} ;# run_solo diff --git a/tests/unit/moduleapi/aclcheck.tcl b/tests/unit/moduleapi/aclcheck.tcl new file mode 100644 index 0000000..d96ea89 --- /dev/null +++ b/tests/unit/moduleapi/aclcheck.tcl @@ -0,0 +1,99 @@ +set testmodule [file normalize tests/modules/aclcheck.so] + +start_server {tags {"modules acl"}} { + r module load $testmodule + + test {test module check acl for command perm} { + # by default all commands allowed + assert_equal [r aclcheck.rm_call.check.cmd set x 5] OK + # block SET command for user + r acl setuser default -set + catch {r aclcheck.rm_call.check.cmd set x 5} e + assert_match {*DENIED CMD*} $e + + # verify that new log entry added + set entry [lindex [r ACL LOG] 0] + assert {[dict get $entry username] eq {default}} + assert {[dict get $entry context] eq {module}} + assert {[dict get $entry object] eq {set}} + assert {[dict get $entry reason] eq {command}} + } + + test {test module check acl for key perm} { + # give permission for SET and block all keys but x(READ+WRITE), y(WRITE), z(READ) + r acl setuser default +set resetkeys ~x %W~y %R~z + + assert_equal [r aclcheck.set.check.key "*" x 5] OK + catch {r aclcheck.set.check.key "*" v 5} e + assert_match "*DENIED KEY*" $e + + assert_equal [r aclcheck.set.check.key "~" x 5] OK + assert_equal [r aclcheck.set.check.key "~" y 5] OK + assert_equal [r aclcheck.set.check.key "~" z 5] OK + catch {r aclcheck.set.check.key "~" v 5} e + assert_match "*DENIED KEY*" $e + + assert_equal [r aclcheck.set.check.key "W" y 5] OK + catch {r aclcheck.set.check.key "W" v 5} e + assert_match "*DENIED KEY*" $e + + assert_equal [r aclcheck.set.check.key "R" z 5] OK + catch {r aclcheck.set.check.key "R" v 5} e + assert_match "*DENIED KEY*" $e + } + + test {test module check acl for module user} { + # the module user has access to all keys + assert_equal [r aclcheck.rm_call.check.cmd.module.user set y 5] OK + } + + test {test module check acl for channel perm} { + # block all channels but ch1 + r acl setuser default resetchannels &ch1 + assert_equal [r aclcheck.publish.check.channel ch1 msg] 0 + catch {r aclcheck.publish.check.channel ch2 msg} e + set e + } {*DENIED CHANNEL*} + + test {test module check acl in rm_call} { + # rm call check for key permission (x: READ + WRITE) + assert_equal [r aclcheck.rm_call set x 5] OK + assert_equal [r aclcheck.rm_call set x 6 get] 5 + + # rm call check for key permission (y: only WRITE) + assert_equal [r aclcheck.rm_call set y 5] OK + assert_error {*NOPERM*} {r aclcheck.rm_call set y 5 get} + assert_error {ERR acl verification failed, can't access at least one of the keys mentioned in the command arguments.} {r aclcheck.rm_call_with_errors set y 5 get} + + # rm call check for key permission (z: only READ) + assert_error {*NOPERM*} {r aclcheck.rm_call set z 5} + assert_error {ERR acl verification failed, can't access at least one of the keys mentioned in the command arguments.} {r aclcheck.rm_call_with_errors set z 5} + assert_error {*NOPERM*} {r aclcheck.rm_call set z 6 get} + assert_error {ERR acl verification failed, can't access at least one of the keys mentioned in the command arguments.} {r aclcheck.rm_call_with_errors set z 6 get} + + # verify that new log entry added + set entry [lindex [r ACL LOG] 0] + assert {[dict get $entry username] eq {default}} + assert {[dict get $entry context] eq {module}} + assert {[dict get $entry object] eq {z}} + assert {[dict get $entry reason] eq {key}} + + # rm call check for command permission + r acl setuser default -set + catch {r aclcheck.rm_call set x 5} e + assert_match {*NOPERM*} $e + catch {r aclcheck.rm_call_with_errors set x 5} e + assert_match {ERR acl verification failed, can't run this command or subcommand.} $e + + # verify that new log entry added + set entry [lindex [r ACL LOG] 0] + assert {[dict get $entry username] eq {default}} + assert {[dict get $entry context] eq {module}} + assert {[dict get $entry object] eq {set}} + assert {[dict get $entry reason] eq {command}} + } + + test "Unload the module - aclcheck" { + assert_equal {OK} [r module unload aclcheck] + } +} diff --git a/tests/unit/moduleapi/auth.tcl b/tests/unit/moduleapi/auth.tcl new file mode 100644 index 0000000..c7c2def --- /dev/null +++ b/tests/unit/moduleapi/auth.tcl @@ -0,0 +1,90 @@ +set testmodule [file normalize tests/modules/auth.so] + +start_server {tags {"modules"}} { + r module load $testmodule + + test {Modules can create a user that can be authenticated} { + # Make sure we start authenticated with default user + r auth default "" + assert_equal [r acl whoami] "default" + r auth.createmoduleuser + + set id [r auth.authmoduleuser] + assert_equal [r client id] $id + + # Verify returned id is the same as our current id and + # we are authenticated with the specified user + assert_equal [r acl whoami] "global" + } + + test {De-authenticating clients is tracked and kills clients} { + assert_equal [r auth.changecount] 0 + r auth.createmoduleuser + + # Catch the I/O exception that was thrown when Redis + # disconnected with us. + catch { [r ping] } e + assert_match {*I/O*} $e + + # Check that a user change was registered + assert_equal [r auth.changecount] 1 + } + + test {Modules can't authenticate with ACLs users that dont exist} { + catch { [r auth.authrealuser auth-module-test-fake] } e + assert_match {*Invalid user*} $e + } + + test {Modules can authenticate with ACL users} { + assert_equal [r acl whoami] "default" + + # Create user to auth into + r acl setuser auth-module-test on allkeys allcommands + + set id [r auth.authrealuser auth-module-test] + + # Verify returned id is the same as our current id and + # we are authenticated with the specified user + assert_equal [r client id] $id + assert_equal [r acl whoami] "auth-module-test" + } + + test {Client callback is called on user switch} { + assert_equal [r auth.changecount] 0 + + # Auth again and validate change count + r auth.authrealuser auth-module-test + assert_equal [r auth.changecount] 1 + + # Re-auth with the default user + r auth default "" + assert_equal [r auth.changecount] 1 + assert_equal [r acl whoami] "default" + + # Re-auth with the default user again, to + # verify the callback isn't fired again + r auth default "" + assert_equal [r auth.changecount] 0 + assert_equal [r acl whoami] "default" + } + + test {modules can redact arguments} { + r config set slowlog-log-slower-than 0 + r slowlog reset + r auth.redact 1 2 3 4 + r auth.redact 1 2 3 + r config set slowlog-log-slower-than -1 + set slowlog_resp [r slowlog get] + + # There will be 3 records, slowlog reset and the + # two auth redact calls. + assert_equal 3 [llength $slowlog_resp] + assert_equal {slowlog reset} [lindex [lindex $slowlog_resp 2] 3] + assert_equal {auth.redact 1 (redacted) 3 (redacted)} [lindex [lindex $slowlog_resp 1] 3] + assert_equal {auth.redact (redacted) 2 (redacted)} [lindex [lindex $slowlog_resp 0] 3] + } + + test "Unload the module - testacl" { + assert_equal {OK} [r module unload testacl] + } +} diff --git a/tests/unit/moduleapi/basics.tcl b/tests/unit/moduleapi/basics.tcl new file mode 100644 index 0000000..040d9eb --- /dev/null +++ b/tests/unit/moduleapi/basics.tcl @@ -0,0 +1,41 @@ +set testmodule [file normalize tests/modules/basics.so] + +start_server {tags {"modules"}} { + r module load $testmodule + + test {test module api basics} { + r test.basics + } {ALL TESTS PASSED} + + test {test rm_call auto mode} { + r hello 2 + set reply [r test.rmcallautomode] + assert_equal [lindex $reply 0] f1 + assert_equal [lindex $reply 1] v1 + assert_equal [lindex $reply 2] f2 + assert_equal [lindex $reply 3] v2 + r hello 3 + set reply [r test.rmcallautomode] + assert_equal [dict get $reply f1] v1 + assert_equal [dict get $reply f2] v2 + } + + test {test get resp} { + r hello 2 + set reply [r test.getresp] + assert_equal $reply 2 + r hello 3 + set reply [r test.getresp] + assert_equal $reply 3 + } + + test "Unload the module - test" { + assert_equal {OK} [r module unload test] + } +} + +start_server {tags {"modules external:skip"} overrides {enable-module-command no}} { + test {module command disabled} { + assert_error "ERR *MODULE command not allowed*" {r module load $testmodule} + } +}
\ No newline at end of file diff --git a/tests/unit/moduleapi/blockedclient.tcl b/tests/unit/moduleapi/blockedclient.tcl new file mode 100644 index 0000000..bdcef96 --- /dev/null +++ b/tests/unit/moduleapi/blockedclient.tcl @@ -0,0 +1,277 @@ +set testmodule [file normalize tests/modules/blockedclient.so] + +start_server {tags {"modules"}} { + r module load $testmodule + + test {Locked GIL acquisition} { + assert_match "OK" [r acquire_gil] + } + + test {Locked GIL acquisition during multi} { + r multi + r acquire_gil + assert_equal {{Blocked client is not supported inside multi}} [r exec] + } + + test {Locked GIL acquisition from RM_Call} { + assert_equal {Blocked client is not allowed} [r do_rm_call acquire_gil] + } + + test {Blocking command are not block the client on RM_Call} { + r lpush l test + assert_equal [r do_rm_call blpop l 0] {l test} + + r lpush l test + assert_equal [r do_rm_call brpop l 0] {l test} + + r lpush l1 test + assert_equal [r do_rm_call brpoplpush l1 l2 0] {test} + assert_equal [r do_rm_call brpop l2 0] {l2 test} + + r lpush l1 test + assert_equal [r do_rm_call blmove l1 l2 LEFT LEFT 0] {test} + assert_equal [r do_rm_call brpop l2 0] {l2 test} + + r ZADD zset1 0 a 1 b 2 c + assert_equal [r do_rm_call bzpopmin zset1 0] {zset1 a 0} + assert_equal [r do_rm_call bzpopmax zset1 0] {zset1 c 2} + + r xgroup create s g $ MKSTREAM + r xadd s * foo bar + assert {[r do_rm_call xread BLOCK 0 STREAMS s 0-0] ne {}} + assert {[r do_rm_call xreadgroup group g c BLOCK 0 STREAMS s >] ne {}} + + assert {[r do_rm_call blpop empty_list 0] eq {}} + assert {[r do_rm_call brpop empty_list 0] eq {}} + assert {[r do_rm_call brpoplpush empty_list1 empty_list2 0] eq {}} + assert {[r do_rm_call blmove empty_list1 empty_list2 LEFT LEFT 0] eq {}} + + assert {[r do_rm_call bzpopmin empty_zset 0] eq {}} + assert {[r do_rm_call bzpopmax empty_zset 0] eq {}} + + r xgroup create empty_stream g $ MKSTREAM + assert {[r do_rm_call xread BLOCK 0 STREAMS empty_stream $] eq {}} + assert {[r do_rm_call xreadgroup group g c BLOCK 0 STREAMS empty_stream >] eq {}} + + } + + test {Monitor disallow inside RM_Call} { + set e {} + catch { + r do_rm_call monitor + } e + set e + } {*ERR*DENY BLOCKING*} + + test {subscribe disallow inside RM_Call} { + set e {} + catch { + r do_rm_call subscribe x + } e + set e + } {*ERR*DENY BLOCKING*} + + test {RM_Call from blocked client} { + r hset hash foo bar + r do_bg_rm_call hgetall hash + } {foo bar} + + test {RM_Call from blocked client with script mode} { + r do_bg_rm_call_format S hset k foo bar + } {1} + + test {RM_Call from blocked client with oom mode} { + r config set maxmemory 1 + # will set server.pre_command_oom_state to 1 + assert_error {OOM command not allowed*} {r hset hash foo bar} + r config set maxmemory 0 + # now its should be OK to call OOM commands + r do_bg_rm_call_format M hset k1 foo bar + } {1} {needs:config-maxmemory} + + test {RESP version carries through to blocked client} { + for {set client_proto 2} {$client_proto <= 3} {incr client_proto} { + r hello $client_proto + r readraw 1 + set ret [r do_fake_bg_true] + if {$client_proto == 2} { + assert_equal $ret {:1} + } else { + assert_equal $ret "#t" + } + r readraw 0 + } + } + +foreach call_type {nested normal} { + test "Busy module command - $call_type" { + set busy_time_limit 50 + set old_time_limit [lindex [r config get busy-reply-threshold] 1] + r config set busy-reply-threshold $busy_time_limit + set rd [redis_deferring_client] + + # run command that blocks until released + set start [clock clicks -milliseconds] + if {$call_type == "nested"} { + $rd do_rm_call slow_fg_command 0 + } else { + $rd slow_fg_command 0 + } + $rd flush + + # send another command after the blocked one, to make sure we don't attempt to process it + $rd ping + $rd flush + + # make sure we get BUSY error, and that we didn't get it too early + assert_error {*BUSY Slow module operation*} {r ping} + assert_morethan_equal [expr [clock clicks -milliseconds]-$start] $busy_time_limit + + # abort the blocking operation + r stop_slow_fg_command + wait_for_condition 50 100 { + [catch {r ping} e] == 0 + } else { + fail "Failed waiting for busy command to end" + } + assert_equal [$rd read] "1" + assert_equal [$rd read] "PONG" + + # run command that blocks for 200ms + set start [clock clicks -milliseconds] + if {$call_type == "nested"} { + $rd do_rm_call slow_fg_command 200000 + } else { + $rd slow_fg_command 200000 + } + $rd flush + after 10 ;# try to make sure redis started running the command before we proceed + + # make sure we didn't get BUSY error, it simply blocked till the command was done + r ping + assert_morethan_equal [expr [clock clicks -milliseconds]-$start] 200 + $rd read + + $rd close + r config set busy-reply-threshold $old_time_limit + } +} + + test {RM_Call from blocked client} { + set busy_time_limit 50 + set old_time_limit [lindex [r config get busy-reply-threshold] 1] + r config set busy-reply-threshold $busy_time_limit + + # trigger slow operation + r set_slow_bg_operation 1 + r hset hash foo bar + set rd [redis_deferring_client] + set start [clock clicks -milliseconds] + $rd do_bg_rm_call hgetall hash + + # send another command after the blocked one, to make sure we don't attempt to process it + $rd ping + $rd flush + + # wait till we know we're blocked inside the module + wait_for_condition 50 100 { + [r is_in_slow_bg_operation] eq 1 + } else { + fail "Failed waiting for slow operation to start" + } + + # make sure we get BUSY error, and that we didn't get here too early + assert_error {*BUSY Slow module operation*} {r ping} + assert_morethan [expr [clock clicks -milliseconds]-$start] $busy_time_limit + # abort the blocking operation + r set_slow_bg_operation 0 + + wait_for_condition 50 100 { + [r is_in_slow_bg_operation] eq 0 + } else { + fail "Failed waiting for slow operation to stop" + } + assert_equal [r ping] {PONG} + + r config set busy-reply-threshold $old_time_limit + assert_equal [$rd read] {foo bar} + assert_equal [$rd read] {PONG} + $rd close + } + + test {blocked client reaches client output buffer limit} { + r hset hash big [string repeat x 50000] + r hset hash bada [string repeat x 50000] + r hset hash boom [string repeat x 50000] + r config set client-output-buffer-limit {normal 100000 0 0} + r client setname myclient + catch {r do_bg_rm_call hgetall hash} e + assert_match "*I/O error*" $e + reconnect + set clients [r client list] + assert_no_match "*name=myclient*" $clients + } + + test {module client error stats} { + r config resetstat + + # simple module command that replies with string error + assert_error "ERR unknown command 'hgetalllll', with args beginning with:" {r do_rm_call hgetalllll} + assert_equal [errorrstat ERR r] {count=1} + + # simple module command that replies with string error + assert_error "ERR unknown subcommand 'bla'. Try CONFIG HELP." {r do_rm_call config bla} + assert_equal [errorrstat ERR r] {count=2} + + # module command that replies with string error from bg thread + assert_error "NULL reply returned" {r do_bg_rm_call hgetalllll} + assert_equal [errorrstat NULL r] {count=1} + + # module command that returns an arity error + r do_rm_call set x x + assert_error "ERR wrong number of arguments for 'do_rm_call' command" {r do_rm_call} + assert_equal [errorrstat ERR r] {count=3} + + # RM_Call that propagates an error + assert_error "WRONGTYPE*" {r do_rm_call hgetall x} + assert_equal [errorrstat WRONGTYPE r] {count=1} + assert_match {*calls=1,*,rejected_calls=0,failed_calls=1} [cmdrstat hgetall r] + + # RM_Call from bg thread that propagates an error + assert_error "WRONGTYPE*" {r do_bg_rm_call hgetall x} + assert_equal [errorrstat WRONGTYPE r] {count=2} + assert_match {*calls=2,*,rejected_calls=0,failed_calls=2} [cmdrstat hgetall r] + + assert_equal [s total_error_replies] 6 + assert_match {*calls=5,*,rejected_calls=0,failed_calls=4} [cmdrstat do_rm_call r] + assert_match {*calls=2,*,rejected_calls=0,failed_calls=2} [cmdrstat do_bg_rm_call r] + } + + set master [srv 0 client] + set master_host [srv 0 host] + set master_port [srv 0 port] + start_server [list overrides [list loadmodule "$testmodule"]] { + set replica [srv 0 client] + set replica_host [srv 0 host] + set replica_port [srv 0 port] + + # Start the replication process... + $replica replicaof $master_host $master_port + wait_for_sync $replica + + test {WAIT command on module blocked client} { + pause_process [srv 0 pid] + + $master do_bg_rm_call_format ! hset bk1 foo bar + + assert_equal [$master wait 1 1000] 0 + resume_process [srv 0 pid] + assert_equal [$master wait 1 1000] 1 + assert_equal [$replica hget bk1 foo] bar + } + } + + test "Unload the module - blockedclient" { + assert_equal {OK} [r module unload blockedclient] + } +} diff --git a/tests/unit/moduleapi/blockonbackground.tcl b/tests/unit/moduleapi/blockonbackground.tcl new file mode 100644 index 0000000..fcd7f1d --- /dev/null +++ b/tests/unit/moduleapi/blockonbackground.tcl @@ -0,0 +1,126 @@ +set testmodule [file normalize tests/modules/blockonbackground.so] + +source tests/support/util.tcl + +proc latency_percentiles_usec {cmd} { + return [latencyrstat_percentiles $cmd r] +} + +start_server {tags {"modules"}} { + r module load $testmodule + + test { blocked clients time tracking - check blocked command that uses RedisModule_BlockedClientMeasureTimeStart() is tracking background time} { + r slowlog reset + r config set slowlog-log-slower-than 200000 + if {!$::no_latency} { + assert_equal [r slowlog len] 0 + } + r block.debug 0 10000 + if {!$::no_latency} { + assert_equal [r slowlog len] 0 + } + r config resetstat + r config set latency-tracking yes + r config set latency-tracking-info-percentiles "50.0" + r block.debug 200 10000 + if {!$::no_latency} { + assert_equal [r slowlog len] 1 + } + + set cmdstatline [cmdrstat block.debug r] + set latencystatline_debug [latency_percentiles_usec block.debug] + + regexp "calls=1,usec=(.*?),usec_per_call=(.*?),rejected_calls=0,failed_calls=0" $cmdstatline -> usec usec_per_call + regexp "p50=(.+\..+)" $latencystatline_debug -> p50 + assert {$usec >= 100000} + assert {$usec_per_call >= 100000} + assert {$p50 >= 100000} + } + + test { blocked clients time tracking - check blocked command that uses RedisModule_BlockedClientMeasureTimeStart() is tracking background time even in timeout } { + r slowlog reset + r config set slowlog-log-slower-than 200000 + if {!$::no_latency} { + assert_equal [r slowlog len] 0 + } + r block.debug 0 20000 + if {!$::no_latency} { + assert_equal [r slowlog len] 0 + } + r config resetstat + r block.debug 20000 500 + if {!$::no_latency} { + assert_equal [r slowlog len] 1 + } + + set cmdstatline [cmdrstat block.debug r] + + regexp "calls=1,usec=(.*?),usec_per_call=(.*?),rejected_calls=0,failed_calls=0" $cmdstatline usec usec_per_call + assert {$usec >= 250000} + assert {$usec_per_call >= 250000} + } + + test { blocked clients time tracking - check blocked command with multiple calls RedisModule_BlockedClientMeasureTimeStart() is tracking the total background time } { + r slowlog reset + r config set slowlog-log-slower-than 200000 + if {!$::no_latency} { + assert_equal [r slowlog len] 0 + } + r block.double_debug 0 + if {!$::no_latency} { + assert_equal [r slowlog len] 0 + } + r config resetstat + r block.double_debug 100 + if {!$::no_latency} { + assert_equal [r slowlog len] 1 + } + set cmdstatline [cmdrstat block.double_debug r] + + regexp "calls=1,usec=(.*?),usec_per_call=(.*?),rejected_calls=0,failed_calls=0" $cmdstatline usec usec_per_call + assert {$usec >= 60000} + assert {$usec_per_call >= 60000} + } + + test { blocked clients time tracking - check blocked command without calling RedisModule_BlockedClientMeasureTimeStart() is not reporting background time } { + r slowlog reset + r config set slowlog-log-slower-than 200000 + if {!$::no_latency} { + assert_equal [r slowlog len] 0 + } + r block.debug_no_track 200 1000 + # ensure slowlog is still empty + if {!$::no_latency} { + assert_equal [r slowlog len] 0 + } + } + + test "client unblock works only for modules with timeout support" { + set rd [redis_deferring_client] + $rd client id + set id [$rd read] + + # Block with a timeout function - may unblock + $rd block.block 20000 + wait_for_condition 50 100 { + [r block.is_blocked] == 1 + } else { + fail "Module did not block" + } + + assert_equal 1 [r client unblock $id] + assert_match {*Timed out*} [$rd read] + + # Block without a timeout function - cannot unblock + $rd block.block 0 + wait_for_condition 50 100 { + [r block.is_blocked] == 1 + } else { + fail "Module did not block" + } + + assert_equal 0 [r client unblock $id] + assert_equal "OK" [r block.release foobar] + assert_equal "foobar" [$rd read] + } +} diff --git a/tests/unit/moduleapi/blockonkeys.tcl b/tests/unit/moduleapi/blockonkeys.tcl new file mode 100644 index 0000000..5e916c5 --- /dev/null +++ b/tests/unit/moduleapi/blockonkeys.tcl @@ -0,0 +1,306 @@ +set testmodule [file normalize tests/modules/blockonkeys.so] + +start_server {tags {"modules"}} { + r module load $testmodule + + test "Module client blocked on keys: Circular BPOPPUSH" { + set rd1 [redis_deferring_client] + set rd2 [redis_deferring_client] + + r del src dst + + $rd1 fsl.bpoppush src dst 0 + $rd2 fsl.bpoppush dst src 0 + ;# wait until clients are actually blocked + wait_for_condition 50 100 { + [s 0 blocked_clients] eq {2} + } else { + fail "Clients are not blocked" + } + + r fsl.push src 42 + + assert_equal {42} [r fsl.getall src] + assert_equal {} [r fsl.getall dst] + } + + test "Module client blocked on keys: Self-referential BPOPPUSH" { + set rd1 [redis_deferring_client] + + r del src + + $rd1 fsl.bpoppush src src 0 + ;# wait until clients are actually blocked + wait_for_condition 50 100 { + [s 0 blocked_clients] eq {1} + } else { + fail "Clients are not blocked" + } + r fsl.push src 42 + + assert_equal {42} [r fsl.getall src] + } + + test {Module client blocked on keys (no metadata): No block} { + r del k + r fsl.push k 33 + r fsl.push k 34 + r fsl.bpop k 0 + } {34} + + test {Module client blocked on keys (no metadata): Timeout} { + r del k + set rd [redis_deferring_client] + $rd fsl.bpop k 1 + assert_equal {Request timedout} [$rd read] + } + + test {Module client blocked on keys (no metadata): Blocked} { + r del k + set rd [redis_deferring_client] + $rd fsl.bpop k 0 + ;# wait until clients are actually blocked + wait_for_condition 50 100 { + [s 0 blocked_clients] eq {1} + } else { + fail "Clients are not blocked" + } + r fsl.push k 34 + assert_equal {34} [$rd read] + } + + test {Module client blocked on keys (with metadata): No block} { + r del k + r fsl.push k 34 + r fsl.bpopgt k 30 0 + } {34} + + test {Module client blocked on keys (with metadata): Timeout} { + r del k + set rd [redis_deferring_client] + $rd client id + set cid [$rd read] + r fsl.push k 33 + $rd fsl.bpopgt k 35 1 + assert_equal {Request timedout} [$rd read] + r client kill id $cid ;# try to smoke-out client-related memory leak + } + + test {Module client blocked on keys (with metadata): Blocked, case 1} { + r del k + set rd [redis_deferring_client] + $rd client id + set cid [$rd read] + r fsl.push k 33 + $rd fsl.bpopgt k 33 0 + ;# wait until clients are actually blocked + wait_for_condition 50 100 { + [s 0 blocked_clients] eq {1} + } else { + fail "Clients are not blocked" + } + r fsl.push k 34 + assert_equal {34} [$rd read] + r client kill id $cid ;# try to smoke-out client-related memory leak + } + + test {Module client blocked on keys (with metadata): Blocked, case 2} { + r del k + set rd [redis_deferring_client] + $rd fsl.bpopgt k 35 0 + ;# wait until clients are actually blocked + wait_for_condition 50 100 { + [s 0 blocked_clients] eq {1} + } else { + fail "Clients are not blocked" + } + r fsl.push k 33 + r fsl.push k 34 + r fsl.push k 35 + r fsl.push k 36 + assert_equal {36} [$rd read] + } + + test {Module client blocked on keys (with metadata): Blocked, CLIENT KILL} { + r del k + set rd [redis_deferring_client] + $rd client id + set cid [$rd read] + $rd fsl.bpopgt k 35 0 + ;# wait until clients are actually blocked + wait_for_condition 50 100 { + [s 0 blocked_clients] eq {1} + } else { + fail "Clients are not blocked" + } + r client kill id $cid ;# try to smoke-out client-related memory leak + } + + test {Module client blocked on keys (with metadata): Blocked, CLIENT UNBLOCK TIMEOUT} { + r del k + set rd [redis_deferring_client] + $rd client id + set cid [$rd read] + $rd fsl.bpopgt k 35 0 + ;# wait until clients are actually blocked + wait_for_condition 50 100 { + [s 0 blocked_clients] eq {1} + } else { + fail "Clients are not blocked" + } + r client unblock $cid timeout ;# try to smoke-out client-related memory leak + assert_equal {Request timedout} [$rd read] + } + + test {Module client blocked on keys (with metadata): Blocked, CLIENT UNBLOCK ERROR} { + r del k + set rd [redis_deferring_client] + $rd client id + set cid [$rd read] + $rd fsl.bpopgt k 35 0 + ;# wait until clients are actually blocked + wait_for_condition 50 100 { + [s 0 blocked_clients] eq {1} + } else { + fail "Clients are not blocked" + } + r client unblock $cid error ;# try to smoke-out client-related memory leak + assert_error "*unblocked*" {$rd read} + } + + test {Module client blocked on keys, no timeout CB, CLIENT UNBLOCK TIMEOUT} { + r del k + set rd [redis_deferring_client] + $rd client id + set cid [$rd read] + $rd fsl.bpop k 0 NO_TO_CB + ;# wait until clients are actually blocked + wait_for_condition 50 100 { + [s 0 blocked_clients] eq {1} + } else { + fail "Clients are not blocked" + } + assert_equal [r client unblock $cid timeout] {0} + $rd close + } + + test {Module client blocked on keys, no timeout CB, CLIENT UNBLOCK ERROR} { + r del k + set rd [redis_deferring_client] + $rd client id + set cid [$rd read] + $rd fsl.bpop k 0 NO_TO_CB + ;# wait until clients are actually blocked + wait_for_condition 50 100 { + [s 0 blocked_clients] eq {1} + } else { + fail "Clients are not blocked" + } + assert_equal [r client unblock $cid error] {0} + $rd close + } + + test {Module client re-blocked on keys after woke up on wrong type} { + r del k + set rd [redis_deferring_client] + $rd fsl.bpop k 0 + ;# wait until clients are actually blocked + wait_for_condition 50 100 { + [s 0 blocked_clients] eq {1} + } else { + fail "Clients are not blocked" + } + r lpush k 12 + r lpush k 13 + r lpush k 14 + r del k + r fsl.push k 34 + assert_equal {34} [$rd read] + assert_equal {1} [r get fsl_wrong_type] ;# first lpush caused one wrong-type wake-up + } + + test {Module client blocked on keys woken up by LPUSH} { + r del k + set rd [redis_deferring_client] + $rd blockonkeys.popall k + # wait until client is actually blocked + wait_for_condition 50 100 { + [s 0 blocked_clients] eq {1} + } else { + fail "Client is not blocked" + } + r lpush k 42 squirrel banana + assert_equal {banana squirrel 42} [$rd read] + $rd close + } + + test {Module client unblocks BLPOP} { + r del k + set rd [redis_deferring_client] + $rd blpop k 3 + # wait until client is actually blocked + wait_for_condition 50 100 { + [s 0 blocked_clients] eq {1} + } else { + fail "Client is not blocked" + } + r blockonkeys.lpush k 42 + assert_equal {k 42} [$rd read] + $rd close + } + + test {Module unblocks module blocked on non-empty list} { + r del k + r lpush k aa + # Module client blocks to pop 5 elements from list + set rd [redis_deferring_client] + $rd blockonkeys.blpopn k 5 + # Wait until client is actually blocked + wait_for_condition 50 100 { + [s 0 blocked_clients] eq {1} + } else { + fail "Client is not blocked" + } + # Check that RM_SignalKeyAsReady() can wake up BLPOPN + r blockonkeys.lpush_unblock k bb cc ;# Not enough elements for BLPOPN + r lpush k dd ee ff ;# Doesn't unblock module + r blockonkeys.lpush_unblock k gg ;# Unblocks module + assert_equal {gg ff ee dd cc} [$rd read] + $rd close + } + + set master [srv 0 client] + set master_host [srv 0 host] + set master_port [srv 0 port] + start_server [list overrides [list loadmodule "$testmodule"]] { + set replica [srv 0 client] + set replica_host [srv 0 host] + set replica_port [srv 0 port] + + # Start the replication process... + $replica replicaof $master_host $master_port + wait_for_sync $replica + + test {WAIT command on module blocked client on keys} { + set rd [redis_deferring_client -1] + $rd set x y + $rd read + + pause_process [srv 0 pid] + + $master del k + $rd fsl.bpop k 0 + wait_for_blocked_client -1 + $master fsl.push k 34 + $master fsl.push k 35 + assert_equal {34} [$rd read] + + assert_equal [$master wait 1 1000] 0 + resume_process [srv 0 pid] + assert_equal [$master wait 1 1000] 1 + $rd close + assert_equal {35} [$replica fsl.getall k] + } + } + +} diff --git a/tests/unit/moduleapi/cluster.tcl b/tests/unit/moduleapi/cluster.tcl new file mode 100644 index 0000000..bbd2562 --- /dev/null +++ b/tests/unit/moduleapi/cluster.tcl @@ -0,0 +1,204 @@ +# Primitive tests on cluster-enabled redis with modules using redis-cli + +source tests/support/cli.tcl + +set testmodule [file normalize tests/modules/blockonkeys.so] +set testmodule_nokey [file normalize tests/modules/blockonbackground.so] +set testmodule_blockedclient [file normalize tests/modules/blockedclient.so] + +# make sure the test infra won't use SELECT +set old_singledb $::singledb +set ::singledb 1 + +# cluster creation is complicated with TLS, and the current tests don't really need that coverage +tags {tls:skip external:skip cluster modules} { + +# start three servers +set base_conf [list cluster-enabled yes cluster-node-timeout 1 loadmodule $testmodule] +start_server [list overrides $base_conf] { +start_server [list overrides $base_conf] { +start_server [list overrides $base_conf] { + + set node1 [srv 0 client] + set node2 [srv -1 client] + set node3 [srv -2 client] + set node3_pid [srv -2 pid] + + # the "overrides" mechanism can only support one "loadmodule" directive + $node1 module load $testmodule_nokey + $node2 module load $testmodule_nokey + $node3 module load $testmodule_nokey + + $node1 module load $testmodule_blockedclient + $node2 module load $testmodule_blockedclient + $node3 module load $testmodule_blockedclient + + test {Create 3 node cluster} { + exec src/redis-cli --cluster-yes --cluster create \ + 127.0.0.1:[srv 0 port] \ + 127.0.0.1:[srv -1 port] \ + 127.0.0.1:[srv -2 port] + + wait_for_condition 1000 50 { + [csi 0 cluster_state] eq {ok} && + [csi -1 cluster_state] eq {ok} && + [csi -2 cluster_state] eq {ok} + } else { + fail "Cluster doesn't stabilize" + } + } + + test "Run blocking command (blocked on key) on cluster node3" { + # key9184688 is mapped to slot 10923 (first slot of node 3) + set node3_rd [redis_deferring_client -2] + $node3_rd fsl.bpop key9184688 0 + $node3_rd flush + + wait_for_condition 50 100 { + [s -2 blocked_clients] eq {1} + } else { + fail "Client executing blocking command (blocked on key) not blocked" + } + } + + test "Run blocking command (no keys) on cluster node2" { + set node2_rd [redis_deferring_client -1] + $node2_rd block.block 0 + $node2_rd flush + + wait_for_condition 50 100 { + [s -1 blocked_clients] eq {1} + } else { + fail "Client executing blocking command (no keys) not blocked" + } + } + + + test "Perform a Resharding" { + exec src/redis-cli --cluster-yes --cluster reshard 127.0.0.1:[srv -2 port] \ + --cluster-to [$node1 cluster myid] \ + --cluster-from [$node3 cluster myid] \ + --cluster-slots 1 + } + + test "Verify command (no keys) is unaffected after resharding" { + # verify there are blocked clients on node2 + assert_equal [s -1 blocked_clients] {1} + + #release client + $node2 block.release 0 + } + + test "Verify command (blocked on key) got unblocked after resharding" { + # this (read) will wait for the node3 to realize the new topology + assert_error {*MOVED*} {$node3_rd read} + + # verify there are no blocked clients + assert_equal [s 0 blocked_clients] {0} + assert_equal [s -1 blocked_clients] {0} + assert_equal [s -2 blocked_clients] {0} + } + + test "Wait for cluster to be stable" { + wait_for_condition 1000 50 { + [catch {exec src/redis-cli --cluster check 127.0.0.1:[srv 0 port]}] == 0 && + [catch {exec src/redis-cli --cluster check 127.0.0.1:[srv -1 port]}] == 0 && + [catch {exec src/redis-cli --cluster check 127.0.0.1:[srv -2 port]}] == 0 && + [CI 0 cluster_state] eq {ok} && + [CI 1 cluster_state] eq {ok} && + [CI 2 cluster_state] eq {ok} + } else { + fail "Cluster doesn't stabilize" + } + } + + test "Sanity test push cmd after resharding" { + assert_error {*MOVED*} {$node3 fsl.push key9184688 1} + + set node1_rd [redis_deferring_client 0] + $node1_rd fsl.bpop key9184688 0 + $node1_rd flush + + wait_for_condition 50 100 { + [s 0 blocked_clients] eq {1} + } else { + puts "Client not blocked" + puts "read from blocked client: [$node1_rd read]" + fail "Client not blocked" + } + + $node1 fsl.push key9184688 2 + assert_equal {2} [$node1_rd read] + } + + $node1_rd close + $node2_rd close + $node3_rd close + + test "Run blocking command (blocked on key) again on cluster node1" { + $node1 del key9184688 + # key9184688 is mapped to slot 10923 which has been moved to node1 + set node1_rd [redis_deferring_client 0] + $node1_rd fsl.bpop key9184688 0 + $node1_rd flush + + wait_for_condition 50 100 { + [s 0 blocked_clients] eq {1} + } else { + fail "Client executing blocking command (blocked on key) again not blocked" + } + } + + test "Run blocking command (no keys) again on cluster node2" { + set node2_rd [redis_deferring_client -1] + + $node2_rd block.block 0 + $node2_rd flush + + wait_for_condition 50 100 { + [s -1 blocked_clients] eq {1} + } else { + fail "Client executing blocking command (no keys) again not blocked" + } + } + + test "Kill a cluster node and wait for fail state" { + # kill node3 in cluster + exec kill -SIGSTOP $node3_pid + + wait_for_condition 1000 50 { + [csi 0 cluster_state] eq {fail} && + [csi -1 cluster_state] eq {fail} + } else { + fail "Cluster doesn't fail" + } + } + + test "Verify command (blocked on key) got unblocked after cluster failure" { + assert_error {*CLUSTERDOWN*} {$node1_rd read} + } + + test "Verify command (no keys) got unblocked after cluster failure" { + assert_error {*CLUSTERDOWN*} {$node2_rd read} + + # verify there are no blocked clients + assert_equal [s 0 blocked_clients] {0} + assert_equal [s -1 blocked_clients] {0} + } + + test "Verify command RM_Call is rejected when cluster is down" { + assert_error "ERR Can not execute a command 'set' while the cluster is down" {$node1 do_rm_call set x 1} + } + + exec kill -SIGCONT $node3_pid + $node1_rd close + $node2_rd close + +# stop three servers +} +} +} + +} ;# tags + +set ::singledb $old_singledb diff --git a/tests/unit/moduleapi/cmdintrospection.tcl b/tests/unit/moduleapi/cmdintrospection.tcl new file mode 100644 index 0000000..4d67af1 --- /dev/null +++ b/tests/unit/moduleapi/cmdintrospection.tcl @@ -0,0 +1,47 @@ +set testmodule [file normalize tests/modules/cmdintrospection.so] + +start_server {tags {"modules"}} { + r module load $testmodule + + # cmdintrospection.xadd mimics XADD with regards to how + # what COMMAND exposes. There are two differences: + # + # 1. cmdintrospection.xadd (and all module commands) do not have ACL categories + # 2. cmdintrospection.xadd's `group` is "module" + # + # This tests verify that, apart from the above differences, the output of + # COMMAND INFO and COMMAND DOCS are identical for the two commands. + test "Module command introspection via COMMAND INFO" { + set redis_reply [lindex [r command info xadd] 0] + set module_reply [lindex [r command info cmdintrospection.xadd] 0] + for {set i 1} {$i < [llength $redis_reply]} {incr i} { + if {$i == 2} { + # Remove the "module" flag + set mylist [lindex $module_reply $i] + set idx [lsearch $mylist "module"] + set mylist [lreplace $mylist $idx $idx] + lset module_reply $i $mylist + } + if {$i == 6} { + # Skip ACL categories + continue + } + assert_equal [lindex $redis_reply $i] [lindex $module_reply $i] + } + } + + test "Module command introspection via COMMAND DOCS" { + set redis_reply [dict create {*}[lindex [r command docs xadd] 1]] + set module_reply [dict create {*}[lindex [r command docs cmdintrospection.xadd] 1]] + # Compare the maps. We need to pop "group" first. + dict unset redis_reply group + dict unset module_reply group + dict unset module_reply module + + assert_equal $redis_reply $module_reply + } + + test "Unload the module - cmdintrospection" { + assert_equal {OK} [r module unload cmdintrospection] + } +} diff --git a/tests/unit/moduleapi/commandfilter.tcl b/tests/unit/moduleapi/commandfilter.tcl new file mode 100644 index 0000000..427609d --- /dev/null +++ b/tests/unit/moduleapi/commandfilter.tcl @@ -0,0 +1,118 @@ +set testmodule [file normalize tests/modules/commandfilter.so] + +start_server {tags {"modules"}} { + r module load $testmodule log-key 0 + + test {Retain a command filter argument} { + # Retain an argument now. Later we'll try to re-read it and make sure + # it is not corrupt and that valgrind does not complain. + r rpush some-list @retain my-retained-string + r commandfilter.retained + } {my-retained-string} + + test {Command Filter handles redirected commands} { + r set mykey @log + r lrange log-key 0 -1 + } "{set mykey @log}" + + test {Command Filter can call RedisModule_CommandFilterArgDelete} { + r rpush mylist elem1 @delme elem2 + r lrange mylist 0 -1 + } {elem1 elem2} + + test {Command Filter can call RedisModule_CommandFilterArgInsert} { + r del mylist + r rpush mylist elem1 @insertbefore elem2 @insertafter elem3 + r lrange mylist 0 -1 + } {elem1 --inserted-before-- @insertbefore elem2 @insertafter --inserted-after-- elem3} + + test {Command Filter can call RedisModule_CommandFilterArgReplace} { + r del mylist + r rpush mylist elem1 @replaceme elem2 + r lrange mylist 0 -1 + } {elem1 --replaced-- elem2} + + test {Command Filter applies on RM_Call() commands} { + r del log-key + r commandfilter.ping + r lrange log-key 0 -1 + } "{ping @log}" + + test {Command Filter applies on Lua redis.call()} { + r del log-key + r eval "redis.call('ping', '@log')" 0 + r lrange log-key 0 -1 + } "{ping @log}" + + test {Command Filter applies on Lua redis.call() that calls a module} { + r del log-key + r eval "redis.call('commandfilter.ping')" 0 + r lrange log-key 0 -1 + } "{ping @log}" + + test {Command Filter strings can be retained} { + r commandfilter.retained + } {my-retained-string} + + test {Command Filter is unregistered implicitly on module unload} { + r del log-key + r module unload commandfilter + r set mykey @log + r lrange log-key 0 -1 + } {} + + r module load $testmodule log-key 0 + + test {Command Filter unregister works as expected} { + # Validate reloading succeeded + r del log-key + r set mykey @log + assert_equal "{set mykey @log}" [r lrange log-key 0 -1] + + # Unregister + r commandfilter.unregister + r del log-key + + r set mykey @log + r lrange log-key 0 -1 + } {} + + r module unload commandfilter + r module load $testmodule log-key 1 + + test {Command Filter REDISMODULE_CMDFILTER_NOSELF works as expected} { + r set mykey @log + assert_equal "{set mykey @log}" [r lrange log-key 0 -1] + + r del log-key + r commandfilter.ping + assert_equal {} [r lrange log-key 0 -1] + + r eval "redis.call('commandfilter.ping')" 0 + assert_equal {} [r lrange log-key 0 -1] + } + + test "Unload the module - commandfilter" { + assert_equal {OK} [r module unload commandfilter] + } +} + +test {RM_CommandFilterArgInsert and script argv caching} { + # coverage for scripts calling commands that expand the argv array + # an attempt to add coverage for a possible bug in luaArgsToRedisArgv + # this test needs a fresh server so that lua_argv_size is 0. + # glibc realloc can return the same pointer even when the size changes + # still this test isn't able to trigger the issue, but we keep it anyway. + start_server {tags {"modules"}} { + r module load $testmodule log-key 0 + r del mylist + # command with 6 args + r eval {redis.call('rpush', KEYS[1], 'elem1', 'elem2', 'elem3', 'elem4')} 1 mylist + # command with 3 args that is changed to 4 + r eval {redis.call('rpush', KEYS[1], '@insertafter')} 1 mylist + # command with 6 args again + r eval {redis.call('rpush', KEYS[1], 'elem1', 'elem2', 'elem3', 'elem4')} 1 mylist + assert_equal [r lrange mylist 0 -1] {elem1 elem2 elem3 elem4 @insertafter --inserted-after-- elem1 elem2 elem3 elem4} + } +} + diff --git a/tests/unit/moduleapi/datatype.tcl b/tests/unit/moduleapi/datatype.tcl new file mode 100644 index 0000000..c8fd30e --- /dev/null +++ b/tests/unit/moduleapi/datatype.tcl @@ -0,0 +1,88 @@ +set testmodule [file normalize tests/modules/datatype.so] + +start_server {tags {"modules"}} { + r module load $testmodule + + test {DataType: Test module is sane, GET/SET work.} { + r datatype.set dtkey 100 stringval + assert {[r datatype.get dtkey] eq {100 stringval}} + } + + test {DataType: RM_SaveDataTypeToString(), RM_LoadDataTypeFromStringEncver() work} { + r datatype.set dtkey -1111 MyString + set encoded [r datatype.dump dtkey] + + assert {[r datatype.restore dtkeycopy $encoded 4] eq {4}} + assert {[r datatype.get dtkeycopy] eq {-1111 MyString}} + } + + test {DataType: Handle truncated RM_LoadDataTypeFromStringEncver()} { + r datatype.set dtkey -1111 MyString + set encoded [r datatype.dump dtkey] + set truncated [string range $encoded 0 end-1] + + catch {r datatype.restore dtkeycopy $truncated 4} e + set e + } {*Invalid*} + + test {DataType: ModuleTypeReplaceValue() happy path works} { + r datatype.set key-a 1 AAA + r datatype.set key-b 2 BBB + + assert {[r datatype.swap key-a key-b] eq {OK}} + assert {[r datatype.get key-a] eq {2 BBB}} + assert {[r datatype.get key-b] eq {1 AAA}} + } + + test {DataType: ModuleTypeReplaceValue() fails on non-module keys} { + r datatype.set key-a 1 AAA + r set key-b RedisString + + catch {r datatype.swap key-a key-b} e + set e + } {*ERR*} + + test {DataType: Copy command works for modules} { + # Test failed copies + r datatype.set answer-to-universe 42 AAA + catch {r copy answer-to-universe answer2} e + assert_match {*module key failed to copy*} $e + + # Our module's data type copy function copies the int value as-is + # but appends /<from-key>/<to-key> to the string value so we can + # track passed arguments. + r datatype.set sourcekey 1234 AAA + r copy sourcekey targetkey + r datatype.get targetkey + } {1234 AAA/sourcekey/targetkey} + + test {DataType: Slow Loading} { + r config set busy-reply-threshold 5000 ;# make sure we're using a high default + # trigger slow loading + r datatype.slow_loading 1 + set rd [redis_deferring_client] + set start [clock clicks -milliseconds] + $rd debug reload + + # wait till we know we're blocked inside the module + wait_for_condition 50 100 { + [r datatype.is_in_slow_loading] eq 1 + } else { + fail "Failed waiting for slow loading to start" + } + + # make sure we get LOADING error, and that we didn't get here late (not waiting for busy-reply-threshold) + assert_error {*LOADING*} {r ping} + assert_lessthan [expr [clock clicks -milliseconds]-$start] 2000 + + # abort the blocking operation + r datatype.slow_loading 0 + wait_for_condition 50 100 { + [s loading] eq {0} + } else { + fail "Failed waiting for loading to end" + } + $rd read + $rd close + } +} diff --git a/tests/unit/moduleapi/datatype2.tcl b/tests/unit/moduleapi/datatype2.tcl new file mode 100644 index 0000000..95acc9a --- /dev/null +++ b/tests/unit/moduleapi/datatype2.tcl @@ -0,0 +1,232 @@ +set testmodule [file normalize tests/modules/datatype2.so] + +start_server {tags {"modules"}} { + r module load $testmodule + + test "datatype2: test mem alloc and free" { + r flushall + + r select 0 + assert_equal 3 [r mem.alloc k1 3] + assert_equal 2 [r mem.alloc k2 2] + + r select 1 + assert_equal 1 [r mem.alloc k1 1] + assert_equal 5 [r mem.alloc k2 5] + + r select 0 + assert_equal 1 [r mem.free k1] + assert_equal 1 [r mem.free k2] + + r select 1 + assert_equal 1 [r mem.free k1] + assert_equal 1 [r mem.free k2] + } + + test "datatype2: test del and unlink" { + r flushall + + assert_equal 100 [r mem.alloc k1 100] + assert_equal 60 [r mem.alloc k2 60] + + assert_equal 1 [r unlink k1] + assert_equal 1 [r del k2] + } + + test "datatype2: test read and write" { + r flushall + + assert_equal 3 [r mem.alloc k1 3] + + set data datatype2 + assert_equal [string length $data] [r mem.write k1 0 $data] + assert_equal $data [r mem.read k1 0] + } + + test "datatype2: test rdb save and load" { + r flushall + + r select 0 + set data k1 + assert_equal 3 [r mem.alloc k1 3] + assert_equal [string length $data] [r mem.write k1 1 $data] + + set data k2 + assert_equal 2 [r mem.alloc k2 2] + assert_equal [string length $data] [r mem.write k2 0 $data] + + r select 1 + set data k3 + assert_equal 3 [r mem.alloc k3 3] + assert_equal [string length $data] [r mem.write k3 1 $data] + + set data k4 + assert_equal 2 [r mem.alloc k4 2] + assert_equal [string length $data] [r mem.write k4 0 $data] + + r bgsave + waitForBgsave r + r debug reload + + r select 0 + assert_equal k1 [r mem.read k1 1] + assert_equal k2 [r mem.read k2 0] + + r select 1 + assert_equal k3 [r mem.read k3 1] + assert_equal k4 [r mem.read k4 0] + } + + test "datatype2: test aof rewrite" { + r flushall + + r select 0 + set data k1 + assert_equal 3 [r mem.alloc k1 3] + assert_equal [string length $data] [r mem.write k1 1 $data] + + set data k2 + assert_equal 2 [r mem.alloc k2 2] + assert_equal [string length $data] [r mem.write k2 0 $data] + + r select 1 + set data k3 + assert_equal 3 [r mem.alloc k3 3] + assert_equal [string length $data] [r mem.write k3 1 $data] + + set data k4 + assert_equal 2 [r mem.alloc k4 2] + assert_equal [string length $data] [r mem.write k4 0 $data] + + r bgrewriteaof + waitForBgrewriteaof r + r debug loadaof + + r select 0 + assert_equal k1 [r mem.read k1 1] + assert_equal k2 [r mem.read k2 0] + + r select 1 + assert_equal k3 [r mem.read k3 1] + assert_equal k4 [r mem.read k4 0] + } + + test "datatype2: test copy" { + r flushall + + r select 0 + set data k1 + assert_equal 3 [r mem.alloc k1 3] + assert_equal [string length $data] [r mem.write k1 1 $data] + assert_equal $data [r mem.read k1 1] + + set data k2 + assert_equal 2 [r mem.alloc k2 2] + assert_equal [string length $data] [r mem.write k2 0 $data] + assert_equal $data [r mem.read k2 0] + + r select 1 + set data k3 + assert_equal 3 [r mem.alloc k3 3] + assert_equal [string length $data] [r mem.write k3 1 $data] + + set data k4 + assert_equal 2 [r mem.alloc k4 2] + assert_equal [string length $data] [r mem.write k4 0 $data] + + assert_equal {total 5 used 2} [r mem.usage 0] + assert_equal {total 5 used 2} [r mem.usage 1] + + r select 0 + assert_equal 1 [r copy k1 k3] + assert_equal k1 [r mem.read k3 1] + assert_equal {total 8 used 3} [r mem.usage 0] + assert_equal 1 [r copy k2 k1 db 1] + + r select 1 + assert_equal k2 [r mem.read k1 0] + assert_equal {total 8 used 3} [r mem.usage 0] + assert_equal {total 7 used 3} [r mem.usage 1] + } + + test "datatype2: test swapdb" { + r flushall + + r select 0 + set data k1 + assert_equal 5 [r mem.alloc k1 5] + assert_equal [string length $data] [r mem.write k1 1 $data] + assert_equal $data [r mem.read k1 1] + + set data k2 + assert_equal 4 [r mem.alloc k2 4] + assert_equal [string length $data] [r mem.write k2 0 $data] + assert_equal $data [r mem.read k2 0] + + r select 1 + set data k1 + assert_equal 3 [r mem.alloc k3 3] + assert_equal [string length $data] [r mem.write k3 1 $data] + + set data k2 + assert_equal 2 [r mem.alloc k4 2] + assert_equal [string length $data] [r mem.write k4 0 $data] + + assert_equal {total 9 used 2} [r mem.usage 0] + assert_equal {total 5 used 2} [r mem.usage 1] + + assert_equal OK [r swapdb 0 1] + assert_equal {total 9 used 2} [r mem.usage 1] + assert_equal {total 5 used 2} [r mem.usage 0] + } + + test "datatype2: test digest" { + r flushall + + r select 0 + set data k1 + assert_equal 3 [r mem.alloc k1 3] + assert_equal [string length $data] [r mem.write k1 1 $data] + assert_equal $data [r mem.read k1 1] + + set data k2 + assert_equal 2 [r mem.alloc k2 2] + assert_equal [string length $data] [r mem.write k2 0 $data] + assert_equal $data [r mem.read k2 0] + + r select 1 + set data k1 + assert_equal 3 [r mem.alloc k1 3] + assert_equal [string length $data] [r mem.write k1 1 $data] + assert_equal $data [r mem.read k1 1] + + set data k2 + assert_equal 2 [r mem.alloc k2 2] + assert_equal [string length $data] [r mem.write k2 0 $data] + assert_equal $data [r mem.read k2 0] + + r select 0 + set digest0 [debug_digest] + + r select 1 + set digest1 [debug_digest] + + assert_equal $digest0 $digest1 + } + + test "datatype2: test memusage" { + r flushall + + set data k1 + assert_equal 3 [r mem.alloc k1 3] + assert_equal [string length $data] [r mem.write k1 1 $data] + assert_equal $data [r mem.read k1 1] + + set data k2 + assert_equal 3 [r mem.alloc k2 3] + assert_equal [string length $data] [r mem.write k2 0 $data] + assert_equal $data [r mem.read k2 0] + + assert_equal [memory_usage k1] [memory_usage k2] + } +}
\ No newline at end of file diff --git a/tests/unit/moduleapi/defrag.tcl b/tests/unit/moduleapi/defrag.tcl new file mode 100644 index 0000000..b2e2396 --- /dev/null +++ b/tests/unit/moduleapi/defrag.tcl @@ -0,0 +1,46 @@ +set testmodule [file normalize tests/modules/defragtest.so] + +start_server {tags {"modules"} overrides {{save ""}}} { + r module load $testmodule 10000 + r config set hz 100 + r config set active-defrag-ignore-bytes 1 + r config set active-defrag-threshold-lower 0 + r config set active-defrag-cycle-min 99 + + # try to enable active defrag, it will fail if redis was compiled without it + catch {r config set activedefrag yes} e + if {[r config get activedefrag] eq "activedefrag yes"} { + + test {Module defrag: simple key defrag works} { + r frag.create key1 1 1000 0 + + after 2000 + set info [r info defragtest_stats] + assert {[getInfoProperty $info defragtest_datatype_attempts] > 0} + assert_equal 0 [getInfoProperty $info defragtest_datatype_resumes] + } + + test {Module defrag: late defrag with cursor works} { + r flushdb + r frag.resetstats + + # key can only be defragged in no less than 10 iterations + # due to maxstep + r frag.create key2 10000 100 1000 + + after 2000 + set info [r info defragtest_stats] + assert {[getInfoProperty $info defragtest_datatype_resumes] > 10} + assert_equal 0 [getInfoProperty $info defragtest_datatype_wrong_cursor] + } + + test {Module defrag: global defrag works} { + r flushdb + r frag.resetstats + + after 2000 + set info [r info defragtest_stats] + assert {[getInfoProperty $info defragtest_global_attempts] > 0} + } + } +} diff --git a/tests/unit/moduleapi/eventloop.tcl b/tests/unit/moduleapi/eventloop.tcl new file mode 100644 index 0000000..81e01ca --- /dev/null +++ b/tests/unit/moduleapi/eventloop.tcl @@ -0,0 +1,28 @@ +set testmodule [file normalize tests/modules/eventloop.so] + +start_server {tags {"modules"}} { + r module load $testmodule + + test "Module eventloop sendbytes" { + assert_match "OK" [r test.sendbytes 5000000] + assert_match "OK" [r test.sendbytes 2000000] + } + + test "Module eventloop iteration" { + set iteration [r test.iteration] + set next_iteration [r test.iteration] + assert {$next_iteration > $iteration} + } + + test "Module eventloop sanity" { + r test.sanity + } + + test "Module eventloop oneshot" { + r test.oneshot + } + + test "Unload the module - eventloop" { + assert_equal {OK} [r module unload eventloop] + } +} diff --git a/tests/unit/moduleapi/fork.tcl b/tests/unit/moduleapi/fork.tcl new file mode 100644 index 0000000..c89a6c5 --- /dev/null +++ b/tests/unit/moduleapi/fork.tcl @@ -0,0 +1,49 @@ +set testmodule [file normalize tests/modules/fork.so] + +proc count_log_message {pattern} { + set status [catch {exec grep -c $pattern < [srv 0 stdout]} result] + if {$status == 1} { + set result 0 + } + return $result +} + +start_server {tags {"modules"}} { + r module load $testmodule + + test {Module fork} { + # the argument to fork.create is the exitcode on termination + # the second argument to fork.create is passed to usleep + r fork.create 3 100000 ;# 100ms + wait_for_condition 20 100 { + [r fork.exitcode] != -1 + } else { + fail "fork didn't terminate" + } + r fork.exitcode + } {3} + + test {Module fork kill} { + # use a longer time to avoid the child exiting before being killed + r fork.create 3 100000000 ;# 100s + wait_for_condition 20 100 { + [count_log_message "fork child started"] == 2 + } else { + fail "fork didn't start" + } + + # module fork twice + assert_error {Fork failed} {r fork.create 0 1} + assert {[count_log_message "Can't fork for module: File exists"] eq "1"} + + r fork.kill + + assert {[count_log_message "Received SIGUSR1 in child"] eq "1"} + # check that it wasn't printed again (the print belong to the previous test) + assert {[count_log_message "fork child exiting"] eq "1"} + } + + test "Unload the module - fork" { + assert_equal {OK} [r module unload fork] + } +} diff --git a/tests/unit/moduleapi/getchannels.tcl b/tests/unit/moduleapi/getchannels.tcl new file mode 100644 index 0000000..e8f557d --- /dev/null +++ b/tests/unit/moduleapi/getchannels.tcl @@ -0,0 +1,40 @@ +set testmodule [file normalize tests/modules/getchannels.so] + +start_server {tags {"modules"}} { + r module load $testmodule + + # Channels are currently used to just validate ACLs, so test them here + r ACL setuser testuser +@all resetchannels &channel &pattern* + + test "module getchannels-api with literals - ACL" { + assert_equal "OK" [r ACL DRYRUN testuser getchannels.command subscribe literal channel subscribe literal pattern1] + assert_equal "OK" [r ACL DRYRUN testuser getchannels.command publish literal channel publish literal pattern1] + assert_equal "OK" [r ACL DRYRUN testuser getchannels.command unsubscribe literal channel unsubscribe literal pattern1] + + assert_equal "This user has no permissions to access the 'nopattern1' channel" [r ACL DRYRUN testuser getchannels.command subscribe literal channel subscribe literal nopattern1] + assert_equal "This user has no permissions to access the 'nopattern1' channel" [r ACL DRYRUN testuser getchannels.command publish literal channel subscribe literal nopattern1] + assert_equal "OK" [r ACL DRYRUN testuser getchannels.command unsubscribe literal channel unsubscribe literal nopattern1] + + assert_equal "This user has no permissions to access the 'otherchannel' channel" [r ACL DRYRUN testuser getchannels.command subscribe literal otherchannel subscribe literal pattern1] + assert_equal "This user has no permissions to access the 'otherchannel' channel" [r ACL DRYRUN testuser getchannels.command publish literal otherchannel subscribe literal pattern1] + assert_equal "OK" [r ACL DRYRUN testuser getchannels.command unsubscribe literal otherchannel unsubscribe literal pattern1] + } + + test "module getchannels-api with patterns - ACL" { + assert_equal "OK" [r ACL DRYRUN testuser getchannels.command subscribe pattern pattern*] + assert_equal "OK" [r ACL DRYRUN testuser getchannels.command publish pattern pattern*] + assert_equal "OK" [r ACL DRYRUN testuser getchannels.command unsubscribe pattern pattern*] + + assert_equal "This user has no permissions to access the 'pattern1' channel" [r ACL DRYRUN testuser getchannels.command subscribe pattern pattern1 subscribe pattern pattern*] + assert_equal "This user has no permissions to access the 'pattern1' channel" [r ACL DRYRUN testuser getchannels.command publish pattern pattern1 subscribe pattern pattern*] + assert_equal "OK" [r ACL DRYRUN testuser getchannels.command unsubscribe pattern pattern1 unsubscribe pattern pattern*] + + assert_equal "This user has no permissions to access the 'otherpattern*' channel" [r ACL DRYRUN testuser getchannels.command subscribe pattern otherpattern* subscribe pattern pattern*] + assert_equal "This user has no permissions to access the 'otherpattern*' channel" [r ACL DRYRUN testuser getchannels.command publish pattern otherpattern* subscribe pattern pattern*] + assert_equal "OK" [r ACL DRYRUN testuser getchannels.command unsubscribe pattern otherpattern* unsubscribe pattern pattern*] + } + + test "Unload the module - getchannels" { + assert_equal {OK} [r module unload getchannels] + } +} diff --git a/tests/unit/moduleapi/getkeys.tcl b/tests/unit/moduleapi/getkeys.tcl new file mode 100644 index 0000000..734c55f --- /dev/null +++ b/tests/unit/moduleapi/getkeys.tcl @@ -0,0 +1,80 @@ +set testmodule [file normalize tests/modules/getkeys.so] + +start_server {tags {"modules"}} { + r module load $testmodule + + test {COMMAND INFO correctly reports a movable keys module command} { + set info [lindex [r command info getkeys.command] 0] + + assert_equal {module movablekeys} [lindex $info 2] + assert_equal {0} [lindex $info 3] + assert_equal {0} [lindex $info 4] + assert_equal {0} [lindex $info 5] + } + + test {COMMAND GETKEYS correctly reports a movable keys module command} { + r command getkeys getkeys.command arg1 arg2 key key1 arg3 key key2 key key3 + } {key1 key2 key3} + + test {COMMAND GETKEYS correctly reports a movable keys module command using flags} { + r command getkeys getkeys.command_with_flags arg1 arg2 key key1 arg3 key key2 key key3 + } {key1 key2 key3} + + test {COMMAND GETKEYSANDFLAGS correctly reports a movable keys module command not using flags} { + r command getkeysandflags getkeys.command arg1 arg2 key key1 arg3 key key2 + } {{key1 {RW access update}} {key2 {RW access update}}} + + test {COMMAND GETKEYSANDFLAGS correctly reports a movable keys module command using flags} { + r command getkeysandflags getkeys.command_with_flags arg1 arg2 key key1 arg3 key key2 key key3 + } {{key1 {RO access}} {key2 {RO access}} {key3 {RO access}}} + + test {RM_GetCommandKeys on non-existing command} { + catch {r getkeys.introspect 0 non-command key1 key2} e + set _ $e + } {*ENOENT*} + + test {RM_GetCommandKeys on built-in fixed keys command} { + r getkeys.introspect 0 set key1 value1 + } {key1} + + test {RM_GetCommandKeys on built-in fixed keys command with flags} { + r getkeys.introspect 1 set key1 value1 + } {{key1 OW}} + + test {RM_GetCommandKeys on EVAL} { + r getkeys.introspect 0 eval "" 4 key1 key2 key3 key4 arg1 arg2 + } {key1 key2 key3 key4} + + test {RM_GetCommandKeys on a movable keys module command} { + r getkeys.introspect 0 getkeys.command arg1 arg2 key key1 arg3 key key2 key key3 + } {key1 key2 key3} + + test {RM_GetCommandKeys on a non-movable module command} { + r getkeys.introspect 0 getkeys.fixed arg1 key1 key2 key3 arg2 + } {key1 key2 key3} + + test {RM_GetCommandKeys with bad arity} { + catch {r getkeys.introspect 0 set key} e + set _ $e + } {*EINVAL*} + + # user that can only read from "read" keys, write to "write" keys, and read+write to "RW" keys + r ACL setuser testuser +@all %R~read* %W~write* %RW~rw* + + test "module getkeys-api - ACL" { + # legacy triple didn't provide flags, so they require both read and write + assert_equal "OK" [r ACL DRYRUN testuser getkeys.command key rw] + assert_equal "This user has no permissions to access the 'read' key" [r ACL DRYRUN testuser getkeys.command key read] + assert_equal "This user has no permissions to access the 'write' key" [r ACL DRYRUN testuser getkeys.command key write] + } + + test "module getkeys-api with flags - ACL" { + assert_equal "OK" [r ACL DRYRUN testuser getkeys.command_with_flags key rw] + assert_equal "OK" [r ACL DRYRUN testuser getkeys.command_with_flags key read] + assert_equal "This user has no permissions to access the 'write' key" [r ACL DRYRUN testuser getkeys.command_with_flags key write] + } + + test "Unload the module - getkeys" { + assert_equal {OK} [r module unload getkeys] + } +} diff --git a/tests/unit/moduleapi/hash.tcl b/tests/unit/moduleapi/hash.tcl new file mode 100644 index 0000000..116b1c5 --- /dev/null +++ b/tests/unit/moduleapi/hash.tcl @@ -0,0 +1,27 @@ +set testmodule [file normalize tests/modules/hash.so] + +start_server {tags {"modules"}} { + r module load $testmodule + + test {Module hash set} { + r set k mystring + assert_error "WRONGTYPE*" {r hash.set k "" hello world} + r del k + # "" = count updates and deletes of existing fields only + assert_equal 0 [r hash.set k "" squirrel yes] + # "a" = COUNT_ALL = count inserted, modified and deleted fields + assert_equal 2 [r hash.set k "a" banana no sushi whynot] + # "n" = NX = only add fields not already existing in the hash + # "x" = XX = only replace the value for existing fields + assert_equal 0 [r hash.set k "n" squirrel hoho what nothing] + assert_equal 1 [r hash.set k "na" squirrel hoho something nice] + assert_equal 0 [r hash.set k "xa" new stuff not inserted] + assert_equal 1 [r hash.set k "x" squirrel ofcourse] + assert_equal 1 [r hash.set k "" sushi :delete: none :delete:] + r hgetall k + } {squirrel ofcourse banana no what nothing something nice} + + test "Unload the module - hash" { + assert_equal {OK} [r module unload hash] + } +} diff --git a/tests/unit/moduleapi/hooks.tcl b/tests/unit/moduleapi/hooks.tcl new file mode 100644 index 0000000..6e79f94 --- /dev/null +++ b/tests/unit/moduleapi/hooks.tcl @@ -0,0 +1,179 @@ +set testmodule [file normalize tests/modules/hooks.so] + +tags "modules" { + start_server [list overrides [list loadmodule "$testmodule" appendonly yes]] { + test {Test module aof save on server start from empty} { + assert {[r hooks.event_count persistence-syncaof-start] == 1} + } + + test {Test clients connection / disconnection hooks} { + for {set j 0} {$j < 2} {incr j} { + set rd1 [redis_deferring_client] + $rd1 close + } + assert {[r hooks.event_count client-connected] > 1} + assert {[r hooks.event_count client-disconnected] > 1} + } + + test {Test module client change event for blocked client} { + set rd [redis_deferring_client] + # select db other than 0 + $rd select 1 + # block on key + $rd brpop foo 0 + # kill blocked client + r client kill skipme yes + # assert server is still up + assert_equal [r ping] PONG + $rd close + } + + test {Test module cron hook} { + after 100 + assert {[r hooks.event_count cron-loop] > 0} + set hz [r hooks.event_last cron-loop] + assert_equal $hz 10 + } + + test {Test module loaded / unloaded hooks} { + set othermodule [file normalize tests/modules/infotest.so] + r module load $othermodule + r module unload infotest + assert_equal [r hooks.event_last module-loaded] "infotest" + assert_equal [r hooks.event_last module-unloaded] "infotest" + } + + test {Test module aofrw hook} { + r debug populate 1000 foo 10000 ;# 10mb worth of data + r config set rdbcompression no ;# rdb progress is only checked once in 2mb + r BGREWRITEAOF + waitForBgrewriteaof r + assert_equal [string match {*module-event-persistence-aof-start*} [exec tail -20 < [srv 0 stdout]]] 1 + assert_equal [string match {*module-event-persistence-end*} [exec tail -20 < [srv 0 stdout]]] 1 + } + + test {Test module aof load and rdb/aof progress hooks} { + # create some aof tail (progress is checked only once in 1000 commands) + for {set j 0} {$j < 4000} {incr j} { + r set "bar$j" x + } + # set some configs that will cause many loading progress events during aof loading + r config set key-load-delay 500 + r config set dynamic-hz no + r config set hz 500 + r DEBUG LOADAOF + assert_equal [r hooks.event_last loading-aof-start] 0 + assert_equal [r hooks.event_last loading-end] 0 + assert {[r hooks.event_count loading-rdb-start] == 0} + assert_lessthan 2 [r hooks.event_count loading-progress-rdb] ;# comes from the preamble section + assert_lessthan 2 [r hooks.event_count loading-progress-aof] + if {$::verbose} { + puts "rdb progress events [r hooks.event_count loading-progress-rdb]" + puts "aof progress events [r hooks.event_count loading-progress-aof]" + } + } + # undo configs before next test + r config set dynamic-hz yes + r config set key-load-delay 0 + + test {Test module rdb save hook} { + # debug reload does: save, flush, load: + assert {[r hooks.event_count persistence-syncrdb-start] == 0} + assert {[r hooks.event_count loading-rdb-start] == 0} + r debug reload + assert {[r hooks.event_count persistence-syncrdb-start] == 1} + assert {[r hooks.event_count loading-rdb-start] == 1} + } + + test {Test flushdb hooks} { + r flushdb + assert_equal [r hooks.event_last flush-start] 9 + assert_equal [r hooks.event_last flush-end] 9 + r flushall + assert_equal [r hooks.event_last flush-start] -1 + assert_equal [r hooks.event_last flush-end] -1 + } + + # replication related tests + set master [srv 0 client] + set master_host [srv 0 host] + set master_port [srv 0 port] + start_server {} { + r module load $testmodule + set replica [srv 0 client] + set replica_host [srv 0 host] + set replica_port [srv 0 port] + $replica replicaof $master_host $master_port + + wait_replica_online $master + + test {Test master link up hook} { + assert_equal [r hooks.event_count masterlink-up] 1 + assert_equal [r hooks.event_count masterlink-down] 0 + } + + test {Test role-replica hook} { + assert_equal [r hooks.event_count role-replica] 1 + assert_equal [r hooks.event_count role-master] 0 + assert_equal [r hooks.event_last role-replica] [s 0 master_host] + } + + test {Test replica-online hook} { + assert_equal [r -1 hooks.event_count replica-online] 1 + assert_equal [r -1 hooks.event_count replica-offline] 0 + } + + test {Test master link down hook} { + r client kill type master + assert_equal [r hooks.event_count masterlink-down] 1 + + wait_for_condition 50 100 { + [string match {*master_link_status:up*} [r info replication]] + } else { + fail "Replica didn't reconnect" + } + + assert_equal [r hooks.event_count masterlink-down] 1 + assert_equal [r hooks.event_count masterlink-up] 2 + } + + wait_for_condition 50 10 { + [string match {*master_link_status:up*} [r info replication]] + } else { + fail "Can't turn the instance into a replica" + } + + $replica replicaof no one + + test {Test role-master hook} { + assert_equal [r hooks.event_count role-replica] 1 + assert_equal [r hooks.event_count role-master] 1 + assert_equal [r hooks.event_last role-master] {} + } + + test {Test replica-offline hook} { + assert_equal [r -1 hooks.event_count replica-online] 2 + assert_equal [r -1 hooks.event_count replica-offline] 2 + } + # get the replica stdout, to be used by the next test + set replica_stdout [srv 0 stdout] + } + + test {Test swapdb hooks} { + r swapdb 0 10 + assert_equal [r hooks.event_last swapdb-first] 0 + assert_equal [r hooks.event_last swapdb-second] 10 + } + + test {Test configchange hooks} { + r config set rdbcompression no + assert_equal [r hooks.event_last config-change-count] 1 + assert_equal [r hooks.event_last config-change-first] rdbcompression + } + + # look into the log file of the server that just exited + test {Test shutdown hook} { + assert_equal [string match {*module-event-shutdown*} [exec tail -5 < $replica_stdout]] 1 + } + } +} diff --git a/tests/unit/moduleapi/infotest.tcl b/tests/unit/moduleapi/infotest.tcl new file mode 100644 index 0000000..ccd8c4e --- /dev/null +++ b/tests/unit/moduleapi/infotest.tcl @@ -0,0 +1,131 @@ +set testmodule [file normalize tests/modules/infotest.so] + +# Return value for INFO property +proc field {info property} { + if {[regexp "\r\n$property:(.*?)\r\n" $info _ value]} { + set _ $value + } +} + +start_server {tags {"modules"}} { + r module load $testmodule log-key 0 + + test {module reading info} { + # check string, integer and float fields + assert_equal [r info.gets replication role] "master" + assert_equal [r info.getc replication role] "master" + assert_equal [r info.geti stats expired_keys] 0 + assert_equal [r info.getd stats expired_stale_perc] 0 + + # check signed and unsigned + assert_equal [r info.geti infotest infotest_global] -2 + assert_equal [r info.getu infotest infotest_uglobal] -2 + + # the above are always 0, try module info that is non-zero + assert_equal [r info.geti infotest_italian infotest_due] 2 + set tre [r info.getd infotest_italian infotest_tre] + assert {$tre > 3.2 && $tre < 3.4 } + + # search using the wrong section + catch { [r info.gets badname redis_version] } e + assert_match {*not found*} $e + + # check that section filter works + assert { [string match "*usec_per_call*" [r info.gets all cmdstat_info.gets] ] } + catch { [r info.gets default cmdstat_info.gets] ] } e + assert_match {*not found*} $e + } + + test {module info all} { + set info [r info all] + # info all does not contain modules + assert { ![string match "*Spanish*" $info] } + assert { ![string match "*infotest_*" $info] } + assert { [string match "*used_memory*" $info] } + } + + test {module info all infotest} { + set info [r info all infotest] + # info all infotest should contain both ALL and the module information + assert { [string match "*Spanish*" $info] } + assert { [string match "*infotest_*" $info] } + assert { [string match "*used_memory*" $info] } + } + + test {module info everything} { + set info [r info everything] + # info everything contains all default sections, but not ones for crash report + assert { [string match "*infotest_global*" $info] } + assert { [string match "*Spanish*" $info] } + assert { [string match "*Italian*" $info] } + assert { [string match "*used_memory*" $info] } + assert { ![string match "*Klingon*" $info] } + field $info infotest_dos + } {2} + + test {module info modules} { + set info [r info modules] + # info all does not contain modules + assert { [string match "*Spanish*" $info] } + assert { [string match "*infotest_global*" $info] } + assert { ![string match "*used_memory*" $info] } + } + + test {module info one module} { + set info [r info INFOtest] ;# test case insensitive compare + # info all does not contain modules + assert { [string match "*Spanish*" $info] } + assert { ![string match "*used_memory*" $info] } + field $info infotest_global + } {-2} + + test {module info one section} { + set info [r info INFOtest_SpanisH] ;# test case insensitive compare + assert { ![string match "*used_memory*" $info] } + assert { ![string match "*Italian*" $info] } + assert { ![string match "*infotest_global*" $info] } + field $info infotest_uno + } {one} + + test {module info dict} { + set info [r info infotest_keyspace] + set keyspace [field $info infotest_db0] + set keys [scan [regexp -inline {keys\=([\d]*)} $keyspace] keys=%d] + } {3} + + test {module info unsafe fields} { + set info [r info infotest_unsafe] + assert_match {*infotest_unsafe_field:value=1*} $info + } + + test {module info multiply sections without all, everything, default keywords} { + set info [r info replication INFOTEST] + assert { [string match "*Spanish*" $info] } + assert { ![string match "*used_memory*" $info] } + assert { [string match "*repl_offset*" $info] } + } + + test {module info multiply sections with all keyword and modules} { + set info [r info all modules] + assert { [string match "*cluster*" $info] } + assert { [string match "*cmdstat_info*" $info] } + assert { [string match "*infotest_global*" $info] } + } + + test {module info multiply sections with everything keyword} { + set info [r info replication everything cpu] + assert { [string match "*client_recent*" $info] } + assert { [string match "*cmdstat_info*" $info] } + assert { [string match "*Italian*" $info] } + # check that we didn't get the same info twice + assert { ![string match "*used_cpu_user_children*used_cpu_user_children*" $info] } + assert { ![string match "*Italian*Italian*" $info] } + field $info infotest_dos + } {2} + + test "Unload the module - infotest" { + assert_equal {OK} [r module unload infotest] + } + + # TODO: test crash report. +} diff --git a/tests/unit/moduleapi/infra.tcl b/tests/unit/moduleapi/infra.tcl new file mode 100644 index 0000000..7bfa7d4 --- /dev/null +++ b/tests/unit/moduleapi/infra.tcl @@ -0,0 +1,22 @@ +set testmodule [file normalize tests/modules/infotest.so] + +test {modules config rewrite} { + + start_server {tags {"modules"}} { + r module load $testmodule + + assert_equal [lindex [lindex [r module list] 0] 1] infotest + + r config rewrite + restart_server 0 true false + + assert_equal [lindex [lindex [r module list] 0] 1] infotest + + assert_equal {OK} [r module unload infotest] + + r config rewrite + restart_server 0 true false + + assert_equal [llength [r module list]] 0 + } +} diff --git a/tests/unit/moduleapi/keyspace_events.tcl b/tests/unit/moduleapi/keyspace_events.tcl new file mode 100644 index 0000000..ceec6fd --- /dev/null +++ b/tests/unit/moduleapi/keyspace_events.tcl @@ -0,0 +1,101 @@ +set testmodule [file normalize tests/modules/keyspace_events.so] + +tags "modules" { + start_server [list overrides [list loadmodule "$testmodule"]] { + + test {Test loaded key space event} { + r set x 1 + r hset y f v + r lpush z 1 2 3 + r sadd p 1 2 3 + r zadd t 1 f1 2 f2 + r xadd s * f v + r debug reload + assert_equal {1 x} [r keyspace.is_key_loaded x] + assert_equal {1 y} [r keyspace.is_key_loaded y] + assert_equal {1 z} [r keyspace.is_key_loaded z] + assert_equal {1 p} [r keyspace.is_key_loaded p] + assert_equal {1 t} [r keyspace.is_key_loaded t] + assert_equal {1 s} [r keyspace.is_key_loaded s] + } + + test {Nested multi due to RM_Call} { + r del multi + r del lua + + r set x 1 + r set x_copy 1 + r keyspace.del_key_copy x + r keyspace.incr_case1 x + r keyspace.incr_case2 x + r keyspace.incr_case3 x + assert_equal {} [r get multi] + assert_equal {} [r get lua] + r get x + } {3} + + test {Nested multi due to RM_Call, with client MULTI} { + r del multi + r del lua + + r set x 1 + r set x_copy 1 + r multi + r keyspace.del_key_copy x + r keyspace.incr_case1 x + r keyspace.incr_case2 x + r keyspace.incr_case3 x + r exec + assert_equal {1} [r get multi] + assert_equal {} [r get lua] + r get x + } {3} + + test {Nested multi due to RM_Call, with EVAL} { + r del multi + r del lua + + r set x 1 + r set x_copy 1 + r eval { + redis.pcall('keyspace.del_key_copy', KEYS[1]) + redis.pcall('keyspace.incr_case1', KEYS[1]) + redis.pcall('keyspace.incr_case2', KEYS[1]) + redis.pcall('keyspace.incr_case3', KEYS[1]) + } 1 x + assert_equal {} [r get multi] + assert_equal {1} [r get lua] + r get x + } {3} + + test {Test module key space event} { + r keyspace.notify x + assert_equal {1 x} [r keyspace.is_module_key_notified x] + } + + test "Keyspace notifications: module events test" { + r config set notify-keyspace-events Kd + r del x + set rd1 [redis_deferring_client] + assert_equal {1} [psubscribe $rd1 *] + r keyspace.notify x + assert_equal {pmessage * __keyspace@9__:x notify} [$rd1 read] + $rd1 close + } + + test {Test expired key space event} { + set prev_expired [s expired_keys] + r set exp 1 PX 10 + wait_for_condition 100 10 { + [s expired_keys] eq $prev_expired + 1 + } else { + fail "key not expired" + } + assert_equal [r get testkeyspace:expired] 1 + } + + test "Unload the module - testkeyspace" { + assert_equal {OK} [r module unload testkeyspace] + } + } +} diff --git a/tests/unit/moduleapi/keyspecs.tcl b/tests/unit/moduleapi/keyspecs.tcl new file mode 100644 index 0000000..8491bc1 --- /dev/null +++ b/tests/unit/moduleapi/keyspecs.tcl @@ -0,0 +1,160 @@ +set testmodule [file normalize tests/modules/keyspecs.so] + +start_server {tags {"modules"}} { + r module load $testmodule + + test "Module key specs: No spec, only legacy triple" { + set reply [lindex [r command info kspec.none] 0] + # Verify (first, last, step) and not movablekeys + assert_equal [lindex $reply 2] {module} + assert_equal [lindex $reply 3] 1 + assert_equal [lindex $reply 4] -1 + assert_equal [lindex $reply 5] 2 + # Verify key-spec auto-generated from the legacy triple + set keyspecs [lindex $reply 8] + assert_equal [llength $keyspecs] 1 + assert_equal [lindex $keyspecs 0] {flags {RW access update} begin_search {type index spec {index 1}} find_keys {type range spec {lastkey -1 keystep 2 limit 0}}} + assert_equal [r command getkeys kspec.none key1 val1 key2 val2] {key1 key2} + } + + test "Module key specs: No spec, only legacy triple with getkeys-api" { + set reply [lindex [r command info kspec.nonewithgetkeys] 0] + # Verify (first, last, step) and movablekeys + assert_equal [lindex $reply 2] {module movablekeys} + assert_equal [lindex $reply 3] 1 + assert_equal [lindex $reply 4] -1 + assert_equal [lindex $reply 5] 2 + # Verify key-spec auto-generated from the legacy triple + set keyspecs [lindex $reply 8] + assert_equal [llength $keyspecs] 1 + assert_equal [lindex $keyspecs 0] {flags {RW access update variable_flags} begin_search {type index spec {index 1}} find_keys {type range spec {lastkey -1 keystep 2 limit 0}}} + assert_equal [r command getkeys kspec.nonewithgetkeys key1 val1 key2 val2] {key1 key2} + } + + test "Module key specs: Two ranges" { + set reply [lindex [r command info kspec.tworanges] 0] + # Verify (first, last, step) and not movablekeys + assert_equal [lindex $reply 2] {module} + assert_equal [lindex $reply 3] 1 + assert_equal [lindex $reply 4] 2 + assert_equal [lindex $reply 5] 1 + # Verify key-specs + set keyspecs [lindex $reply 8] + assert_equal [lindex $keyspecs 0] {flags {RO access} begin_search {type index spec {index 1}} find_keys {type range spec {lastkey 0 keystep 1 limit 0}}} + assert_equal [lindex $keyspecs 1] {flags {RW update} begin_search {type index spec {index 2}} find_keys {type range spec {lastkey 0 keystep 1 limit 0}}} + assert_equal [r command getkeys kspec.tworanges foo bar baz quux] {foo bar} + } + + test "Module key specs: Two ranges with gap" { + set reply [lindex [r command info kspec.tworangeswithgap] 0] + # Verify (first, last, step) and movablekeys + assert_equal [lindex $reply 2] {module movablekeys} + assert_equal [lindex $reply 3] 1 + assert_equal [lindex $reply 4] 1 + assert_equal [lindex $reply 5] 1 + # Verify key-specs + set keyspecs [lindex $reply 8] + assert_equal [lindex $keyspecs 0] {flags {RO access} begin_search {type index spec {index 1}} find_keys {type range spec {lastkey 0 keystep 1 limit 0}}} + assert_equal [lindex $keyspecs 1] {flags {RW update} begin_search {type index spec {index 3}} find_keys {type range spec {lastkey 0 keystep 1 limit 0}}} + assert_equal [r command getkeys kspec.tworangeswithgap foo bar baz quux] {foo baz} + } + + test "Module key specs: Keyword-only spec clears the legacy triple" { + set reply [lindex [r command info kspec.keyword] 0] + # Verify (first, last, step) and movablekeys + assert_equal [lindex $reply 2] {module movablekeys} + assert_equal [lindex $reply 3] 0 + assert_equal [lindex $reply 4] 0 + assert_equal [lindex $reply 5] 0 + # Verify key-specs + set keyspecs [lindex $reply 8] + assert_equal [lindex $keyspecs 0] {flags {RO access} begin_search {type keyword spec {keyword KEYS startfrom 1}} find_keys {type range spec {lastkey -1 keystep 1 limit 0}}} + assert_equal [r command getkeys kspec.keyword foo KEYS bar baz] {bar baz} + } + + test "Module key specs: Complex specs, case 1" { + set reply [lindex [r command info kspec.complex1] 0] + # Verify (first, last, step) and movablekeys + assert_equal [lindex $reply 2] {module movablekeys} + assert_equal [lindex $reply 3] 1 + assert_equal [lindex $reply 4] 1 + assert_equal [lindex $reply 5] 1 + # Verify key-specs + set keyspecs [lindex $reply 8] + assert_equal [lindex $keyspecs 0] {flags RO begin_search {type index spec {index 1}} find_keys {type range spec {lastkey 0 keystep 1 limit 0}}} + assert_equal [lindex $keyspecs 1] {flags {RW update} begin_search {type keyword spec {keyword STORE startfrom 2}} find_keys {type range spec {lastkey 0 keystep 1 limit 0}}} + assert_equal [lindex $keyspecs 2] {flags {RO access} begin_search {type keyword spec {keyword KEYS startfrom 2}} find_keys {type keynum spec {keynumidx 0 firstkey 1 keystep 1}}} + assert_equal [r command getkeys kspec.complex1 foo dummy KEYS 1 bar baz STORE quux] {foo quux bar} + } + + test "Module key specs: Complex specs, case 2" { + set reply [lindex [r command info kspec.complex2] 0] + # Verify (first, last, step) and movablekeys + assert_equal [lindex $reply 2] {module movablekeys} + assert_equal [lindex $reply 3] 1 + assert_equal [lindex $reply 4] 2 + assert_equal [lindex $reply 5] 1 + # Verify key-specs + set keyspecs [lindex $reply 8] + assert_equal [lindex $keyspecs 0] {flags {RW update} begin_search {type keyword spec {keyword STORE startfrom 5}} find_keys {type range spec {lastkey 0 keystep 1 limit 0}}} + assert_equal [lindex $keyspecs 1] {flags {RO access} begin_search {type index spec {index 1}} find_keys {type range spec {lastkey 0 keystep 1 limit 0}}} + assert_equal [lindex $keyspecs 2] {flags {RO access} begin_search {type index spec {index 2}} find_keys {type range spec {lastkey 0 keystep 1 limit 0}}} + assert_equal [lindex $keyspecs 3] {flags {RW update} begin_search {type index spec {index 3}} find_keys {type keynum spec {keynumidx 0 firstkey 1 keystep 1}}} + assert_equal [lindex $keyspecs 4] {flags {RW update} begin_search {type keyword spec {keyword MOREKEYS startfrom 5}} find_keys {type range spec {lastkey -1 keystep 1 limit 0}}} + assert_equal [r command getkeys kspec.complex2 foo bar 2 baz quux banana STORE dst dummy MOREKEYS hey ho] {dst foo bar baz quux hey ho} + } + + test "Module command list filtering" { + ;# Note: we piggyback this tcl file to test the general functionality of command list filtering + set reply [r command list filterby module keyspecs] + assert_equal [lsort $reply] {kspec.complex1 kspec.complex2 kspec.keyword kspec.none kspec.nonewithgetkeys kspec.tworanges kspec.tworangeswithgap} + assert_equal [r command getkeys kspec.complex2 foo bar 2 baz quux banana STORE dst dummy MOREKEYS hey ho] {dst foo bar baz quux hey ho} + } + + test {COMMAND GETKEYSANDFLAGS correctly reports module key-spec without flags} { + r command getkeysandflags kspec.none key1 val1 key2 val2 + } {{key1 {RW access update}} {key2 {RW access update}}} + + test {COMMAND GETKEYSANDFLAGS correctly reports module key-spec with flags} { + r command getkeysandflags kspec.nonewithgetkeys key1 val1 key2 val2 + } {{key1 {RO access}} {key2 {RO access}}} + + test {COMMAND GETKEYSANDFLAGS correctly reports module key-spec flags} { + r command getkeysandflags kspec.keyword keys key1 key2 key3 + } {{key1 {RO access}} {key2 {RO access}} {key3 {RO access}}} + + # user that can only read from "read" keys, write to "write" keys, and read+write to "RW" keys + r ACL setuser testuser +@all %R~read* %W~write* %RW~rw* + + test "Module key specs: No spec, only legacy triple - ACL" { + # legacy triple didn't provide flags, so they require both read and write + assert_equal "OK" [r ACL DRYRUN testuser kspec.none rw val1] + assert_equal "This user has no permissions to access the 'read' key" [r ACL DRYRUN testuser kspec.none read val1] + assert_equal "This user has no permissions to access the 'write' key" [r ACL DRYRUN testuser kspec.none write val1] + } + + test "Module key specs: tworanges - ACL" { + assert_equal "OK" [r ACL DRYRUN testuser kspec.tworanges read write] + assert_equal "OK" [r ACL DRYRUN testuser kspec.tworanges rw rw] + assert_equal "This user has no permissions to access the 'read' key" [r ACL DRYRUN testuser kspec.tworanges rw read] + assert_equal "This user has no permissions to access the 'write' key" [r ACL DRYRUN testuser kspec.tworanges write rw] + } + + foreach cmd {kspec.none kspec.tworanges} { + test "$cmd command will not be marked with movablekeys" { + set info [lindex [r command info $cmd] 0] + assert_no_match {*movablekeys*} [lindex $info 2] + } + } + + foreach cmd {kspec.keyword kspec.complex1 kspec.complex2 kspec.nonewithgetkeys} { + test "$cmd command is marked with movablekeys" { + set info [lindex [r command info $cmd] 0] + assert_match {*movablekeys*} [lindex $info 2] + } + } + + test "Unload the module - keyspecs" { + assert_equal {OK} [r module unload keyspecs] + } +} diff --git a/tests/unit/moduleapi/list.tcl b/tests/unit/moduleapi/list.tcl new file mode 100644 index 0000000..0c44055 --- /dev/null +++ b/tests/unit/moduleapi/list.tcl @@ -0,0 +1,124 @@ +set testmodule [file normalize tests/modules/list.so] + +# The following arguments can be passed to args: +# i -- the number of inserts +# d -- the number of deletes +# r -- the number of replaces +# index -- the last index +# entry -- The entry pointed to by index +proc verify_list_edit_reply {reply argv} { + foreach {k v} $argv { + assert_equal [dict get $reply $k] $v + } +} + +start_server {tags {"modules"}} { + r module load $testmodule + + test {Module list set, get, insert, delete} { + r del k + r rpush k x + # insert, set, get + r list.insert k 0 foo + r list.insert k -1 bar + r list.set k 1 xyz + assert_equal {foo xyz bar} [r list.getall k] + assert_equal {foo} [r list.get k 0] + assert_equal {xyz} [r list.get k 1] + assert_equal {bar} [r list.get k 2] + assert_equal {bar} [r list.get k -1] + assert_equal {foo} [r list.get k -3] + assert_error {ERR index out*} {r list.get k -4} + assert_error {ERR index out*} {r list.get k 3} + # remove + assert_error {ERR index out*} {r list.delete k -4} + assert_error {ERR index out*} {r list.delete k 3} + r list.delete k 0 + r list.delete k -1 + assert_equal {xyz} [r list.getall k] + # removing the last element deletes the list + r list.delete k 0 + assert_equal 0 [r exists k] + } + + test {Module list iteration} { + r del k + r rpush k x y z + assert_equal {x y z} [r list.getall k] + assert_equal {z y x} [r list.getall k REVERSE] + } + + test {Module list insert & delete} { + r del k + r rpush k x y z + verify_list_edit_reply [r list.edit k ikikdi foo bar baz] {i 3 index 5} + r list.getall k + } {foo x bar y baz} + + test {Module list insert & delete, neg index} { + r del k + r rpush k x y z + verify_list_edit_reply [r list.edit k REVERSE ikikdi foo bar baz] {i 3 index -6} + r list.getall k + } {baz y bar z foo} + + test {Module list set while iterating} { + r del k + r rpush k x y z + verify_list_edit_reply [r list.edit k rkr foo bar] {r 2 index 3} + r list.getall k + } {foo y bar} + + test {Module list set while iterating, neg index} { + r del k + r rpush k x y z + verify_list_edit_reply [r list.edit k reverse rkr foo bar] {r 2 index -4} + r list.getall k + } {bar y foo} + + test {Module list - list entry and index should be updated when deletion} { + set original_config [config_get_set list-max-listpack-size 1] + + # delete from start (index 0) + r del l + r rpush l x y z + verify_list_edit_reply [r list.edit l dd] {d 2 index 0 entry z} + assert_equal [r list.getall l] {z} + + # delete from start (index -3) + r del l + r rpush l x y z + verify_list_edit_reply [r list.edit l reverse kkd] {d 1 index -3} + assert_equal [r list.getall l] {y z} + + # # delete from tail (index 2) + r del l + r rpush l x y z + verify_list_edit_reply [r list.edit l kkd] {d 1 index 2} + assert_equal [r list.getall l] {x y} + + # # delete from tail (index -1) + r del l + r rpush l x y z + verify_list_edit_reply [r list.edit l reverse dd] {d 2 index -1 entry x} + assert_equal [r list.getall l] {x} + + # # delete from middle (index 1) + r del l + r rpush l x y z + verify_list_edit_reply [r list.edit l kdd] {d 2 index 1} + assert_equal [r list.getall l] {x} + + # # delete from middle (index -2) + r del l + r rpush l x y z + verify_list_edit_reply [r list.edit l reverse kdd] {d 2 index -2} + assert_equal [r list.getall l] {z} + + config_set list-max-listpack-size $original_config + } + + test "Unload the module - list" { + assert_equal {OK} [r module unload list] + } +} diff --git a/tests/unit/moduleapi/mallocsize.tcl b/tests/unit/moduleapi/mallocsize.tcl new file mode 100644 index 0000000..359a7ae --- /dev/null +++ b/tests/unit/moduleapi/mallocsize.tcl @@ -0,0 +1,21 @@ +set testmodule [file normalize tests/modules/mallocsize.so] + + +start_server {tags {"modules"}} { + r module load $testmodule + + test {MallocSize of raw bytes} { + assert_equal [r mallocsize.setraw key 40] {OK} + assert_morethan [r memory usage key] 40 + } + + test {MallocSize of string} { + assert_equal [r mallocsize.setstr key abcdefg] {OK} + assert_morethan [r memory usage key] 7 ;# Length of "abcdefg" + } + + test {MallocSize of dict} { + assert_equal [r mallocsize.setdict key f1 v1 f2 v2] {OK} + assert_morethan [r memory usage key] 8 ;# Length of "f1v1f2v2" + } +} diff --git a/tests/unit/moduleapi/misc.tcl b/tests/unit/moduleapi/misc.tcl new file mode 100644 index 0000000..55f4036 --- /dev/null +++ b/tests/unit/moduleapi/misc.tcl @@ -0,0 +1,421 @@ +set testmodule [file normalize tests/modules/misc.so] + +start_server {tags {"modules"}} { + r module load $testmodule + + test {test RM_Call} { + set info [r test.call_info commandstats] + # cmdstat is not in a default section, so we also test an argument was passed + assert { [string match "*cmdstat_module*" $info] } + } + + test {test RM_Call args array} { + set info [r test.call_generic info commandstats] + # cmdstat is not in a default section, so we also test an argument was passed + assert { [string match "*cmdstat_module*" $info] } + } + + test {test RM_Call recursive} { + set info [r test.call_generic test.call_generic info commandstats] + assert { [string match "*cmdstat_module*" $info] } + } + + test {test redis version} { + set version [s redis_version] + assert_equal $version [r test.redisversion] + } + + test {test long double conversions} { + set ld [r test.ld_conversion] + assert {[string match $ld "0.00000000000000001"]} + } + + test {test unsigned long long conversions} { + set ret [r test.ull_conversion] + assert {[string match $ret "ok"]} + } + + test {test module db commands} { + r set x foo + set key [r test.randomkey] + assert_equal $key "x" + assert_equal [r test.dbsize] 1 + r test.flushall + assert_equal [r test.dbsize] 0 + } + + test {test RedisModule_ResetDataset do not reset functions} { + r function load {#!lua name=lib + redis.register_function('test', function() return 1 end) + } + assert_equal [r function list] {{library_name lib engine LUA functions {{name test description {} flags {}}}}} + r test.flushall + assert_equal [r function list] {{library_name lib engine LUA functions {{name test description {} flags {}}}}} + r function flush + } + + test {test module keyexists} { + r set x foo + assert_equal 1 [r test.keyexists x] + r del x + assert_equal 0 [r test.keyexists x] + } + + test {test module lru api} { + r config set maxmemory-policy allkeys-lru + r set x foo + set lru [r test.getlru x] + assert { $lru <= 1000 } + set was_set [r test.setlru x 100000] + assert { $was_set == 1 } + set idle [r object idletime x] + assert { $idle >= 100 } + set lru [r test.getlru x] + assert { $lru >= 100000 } + r config set maxmemory-policy allkeys-lfu + set lru [r test.getlru x] + assert { $lru == -1 } + set was_set [r test.setlru x 100000] + assert { $was_set == 0 } + } + r config set maxmemory-policy allkeys-lru + + test {test module lfu api} { + r config set maxmemory-policy allkeys-lfu + r set x foo + set lfu [r test.getlfu x] + assert { $lfu >= 1 } + set was_set [r test.setlfu x 100] + assert { $was_set == 1 } + set freq [r object freq x] + assert { $freq <= 100 } + set lfu [r test.getlfu x] + assert { $lfu <= 100 } + r config set maxmemory-policy allkeys-lru + set lfu [r test.getlfu x] + assert { $lfu == -1 } + set was_set [r test.setlfu x 100] + assert { $was_set == 0 } + } + + test {test module clientinfo api} { + # Test basic sanity and SSL flag + set info [r test.clientinfo] + set ssl_flag [expr $::tls ? {"ssl:"} : {":"}] + + assert { [dict get $info db] == 9 } + assert { [dict get $info flags] == "${ssl_flag}::::" } + + # Test MULTI flag + r multi + r test.clientinfo + set info [lindex [r exec] 0] + assert { [dict get $info flags] == "${ssl_flag}::::multi" } + + # Test TRACKING flag + r client tracking on + set info [r test.clientinfo] + assert { [dict get $info flags] == "${ssl_flag}::tracking::" } + } + + test {test module get/set client name by id api} { + catch { r test.getname } e + assert_equal "-ERR No name" $e + r client setname nobody + catch { r test.setname "name with spaces" } e + assert_match "*Invalid argument*" $e + assert_equal nobody [r client getname] + assert_equal nobody [r test.getname] + r test.setname somebody + assert_equal somebody [r client getname] + } + + test {test module getclientcert api} { + set cert [r test.getclientcert] + + if {$::tls} { + assert {$cert != ""} + } else { + assert {$cert == ""} + } + } + + test {test detached thread safe cnotext} { + r test.log_tsctx "info" "Test message" + verify_log_message 0 "*<misc> Test message*" 0 + } + + test {test RM_Call CLIENT INFO} { + assert_match "*fd=-1*" [r test.call_generic client info] + } + + test {Unsafe command names are sanitized in INFO output} { + r test.weird:cmd + set info [r info commandstats] + assert_match {*cmdstat_test.weird_cmd:calls=1*} $info + } + + test {test monotonic time} { + set x [r test.monotonic_time] + assert { [r test.monotonic_time] >= $x } + } + + test {rm_call OOM} { + r config set maxmemory 1 + r config set maxmemory-policy volatile-lru + + # sanity test plain call + assert_equal {OK} [ + r test.rm_call set x 1 + ] + + # add the M flag + assert_error {OOM *} { + r test.rm_call_flags M set x 1 + + } + + # test a non deny-oom command + assert_equal {1} [ + r test.rm_call_flags M get x + ] + + r config set maxmemory 0 + } {OK} {needs:config-maxmemory} + + test {rm_call clear OOM} { + r config set maxmemory 1 + + # verify rm_call fails with OOM + assert_error {OOM *} { + r test.rm_call_flags M set x 1 + } + + # clear OOM state + r config set maxmemory 0 + + # test set command is allowed + r test.rm_call_flags M set x 1 + } {OK} {needs:config-maxmemory} + + test {rm_call OOM Eval} { + r config set maxmemory 1 + r config set maxmemory-policy volatile-lru + + # use the M flag without allow-oom shebang flag + assert_error {OOM *} { + r test.rm_call_flags M eval {#!lua + redis.call('set','x',1) + return 1 + } 1 x + } + + # add the M flag with allow-oom shebang flag + assert_equal {1} [ + r test.rm_call_flags M eval {#!lua flags=allow-oom + redis.call('set','x',1) + return 1 + } 1 x + ] + + r config set maxmemory 0 + } {OK} {needs:config-maxmemory} + + test {rm_call write flag} { + # add the W flag + assert_error {ERR Write command 'set' was called while write is not allowed.} { + r test.rm_call_flags W set x 1 + } + + # test a non deny-oom command + r test.rm_call_flags W get x + } {1} + + test {rm_call EVAL} { + r test.rm_call eval { + redis.call('set','x',1) + return 1 + } 1 x + + assert_error {ERR Write commands are not allowed from read-only scripts.*} { + r test.rm_call eval {#!lua flags=no-writes + redis.call('set','x',1) + return 1 + } 1 x + } + } + + test {rm_call EVAL - OOM} { + r config set maxmemory 1 + + assert_error {OOM command not allowed when used memory > 'maxmemory'. script*} { + r test.rm_call eval { + redis.call('set','x',1) + return 1 + } 1 x + } + + r test.rm_call eval {#!lua flags=no-writes + redis.call('get','x') + return 2 + } 1 x + + assert_error {OOM allow-oom flag is not set on the script,*} { + r test.rm_call eval {#!lua + redis.call('get','x') + return 3 + } 1 x + } + + r test.rm_call eval { + redis.call('get','x') + return 4 + } 1 x + + r config set maxmemory 0 + } {OK} {needs:config-maxmemory} + + test "not enough good replicas" { + r set x "some value" + r config set min-replicas-to-write 1 + + # rm_call in script mode + assert_error {NOREPLICAS *} {r test.rm_call_flags S set x s} + + assert_equal [ + r test.rm_call eval {#!lua flags=no-writes + return redis.call('get','x') + } 1 x + ] "some value" + + assert_equal [ + r test.rm_call eval { + return redis.call('get','x') + } 1 x + ] "some value" + + assert_error {NOREPLICAS *} { + r test.rm_call eval {#!lua + return redis.call('get','x') + } 1 x + } + + assert_error {NOREPLICAS *} { + r test.rm_call eval { + return redis.call('set','x', 1) + } 1 x + } + + r config set min-replicas-to-write 0 + } + + test {rm_call EVAL - read-only replica} { + r replicaof 127.0.0.1 1 + + # rm_call in script mode + assert_error {READONLY *} {r test.rm_call_flags S set x 1} + + assert_error {READONLY You can't write against a read only replica. script*} { + r test.rm_call eval { + redis.call('set','x',1) + return 1 + } 1 x + } + + r test.rm_call eval {#!lua flags=no-writes + redis.call('get','x') + return 2 + } 1 x + + assert_error {READONLY Can not run script with write flag on readonly replica*} { + r test.rm_call eval {#!lua + redis.call('get','x') + return 3 + } 1 x + } + + r test.rm_call eval { + redis.call('get','x') + return 4 + } 1 x + + r replicaof no one + } {OK} {needs:config-maxmemory} + + test {rm_call EVAL - stale replica} { + r replicaof 127.0.0.1 1 + r config set replica-serve-stale-data no + + # rm_call in script mode + assert_error {MASTERDOWN *} { + r test.rm_call_flags S get x + } + + assert_error {MASTERDOWN *} { + r test.rm_call eval {#!lua flags=no-writes + redis.call('get','x') + return 2 + } 1 x + } + + assert_error {MASTERDOWN *} { + r test.rm_call eval { + redis.call('get','x') + return 4 + } 1 x + } + + r replicaof no one + r config set replica-serve-stale-data yes + } {OK} {needs:config-maxmemory} + + test "rm_call EVAL - failed bgsave prevents writes" { + r config set rdb-key-save-delay 10000000 + populate 1000 + r set x x + r bgsave + set pid1 [get_child_pid 0] + catch {exec kill -9 $pid1} + waitForBgsave r + + # make sure a read command succeeds + assert_equal [r get x] x + + # make sure a write command fails + assert_error {MISCONF *} {r set x y} + + # rm_call in script mode + assert_error {MISCONF *} {r test.rm_call_flags S set x 1} + + # repeate with script + assert_error {MISCONF *} {r test.rm_call eval { + return redis.call('set','x',1) + } 1 x + } + assert_equal {x} [r test.rm_call eval { + return redis.call('get','x') + } 1 x + ] + + # again with script using shebang + assert_error {MISCONF *} {r test.rm_call eval {#!lua + return redis.call('set','x',1) + } 1 x + } + assert_equal {x} [r test.rm_call eval {#!lua flags=no-writes + return redis.call('get','x') + } 1 x + ] + + r config set rdb-key-save-delay 0 + r bgsave + waitForBgsave r + + # server is writable again + r set x y + } {OK} + + test "Unload the module - misc" { + assert_equal {OK} [r module unload misc] + } +} diff --git a/tests/unit/moduleapi/moduleconfigs.tcl b/tests/unit/moduleapi/moduleconfigs.tcl new file mode 100644 index 0000000..8ebce35 --- /dev/null +++ b/tests/unit/moduleapi/moduleconfigs.tcl @@ -0,0 +1,259 @@ +set testmodule [file normalize tests/modules/moduleconfigs.so] +set testmoduletwo [file normalize tests/modules/moduleconfigstwo.so] + +start_server {tags {"modules"}} { + r module load $testmodule + test {Config get commands work} { + # Make sure config get module config works + assert_equal [lindex [lindex [r module list] 0] 1] moduleconfigs + assert_equal [r config get moduleconfigs.mutable_bool] "moduleconfigs.mutable_bool yes" + assert_equal [r config get moduleconfigs.immutable_bool] "moduleconfigs.immutable_bool no" + assert_equal [r config get moduleconfigs.memory_numeric] "moduleconfigs.memory_numeric 1024" + assert_equal [r config get moduleconfigs.string] "moduleconfigs.string {secret password}" + assert_equal [r config get moduleconfigs.enum] "moduleconfigs.enum one" + assert_equal [r config get moduleconfigs.flags] "moduleconfigs.flags {one two}" + assert_equal [r config get moduleconfigs.numeric] "moduleconfigs.numeric -1" + } + + test {Config set commands work} { + # Make sure that config sets work during runtime + r config set moduleconfigs.mutable_bool no + assert_equal [r config get moduleconfigs.mutable_bool] "moduleconfigs.mutable_bool no" + r config set moduleconfigs.memory_numeric 1mb + assert_equal [r config get moduleconfigs.memory_numeric] "moduleconfigs.memory_numeric 1048576" + r config set moduleconfigs.string wafflewednesdays + assert_equal [r config get moduleconfigs.string] "moduleconfigs.string wafflewednesdays" + set not_embstr [string repeat A 50] + r config set moduleconfigs.string $not_embstr + assert_equal [r config get moduleconfigs.string] "moduleconfigs.string $not_embstr" + r config set moduleconfigs.string \x73\x75\x70\x65\x72\x20\x00\x73\x65\x63\x72\x65\x74\x20\x70\x61\x73\x73\x77\x6f\x72\x64 + assert_equal [r config get moduleconfigs.string] "moduleconfigs.string {super \0secret password}" + r config set moduleconfigs.enum two + assert_equal [r config get moduleconfigs.enum] "moduleconfigs.enum two" + r config set moduleconfigs.flags two + assert_equal [r config get moduleconfigs.flags] "moduleconfigs.flags two" + r config set moduleconfigs.numeric -2 + assert_equal [r config get moduleconfigs.numeric] "moduleconfigs.numeric -2" + } + + test {Config set commands enum flags} { + r config set moduleconfigs.flags "none" + assert_equal [r config get moduleconfigs.flags] "moduleconfigs.flags none" + + r config set moduleconfigs.flags "two four" + assert_equal [r config get moduleconfigs.flags] "moduleconfigs.flags {two four}" + + r config set moduleconfigs.flags "five" + assert_equal [r config get moduleconfigs.flags] "moduleconfigs.flags five" + + r config set moduleconfigs.flags "one four" + assert_equal [r config get moduleconfigs.flags] "moduleconfigs.flags five" + + r config set moduleconfigs.flags "one two four" + assert_equal [r config get moduleconfigs.flags] "moduleconfigs.flags {five two}" + } + + test {Immutable flag works properly and rejected strings dont leak} { + # Configs flagged immutable should not allow sets + catch {[r config set moduleconfigs.immutable_bool yes]} e + assert_match {*can't set immutable config*} $e + catch {[r config set moduleconfigs.string rejectisfreed]} e + assert_match {*Cannot set string to 'rejectisfreed'*} $e + } + + test {Numeric limits work properly} { + # Configs over/under the limit shouldn't be allowed, and memory configs should only take memory values + catch {[r config set moduleconfigs.memory_numeric 200gb]} e + assert_match {*argument must be between*} $e + catch {[r config set moduleconfigs.memory_numeric -5]} e + assert_match {*argument must be a memory value*} $e + catch {[r config set moduleconfigs.numeric -10]} e + assert_match {*argument must be between*} $e + } + + test {Enums only able to be set to passed in values} { + # Module authors specify what values are valid for enums, check that only those values are ok on a set + catch {[r config set moduleconfigs.enum asdf]} e + assert_match {*must be one of the following*} $e + } + + test {Unload removes module configs} { + r module unload moduleconfigs + assert_equal [r config get moduleconfigs.*] "" + r module load $testmodule + # these should have reverted back to their module specified values + assert_equal [r config get moduleconfigs.mutable_bool] "moduleconfigs.mutable_bool yes" + assert_equal [r config get moduleconfigs.immutable_bool] "moduleconfigs.immutable_bool no" + assert_equal [r config get moduleconfigs.memory_numeric] "moduleconfigs.memory_numeric 1024" + assert_equal [r config get moduleconfigs.string] "moduleconfigs.string {secret password}" + assert_equal [r config get moduleconfigs.enum] "moduleconfigs.enum one" + assert_equal [r config get moduleconfigs.flags] "moduleconfigs.flags {one two}" + assert_equal [r config get moduleconfigs.numeric] "moduleconfigs.numeric -1" + r module unload moduleconfigs + } + + test {test loadex functionality} { + r module loadex $testmodule CONFIG moduleconfigs.mutable_bool no CONFIG moduleconfigs.immutable_bool yes CONFIG moduleconfigs.memory_numeric 2mb CONFIG moduleconfigs.string tclortickle + assert_equal [lindex [lindex [r module list] 0] 1] moduleconfigs + assert_equal [r config get moduleconfigs.mutable_bool] "moduleconfigs.mutable_bool no" + assert_equal [r config get moduleconfigs.immutable_bool] "moduleconfigs.immutable_bool yes" + assert_equal [r config get moduleconfigs.memory_numeric] "moduleconfigs.memory_numeric 2097152" + assert_equal [r config get moduleconfigs.string] "moduleconfigs.string tclortickle" + # Configs that were not changed should still be their module specified value + assert_equal [r config get moduleconfigs.enum] "moduleconfigs.enum one" + assert_equal [r config get moduleconfigs.flags] "moduleconfigs.flags {one two}" + assert_equal [r config get moduleconfigs.numeric] "moduleconfigs.numeric -1" + } + + test {apply function works} { + catch {[r config set moduleconfigs.mutable_bool yes]} e + assert_match {*Bool configs*} $e + assert_equal [r config get moduleconfigs.mutable_bool] "moduleconfigs.mutable_bool no" + catch {[r config set moduleconfigs.memory_numeric 1000 moduleconfigs.numeric 1000]} e + assert_match {*cannot equal*} $e + assert_equal [r config get moduleconfigs.memory_numeric] "moduleconfigs.memory_numeric 2097152" + assert_equal [r config get moduleconfigs.numeric] "moduleconfigs.numeric -1" + r module unload moduleconfigs + } + + test {test double config argument to loadex} { + r module loadex $testmodule CONFIG moduleconfigs.mutable_bool yes CONFIG moduleconfigs.mutable_bool no + assert_equal [r config get moduleconfigs.mutable_bool] "moduleconfigs.mutable_bool no" + r module unload moduleconfigs + } + + test {missing loadconfigs call} { + catch {[r module loadex $testmodule CONFIG moduleconfigs.string "cool" ARGS noload]} e + assert_match {*ERR*} $e + } + + test {test loadex rejects bad configs} { + # Bad config 200gb is over the limit + catch {[r module loadex $testmodule CONFIG moduleconfigs.memory_numeric 200gb ARGS]} e + assert_match {*ERR*} $e + # We should completely remove all configs on a failed load + assert_equal [r config get moduleconfigs.*] "" + # No value for config, should error out + catch {[r module loadex $testmodule CONFIG moduleconfigs.mutable_bool CONFIG moduleconfigs.enum two ARGS]} e + assert_match {*ERR*} $e + assert_equal [r config get moduleconfigs.*] "" + # Asan will catch this if this string is not freed + catch {[r module loadex $testmodule CONFIG moduleconfigs.string rejectisfreed]} + assert_match {*ERR*} $e + assert_equal [r config get moduleconfigs.*] "" + # test we can't set random configs + catch {[r module loadex $testmodule CONFIG maxclients 333]} + assert_match {*ERR*} $e + assert_equal [r config get moduleconfigs.*] "" + assert_not_equal [r config get maxclients] "maxclients 333" + # test we can't set other module's configs + r module load $testmoduletwo + catch {[r module loadex $testmodule CONFIG configs.test no]} + assert_match {*ERR*} $e + assert_equal [r config get configs.test] "configs.test yes" + r module unload configs + } + + test {test config rewrite with dynamic load} { + #translates to: super \0secret password + r module loadex $testmodule CONFIG moduleconfigs.string \x73\x75\x70\x65\x72\x20\x00\x73\x65\x63\x72\x65\x74\x20\x70\x61\x73\x73\x77\x6f\x72\x64 ARGS + assert_equal [lindex [lindex [r module list] 0] 1] moduleconfigs + assert_equal [r config get moduleconfigs.string] "moduleconfigs.string {super \0secret password}" + r config set moduleconfigs.mutable_bool yes + r config set moduleconfigs.memory_numeric 750 + r config set moduleconfigs.enum two + r config set moduleconfigs.flags "four two" + r config rewrite + restart_server 0 true false + # Ensure configs we rewrote are present and that the conf file is readable + assert_equal [r config get moduleconfigs.mutable_bool] "moduleconfigs.mutable_bool yes" + assert_equal [r config get moduleconfigs.memory_numeric] "moduleconfigs.memory_numeric 750" + assert_equal [r config get moduleconfigs.string] "moduleconfigs.string {super \0secret password}" + assert_equal [r config get moduleconfigs.enum] "moduleconfigs.enum two" + assert_equal [r config get moduleconfigs.flags] "moduleconfigs.flags {two four}" + assert_equal [r config get moduleconfigs.numeric] "moduleconfigs.numeric -1" + r module unload moduleconfigs + } + + test {test multiple modules with configs} { + r module load $testmodule + r module loadex $testmoduletwo CONFIG configs.test yes + assert_equal [r config get moduleconfigs.mutable_bool] "moduleconfigs.mutable_bool yes" + assert_equal [r config get moduleconfigs.immutable_bool] "moduleconfigs.immutable_bool no" + assert_equal [r config get moduleconfigs.memory_numeric] "moduleconfigs.memory_numeric 1024" + assert_equal [r config get moduleconfigs.string] "moduleconfigs.string {secret password}" + assert_equal [r config get moduleconfigs.enum] "moduleconfigs.enum one" + assert_equal [r config get moduleconfigs.numeric] "moduleconfigs.numeric -1" + assert_equal [r config get configs.test] "configs.test yes" + r config set moduleconfigs.mutable_bool no + r config set moduleconfigs.string nice + r config set moduleconfigs.enum two + r config set configs.test no + assert_equal [r config get moduleconfigs.mutable_bool] "moduleconfigs.mutable_bool no" + assert_equal [r config get moduleconfigs.string] "moduleconfigs.string nice" + assert_equal [r config get moduleconfigs.enum] "moduleconfigs.enum two" + assert_equal [r config get configs.test] "configs.test no" + r config rewrite + # test we can load from conf file with multiple different modules. + restart_server 0 true false + assert_equal [r config get moduleconfigs.mutable_bool] "moduleconfigs.mutable_bool no" + assert_equal [r config get moduleconfigs.string] "moduleconfigs.string nice" + assert_equal [r config get moduleconfigs.enum] "moduleconfigs.enum two" + assert_equal [r config get configs.test] "configs.test no" + r module unload moduleconfigs + r module unload configs + } + + test {test 1.module load 2.config rewrite 3.module unload 4.config rewrite works} { + # Configs need to be removed from the old config file in this case. + r module loadex $testmodule CONFIG moduleconfigs.memory_numeric 500 ARGS + assert_equal [lindex [lindex [r module list] 0] 1] moduleconfigs + r config rewrite + r module unload moduleconfigs + r config rewrite + restart_server 0 true false + # Ensure configs we rewrote are no longer present + assert_equal [r config get moduleconfigs.*] "" + } + test {startup moduleconfigs} { + # No loadmodule directive + set nomodload [start_server [list overrides [list moduleconfigs.string "hello"]]] + wait_for_condition 100 50 { + ! [is_alive $nomodload] + } else { + fail "startup should've failed with no load and module configs supplied" + } + set stdout [dict get $nomodload stdout] + assert_equal [count_message_lines $stdout "Module Configuration detected without loadmodule directive or no ApplyConfig call: aborting"] 1 + + # Bad config value + set badconfig [start_server [list overrides [list loadmodule "$testmodule" moduleconfigs.string "rejectisfreed"]]] + wait_for_condition 100 50 { + ! [is_alive $badconfig] + } else { + fail "startup with bad moduleconfigs should've failed" + } + set stdout [dict get $badconfig stdout] + assert_equal [count_message_lines $stdout "Issue during loading of configuration moduleconfigs.string : Cannot set string to 'rejectisfreed'"] 1 + + set noload [start_server [list overrides [list loadmodule "$testmodule noload" moduleconfigs.string "hello"]]] + wait_for_condition 100 50 { + ! [is_alive $noload] + } else { + fail "startup with moduleconfigs and no loadconfigs call should've failed" + } + set stdout [dict get $noload stdout] + assert_equal [count_message_lines $stdout "Module Configurations were not set, likely a missing LoadConfigs call. Unloading the module."] 1 + + start_server [list overrides [list loadmodule "$testmodule" moduleconfigs.string "bootedup" moduleconfigs.enum two moduleconfigs.flags "two four"]] { + assert_equal [r config get moduleconfigs.string] "moduleconfigs.string bootedup" + assert_equal [r config get moduleconfigs.mutable_bool] "moduleconfigs.mutable_bool yes" + assert_equal [r config get moduleconfigs.immutable_bool] "moduleconfigs.immutable_bool no" + assert_equal [r config get moduleconfigs.enum] "moduleconfigs.enum two" + assert_equal [r config get moduleconfigs.flags] "moduleconfigs.flags {two four}" + assert_equal [r config get moduleconfigs.numeric] "moduleconfigs.numeric -1" + assert_equal [r config get moduleconfigs.memory_numeric] "moduleconfigs.memory_numeric 1024" + } + } +} + diff --git a/tests/unit/moduleapi/propagate.tcl b/tests/unit/moduleapi/propagate.tcl new file mode 100644 index 0000000..846d938 --- /dev/null +++ b/tests/unit/moduleapi/propagate.tcl @@ -0,0 +1,616 @@ +set testmodule [file normalize tests/modules/propagate.so] +set keyspace_events [file normalize tests/modules/keyspace_events.so] + +tags "modules" { + test {Modules can propagate in async and threaded contexts} { + start_server [list overrides [list loadmodule "$testmodule"]] { + set replica [srv 0 client] + set replica_host [srv 0 host] + set replica_port [srv 0 port] + $replica module load $keyspace_events + start_server [list overrides [list loadmodule "$testmodule"]] { + set master [srv 0 client] + set master_host [srv 0 host] + set master_port [srv 0 port] + $master module load $keyspace_events + + # Start the replication process... + $replica replicaof $master_host $master_port + wait_for_sync $replica + after 1000 + + test {module propagates from timer} { + set repl [attach_to_replication_stream] + + $master propagate-test.timer + + wait_for_condition 500 10 { + [$replica get timer] eq "3" + } else { + fail "The two counters don't match the expected value." + } + + assert_replication_stream $repl { + {select *} + {incr timer} + {incr timer} + {incr timer} + } + close_replication_stream $repl + } + + test {module propagation with notifications} { + set repl [attach_to_replication_stream] + + $master set x y + + assert_replication_stream $repl { + {select *} + {multi} + {incr notifications} + {set x y} + {exec} + } + close_replication_stream $repl + } + + test {module propagation with notifications with multi} { + set repl [attach_to_replication_stream] + + $master multi + $master set x1 y1 + $master set x2 y2 + $master exec + + assert_replication_stream $repl { + {select *} + {multi} + {incr notifications} + {set x1 y1} + {incr notifications} + {set x2 y2} + {exec} + } + close_replication_stream $repl + } + + test {module propagation with notifications with active-expire} { + $master debug set-active-expire 1 + set repl [attach_to_replication_stream] + + $master set asdf1 1 PX 300 + $master set asdf2 2 PX 300 + $master set asdf3 3 PX 300 + + wait_for_condition 500 10 { + [$replica keys asdf*] eq {} + } else { + fail "Not all keys have expired" + } + + # Note whenever there's double notification: SET with PX issues two separate + # notifications: one for "set" and one for "expire" + assert_replication_stream $repl { + {select *} + {multi} + {incr notifications} + {incr notifications} + {set asdf1 1 PXAT *} + {exec} + {multi} + {incr notifications} + {incr notifications} + {set asdf2 2 PXAT *} + {exec} + {multi} + {incr notifications} + {incr notifications} + {set asdf3 3 PXAT *} + {exec} + {incr notifications} + {incr notifications} + {incr testkeyspace:expired} + {del asdf*} + {incr notifications} + {incr notifications} + {incr testkeyspace:expired} + {del asdf*} + {incr notifications} + {incr notifications} + {incr testkeyspace:expired} + {del asdf*} + } + close_replication_stream $repl + + $master debug set-active-expire 0 + } + + test {module propagation with notifications with eviction case 1} { + $master flushall + $master set asdf1 1 + $master set asdf2 2 + $master set asdf3 3 + + $master config set maxmemory-policy allkeys-random + $master config set maxmemory 1 + + # Please note the following loop: + # We evict a key and send a notification, which does INCR on the "notifications" key, so + # that every time we evict any key, "notifications" key exist (it happens inside the + # performEvictions loop). So even evicting "notifications" causes INCR on "notifications". + # If maxmemory_eviction_tenacity would have been set to 100 this would be an endless loop, but + # since the default is 10, at some point the performEvictions loop would end. + # Bottom line: "notifications" always exists and we can't really determine the order of evictions + # This test is here only for sanity + + wait_for_condition 500 10 { + [$replica dbsize] eq 1 + } else { + fail "Not all keys have been evicted" + } + + $master config set maxmemory 0 + $master config set maxmemory-policy noeviction + } + + test {module propagation with notifications with eviction case 2} { + $master flushall + set repl [attach_to_replication_stream] + + $master set asdf1 1 EX 300 + $master set asdf2 2 EX 300 + $master set asdf3 3 EX 300 + + # Please note we use volatile eviction to prevent the loop described in the test above. + # "notifications" is not volatile so it always remains + $master config resetstat + $master config set maxmemory-policy volatile-ttl + $master config set maxmemory 1 + + wait_for_condition 500 10 { + [s evicted_keys] eq 3 + } else { + fail "Not all keys have been evicted" + } + + $master config set maxmemory 0 + $master config set maxmemory-policy noeviction + + $master set asdf4 4 + + # Note whenever there's double notification: SET with EX issues two separate + # notifications: one for "set" and one for "expire" + # Note that although CONFIG SET maxmemory is called in this flow (see issue #10014), + # eviction will happen and will not induce propagation of the CONFIG command (see #10019). + assert_replication_stream $repl { + {select *} + {multi} + {incr notifications} + {incr notifications} + {set asdf1 1 PXAT *} + {exec} + {multi} + {incr notifications} + {incr notifications} + {set asdf2 2 PXAT *} + {exec} + {multi} + {incr notifications} + {incr notifications} + {set asdf3 3 PXAT *} + {exec} + {incr notifications} + {del asdf*} + {incr notifications} + {del asdf*} + {incr notifications} + {del asdf*} + {multi} + {incr notifications} + {set asdf4 4} + {exec} + } + close_replication_stream $repl + } + + test {module propagation with timer and CONFIG SET maxmemory} { + set repl [attach_to_replication_stream] + + $master config resetstat + $master config set maxmemory-policy volatile-random + + $master propagate-test.timer-maxmemory + + # Wait until the volatile keys are evicted + wait_for_condition 500 10 { + [s evicted_keys] eq 2 + } else { + fail "Not all keys have been evicted" + } + + assert_replication_stream $repl { + {select *} + {multi} + {incr notifications} + {incr notifications} + {set timer-maxmemory-volatile-start 1 PXAT *} + {incr timer-maxmemory-middle} + {incr notifications} + {incr notifications} + {set timer-maxmemory-volatile-end 1 PXAT *} + {exec} + {incr notifications} + {del timer-maxmemory-volatile-*} + {incr notifications} + {del timer-maxmemory-volatile-*} + } + close_replication_stream $repl + + $master config set maxmemory 0 + $master config set maxmemory-policy noeviction + } + + test {module propagation with timer and EVAL} { + set repl [attach_to_replication_stream] + + $master propagate-test.timer-eval + + assert_replication_stream $repl { + {select *} + {multi} + {incr notifications} + {incrby timer-eval-start 1} + {incr notifications} + {set foo bar} + {incr timer-eval-middle} + {incr notifications} + {incrby timer-eval-end 1} + {exec} + } + close_replication_stream $repl + } + + test {module propagates nested ctx case1} { + set repl [attach_to_replication_stream] + + $master propagate-test.timer-nested + + wait_for_condition 500 10 { + [$replica get timer-nested-end] eq "1" + } else { + fail "The two counters don't match the expected value." + } + + assert_replication_stream $repl { + {select *} + {multi} + {incrby timer-nested-start 1} + {incrby timer-nested-end 1} + {exec} + } + close_replication_stream $repl + + # Note propagate-test.timer-nested just propagates INCRBY, causing an + # inconsistency, so we flush + $master flushall + } + + test {module propagates nested ctx case2} { + set repl [attach_to_replication_stream] + + $master propagate-test.timer-nested-repl + + wait_for_condition 500 10 { + [$replica get timer-nested-end] eq "1" + } else { + fail "The two counters don't match the expected value." + } + + assert_replication_stream $repl { + {select *} + {multi} + {incrby timer-nested-start 1} + {incr notifications} + {incr using-call} + {incr counter-1} + {incr counter-2} + {incr counter-3} + {incr counter-4} + {incr notifications} + {incr after-call} + {incr notifications} + {incr before-call-2} + {incr notifications} + {incr asdf} + {incr notifications} + {del asdf} + {incr notifications} + {incr after-call-2} + {incr notifications} + {incr timer-nested-middle} + {incrby timer-nested-end 1} + {exec} + } + close_replication_stream $repl + + # Note propagate-test.timer-nested-repl just propagates INCRBY, causing an + # inconsistency, so we flush + $master flushall + } + + test {module propagates from thread} { + set repl [attach_to_replication_stream] + + $master propagate-test.thread + + wait_for_condition 500 10 { + [$replica get a-from-thread] eq "3" + } else { + fail "The two counters don't match the expected value." + } + + assert_replication_stream $repl { + {select *} + {multi} + {incr a-from-thread} + {incr notifications} + {incr thread-call} + {incr b-from-thread} + {exec} + {multi} + {incr a-from-thread} + {incr notifications} + {incr thread-call} + {incr b-from-thread} + {exec} + {multi} + {incr a-from-thread} + {incr notifications} + {incr thread-call} + {incr b-from-thread} + {exec} + } + close_replication_stream $repl + } + + test {module propagates from thread with detached ctx} { + set repl [attach_to_replication_stream] + + $master propagate-test.detached-thread + + wait_for_condition 500 10 { + [$replica get thread-detached-after] eq "1" + } else { + fail "The key doesn't match the expected value." + } + + assert_replication_stream $repl { + {select *} + {multi} + {incr thread-detached-before} + {incr notifications} + {incr thread-detached-1} + {incr notifications} + {incr thread-detached-2} + {incr thread-detached-after} + {exec} + } + close_replication_stream $repl + } + + test {module propagates from command} { + set repl [attach_to_replication_stream] + + $master propagate-test.simple + $master propagate-test.mixed + + assert_replication_stream $repl { + {select *} + {multi} + {incr counter-1} + {incr counter-2} + {exec} + {multi} + {incr notifications} + {incr using-call} + {incr counter-1} + {incr counter-2} + {incr notifications} + {incr after-call} + {exec} + } + close_replication_stream $repl + } + + test {module propagates from EVAL} { + set repl [attach_to_replication_stream] + + assert_equal [ $master eval { \ + redis.call("propagate-test.simple"); \ + redis.call("set", "x", "y"); \ + redis.call("propagate-test.mixed"); return "OK" } 0 ] {OK} + + assert_replication_stream $repl { + {select *} + {multi} + {incr counter-1} + {incr counter-2} + {incr notifications} + {set x y} + {incr notifications} + {incr using-call} + {incr counter-1} + {incr counter-2} + {incr notifications} + {incr after-call} + {exec} + } + close_replication_stream $repl + } + + test {module propagates from command after good EVAL} { + set repl [attach_to_replication_stream] + + assert_equal [ $master eval { return "hello" } 0 ] {hello} + $master propagate-test.simple + $master propagate-test.mixed + + assert_replication_stream $repl { + {select *} + {multi} + {incr counter-1} + {incr counter-2} + {exec} + {multi} + {incr notifications} + {incr using-call} + {incr counter-1} + {incr counter-2} + {incr notifications} + {incr after-call} + {exec} + } + close_replication_stream $repl + } + + test {module propagates from command after bad EVAL} { + set repl [attach_to_replication_stream] + + catch { $master eval { return "hello" } -12 } e + assert_equal $e {ERR Number of keys can't be negative} + $master propagate-test.simple + $master propagate-test.mixed + + assert_replication_stream $repl { + {select *} + {multi} + {incr counter-1} + {incr counter-2} + {exec} + {multi} + {incr notifications} + {incr using-call} + {incr counter-1} + {incr counter-2} + {incr notifications} + {incr after-call} + {exec} + } + close_replication_stream $repl + } + + test {module propagates from multi-exec} { + set repl [attach_to_replication_stream] + + $master multi + $master propagate-test.simple + $master propagate-test.mixed + $master propagate-test.timer-nested-repl + $master exec + + wait_for_condition 500 10 { + [$replica get timer-nested-end] eq "1" + } else { + fail "The two counters don't match the expected value." + } + + assert_replication_stream $repl { + {select *} + {multi} + {incr counter-1} + {incr counter-2} + {incr notifications} + {incr using-call} + {incr counter-1} + {incr counter-2} + {incr notifications} + {incr after-call} + {exec} + {multi} + {incrby timer-nested-start 1} + {incr notifications} + {incr using-call} + {incr counter-1} + {incr counter-2} + {incr counter-3} + {incr counter-4} + {incr notifications} + {incr after-call} + {incr notifications} + {incr before-call-2} + {incr notifications} + {incr asdf} + {incr notifications} + {del asdf} + {incr notifications} + {incr after-call-2} + {incr notifications} + {incr timer-nested-middle} + {incrby timer-nested-end 1} + {exec} + } + close_replication_stream $repl + + # Note propagate-test.timer-nested just propagates INCRBY, causing an + # inconsistency, so we flush + $master flushall + } + + test {module RM_Call of expired key propagation} { + $master debug set-active-expire 0 + + $master set k1 900 px 100 + after 110 + + set repl [attach_to_replication_stream] + $master propagate-test.incr k1 + + assert_replication_stream $repl { + {select *} + {multi} + {del k1} + {propagate-test.incr k1} + {exec} + } + close_replication_stream $repl + + assert_equal [$master get k1] 1 + assert_equal [$master ttl k1] -1 + assert_equal [$replica get k1] 1 + assert_equal [$replica ttl k1] -1 + } + + test "Unload the module - propagate-test/testkeyspace" { + assert_equal {OK} [r module unload propagate-test] + assert_equal {OK} [r module unload testkeyspace] + } + + assert_equal [s -1 unexpected_error_replies] 0 + } + } + } +} + +tags "modules aof" { + test {Modules RM_Replicate replicates MULTI/EXEC correctly} { + start_server [list overrides [list loadmodule "$testmodule"]] { + # Enable the AOF + r config set appendonly yes + r config set auto-aof-rewrite-percentage 0 ; # Disable auto-rewrite. + waitForBgrewriteaof r + + r propagate-test.simple + r propagate-test.mixed + r multi + r propagate-test.simple + r propagate-test.mixed + r exec + + # Load the AOF + r debug loadaof + + assert_equal {OK} [r module unload propagate-test] + assert_equal [s 0 unexpected_error_replies] 0 + } + } +} diff --git a/tests/unit/moduleapi/publish.tcl b/tests/unit/moduleapi/publish.tcl new file mode 100644 index 0000000..ccc966a --- /dev/null +++ b/tests/unit/moduleapi/publish.tcl @@ -0,0 +1,17 @@ +set testmodule [file normalize tests/modules/publish.so] + +start_server {tags {"modules"}} { + r module load $testmodule + + test {PUBLISH and SPUBLISH via a module} { + set rd1 [redis_deferring_client] + set rd2 [redis_deferring_client] + + assert_equal {1} [ssubscribe $rd1 {chan1}] + assert_equal {1} [subscribe $rd2 {chan1}] + assert_equal 1 [r publish.shard chan1 hello] + assert_equal 1 [r publish.classic chan1 world] + assert_equal {smessage chan1 hello} [$rd1 read] + assert_equal {message chan1 world} [$rd2 read] + } +} diff --git a/tests/unit/moduleapi/reply.tcl b/tests/unit/moduleapi/reply.tcl new file mode 100644 index 0000000..7fe8c86 --- /dev/null +++ b/tests/unit/moduleapi/reply.tcl @@ -0,0 +1,101 @@ +set testmodule [file normalize tests/modules/reply.so] + +start_server {tags {"modules"}} { + r module load $testmodule + + # test all with hello 2/3 + for {set proto 2} {$proto <= 3} {incr proto} { + r hello $proto + + test "RESP$proto: RM_ReplyWithString: an string reply" { + # RedisString + set string [r rw.string "Redis"] + assert_equal "Redis" $string + # C string + set string [r rw.cstring] + assert_equal "A simple string" $string + } + + test "RESP$proto: RM_ReplyWithBigNumber: an string reply" { + assert_equal "123456778901234567890" [r rw.bignumber "123456778901234567890"] + } + + test "RESP$proto: RM_ReplyWithInt: an integer reply" { + assert_equal 42 [r rw.int 42] + } + + test "RESP$proto: RM_ReplyWithDouble: a float reply" { + assert_equal 3.141 [r rw.double 3.141] + } + + set ld 0.00000000000000001 + test "RESP$proto: RM_ReplyWithLongDouble: a float reply" { + if {$proto == 2} { + # here the response gets to TCL as a string + assert_equal $ld [r rw.longdouble $ld] + } else { + # TCL doesn't support long double and the test infra converts it to a + # normal double which causes precision loss. so we use readraw instead + r readraw 1 + assert_equal ",$ld" [r rw.longdouble $ld] + r readraw 0 + } + } + + test "RESP$proto: RM_ReplyWithVerbatimString: a string reply" { + assert_equal "bla\nbla\nbla" [r rw.verbatim "bla\nbla\nbla"] + } + + test "RESP$proto: RM_ReplyWithArray: an array reply" { + assert_equal {0 1 2 3 4} [r rw.array 5] + } + + test "RESP$proto: RM_ReplyWithMap: an map reply" { + set res [r rw.map 3] + if {$proto == 2} { + assert_equal {0 0 1 1.5 2 3} $res + } else { + assert_equal [dict create 0 0.0 1 1.5 2 3.0] $res + } + } + + test "RESP$proto: RM_ReplyWithSet: an set reply" { + assert_equal {0 1 2} [r rw.set 3] + } + + test "RESP$proto: RM_ReplyWithAttribute: an set reply" { + if {$proto == 2} { + catch {[r rw.attribute 3]} e + assert_match "Attributes aren't supported by RESP 2" $e + } else { + r readraw 1 + set res [r rw.attribute 3] + assert_equal [r read] {:0} + assert_equal [r read] {,0} + assert_equal [r read] {:1} + assert_equal [r read] {,1.5} + assert_equal [r read] {:2} + assert_equal [r read] {,3} + assert_equal [r read] {+OK} + r readraw 0 + } + } + + test "RESP$proto: RM_ReplyWithBool: a boolean reply" { + assert_equal {0 1} [r rw.bool] + } + + test "RESP$proto: RM_ReplyWithNull: a NULL reply" { + assert_equal {} [r rw.null] + } + + test "RESP$proto: RM_ReplyWithError: an error reply" { + catch {r rw.error} e + assert_match "An error" $e + } + } + + test "Unload the module - replywith" { + assert_equal {OK} [r module unload replywith] + } +} diff --git a/tests/unit/moduleapi/scan.tcl b/tests/unit/moduleapi/scan.tcl new file mode 100644 index 0000000..66faf5e --- /dev/null +++ b/tests/unit/moduleapi/scan.tcl @@ -0,0 +1,56 @@ +set testmodule [file normalize tests/modules/scan.so] + +start_server {tags {"modules"}} { + r module load $testmodule + + test {Module scan keyspace} { + # the module create a scan command with filtering which also return values + r set x 1 + r set y 2 + r set z 3 + r hset h f v + lsort [r scan.scan_strings] + } {{x 1} {y 2} {z 3}} + + test {Module scan hash ziplist} { + r hmset hh f1 v1 f2 v2 + lsort [r scan.scan_key hh] + } {{f1 v1} {f2 v2}} + + test {Module scan hash dict with int value} { + r hmset hh1 f1 1 + lsort [r scan.scan_key hh1] + } {{f1 1}} + + test {Module scan hash dict} { + r config set hash-max-ziplist-entries 2 + r hmset hh f3 v3 + lsort [r scan.scan_key hh] + } {{f1 v1} {f2 v2} {f3 v3}} + + test {Module scan zset ziplist} { + r zadd zz 1 f1 2 f2 + lsort [r scan.scan_key zz] + } {{f1 1} {f2 2}} + + test {Module scan zset dict} { + r config set zset-max-ziplist-entries 2 + r zadd zz 3 f3 + lsort [r scan.scan_key zz] + } {{f1 1} {f2 2} {f3 3}} + + test {Module scan set intset} { + r sadd ss 1 2 + lsort [r scan.scan_key ss] + } {{1 {}} {2 {}}} + + test {Module scan set dict} { + r config set set-max-intset-entries 2 + r sadd ss 3 + lsort [r scan.scan_key ss] + } {{1 {}} {2 {}} {3 {}}} + + test "Unload the module - scan" { + assert_equal {OK} [r module unload scan] + } +} diff --git a/tests/unit/moduleapi/stream.tcl b/tests/unit/moduleapi/stream.tcl new file mode 100644 index 0000000..80c24ff --- /dev/null +++ b/tests/unit/moduleapi/stream.tcl @@ -0,0 +1,159 @@ +set testmodule [file normalize tests/modules/stream.so] + +start_server {tags {"modules"}} { + r module load $testmodule + + test {Module stream add and delete} { + r del mystream + # add to empty key + set streamid1 [r stream.add mystream item 1 value a] + # add to existing stream + set streamid2 [r stream.add mystream item 2 value b] + # check result + assert { [string match "*-*" $streamid1] } + set items [r XRANGE mystream - +] + assert_equal $items \ + "{$streamid1 {item 1 value a}} {$streamid2 {item 2 value b}}" + # delete one of them and try deleting non-existing ID + assert_equal OK [r stream.delete mystream $streamid1] + assert_error "ERR StreamDelete*" {r stream.delete mystream 123-456} + assert_error "Invalid stream ID*" {r stream.delete mystream foo} + assert_equal "{$streamid2 {item 2 value b}}" [r XRANGE mystream - +] + # check error condition: wrong type + r del mystream + r set mystream mystring + assert_error "ERR StreamAdd*" {r stream.add mystream item 1 value a} + assert_error "ERR StreamDelete*" {r stream.delete mystream 123-456} + } + + test {Module stream add unblocks blocking xread} { + r del mystream + + # Blocking XREAD on an empty key + set rd1 [redis_deferring_client] + $rd1 XREAD BLOCK 3000 STREAMS mystream $ + # wait until client is actually blocked + wait_for_condition 50 100 { + [s 0 blocked_clients] eq {1} + } else { + fail "Client is not blocked" + } + set id [r stream.add mystream field 1 value a] + assert_equal "{mystream {{$id {field 1 value a}}}}" [$rd1 read] + + # Blocking XREAD on an existing stream + set rd2 [redis_deferring_client] + $rd2 XREAD BLOCK 3000 STREAMS mystream $ + # wait until client is actually blocked + wait_for_condition 50 100 { + [s 0 blocked_clients] eq {1} + } else { + fail "Client is not blocked" + } + set id [r stream.add mystream field 2 value b] + assert_equal "{mystream {{$id {field 2 value b}}}}" [$rd2 read] + } + + test {Module stream add benchmark (1M stream add)} { + set n 1000000 + r del mystream + set result [r stream.addn mystream $n field value] + assert_equal $result $n + } + + test {Module stream iterator} { + r del mystream + set streamid1 [r xadd mystream * item 1 value a] + set streamid2 [r xadd mystream * item 2 value b] + # range result + set result1 [r stream.range mystream "-" "+"] + set expect1 [r xrange mystream "-" "+"] + assert_equal $result1 $expect1 + # reverse range + set result_rev [r stream.range mystream "+" "-"] + set expect_rev [r xrevrange mystream "+" "-"] + assert_equal $result_rev $expect_rev + + # only one item: range with startid = endid + set result2 [r stream.range mystream "-" $streamid1] + assert_equal $result2 "{$streamid1 {item 1 value a}}" + assert_equal $result2 [list [list $streamid1 {item 1 value a}]] + # only one item: range with startid = endid + set result3 [r stream.range mystream $streamid2 $streamid2] + assert_equal $result3 "{$streamid2 {item 2 value b}}" + assert_equal $result3 [list [list $streamid2 {item 2 value b}]] + } + + test {Module stream iterator delete} { + r del mystream + set id1 [r xadd mystream * normal item] + set id2 [r xadd mystream * selfdestruct yes] + set id3 [r xadd mystream * another item] + # stream.range deletes the "selfdestruct" item after returning it + assert_equal \ + "{$id1 {normal item}} {$id2 {selfdestruct yes}} {$id3 {another item}}" \ + [r stream.range mystream - +] + # now, the "selfdestruct" item is gone + assert_equal \ + "{$id1 {normal item}} {$id3 {another item}}" \ + [r stream.range mystream - +] + } + + test {Module stream trim by length} { + r del mystream + # exact maxlen + r xadd mystream * item 1 value a + r xadd mystream * item 2 value b + r xadd mystream * item 3 value c + assert_equal 3 [r xlen mystream] + assert_equal 0 [r stream.trim mystream maxlen = 5] + assert_equal 3 [r xlen mystream] + assert_equal 2 [r stream.trim mystream maxlen = 1] + assert_equal 1 [r xlen mystream] + assert_equal 1 [r stream.trim mystream maxlen = 0] + # check that there is no limit for exact maxlen + r stream.addn mystream 20000 item x value y + assert_equal 20000 [r stream.trim mystream maxlen = 0] + # approx maxlen (100 items per node implies default limit 10K items) + r stream.addn mystream 20000 item x value y + assert_equal 20000 [r xlen mystream] + assert_equal 10000 [r stream.trim mystream maxlen ~ 2] + assert_equal 9900 [r stream.trim mystream maxlen ~ 2] + assert_equal 0 [r stream.trim mystream maxlen ~ 2] + assert_equal 100 [r xlen mystream] + assert_equal 100 [r stream.trim mystream maxlen ~ 0] + assert_equal 0 [r xlen mystream] + } + + test {Module stream trim by ID} { + r del mystream + # exact minid + r xadd mystream * item 1 value a + r xadd mystream * item 2 value b + set minid [r xadd mystream * item 3 value c] + assert_equal 3 [r xlen mystream] + assert_equal 0 [r stream.trim mystream minid = -] + assert_equal 3 [r xlen mystream] + assert_equal 2 [r stream.trim mystream minid = $minid] + assert_equal 1 [r xlen mystream] + assert_equal 1 [r stream.trim mystream minid = +] + # check that there is no limit for exact minid + r stream.addn mystream 20000 item x value y + assert_equal 20000 [r stream.trim mystream minid = +] + # approx minid (100 items per node implies default limit 10K items) + r stream.addn mystream 19980 item x value y + set minid [r xadd mystream * item x value y] + r stream.addn mystream 19 item x value y + assert_equal 20000 [r xlen mystream] + assert_equal 10000 [r stream.trim mystream minid ~ $minid] + assert_equal 9900 [r stream.trim mystream minid ~ $minid] + assert_equal 0 [r stream.trim mystream minid ~ $minid] + assert_equal 100 [r xlen mystream] + assert_equal 100 [r stream.trim mystream minid ~ +] + assert_equal 0 [r xlen mystream] + } + + test "Unload the module - stream" { + assert_equal {OK} [r module unload stream] + } +} diff --git a/tests/unit/moduleapi/subcommands.tcl b/tests/unit/moduleapi/subcommands.tcl new file mode 100644 index 0000000..62de593 --- /dev/null +++ b/tests/unit/moduleapi/subcommands.tcl @@ -0,0 +1,57 @@ +set testmodule [file normalize tests/modules/subcommands.so] + +start_server {tags {"modules"}} { + r module load $testmodule + + test "Module subcommands via COMMAND" { + # Verify that module subcommands are displayed correctly in COMMAND + set command_reply [r command info subcommands.bitarray] + set first_cmd [lindex $command_reply 0] + set subcmds_in_command [lsort [lindex $first_cmd 9]] + assert_equal [lindex $subcmds_in_command 0] {subcommands.bitarray|get -2 module 1 1 1 {} {} {{flags {RO access} begin_search {type index spec {index 1}} find_keys {type range spec {lastkey 0 keystep 1 limit 0}}}} {}} + assert_equal [lindex $subcmds_in_command 1] {subcommands.bitarray|set -2 module 1 1 1 {} {} {{flags {RW update} begin_search {type index spec {index 1}} find_keys {type range spec {lastkey 0 keystep 1 limit 0}}}} {}} + + # Verify that module subcommands are displayed correctly in COMMAND DOCS + set docs_reply [r command docs subcommands.bitarray] + set docs [dict create {*}[lindex $docs_reply 1]] + set subcmds_in_cmd_docs [dict create {*}[dict get $docs subcommands]] + assert_equal [dict get $subcmds_in_cmd_docs "subcommands.bitarray|get"] {group module module subcommands} + assert_equal [dict get $subcmds_in_cmd_docs "subcommands.bitarray|set"] {group module module subcommands} + } + + test "Module pure-container command fails on arity error" { + catch {r subcommands.bitarray} e + assert_match {*wrong number of arguments for 'subcommands.bitarray' command} $e + + # Subcommands can be called + assert_equal [r subcommands.bitarray get k1] {OK} + + # Subcommand arity error + catch {r subcommands.bitarray get k1 8 90} e + assert_match {*wrong number of arguments for 'subcommands.bitarray|get' command} $e + } + + test "Module get current command fullname" { + assert_equal [r subcommands.parent_get_fullname] {subcommands.parent_get_fullname} + } + + test "Module get current subcommand fullname" { + assert_equal [r subcommands.sub get_fullname] {subcommands.sub|get_fullname} + } + + test "COMMAND LIST FILTERBY MODULE" { + assert_equal {} [r command list filterby module non_existing] + + set commands [r command list filterby module subcommands] + assert_not_equal [lsearch $commands "subcommands.bitarray"] -1 + assert_not_equal [lsearch $commands "subcommands.bitarray|set"] -1 + assert_not_equal [lsearch $commands "subcommands.parent_get_fullname"] -1 + assert_not_equal [lsearch $commands "subcommands.sub|get_fullname"] -1 + + assert_equal [lsearch $commands "set"] -1 + } + + test "Unload the module - subcommands" { + assert_equal {OK} [r module unload subcommands] + } +} diff --git a/tests/unit/moduleapi/test_lazyfree.tcl b/tests/unit/moduleapi/test_lazyfree.tcl new file mode 100644 index 0000000..8d2c55a --- /dev/null +++ b/tests/unit/moduleapi/test_lazyfree.tcl @@ -0,0 +1,32 @@ +set testmodule [file normalize tests/modules/test_lazyfree.so] + +start_server {tags {"modules"}} { + r module load $testmodule + + test "modules allocated memory can be reclaimed in the background" { + set orig_mem [s used_memory] + set rd [redis_deferring_client] + + # LAZYFREE_THRESHOLD is 64 + for {set i 0} {$i < 10000} {incr i} { + $rd lazyfreelink.insert lazykey $i + } + + for {set j 0} {$j < 10000} {incr j} { + $rd read + } + + assert {[r lazyfreelink.len lazykey] == 10000} + + set peak_mem [s used_memory] + assert {[r unlink lazykey] == 1} + assert {$peak_mem > $orig_mem+10000} + wait_for_condition 50 100 { + [s used_memory] < $peak_mem && + [s used_memory] < $orig_mem*2 && + [string match {*lazyfreed_objects:1*} [r info Memory]] + } else { + fail "Module memory is not reclaimed by UNLINK" + } + } +} diff --git a/tests/unit/moduleapi/testrdb.tcl b/tests/unit/moduleapi/testrdb.tcl new file mode 100644 index 0000000..a01bcb3 --- /dev/null +++ b/tests/unit/moduleapi/testrdb.tcl @@ -0,0 +1,259 @@ +set testmodule [file normalize tests/modules/testrdb.so] + +tags "modules" { + test {modules are able to persist types} { + start_server [list overrides [list loadmodule "$testmodule"]] { + r testrdb.set.key key1 value1 + assert_equal "value1" [r testrdb.get.key key1] + r debug reload + assert_equal "value1" [r testrdb.get.key key1] + } + } + + test {modules global are lost without aux} { + set server_path [tmpdir "server.module-testrdb"] + start_server [list overrides [list loadmodule "$testmodule" "dir" $server_path] keep_persistence true] { + r testrdb.set.before global1 + assert_equal "global1" [r testrdb.get.before] + } + start_server [list overrides [list loadmodule "$testmodule" "dir" $server_path]] { + assert_equal "" [r testrdb.get.before] + } + } + + test {modules are able to persist globals before and after} { + set server_path [tmpdir "server.module-testrdb"] + start_server [list overrides [list loadmodule "$testmodule 2" "dir" $server_path] keep_persistence true] { + r testrdb.set.before global1 + r testrdb.set.after global2 + assert_equal "global1" [r testrdb.get.before] + assert_equal "global2" [r testrdb.get.after] + } + start_server [list overrides [list loadmodule "$testmodule 2" "dir" $server_path]] { + assert_equal "global1" [r testrdb.get.before] + assert_equal "global2" [r testrdb.get.after] + } + + } + + test {modules are able to persist globals just after} { + set server_path [tmpdir "server.module-testrdb"] + start_server [list overrides [list loadmodule "$testmodule 1" "dir" $server_path] keep_persistence true] { + r testrdb.set.after global2 + assert_equal "global2" [r testrdb.get.after] + } + start_server [list overrides [list loadmodule "$testmodule 1" "dir" $server_path]] { + assert_equal "global2" [r testrdb.get.after] + } + } + + test {Verify module options info} { + start_server [list overrides [list loadmodule "$testmodule"]] { + assert_match "*\[handle-io-errors|handle-repl-async-load\]*" [r info modules] + } + } + + tags {repl} { + test {diskless loading short read with module} { + start_server [list overrides [list loadmodule "$testmodule"]] { + set replica [srv 0 client] + set replica_host [srv 0 host] + set replica_port [srv 0 port] + start_server [list overrides [list loadmodule "$testmodule"]] { + set master [srv 0 client] + set master_host [srv 0 host] + set master_port [srv 0 port] + + # Set master and replica to use diskless replication + $master config set repl-diskless-sync yes + $master config set rdbcompression no + $replica config set repl-diskless-load swapdb + $master config set hz 500 + $replica config set hz 500 + $master config set dynamic-hz no + $replica config set dynamic-hz no + set start [clock clicks -milliseconds] + for {set k 0} {$k < 30} {incr k} { + r testrdb.set.key key$k [string repeat A [expr {int(rand()*1000000)}]] + } + + if {$::verbose} { + set end [clock clicks -milliseconds] + set duration [expr $end - $start] + puts "filling took $duration ms (TODO: use pipeline)" + set start [clock clicks -milliseconds] + } + + # Start the replication process... + set loglines [count_log_lines -1] + $master config set repl-diskless-sync-delay 0 + $replica replicaof $master_host $master_port + + # kill the replication at various points + set attempts 100 + if {$::accurate} { set attempts 500 } + for {set i 0} {$i < $attempts} {incr i} { + # wait for the replica to start reading the rdb + # using the log file since the replica only responds to INFO once in 2mb + set res [wait_for_log_messages -1 {"*Loading DB in memory*"} $loglines 2000 1] + set loglines [lindex $res 1] + + # add some additional random sleep so that we kill the master on a different place each time + after [expr {int(rand()*50)}] + + # kill the replica connection on the master + set killed [$master client kill type replica] + + set res [wait_for_log_messages -1 {"*Internal error in RDB*" "*Finished with success*" "*Successful partial resynchronization*"} $loglines 500 10] + if {$::verbose} { puts $res } + set log_text [lindex $res 0] + set loglines [lindex $res 1] + if {![string match "*Internal error in RDB*" $log_text]} { + # force the replica to try another full sync + $master multi + $master client kill type replica + $master set asdf asdf + # fill replication backlog with new content + $master config set repl-backlog-size 16384 + for {set keyid 0} {$keyid < 10} {incr keyid} { + $master set "$keyid string_$keyid" [string repeat A 16384] + } + $master exec + } + + # wait for loading to stop (fail) + # After a loading successfully, next loop will enter `async_loading` + wait_for_condition 1000 1 { + [s -1 async_loading] eq 0 && + [s -1 loading] eq 0 + } else { + fail "Replica didn't disconnect" + } + } + if {$::verbose} { + set end [clock clicks -milliseconds] + set duration [expr $end - $start] + puts "test took $duration ms" + } + # enable fast shutdown + $master config set rdb-key-save-delay 0 + } + } + } + + # Module events for diskless load swapdb when async_loading (matching master replid) + foreach testType {Successful Aborted} { + start_server [list overrides [list loadmodule "$testmodule 2"] tags [list external:skip]] { + set replica [srv 0 client] + set replica_host [srv 0 host] + set replica_port [srv 0 port] + set replica_log [srv 0 stdout] + start_server [list overrides [list loadmodule "$testmodule 2"]] { + set master [srv 0 client] + set master_host [srv 0 host] + set master_port [srv 0 port] + + set start [clock clicks -milliseconds] + + # Set master and replica to use diskless replication on swapdb mode + $master config set repl-diskless-sync yes + $master config set repl-diskless-sync-delay 0 + $master config set save "" + $replica config set repl-diskless-load swapdb + $replica config set save "" + + # Initial sync to have matching replids between master and replica + $replica replicaof $master_host $master_port + + # Let replica finish initial sync with master + wait_for_condition 100 100 { + [s -1 master_link_status] eq "up" + } else { + fail "Master <-> Replica didn't finish sync" + } + + # Set global values on module so we can check if module event callbacks will pick it up correctly + $master testrdb.set.before value1_master + $replica testrdb.set.before value1_replica + + # Put different data sets on the master and replica + # We need to put large keys on the master since the replica replies to info only once in 2mb + $replica debug populate 200 slave 10 + $master debug populate 1000 master 100000 + $master config set rdbcompression no + + # Force the replica to try another full sync (this time it will have matching master replid) + $master multi + $master client kill type replica + # Fill replication backlog with new content + $master config set repl-backlog-size 16384 + for {set keyid 0} {$keyid < 10} {incr keyid} { + $master set "$keyid string_$keyid" [string repeat A 16384] + } + $master exec + + switch $testType { + "Aborted" { + # Set master with a slow rdb generation, so that we can easily intercept loading + # 10ms per key, with 1000 keys is 10 seconds + $master config set rdb-key-save-delay 10000 + + test {Diskless load swapdb RedisModuleEvent_ReplAsyncLoad handling: during loading, can keep module variable same as before} { + # Wait for the replica to start reading the rdb and module for acknowledgement + # We wanna abort only after the temp db was populated by REDISMODULE_AUX_BEFORE_RDB + wait_for_condition 100 100 { + [s -1 async_loading] eq 1 && [$replica testrdb.async_loading.get.before] eq "value1_master" + } else { + fail "Module didn't receive or react to REDISMODULE_SUBEVENT_REPL_ASYNC_LOAD_STARTED" + } + + assert_equal [$replica dbsize] 200 + assert_equal value1_replica [$replica testrdb.get.before] + } + + # Make sure that next sync will not start immediately so that we can catch the replica in between syncs + $master config set repl-diskless-sync-delay 5 + + # Kill the replica connection on the master + set killed [$master client kill type replica] + + test {Diskless load swapdb RedisModuleEvent_ReplAsyncLoad handling: when loading aborted, can keep module variable same as before} { + # Wait for loading to stop (fail) and module for acknowledgement + wait_for_condition 100 100 { + [s -1 async_loading] eq 0 && [$replica testrdb.async_loading.get.before] eq "" + } else { + fail "Module didn't receive or react to REDISMODULE_SUBEVENT_REPL_ASYNC_LOAD_ABORTED" + } + + assert_equal [$replica dbsize] 200 + assert_equal value1_replica [$replica testrdb.get.before] + } + + # Speed up shutdown + $master config set rdb-key-save-delay 0 + } + "Successful" { + # Let replica finish sync with master + wait_for_condition 100 100 { + [s -1 master_link_status] eq "up" + } else { + fail "Master <-> Replica didn't finish sync" + } + + test {Diskless load swapdb RedisModuleEvent_ReplAsyncLoad handling: after db loaded, can set module variable with new value} { + assert_equal [$replica dbsize] 1010 + assert_equal value1_master [$replica testrdb.get.before] + } + } + } + + if {$::verbose} { + set end [clock clicks -milliseconds] + set duration [expr $end - $start] + puts "test took $duration ms" + } + } + } + } + } +} diff --git a/tests/unit/moduleapi/timer.tcl b/tests/unit/moduleapi/timer.tcl new file mode 100644 index 0000000..4e9dd0f --- /dev/null +++ b/tests/unit/moduleapi/timer.tcl @@ -0,0 +1,99 @@ +set testmodule [file normalize tests/modules/timer.so] + +start_server {tags {"modules"}} { + r module load $testmodule + + test {RM_CreateTimer: a sequence of timers work} { + # We can't guarantee same-ms but we try using MULTI/EXEC + r multi + for {set i 0} {$i < 20} {incr i} { + r test.createtimer 10 timer-incr-key + } + r exec + + after 500 + assert_equal 20 [r get timer-incr-key] + } + + test {RM_GetTimer: basic sanity} { + # Getting non-existing timer + assert_equal {} [r test.gettimer 0] + + # Getting a real timer + set id [r test.createtimer 10000 timer-incr-key] + set info [r test.gettimer $id] + + assert_equal "timer-incr-key" [lindex $info 0] + set remaining [lindex $info 1] + assert {$remaining < 10000 && $remaining > 1} + # Stop the timer after get timer test + assert_equal 1 [r test.stoptimer $id] + } + + test {RM_StopTimer: basic sanity} { + r set "timer-incr-key" 0 + set id [r test.createtimer 1000 timer-incr-key] + + assert_equal 1 [r test.stoptimer $id] + + # Wait to be sure timer doesn't execute + after 2000 + assert_equal 0 [r get timer-incr-key] + + # Stop non-existing timer + assert_equal 0 [r test.stoptimer $id] + } + + test {Timer appears non-existing after it fires} { + r set "timer-incr-key" 0 + set id [r test.createtimer 10 timer-incr-key] + + # verify timer fired + after 500 + assert_equal 1 [r get timer-incr-key] + + # verify id does not exist + assert_equal {} [r test.gettimer $id] + } + + test "Module can be unloaded when timer was finished" { + r set "timer-incr-key" 0 + r test.createtimer 500 timer-incr-key + + # Make sure the Timer has not been fired + assert_equal 0 [r get timer-incr-key] + # Module can not be unloaded since the timer was ongoing + catch {r module unload timer} err + assert_match {*the module holds timer that is not fired*} $err + + # Wait to be sure timer has been finished + wait_for_condition 10 500 { + [r get timer-incr-key] == 1 + } else { + fail "Timer not fired" + } + + # Timer fired, can be unloaded now. + assert_equal {OK} [r module unload timer] + } + + test "Module can be unloaded when timer was stopped" { + r module load $testmodule + r set "timer-incr-key" 0 + set id [r test.createtimer 5000 timer-incr-key] + + # Module can not be unloaded since the timer was ongoing + catch {r module unload timer} err + assert_match {*the module holds timer that is not fired*} $err + + # Stop the timer + assert_equal 1 [r test.stoptimer $id] + + # Make sure the Timer has not been fired + assert_equal 0 [r get timer-incr-key] + + # Timer has stopped, can be unloaded now. + assert_equal {OK} [r module unload timer] + } +} + diff --git a/tests/unit/moduleapi/usercall.tcl b/tests/unit/moduleapi/usercall.tcl new file mode 100644 index 0000000..ed82a38 --- /dev/null +++ b/tests/unit/moduleapi/usercall.tcl @@ -0,0 +1,95 @@ +set testmodule [file normalize tests/modules/usercall.so] + +set test_script_set "#!lua +redis.call('set','x',1) +return 1" + +set test_script_get "#!lua +redis.call('get','x') +return 1" + +start_server {tags {"modules usercall"}} { + r module load $testmodule + + # baseline test that module isn't doing anything weird + test {test module check regular redis command without user/acl} { + assert_equal [r usercall.reset_user] OK + assert_equal [r usercall.add_to_acl "~* &* +@all -set"] OK + assert_equal [r usercall.call_without_user set x 5] OK + assert_equal [r usercall.reset_user] OK + } + + # call with user with acl set on it, but without testing the acl + test {test module check regular redis command with user} { + assert_equal [r set x 5] OK + + assert_equal [r usercall.reset_user] OK + assert_equal [r usercall.add_to_acl "~* &* +@all -set"] OK + # off and sanitize-payload because module user / default value + assert_equal [r usercall.get_acl] "off ~* &* +@all -set" + + # doesn't fail for regular commands as just testing acl here + assert_equal [r usercall.call_with_user_flag {} set x 10] OK + + assert_equal [r get x] 10 + assert_equal [r usercall.reset_user] OK + } + + # call with user with acl set on it, but with testing the acl in rm_call (for cmd itself) + test {test module check regular redis command with user and acl} { + assert_equal [r set x 5] OK + + assert_equal [r usercall.reset_user] OK + assert_equal [r usercall.add_to_acl "~* &* +@all -set"] OK + # off and sanitize-payload because module user / default value + assert_equal [r usercall.get_acl] "off ~* &* +@all -set" + + # fails here as testing acl in rm call + catch {r usercall.call_with_user_flag C set x 10} e + assert_match {*ERR acl verification failed*} $e + + assert_equal [r usercall.call_with_user_flag C get x] 5 + + assert_equal [r usercall.reset_user] OK + } + + # baseline script test, call without user on script + test {test module check eval script without user} { + set sha_set [r script load $test_script_set] + set sha_get [r script load $test_script_get] + + assert_equal [r usercall.call_without_user evalsha $sha_set 0] 1 + assert_equal [r usercall.call_without_user evalsha $sha_get 0] 1 + } + + # baseline script test, call without user on script + test {test module check eval script with user being set, but not acl testing} { + set sha_set [r script load $test_script_set] + set sha_get [r script load $test_script_get] + + assert_equal [r usercall.reset_user] OK + assert_equal [r usercall.add_to_acl "~* &* +@all -set"] OK + # off and sanitize-payload because module user / default value + assert_equal [r usercall.get_acl] "off ~* &* +@all -set" + + # passes as not checking ACL + assert_equal [r usercall.call_with_user_flag {} evalsha $sha_set 0] 1 + assert_equal [r usercall.call_with_user_flag {} evalsha $sha_get 0] 1 + } + + # call with user on script (without rm_call acl check) to ensure user carries through to script execution + # we already tested the check in rm_call above, here we are checking the script itself will enforce ACL + test {test module check eval script with user and acl} { + set sha_set [r script load $test_script_set] + set sha_get [r script load $test_script_get] + + assert_equal [r usercall.reset_user] OK + assert_equal [r usercall.add_to_acl "~* &* +@all -set"] OK + + # fails here in script, as rm_call will permit the eval call + catch {r usercall.call_with_user_flag C evalsha $sha_set 0} e + assert_match {*ERR The user executing the script can't run this command or subcommand script*} $e + + assert_equal [r usercall.call_with_user_flag C evalsha $sha_get 0] 1 + } +}
\ No newline at end of file diff --git a/tests/unit/moduleapi/zset.tcl b/tests/unit/moduleapi/zset.tcl new file mode 100644 index 0000000..1c146ea --- /dev/null +++ b/tests/unit/moduleapi/zset.tcl @@ -0,0 +1,20 @@ +set testmodule [file normalize tests/modules/zset.so] + +start_server {tags {"modules"}} { + r module load $testmodule + + test {Module zset rem} { + r del k + r zadd k 100 hello 200 world + assert_equal 1 [r zset.rem k hello] + assert_equal 0 [r zset.rem k hello] + assert_equal 1 [r exists k] + # Check that removing the last element deletes the key + assert_equal 1 [r zset.rem k world] + assert_equal 0 [r exists k] + } + + test "Unload the module - zset" { + assert_equal {OK} [r module unload zset] + } +} diff --git a/tests/unit/multi.tcl b/tests/unit/multi.tcl new file mode 100644 index 0000000..d03ec9a --- /dev/null +++ b/tests/unit/multi.tcl @@ -0,0 +1,923 @@ +proc wait_for_dbsize {size} { + set r2 [redis_client] + wait_for_condition 50 100 { + [$r2 dbsize] == $size + } else { + fail "Target dbsize not reached" + } + $r2 close +} + +start_server {tags {"multi"}} { + test {MULTI / EXEC basics} { + r del mylist + r rpush mylist a + r rpush mylist b + r rpush mylist c + r multi + set v1 [r lrange mylist 0 -1] + set v2 [r ping] + set v3 [r exec] + list $v1 $v2 $v3 + } {QUEUED QUEUED {{a b c} PONG}} + + test {DISCARD} { + r del mylist + r rpush mylist a + r rpush mylist b + r rpush mylist c + r multi + set v1 [r del mylist] + set v2 [r discard] + set v3 [r lrange mylist 0 -1] + list $v1 $v2 $v3 + } {QUEUED OK {a b c}} + + test {Nested MULTI are not allowed} { + set err {} + r multi + catch {[r multi]} err + r exec + set _ $err + } {*ERR MULTI*} + + test {MULTI where commands alter argc/argv} { + r sadd myset a + r multi + r spop myset + list [r exec] [r exists myset] + } {a 0} + + test {WATCH inside MULTI is not allowed} { + set err {} + r multi + catch {[r watch x]} err + r exec + set _ $err + } {*ERR WATCH*} + + test {EXEC fails if there are errors while queueing commands #1} { + r del foo1{t} foo2{t} + r multi + r set foo1{t} bar1 + catch {r non-existing-command} + r set foo2{t} bar2 + catch {r exec} e + assert_match {EXECABORT*} $e + list [r exists foo1{t}] [r exists foo2{t}] + } {0 0} + + test {EXEC fails if there are errors while queueing commands #2} { + set rd [redis_deferring_client] + r del foo1{t} foo2{t} + r multi + r set foo1{t} bar1 + $rd config set maxmemory 1 + assert {[$rd read] eq {OK}} + catch {r lpush mylist{t} myvalue} + $rd config set maxmemory 0 + assert {[$rd read] eq {OK}} + r set foo2{t} bar2 + catch {r exec} e + assert_match {EXECABORT*} $e + $rd close + list [r exists foo1{t}] [r exists foo2{t}] + } {0 0} {needs:config-maxmemory} + + test {If EXEC aborts, the client MULTI state is cleared} { + r del foo1{t} foo2{t} + r multi + r set foo1{t} bar1 + catch {r non-existing-command} + r set foo2{t} bar2 + catch {r exec} e + assert_match {EXECABORT*} $e + r ping + } {PONG} + + test {EXEC works on WATCHed key not modified} { + r watch x{t} y{t} z{t} + r watch k{t} + r multi + r ping + r exec + } {PONG} + + test {EXEC fail on WATCHed key modified (1 key of 1 watched)} { + r set x 30 + r watch x + r set x 40 + r multi + r ping + r exec + } {} + + test {EXEC fail on WATCHed key modified (1 key of 5 watched)} { + r set x{t} 30 + r watch a{t} b{t} x{t} k{t} z{t} + r set x{t} 40 + r multi + r ping + r exec + } {} + + test {EXEC fail on WATCHed key modified by SORT with STORE even if the result is empty} { + r flushdb + r lpush foo bar + r watch foo + r sort emptylist store foo + r multi + r ping + r exec + } {} {cluster:skip} + + test {EXEC fail on lazy expired WATCHed key} { + r del key + r debug set-active-expire 0 + + for {set j 0} {$j < 10} {incr j} { + r set key 1 px 100 + r watch key + after 101 + r multi + r incr key + + set res [r exec] + if {$res eq {}} break + } + if {$::verbose} { puts "EXEC fail on lazy expired WATCHed key attempts: $j" } + + r debug set-active-expire 1 + set _ $res + } {} {needs:debug} + + test {WATCH stale keys should not fail EXEC} { + r del x + r debug set-active-expire 0 + r set x foo px 1 + after 2 + r watch x + r multi + r ping + assert_equal {PONG} [r exec] + r debug set-active-expire 1 + } {OK} {needs:debug} + + test {Delete WATCHed stale keys should not fail EXEC} { + r del x + r debug set-active-expire 0 + r set x foo px 1 + after 2 + r watch x + # EXISTS triggers lazy expiry/deletion + assert_equal 0 [r exists x] + r multi + r ping + assert_equal {PONG} [r exec] + r debug set-active-expire 1 + } {OK} {needs:debug} + + test {FLUSHDB while watching stale keys should not fail EXEC} { + r del x + r debug set-active-expire 0 + r set x foo px 1 + after 2 + r watch x + r flushdb + r multi + r ping + assert_equal {PONG} [r exec] + r debug set-active-expire 1 + } {OK} {needs:debug} + + test {After successful EXEC key is no longer watched} { + r set x 30 + r watch x + r multi + r ping + r exec + r set x 40 + r multi + r ping + r exec + } {PONG} + + test {After failed EXEC key is no longer watched} { + r set x 30 + r watch x + r set x 40 + r multi + r ping + r exec + r set x 40 + r multi + r ping + r exec + } {PONG} + + test {It is possible to UNWATCH} { + r set x 30 + r watch x + r set x 40 + r unwatch + r multi + r ping + r exec + } {PONG} + + test {UNWATCH when there is nothing watched works as expected} { + r unwatch + } {OK} + + test {FLUSHALL is able to touch the watched keys} { + r set x 30 + r watch x + r flushall + r multi + r ping + r exec + } {} + + test {FLUSHALL does not touch non affected keys} { + r del x + r watch x + r flushall + r multi + r ping + r exec + } {PONG} + + test {FLUSHDB is able to touch the watched keys} { + r set x 30 + r watch x + r flushdb + r multi + r ping + r exec + } {} + + test {FLUSHDB does not touch non affected keys} { + r del x + r watch x + r flushdb + r multi + r ping + r exec + } {PONG} + + test {SWAPDB is able to touch the watched keys that exist} { + r flushall + r select 0 + r set x 30 + r watch x ;# make sure x (set to 30) doesn't change (SWAPDB will "delete" it) + r swapdb 0 1 + r multi + r ping + r exec + } {} {singledb:skip} + + test {SWAPDB is able to touch the watched keys that do not exist} { + r flushall + r select 1 + r set x 30 + r select 0 + r watch x ;# make sure the key x (currently missing) doesn't change (SWAPDB will create it) + r swapdb 0 1 + r multi + r ping + r exec + } {} {singledb:skip} + + test {SWAPDB does not touch watched stale keys} { + r flushall + r select 1 + r debug set-active-expire 0 + r set x foo px 1 + after 2 + r watch x + r swapdb 0 1 ; # expired key replaced with no key => no change + r multi + r ping + assert_equal {PONG} [r exec] + r debug set-active-expire 1 + } {OK} {singledb:skip needs:debug} + + test {SWAPDB does not touch non-existing key replaced with stale key} { + r flushall + r select 0 + r debug set-active-expire 0 + r set x foo px 1 + after 2 + r select 1 + r watch x + r swapdb 0 1 ; # no key replaced with expired key => no change + r multi + r ping + assert_equal {PONG} [r exec] + r debug set-active-expire 1 + } {OK} {singledb:skip needs:debug} + + test {SWAPDB does not touch stale key replaced with another stale key} { + r flushall + r debug set-active-expire 0 + r select 1 + r set x foo px 1 + r select 0 + r set x bar px 1 + after 2 + r select 1 + r watch x + r swapdb 0 1 ; # no key replaced with expired key => no change + r multi + r ping + assert_equal {PONG} [r exec] + r debug set-active-expire 1 + } {OK} {singledb:skip needs:debug} + + test {WATCH is able to remember the DB a key belongs to} { + r select 5 + r set x 30 + r watch x + r select 1 + r set x 10 + r select 5 + r multi + r ping + set res [r exec] + # Restore original DB + r select 9 + set res + } {PONG} {singledb:skip} + + test {WATCH will consider touched keys target of EXPIRE} { + r del x + r set x foo + r watch x + r expire x 10 + r multi + r ping + r exec + } {} + + test {WATCH will consider touched expired keys} { + r flushall + r del x + r set x foo + r expire x 1 + r watch x + + # Wait for the keys to expire. + wait_for_dbsize 0 + + r multi + r ping + r exec + } {} + + test {DISCARD should clear the WATCH dirty flag on the client} { + r watch x + r set x 10 + r multi + r discard + r multi + r incr x + r exec + } {11} + + test {DISCARD should UNWATCH all the keys} { + r watch x + r set x 10 + r multi + r discard + r set x 10 + r multi + r incr x + r exec + } {11} + + test {MULTI / EXEC is not propagated (single write command)} { + set repl [attach_to_replication_stream] + r multi + r set foo bar + r exec + r set foo2 bar + assert_replication_stream $repl { + {select *} + {set foo bar} + {set foo2 bar} + } + close_replication_stream $repl + } {} {needs:repl} + + test {MULTI / EXEC is propagated correctly (multiple commands)} { + set repl [attach_to_replication_stream] + r multi + r set foo{t} bar + r get foo{t} + r set foo2{t} bar2 + r get foo2{t} + r set foo3{t} bar3 + r get foo3{t} + r exec + + assert_replication_stream $repl { + {select *} + {multi} + {set foo{t} bar} + {set foo2{t} bar2} + {set foo3{t} bar3} + {exec} + } + close_replication_stream $repl + } {} {needs:repl} + + test {MULTI / EXEC is propagated correctly (multiple commands with SELECT)} { + set repl [attach_to_replication_stream] + r multi + r select 1 + r set foo{t} bar + r get foo{t} + r select 2 + r set foo2{t} bar2 + r get foo2{t} + r select 3 + r set foo3{t} bar3 + r get foo3{t} + r exec + + assert_replication_stream $repl { + {select *} + {multi} + {set foo{t} bar} + {select *} + {set foo2{t} bar2} + {select *} + {set foo3{t} bar3} + {exec} + } + close_replication_stream $repl + } {} {needs:repl singledb:skip} + + test {MULTI / EXEC is propagated correctly (empty transaction)} { + set repl [attach_to_replication_stream] + r multi + r exec + r set foo bar + assert_replication_stream $repl { + {select *} + {set foo bar} + } + close_replication_stream $repl + } {} {needs:repl} + + test {MULTI / EXEC is propagated correctly (read-only commands)} { + r set foo value1 + set repl [attach_to_replication_stream] + r multi + r get foo + r exec + r set foo value2 + assert_replication_stream $repl { + {select *} + {set foo value2} + } + close_replication_stream $repl + } {} {needs:repl} + + test {MULTI / EXEC is propagated correctly (write command, no effect)} { + r del bar + r del foo + set repl [attach_to_replication_stream] + r multi + r del foo + r exec + + # add another command so that when we see it we know multi-exec wasn't + # propagated + r incr foo + + assert_replication_stream $repl { + {select *} + {incr foo} + } + close_replication_stream $repl + } {} {needs:repl} + + test {MULTI / EXEC with REPLICAOF} { + # This test verifies that if we demote a master to replica inside a transaction, the + # entire transaction is not propagated to the already-connected replica + set repl [attach_to_replication_stream] + r set foo bar + r multi + r set foo2 bar + r replicaof localhost 9999 + r set foo3 bar + r exec + catch {r set foo4 bar} e + assert_match {READONLY*} $e + assert_replication_stream $repl { + {select *} + {set foo bar} + } + r replicaof no one + } {OK} {needs:repl cluster:skip} + + test {DISCARD should not fail during OOM} { + set rd [redis_deferring_client] + $rd config set maxmemory 1 + assert {[$rd read] eq {OK}} + r multi + catch {r set x 1} e + assert_match {OOM*} $e + r discard + $rd config set maxmemory 0 + assert {[$rd read] eq {OK}} + $rd close + r ping + } {PONG} {needs:config-maxmemory} + + test {MULTI and script timeout} { + # check that if MULTI arrives during timeout, it is either refused, or + # allowed to pass, and we don't end up executing half of the transaction + set rd1 [redis_deferring_client] + set r2 [redis_client] + r config set lua-time-limit 10 + r set xx 1 + $rd1 eval {while true do end} 0 + after 200 + catch { $r2 multi; } e + catch { $r2 incr xx; } e + r script kill + after 200 ; # Give some time to Lua to call the hook again... + catch { $r2 incr xx; } e + catch { $r2 exec; } e + assert_match {EXECABORT*previous errors*} $e + set xx [r get xx] + # make sure that either the whole transcation passed or none of it (we actually expect none) + assert { $xx == 1 || $xx == 3} + # check that the connection is no longer in multi state + set pong [$r2 ping asdf] + assert_equal $pong "asdf" + $rd1 close; $r2 close + } + + test {EXEC and script timeout} { + # check that if EXEC arrives during timeout, we don't end up executing + # half of the transaction, and also that we exit the multi state + set rd1 [redis_deferring_client] + set r2 [redis_client] + r config set lua-time-limit 10 + r set xx 1 + catch { $r2 multi; } e + catch { $r2 incr xx; } e + $rd1 eval {while true do end} 0 + after 200 + catch { $r2 incr xx; } e + catch { $r2 exec; } e + assert_match {EXECABORT*BUSY*} $e + r script kill + after 200 ; # Give some time to Lua to call the hook again... + set xx [r get xx] + # make sure that either the whole transcation passed or none of it (we actually expect none) + assert { $xx == 1 || $xx == 3} + # check that the connection is no longer in multi state + set pong [$r2 ping asdf] + assert_equal $pong "asdf" + $rd1 close; $r2 close + } + + test {MULTI-EXEC body and script timeout} { + # check that we don't run an incomplete transaction due to some commands + # arriving during busy script + set rd1 [redis_deferring_client] + set r2 [redis_client] + r config set lua-time-limit 10 + r set xx 1 + catch { $r2 multi; } e + catch { $r2 incr xx; } e + $rd1 eval {while true do end} 0 + after 200 + catch { $r2 incr xx; } e + r script kill + after 200 ; # Give some time to Lua to call the hook again... + catch { $r2 exec; } e + assert_match {EXECABORT*previous errors*} $e + set xx [r get xx] + # make sure that either the whole transcation passed or none of it (we actually expect none) + assert { $xx == 1 || $xx == 3} + # check that the connection is no longer in multi state + set pong [$r2 ping asdf] + assert_equal $pong "asdf" + $rd1 close; $r2 close + } + + test {just EXEC and script timeout} { + # check that if EXEC arrives during timeout, we don't end up executing + # actual commands during busy script, and also that we exit the multi state + set rd1 [redis_deferring_client] + set r2 [redis_client] + r config set lua-time-limit 10 + r set xx 1 + catch { $r2 multi; } e + catch { $r2 incr xx; } e + $rd1 eval {while true do end} 0 + after 200 + catch { $r2 exec; } e + assert_match {EXECABORT*BUSY*} $e + r script kill + after 200 ; # Give some time to Lua to call the hook again... + set xx [r get xx] + # make we didn't execute the transaction + assert { $xx == 1} + # check that the connection is no longer in multi state + set pong [$r2 ping asdf] + assert_equal $pong "asdf" + $rd1 close; $r2 close + } + + test {exec with write commands and state change} { + # check that exec that contains write commands fails if server state changed since they were queued + set r1 [redis_client] + r set xx 1 + r multi + r incr xx + $r1 config set min-replicas-to-write 2 + catch {r exec} e + assert_match {*EXECABORT*NOREPLICAS*} $e + set xx [r get xx] + # make sure that the INCR wasn't executed + assert { $xx == 1} + $r1 config set min-replicas-to-write 0 + $r1 close + } {0} {needs:repl} + + test {exec with read commands and stale replica state change} { + # check that exec that contains read commands fails if server state changed since they were queued + r config set replica-serve-stale-data no + set r1 [redis_client] + r set xx 1 + + # check that GET and PING are disallowed on stale replica, even if the replica becomes stale only after queuing. + r multi + r get xx + $r1 replicaof localhsot 0 + catch {r exec} e + assert_match {*EXECABORT*MASTERDOWN*} $e + + # reset + $r1 replicaof no one + + r multi + r ping + $r1 replicaof localhsot 0 + catch {r exec} e + assert_match {*EXECABORT*MASTERDOWN*} $e + + # check that when replica is not stale, GET is allowed + # while we're at it, let's check that multi is allowed on stale replica too + r multi + $r1 replicaof no one + r get xx + set xx [r exec] + # make sure that the INCR was executed + assert { $xx == 1 } + $r1 close + } {0} {needs:repl cluster:skip} + + test {EXEC with only read commands should not be rejected when OOM} { + set r2 [redis_client] + + r set x value + r multi + r get x + r ping + + # enforcing OOM + $r2 config set maxmemory 1 + + # finish the multi transaction with exec + assert { [r exec] == {value PONG} } + + # releasing OOM + $r2 config set maxmemory 0 + $r2 close + } {0} {needs:config-maxmemory} + + test {EXEC with at least one use-memory command should fail} { + set r2 [redis_client] + + r multi + r set x 1 + r get x + + # enforcing OOM + $r2 config set maxmemory 1 + + # finish the multi transaction with exec + catch {r exec} e + assert_match {EXECABORT*OOM*} $e + + # releasing OOM + $r2 config set maxmemory 0 + $r2 close + } {0} {needs:config-maxmemory} + + test {Blocking commands ignores the timeout} { + r xgroup create s{t} g $ MKSTREAM + + set m [r multi] + r blpop empty_list{t} 0 + r brpop empty_list{t} 0 + r brpoplpush empty_list1{t} empty_list2{t} 0 + r blmove empty_list1{t} empty_list2{t} LEFT LEFT 0 + r bzpopmin empty_zset{t} 0 + r bzpopmax empty_zset{t} 0 + r xread BLOCK 0 STREAMS s{t} $ + r xreadgroup group g c BLOCK 0 STREAMS s{t} > + set res [r exec] + + list $m $res + } {OK {{} {} {} {} {} {} {} {}}} + + test {MULTI propagation of PUBLISH} { + set repl [attach_to_replication_stream] + + r multi + r publish bla bla + r exec + + assert_replication_stream $repl { + {select *} + {publish bla bla} + } + close_replication_stream $repl + } {} {needs:repl cluster:skip} + + test {MULTI propagation of SCRIPT LOAD} { + set repl [attach_to_replication_stream] + + # make sure that SCRIPT LOAD inside MULTI isn't propagated + r multi + r script load {redis.call('set', KEYS[1], 'foo')} + r set foo bar + set res [r exec] + set sha [lindex $res 0] + + assert_replication_stream $repl { + {select *} + {set foo bar} + } + close_replication_stream $repl + } {} {needs:repl} + + test {MULTI propagation of EVAL} { + set repl [attach_to_replication_stream] + + # make sure that EVAL inside MULTI is propagated in a transaction in effects + r multi + r eval {redis.call('set', KEYS[1], 'bar')} 1 bar + r exec + + assert_replication_stream $repl { + {select *} + {set bar bar} + } + close_replication_stream $repl + } {} {needs:repl} + + test {MULTI propagation of SCRIPT FLUSH} { + set repl [attach_to_replication_stream] + + # make sure that SCRIPT FLUSH isn't propagated + r multi + r script flush + r set foo bar + r exec + + assert_replication_stream $repl { + {select *} + {set foo bar} + } + close_replication_stream $repl + } {} {needs:repl} + + tags {"stream"} { + test {MULTI propagation of XREADGROUP} { + set repl [attach_to_replication_stream] + + r XADD mystream * foo bar + r XADD mystream * foo2 bar2 + r XADD mystream * foo3 bar3 + r XGROUP CREATE mystream mygroup 0 + + # make sure the XCALIM (propagated by XREADGROUP) is indeed inside MULTI/EXEC + r multi + r XREADGROUP GROUP mygroup consumer1 COUNT 2 STREAMS mystream ">" + r XREADGROUP GROUP mygroup consumer1 STREAMS mystream ">" + r exec + + assert_replication_stream $repl { + {select *} + {xadd *} + {xadd *} + {xadd *} + {xgroup CREATE *} + {multi} + {xclaim *} + {xclaim *} + {xclaim *} + {exec} + } + close_replication_stream $repl + } {} {needs:repl} + } + + foreach {cmd} {SAVE SHUTDOWN} { + test "MULTI with $cmd" { + r del foo + r multi + r set foo bar + catch {r $cmd} e1 + catch {r exec} e2 + assert_match {*Command not allowed inside a transaction*} $e1 + assert_match {EXECABORT*} $e2 + r get foo + } {} + } + + test "MULTI with BGREWRITEAOF" { + set forks [s total_forks] + r multi + r set foo bar + r BGREWRITEAOF + set res [r exec] + assert_match "*rewriting scheduled*" [lindex $res 1] + wait_for_condition 50 100 { + [s total_forks] > $forks + } else { + fail "aofrw didn't start" + } + waitForBgrewriteaof r + } {} {external:skip} + + test "MULTI with config set appendonly" { + set lines [count_log_lines 0] + set forks [s total_forks] + r multi + r set foo bar + r config set appendonly yes + r exec + verify_log_message 0 "*AOF background was scheduled*" $lines + wait_for_condition 50 100 { + [s total_forks] > $forks + } else { + fail "aofrw didn't start" + } + waitForBgrewriteaof r + } {} {external:skip} + + test "MULTI with config error" { + r multi + r set foo bar + r config set maxmemory bla + + # letting the redis parser read it, it'll throw an exception instead of + # reply with an array that contains an error, so we switch to reading + # raw RESP instead + r readraw 1 + + set res [r exec] + assert_equal $res "*2" + set res [r read] + assert_equal $res "+OK" + set res [r read] + r readraw 1 + set _ $res + } {*CONFIG SET failed*} + + test "Flushall while watching several keys by one client" { + r flushall + r mset a a b b + r watch b a + r flushall + r ping + } +} + +start_server {overrides {appendonly {yes} appendfilename {appendonly.aof} appendfsync always} tags {external:skip}} { + test {MULTI with FLUSHALL and AOF} { + set aof [get_last_incr_aof_path r] + r multi + r set foo bar + r flushall + r exec + assert_aof_content $aof { + {select *} + {multi} + {set *} + {flushall} + {exec} + } + r get foo + } {} +} diff --git a/tests/unit/networking.tcl b/tests/unit/networking.tcl new file mode 100644 index 0000000..559a88e --- /dev/null +++ b/tests/unit/networking.tcl @@ -0,0 +1,165 @@ +source tests/support/cli.tcl + +test {CONFIG SET port number} { + start_server {} { + if {$::tls} { set port_cfg tls-port} else { set port_cfg port } + + # available port + set avail_port [find_available_port $::baseport $::portcount] + set rd [redis [srv 0 host] [srv 0 port] 0 $::tls] + $rd CONFIG SET $port_cfg $avail_port + $rd close + set rd [redis [srv 0 host] $avail_port 0 $::tls] + $rd PING + + # already inuse port + catch {$rd CONFIG SET $port_cfg $::test_server_port} e + assert_match {*Unable to listen on this port*} $e + $rd close + + # make sure server still listening on the previous port + set rd [redis [srv 0 host] $avail_port 0 $::tls] + $rd PING + $rd close + } +} {} {external:skip} + +test {CONFIG SET bind address} { + start_server {} { + # non-valid address + catch {r CONFIG SET bind "999.999.999.999"} e + assert_match {*Failed to bind to specified addresses*} $e + + # make sure server still bound to the previous address + set rd [redis [srv 0 host] [srv 0 port] 0 $::tls] + $rd PING + $rd close + } +} {} {external:skip} + +# Attempt to connect to host using a client bound to bindaddr, +# and return a non-zero value if successful within specified +# millisecond timeout, or zero otherwise. +proc test_loopback {host bindaddr timeout} { + if {[exec uname] != {Linux}} { + return 0 + } + + after $timeout set ::test_loopback_state timeout + if {[catch { + set server_sock [socket -server accept 0] + set port [lindex [fconfigure $server_sock -sockname] 2] } err]} { + return 0 + } + + proc accept {channel clientaddr clientport} { + set ::test_loopback_state "connected" + close $channel + } + + if {[catch {set client_sock [socket -async -myaddr $bindaddr $host $port]} err]} { + puts "test_loopback: Client connect failed: $err" + } else { + close $client_sock + } + + vwait ::test_loopback_state + close $server_sock + + return [expr {$::test_loopback_state == {connected}}] +} + +test {CONFIG SET bind-source-addr} { + if {[test_loopback 127.0.0.1 127.0.0.2 1000]} { + start_server {} { + start_server {} { + set replica [srv 0 client] + set master [srv -1 client] + + $master config set protected-mode no + + $replica config set bind-source-addr 127.0.0.2 + $replica replicaof [srv -1 host] [srv -1 port] + + wait_for_condition 50 100 { + [s 0 master_link_status] eq {up} + } else { + fail "Replication not started." + } + + assert_match {*ip=127.0.0.2*} [s -1 slave0] + } + } + } else { + if {$::verbose} { puts "Skipping bind-source-addr test." } + } +} {} {external:skip} + +start_server {config "minimal.conf" tags {"external:skip"}} { + test {Default bind address configuration handling} { + # Default is explicit and sane + assert_equal "* -::*" [lindex [r CONFIG GET bind] 1] + + # CONFIG REWRITE acknowledges this as a default + r CONFIG REWRITE + assert_equal 0 [count_message_lines [srv 0 config_file] bind] + + # Removing the bind address works + r CONFIG SET bind "" + assert_equal "" [lindex [r CONFIG GET bind] 1] + + # No additional clients can connect + catch {redis_client} err + assert_match {*connection refused*} $err + + # CONFIG REWRITE handles empty bindaddr + r CONFIG REWRITE + assert_equal 1 [count_message_lines [srv 0 config_file] bind] + + # Make sure we're able to restart + restart_server 0 0 0 0 + + # Make sure bind parameter is as expected and server handles binding + # accordingly. + assert_equal {bind {}} [rediscli_exec 0 config get bind] + catch {reconnect 0} err + assert_match {*connection refused*} $err + + assert_equal {OK} [rediscli_exec 0 config set bind *] + reconnect 0 + r ping + } {PONG} + + test {Protected mode works as expected} { + # Get a non-loopback address of this instance for this test. + set myaddr [get_nonloopback_addr] + if {$myaddr != "" && ![string match {127.*} $myaddr]} { + # Non-loopback client should fail by default + set r2 [get_nonloopback_client] + catch {$r2 ping} err + assert_match {*DENIED*} $err + + # Bind configuration should not matter + assert_equal {OK} [r config set bind "*"] + set r2 [get_nonloopback_client] + catch {$r2 ping} err + assert_match {*DENIED*} $err + + # Setting a password should disable protected mode + assert_equal {OK} [r config set requirepass "secret"] + set r2 [redis $myaddr [srv 0 "port"] 0 $::tls] + assert_equal {OK} [$r2 auth secret] + assert_equal {PONG} [$r2 ping] + + # Clearing the password re-enables protected mode + assert_equal {OK} [r config set requirepass ""] + set r2 [redis $myaddr [srv 0 "port"] 0 $::tls] + assert_match {*DENIED*} $err + + # Explicitly disabling protected-mode works + assert_equal {OK} [r config set protected-mode no] + set r2 [redis $myaddr [srv 0 "port"] 0 $::tls] + assert_equal {PONG} [$r2 ping] + } + } +} diff --git a/tests/unit/obuf-limits.tcl b/tests/unit/obuf-limits.tcl new file mode 100644 index 0000000..7eb6def --- /dev/null +++ b/tests/unit/obuf-limits.tcl @@ -0,0 +1,230 @@ +start_server {tags {"obuf-limits external:skip"}} { + test {CONFIG SET client-output-buffer-limit} { + set oldval [lindex [r config get client-output-buffer-limit] 1] + + catch {r config set client-output-buffer-limit "wrong number"} e + assert_match {*Wrong*arguments*} $e + + catch {r config set client-output-buffer-limit "invalid_class 10mb 10mb 60"} e + assert_match {*Invalid*client*class*} $e + catch {r config set client-output-buffer-limit "master 10mb 10mb 60"} e + assert_match {*Invalid*client*class*} $e + + catch {r config set client-output-buffer-limit "normal 10mbs 10mb 60"} e + assert_match {*Error*hard*} $e + + catch {r config set client-output-buffer-limit "replica 10mb 10mbs 60"} e + assert_match {*Error*soft*} $e + + catch {r config set client-output-buffer-limit "pubsub 10mb 10mb 60s"} e + assert_match {*Error*soft_seconds*} $e + + r config set client-output-buffer-limit "normal 1mb 2mb 60 replica 3mb 4mb 70 pubsub 5mb 6mb 80" + set res [lindex [r config get client-output-buffer-limit] 1] + assert_equal $res "normal 1048576 2097152 60 slave 3145728 4194304 70 pubsub 5242880 6291456 80" + + # Set back to the original value. + r config set client-output-buffer-limit $oldval + } + + test {Client output buffer hard limit is enforced} { + r config set client-output-buffer-limit {pubsub 100000 0 0} + set rd1 [redis_deferring_client] + + $rd1 subscribe foo + set reply [$rd1 read] + assert {$reply eq "subscribe foo 1"} + + set omem 0 + while 1 { + r publish foo bar + set clients [split [r client list] "\r\n"] + set c [split [lindex $clients 1] " "] + if {![regexp {omem=([0-9]+)} $c - omem]} break + if {$omem > 200000} break + } + assert {$omem >= 70000 && $omem < 200000} + $rd1 close + } + + foreach {soft_limit_time wait_for_timeout} {3 yes + 4 no } { + if $wait_for_timeout { + set test_name "Client output buffer soft limit is enforced if time is overreached" + } else { + set test_name "Client output buffer soft limit is not enforced too early and is enforced when no traffic" + } + + test $test_name { + r config set client-output-buffer-limit "pubsub 0 100000 $soft_limit_time" + set soft_limit_time [expr $soft_limit_time*1000] + set rd1 [redis_deferring_client] + + $rd1 client setname test_client + set reply [$rd1 read] + assert {$reply eq "OK"} + + $rd1 subscribe foo + set reply [$rd1 read] + assert {$reply eq "subscribe foo 1"} + + set omem 0 + set start_time 0 + set time_elapsed 0 + set last_under_limit_time [clock milliseconds] + while 1 { + r publish foo [string repeat "x" 1000] + set clients [split [r client list] "\r\n"] + set c [lsearch -inline $clients *name=test_client*] + if {$start_time != 0} { + set time_elapsed [expr {[clock milliseconds]-$start_time}] + # Make sure test isn't taking too long + assert {$time_elapsed <= [expr $soft_limit_time+3000]} + } + if {$wait_for_timeout && $c == ""} { + # Make sure we're disconnected when we reach the soft limit + assert {$omem >= 100000 && $time_elapsed >= $soft_limit_time} + break + } else { + assert {[regexp {omem=([0-9]+)} $c - omem]} + } + if {$omem > 100000} { + if {$start_time == 0} {set start_time $last_under_limit_time} + if {!$wait_for_timeout && $time_elapsed >= [expr $soft_limit_time-1000]} break + # Slow down loop when omem has reached the limit. + after 10 + } else { + # if the OS socket buffers swallowed what we previously filled, reset the start timer. + set start_time 0 + set last_under_limit_time [clock milliseconds] + } + } + + if {!$wait_for_timeout} { + # After we completely stopped the traffic, wait for soft limit to time out + set timeout [expr {$soft_limit_time+1500 - ([clock milliseconds]-$start_time)}] + wait_for_condition [expr $timeout/10] 10 { + [lsearch [split [r client list] "\r\n"] *name=test_client*] == -1 + } else { + fail "Soft limit timed out but client still connected" + } + } + + $rd1 close + } + } + + test {No response for single command if client output buffer hard limit is enforced} { + r config set latency-tracking no + r config set client-output-buffer-limit {normal 100000 0 0} + # Total size of all items must be more than 100k + set item [string repeat "x" 1000] + for {set i 0} {$i < 150} {incr i} { + r lpush mylist $item + } + set orig_mem [s used_memory] + # Set client name and get all items + set rd [redis_deferring_client] + $rd client setname mybiglist + assert {[$rd read] eq "OK"} + $rd lrange mylist 0 -1 + $rd flush + after 100 + + # Before we read reply, redis will close this client. + set clients [r client list] + assert_no_match "*name=mybiglist*" $clients + set cur_mem [s used_memory] + # 10k just is a deviation threshold + assert {$cur_mem < 10000 + $orig_mem} + + # Read nothing + set fd [$rd channel] + assert_equal {} [$rd rawread] + } + + # Note: This test assumes that what's written with one write, will be read by redis in one read. + # this assumption is wrong, but seem to work empirically (for now) + test {No response for multi commands in pipeline if client output buffer limit is enforced} { + r config set client-output-buffer-limit {normal 100000 0 0} + set value [string repeat "x" 10000] + r set bigkey $value + set rd1 [redis_deferring_client] + set rd2 [redis_deferring_client] + $rd2 client setname multicommands + assert_equal "OK" [$rd2 read] + + # Let redis sleep 1s firstly + $rd1 debug sleep 1 + $rd1 flush + after 100 + + # Create a pipeline of commands that will be processed in one socket read. + # It is important to use one write, in TLS mode independent writes seem + # to wait for response from the server. + # Total size should be less than OS socket buffer, redis can + # execute all commands in this pipeline when it wakes up. + set buf "" + for {set i 0} {$i < 15} {incr i} { + append buf "set $i $i\r\n" + append buf "get $i\r\n" + append buf "del $i\r\n" + # One bigkey is 10k, total response size must be more than 100k + append buf "get bigkey\r\n" + } + $rd2 write $buf + $rd2 flush + after 100 + + # Reds must wake up if it can send reply + assert_equal "PONG" [r ping] + set clients [r client list] + assert_no_match "*name=multicommands*" $clients + assert_equal {} [$rd2 rawread] + } + + test {Execute transactions completely even if client output buffer limit is enforced} { + r config set client-output-buffer-limit {normal 100000 0 0} + # Total size of all items must be more than 100k + set item [string repeat "x" 1000] + for {set i 0} {$i < 150} {incr i} { + r lpush mylist2 $item + } + + # Output buffer limit is enforced during executing transaction + r client setname transactionclient + r set k1 v1 + r multi + r set k2 v2 + r get k2 + r lrange mylist2 0 -1 + r set k3 v3 + r del k1 + catch {[r exec]} e + assert_match "*I/O error*" $e + reconnect + set clients [r client list] + assert_no_match "*name=transactionclient*" $clients + + # Transactions should be executed completely + assert_equal {} [r get k1] + assert_equal "v2" [r get k2] + assert_equal "v3" [r get k3] + } + + test "Obuf limit, HRANDFIELD with huge count stopped mid-run" { + r config set client-output-buffer-limit {normal 1000000 0 0} + r hset myhash a b + catch {r hrandfield myhash -999999999} e + assert_match "*I/O error*" $e + reconnect + } + + test "Obuf limit, KEYS stopped mid-run" { + r config set client-output-buffer-limit {normal 100000 0 0} + populate 1000 "long-key-name-prefix-of-100-chars-------------------------------------------------------------------" + catch {r keys *} e + assert_match "*I/O error*" $e + reconnect + } +} diff --git a/tests/unit/oom-score-adj.tcl b/tests/unit/oom-score-adj.tcl new file mode 100644 index 0000000..6c7b713 --- /dev/null +++ b/tests/unit/oom-score-adj.tcl @@ -0,0 +1,131 @@ +set system_name [string tolower [exec uname -s]] +set user_id [exec id -u] + +if {$system_name eq {linux}} { + start_server {tags {"oom-score-adj external:skip"}} { + proc get_oom_score_adj {{pid ""}} { + if {$pid == ""} { + set pid [srv 0 pid] + } + set fd [open "/proc/$pid/oom_score_adj" "r"] + set val [gets $fd] + close $fd + + return $val + } + + proc set_oom_score_adj {score {pid ""}} { + if {$pid == ""} { + set pid [srv 0 pid] + } + set fd [open "/proc/$pid/oom_score_adj" "w"] + puts $fd $score + close $fd + } + + test {CONFIG SET oom-score-adj works as expected} { + set base [get_oom_score_adj] + + # Enable oom-score-adj, check defaults + r config set oom-score-adj-values "10 20 30" + r config set oom-score-adj yes + + assert {[get_oom_score_adj] == [expr $base + 10]} + + # Modify current class + r config set oom-score-adj-values "15 20 30" + assert {[get_oom_score_adj] == [expr $base + 15]} + + # Check replica class + r replicaof localhost 1 + assert {[get_oom_score_adj] == [expr $base + 20]} + r replicaof no one + assert {[get_oom_score_adj] == [expr $base + 15]} + + # Check child process + r set key-a value-a + r config set rdb-key-save-delay 1000000 + r bgsave + + set child_pid [get_child_pid 0] + # Wait until background child process to setOOMScoreAdj success. + wait_for_condition 100 10 { + [get_oom_score_adj $child_pid] == [expr $base + 30] + } else { + fail "Set oom-score-adj of background child process is not ok" + } + } + + # Failed oom-score-adj tests can only run unprivileged + if {$user_id != 0} { + test {CONFIG SET oom-score-adj handles configuration failures} { + # Bad config + r config set oom-score-adj no + r config set oom-score-adj-values "-1000 -1000 -1000" + + # Make sure it fails + catch {r config set oom-score-adj yes} e + assert_match {*Failed to set*} $e + + # Make sure it remains off + assert {[r config get oom-score-adj] == "oom-score-adj no"} + + # Fix config + r config set oom-score-adj-values "0 100 100" + r config set oom-score-adj yes + + # Make sure it fails + catch {r config set oom-score-adj-values "-1000 -1000 -1000"} e + assert_match {*Failed*} $e + + # Make sure previous values remain + assert {[r config get oom-score-adj-values] == {oom-score-adj-values {0 100 100}}} + } + } + + test {CONFIG SET oom-score-adj-values doesn't touch proc when disabled} { + set orig_osa [get_oom_score_adj] + + set other_val1 [expr $orig_osa + 1] + set other_val2 [expr $orig_osa + 2] + + r config set oom-score-adj no + + set_oom_score_adj $other_val2 + assert_equal [get_oom_score_adj] $other_val2 + + r config set oom-score-adj-values "$other_val1 $other_val1 $other_val1" + + assert_equal [get_oom_score_adj] $other_val2 + } + + test {CONFIG SET oom score restored on disable} { + r config set oom-score-adj no + set_oom_score_adj 22 + assert_equal [get_oom_score_adj] 22 + + r config set oom-score-adj-values "9 9 9" oom-score-adj yes + assert_equal [get_oom_score_adj] [expr 9+22] + + r config set oom-score-adj no + assert_equal [get_oom_score_adj] 22 + } + + test {CONFIG SET oom score relative and absolute} { + set custom_oom 9 + r config set oom-score-adj no + set base_oom [get_oom_score_adj] + + r config set oom-score-adj-values "$custom_oom $custom_oom $custom_oom" oom-score-adj relative + assert_equal [get_oom_score_adj] [expr $base_oom+$custom_oom] + + r config set oom-score-adj absolute + assert_equal [get_oom_score_adj] $custom_oom + } + + test {CONFIG SET out-of-range oom score} { + assert_error {ERR *must be between -2000 and 2000*} {r config set oom-score-adj-values "-2001 -2001 -2001"} + assert_error {ERR *must be between -2000 and 2000*} {r config set oom-score-adj-values "2001 2001 2001"} + } + } +} diff --git a/tests/unit/other.tcl b/tests/unit/other.tcl new file mode 100644 index 0000000..2ae09b5 --- /dev/null +++ b/tests/unit/other.tcl @@ -0,0 +1,403 @@ +start_server {tags {"other"}} { + if {$::force_failure} { + # This is used just for test suite development purposes. + test {Failing test} { + format err + } {ok} + } + + test {SAVE - make sure there are all the types as values} { + # Wait for a background saving in progress to terminate + waitForBgsave r + r lpush mysavelist hello + r lpush mysavelist world + r set myemptykey {} + r set mynormalkey {blablablba} + r zadd mytestzset 10 a + r zadd mytestzset 20 b + r zadd mytestzset 30 c + r save + } {OK} {needs:save} + + tags {slow} { + if {$::accurate} {set iterations 10000} else {set iterations 1000} + foreach fuzztype {binary alpha compr} { + test "FUZZ stresser with data model $fuzztype" { + set err 0 + for {set i 0} {$i < $iterations} {incr i} { + set fuzz [randstring 0 512 $fuzztype] + r set foo $fuzz + set got [r get foo] + if {$got ne $fuzz} { + set err [list $fuzz $got] + break + } + } + set _ $err + } {0} + } + } + + start_server {overrides {save ""} tags {external:skip}} { + test {FLUSHALL should not reset the dirty counter if we disable save} { + r set key value + r flushall + assert_morethan [s rdb_changes_since_last_save] 0 + } + + test {FLUSHALL should reset the dirty counter to 0 if we enable save} { + r config set save "3600 1 300 100 60 10000" + r set key value + r flushall + assert_equal [s rdb_changes_since_last_save] 0 + } + } + + test {BGSAVE} { + # Use FLUSHALL instead of FLUSHDB, FLUSHALL do a foreground save + # and reset the dirty counter to 0, so we won't trigger an unexpected bgsave. + r flushall + r save + r set x 10 + r bgsave + waitForBgsave r + r debug reload + r get x + } {10} {needs:debug needs:save} + + test {SELECT an out of range DB} { + catch {r select 1000000} err + set _ $err + } {*index is out of range*} {cluster:skip} + + tags {consistency} { + proc check_consistency {dumpname code} { + set dump [csvdump r] + set sha1 [debug_digest] + + uplevel 1 $code + + set sha1_after [debug_digest] + if {$sha1 eq $sha1_after} { + return 1 + } + + # Failed + set newdump [csvdump r] + puts "Consistency test failed!" + puts "You can inspect the two dumps in /tmp/${dumpname}*.txt" + + set fd [open /tmp/${dumpname}1.txt w] + puts $fd $dump + close $fd + set fd [open /tmp/${dumpname}2.txt w] + puts $fd $newdump + close $fd + + return 0 + } + + if {$::accurate} {set numops 10000} else {set numops 1000} + test {Check consistency of different data types after a reload} { + r flushdb + createComplexDataset r $numops usetag + if {$::ignoredigest} { + set _ 1 + } else { + check_consistency {repldump} { + r debug reload + } + } + } {1} {needs:debug} + + test {Same dataset digest if saving/reloading as AOF?} { + if {$::ignoredigest} { + set _ 1 + } else { + check_consistency {aofdump} { + r config set aof-use-rdb-preamble no + r bgrewriteaof + waitForBgrewriteaof r + r debug loadaof + } + } + } {1} {needs:debug} + } + + test {EXPIRES after a reload (snapshot + append only file rewrite)} { + r flushdb + r set x 10 + r expire x 1000 + r save + r debug reload + set ttl [r ttl x] + set e1 [expr {$ttl > 900 && $ttl <= 1000}] + r bgrewriteaof + waitForBgrewriteaof r + r debug loadaof + set ttl [r ttl x] + set e2 [expr {$ttl > 900 && $ttl <= 1000}] + list $e1 $e2 + } {1 1} {needs:debug needs:save} + + test {EXPIRES after AOF reload (without rewrite)} { + r flushdb + r config set appendonly yes + r config set aof-use-rdb-preamble no + r set x somevalue + r expire x 1000 + r setex y 2000 somevalue + r set z somevalue + r expireat z [expr {[clock seconds]+3000}] + + # Milliseconds variants + r set px somevalue + r pexpire px 1000000 + r psetex py 2000000 somevalue + r set pz somevalue + r pexpireat pz [expr {([clock seconds]+3000)*1000}] + + # Reload and check + waitForBgrewriteaof r + # We need to wait two seconds to avoid false positives here, otherwise + # the DEBUG LOADAOF command may read a partial file. + # Another solution would be to set the fsync policy to no, since this + # prevents write() to be delayed by the completion of fsync(). + after 2000 + r debug loadaof + set ttl [r ttl x] + assert {$ttl > 900 && $ttl <= 1000} + set ttl [r ttl y] + assert {$ttl > 1900 && $ttl <= 2000} + set ttl [r ttl z] + assert {$ttl > 2900 && $ttl <= 3000} + set ttl [r ttl px] + assert {$ttl > 900 && $ttl <= 1000} + set ttl [r ttl py] + assert {$ttl > 1900 && $ttl <= 2000} + set ttl [r ttl pz] + assert {$ttl > 2900 && $ttl <= 3000} + r config set appendonly no + } {OK} {needs:debug} + + tags {protocol} { + test {PIPELINING stresser (also a regression for the old epoll bug)} { + if {$::tls} { + set fd2 [::tls::socket [srv host] [srv port]] + } else { + set fd2 [socket [srv host] [srv port]] + } + fconfigure $fd2 -encoding binary -translation binary + if {!$::singledb} { + puts -nonewline $fd2 "SELECT 9\r\n" + flush $fd2 + gets $fd2 + } + + for {set i 0} {$i < 100000} {incr i} { + set q {} + set val "0000${i}0000" + append q "SET key:$i $val\r\n" + puts -nonewline $fd2 $q + set q {} + append q "GET key:$i\r\n" + puts -nonewline $fd2 $q + } + flush $fd2 + + for {set i 0} {$i < 100000} {incr i} { + gets $fd2 line + gets $fd2 count + set count [string range $count 1 end] + set val [read $fd2 $count] + read $fd2 2 + } + close $fd2 + set _ 1 + } {1} + } + + test {APPEND basics} { + r del foo + list [r append foo bar] [r get foo] \ + [r append foo 100] [r get foo] + } {3 bar 6 bar100} + + test {APPEND basics, integer encoded values} { + set res {} + r del foo + r append foo 1 + r append foo 2 + lappend res [r get foo] + r set foo 1 + r append foo 2 + lappend res [r get foo] + } {12 12} + + test {APPEND fuzzing} { + set err {} + foreach type {binary alpha compr} { + set buf {} + r del x + for {set i 0} {$i < 1000} {incr i} { + set bin [randstring 0 10 $type] + append buf $bin + r append x $bin + } + if {$buf != [r get x]} { + set err "Expected '$buf' found '[r get x]'" + break + } + } + set _ $err + } {} + + # Leave the user with a clean DB before to exit + test {FLUSHDB} { + set aux {} + if {$::singledb} { + r flushdb + lappend aux 0 [r dbsize] + } else { + r select 9 + r flushdb + lappend aux [r dbsize] + r select 10 + r flushdb + lappend aux [r dbsize] + } + } {0 0} + + test {Perform a final SAVE to leave a clean DB on disk} { + waitForBgsave r + r save + } {OK} {needs:save} + + test {RESET clears client state} { + r client setname test-client + r client tracking on + + assert_equal [r reset] "RESET" + set client [r client list] + assert_match {*name= *} $client + assert_match {*flags=N *} $client + } {} {needs:reset} + + test {RESET clears MONITOR state} { + set rd [redis_deferring_client] + $rd monitor + assert_equal [$rd read] "OK" + + $rd reset + assert_equal [$rd read] "RESET" + $rd close + + assert_no_match {*flags=O*} [r client list] + } {} {needs:reset} + + test {RESET clears and discards MULTI state} { + r multi + r set key-a a + + r reset + catch {r exec} err + assert_match {*EXEC without MULTI*} $err + } {} {needs:reset} + + test {RESET clears Pub/Sub state} { + r subscribe channel-1 + r reset + + # confirm we're not subscribed by executing another command + r set key val + } {OK} {needs:reset} + + test {RESET clears authenticated state} { + r acl setuser user1 on >secret +@all + r auth user1 secret + assert_equal [r acl whoami] user1 + + r reset + + assert_equal [r acl whoami] default + } {} {needs:reset} + + test "Subcommand syntax error crash (issue #10070)" { + assert_error {*unknown command*} {r GET|} + assert_error {*unknown command*} {r GET|SET} + assert_error {*unknown command*} {r GET|SET|OTHER} + assert_error {*unknown command*} {r CONFIG|GET GET_XX} + assert_error {*unknown subcommand*} {r CONFIG GET_XX} + } +} + +start_server {tags {"other external:skip"}} { + test {Don't rehash if redis has child process} { + r config set save "" + r config set rdb-key-save-delay 1000000 + + populate 4096 "" 1 + r bgsave + wait_for_condition 10 100 { + [s rdb_bgsave_in_progress] eq 1 + } else { + fail "bgsave did not start in time" + } + + r mset k1 v1 k2 v2 + # Hash table should not rehash + assert_no_match "*table size: 8192*" [r debug HTSTATS 9] + exec kill -9 [get_child_pid 0] + waitForBgsave r + after 200 ;# waiting for serverCron + + # Hash table should rehash since there is no child process, + # size is power of two and over 4098, so it is 8192 + r set k3 v3 + assert_match "*table size: 8192*" [r debug HTSTATS 9] + } {} {needs:debug needs:local-process} +} + +proc read_proc_title {pid} { + set fd [open "/proc/$pid/cmdline" "r"] + set cmdline [read $fd 1024] + close $fd + + return $cmdline +} + +start_server {tags {"other external:skip"}} { + test {Process title set as expected} { + # Test only on Linux where it's easy to get cmdline without relying on tools. + # Skip valgrind as it messes up the arguments. + set os [exec uname] + if {$os == "Linux" && !$::valgrind} { + # Set a custom template + r config set "proc-title-template" "TEST {title} {listen-addr} {port} {tls-port} {unixsocket} {config-file}" + set cmdline [read_proc_title [srv 0 pid]] + + assert_equal "TEST" [lindex $cmdline 0] + assert_match "*/redis-server" [lindex $cmdline 1] + + if {$::tls} { + set expect_port 0 + set expect_tls_port [srv 0 port] + } else { + set expect_port [srv 0 port] + set expect_tls_port 0 + } + set port [srv 0 port] + + assert_equal "$::host:$port" [lindex $cmdline 2] + assert_equal $expect_port [lindex $cmdline 3] + assert_equal $expect_tls_port [lindex $cmdline 4] + assert_match "*/tests/tmp/server.*/socket" [lindex $cmdline 5] + assert_match "*/tests/tmp/redis.conf.*" [lindex $cmdline 6] + + # Try setting a bad template + catch {r config set "proc-title-template" "{invalid-var}"} err + assert_match {*template format is invalid*} $err + } + } +} + diff --git a/tests/unit/pause.tcl b/tests/unit/pause.tcl new file mode 100644 index 0000000..3440c5f --- /dev/null +++ b/tests/unit/pause.tcl @@ -0,0 +1,325 @@ +start_server {tags {"pause network"}} { + test "Test read commands are not blocked by client pause" { + r client PAUSE 100000 WRITE + set rd [redis_deferring_client] + $rd GET FOO + $rd PING + $rd INFO + assert_equal [s 0 blocked_clients] 0 + r client unpause + $rd close + } + + test "Test write commands are paused by RO" { + r client PAUSE 60000 WRITE + + set rd [redis_deferring_client] + $rd SET FOO BAR + wait_for_blocked_clients_count 1 50 100 + + r client unpause + assert_match "OK" [$rd read] + $rd close + } + + test "Test special commands are paused by RO" { + r PFADD pause-hll test + r client PAUSE 100000 WRITE + + # Test that pfcount, which can replicate, is also blocked + set rd [redis_deferring_client] + $rd PFCOUNT pause-hll + wait_for_blocked_clients_count 1 50 100 + + # Test that publish, which adds the message to the replication + # stream is blocked. + set rd2 [redis_deferring_client] + $rd2 publish foo bar + wait_for_blocked_clients_count 2 50 100 + + r client unpause + assert_match "1" [$rd read] + assert_match "0" [$rd2 read] + $rd close + $rd2 close + } + + test "Test read/admin mutli-execs are not blocked by pause RO" { + r SET FOO BAR + r client PAUSE 100000 WRITE + set rr [redis_client] + assert_equal [$rr MULTI] "OK" + assert_equal [$rr PING] "QUEUED" + assert_equal [$rr GET FOO] "QUEUED" + assert_match "PONG BAR" [$rr EXEC] + assert_equal [s 0 blocked_clients] 0 + r client unpause + $rr close + } + + test "Test write mutli-execs are blocked by pause RO" { + set rd [redis_deferring_client] + $rd MULTI + assert_equal [$rd read] "OK" + $rd SET FOO BAR + assert_equal [$rd read] "QUEUED" + r client PAUSE 60000 WRITE + $rd EXEC + wait_for_blocked_clients_count 1 50 100 + r client unpause + assert_match "OK" [$rd read] + $rd close + } + + test "Test scripts are blocked by pause RO" { + r client PAUSE 60000 WRITE + set rd [redis_deferring_client] + set rd2 [redis_deferring_client] + $rd EVAL "return 1" 0 + + # test a script with a shebang and no flags for coverage + $rd2 EVAL {#!lua + return 1 + } 0 + + wait_for_blocked_clients_count 2 50 100 + r client unpause + assert_match "1" [$rd read] + assert_match "1" [$rd2 read] + $rd close + $rd2 close + } + + test "Test RO scripts are not blocked by pause RO" { + r set x y + # create a function for later + r FUNCTION load replace {#!lua name=f1 + redis.register_function{ + function_name='f1', + callback=function() return "hello" end, + flags={'no-writes'} + } + } + + r client PAUSE 6000000 WRITE + set rr [redis_client] + + # test an eval that's for sure not in the script cache + assert_equal [$rr EVAL {#!lua flags=no-writes + return 'unique script' + } 0 + ] "unique script" + + # for sanity, repeat that EVAL on a script that's already cached + assert_equal [$rr EVAL {#!lua flags=no-writes + return 'unique script' + } 0 + ] "unique script" + + # test EVAL_RO on a unique script that's for sure not in the cache + assert_equal [$rr EVAL_RO { + return redis.call('GeT', 'x')..' unique script' + } 1 x + ] "y unique script" + + # test with evalsha + set sha [$rr script load {#!lua flags=no-writes + return 2 + }] + assert_equal [$rr EVALSHA $sha 0] 2 + + # test with function + assert_equal [$rr fcall f1 0] hello + + r client unpause + $rr close + } + + test "Test read-only scripts in mutli-exec are not blocked by pause RO" { + r SET FOO BAR + r client PAUSE 100000 WRITE + set rr [redis_client] + assert_equal [$rr MULTI] "OK" + assert_equal [$rr EVAL {#!lua flags=no-writes + return 12 + } 0 + ] QUEUED + assert_equal [$rr EVAL {#!lua flags=no-writes + return 13 + } 0 + ] QUEUED + assert_match "12 13" [$rr EXEC] + assert_equal [s 0 blocked_clients] 0 + r client unpause + $rr close + } + + test "Test write scripts in mutli-exec are blocked by pause RO" { + set rd [redis_deferring_client] + set rd2 [redis_deferring_client] + + # one with a shebang + $rd MULTI + assert_equal [$rd read] "OK" + $rd EVAL {#!lua + return 12 + } 0 + assert_equal [$rd read] "QUEUED" + + # one without a shebang + $rd2 MULTI + assert_equal [$rd2 read] "OK" + $rd2 EVAL {#!lua + return 13 + } 0 + assert_equal [$rd2 read] "QUEUED" + + r client PAUSE 60000 WRITE + $rd EXEC + $rd2 EXEC + wait_for_blocked_clients_count 2 50 100 + r client unpause + assert_match "12" [$rd read] + assert_match "13" [$rd2 read] + $rd close + $rd2 close + } + + test "Test may-replicate commands are rejected in RO scripts" { + # that's specifically important for CLIENT PAUSE WRITE + assert_error {ERR Write commands are not allowed from read-only scripts. script:*} { + r EVAL_RO "return redis.call('publish','ch','msg')" 0 + } + assert_error {ERR Write commands are not allowed from read-only scripts. script:*} { + r EVAL {#!lua flags=no-writes + return redis.call('publish','ch','msg') + } 0 + } + # make sure that publish isn't blocked from a non-RO script + assert_equal [r EVAL "return redis.call('publish','ch','msg')" 0] 0 + } + + test "Test multiple clients can be queued up and unblocked" { + r client PAUSE 60000 WRITE + set clients [list [redis_deferring_client] [redis_deferring_client] [redis_deferring_client]] + foreach client $clients { + $client SET FOO BAR + } + + wait_for_blocked_clients_count 3 50 100 + r client unpause + foreach client $clients { + assert_match "OK" [$client read] + $client close + } + } + + test "Test clients with syntax errors will get responses immediately" { + r client PAUSE 100000 WRITE + catch {r set FOO} err + assert_match "ERR wrong number of arguments for 'set' command" $err + r client unpause + } + + test "Test both active and passive expires are skipped during client pause" { + set expired_keys [s 0 expired_keys] + r multi + r set foo{t} bar{t} PX 10 + r set bar{t} foo{t} PX 10 + r client PAUSE 50000 WRITE + r exec + + wait_for_condition 10 100 { + [r get foo{t}] == {} && [r get bar{t}] == {} + } else { + fail "Keys were never logically expired" + } + + # No keys should actually have been expired + assert_match $expired_keys [s 0 expired_keys] + + r client unpause + + # Force the keys to expire + r get foo{t} + r get bar{t} + + # Now that clients have been unpaused, expires should go through + assert_match [expr $expired_keys + 2] [s 0 expired_keys] + } + + test "Test that client pause starts at the end of a transaction" { + r MULTI + r SET FOO1{t} BAR + r client PAUSE 60000 WRITE + r SET FOO2{t} BAR + r exec + + set rd [redis_deferring_client] + $rd SET FOO3{t} BAR + + wait_for_blocked_clients_count 1 50 100 + + assert_match "BAR" [r GET FOO1{t}] + assert_match "BAR" [r GET FOO2{t}] + assert_match "" [r GET FOO3{t}] + + r client unpause + assert_match "OK" [$rd read] + $rd close + } + + start_server {tags {needs:repl external:skip}} { + set master [srv -1 client] + set master_host [srv -1 host] + set master_port [srv -1 port] + + # Avoid PINGs + $master config set repl-ping-replica-period 3600 + r replicaof $master_host $master_port + + wait_for_condition 50 100 { + [s master_link_status] eq {up} + } else { + fail "Replication not started." + } + + test "Test when replica paused, offset would not grow" { + $master set foo bar + set old_master_offset [status $master master_repl_offset] + + wait_for_condition 50 100 { + [s slave_repl_offset] == [status $master master_repl_offset] + } else { + fail "Replication offset not matched." + } + + r client pause 100000 write + $master set foo2 bar2 + + # Make sure replica received data from master + wait_for_condition 50 100 { + [s slave_read_repl_offset] == [status $master master_repl_offset] + } else { + fail "Replication not work." + } + + # Replica would not apply the write command + assert {[s slave_repl_offset] == $old_master_offset} + r get foo2 + } {} + + test "Test replica offset would grow after unpause" { + r client unpause + wait_for_condition 50 100 { + [s slave_repl_offset] == [status $master master_repl_offset] + } else { + fail "Replication not continue." + } + r get foo2 + } {bar2} + } + + # Make sure we unpause at the end + r client unpause +} diff --git a/tests/unit/pendingquerybuf.tcl b/tests/unit/pendingquerybuf.tcl new file mode 100644 index 0000000..c1278c8 --- /dev/null +++ b/tests/unit/pendingquerybuf.tcl @@ -0,0 +1,28 @@ +proc info_memory {r property} { + if {[regexp "\r\n$property:(.*?)\r\n" [{*}$r info memory] _ value]} { + set _ $value + } +} + +start_server {tags {"wait external:skip"}} { +start_server {} { + set slave [srv 0 client] + set slave_host [srv 0 host] + set slave_port [srv 0 port] + set master [srv -1 client] + set master_host [srv -1 host] + set master_port [srv -1 port] + + test "pending querybuf: check size of pending_querybuf after set a big value" { + $slave slaveof $master_host $master_port + set _v [prepare_value [expr 32*1024*1024]] + $master set key $_v + wait_for_ofs_sync $master $slave + + wait_for_condition 50 100 { + [info_memory $slave used_memory] <= [info_memory $master used_memory] + 10*1024*1024 + } else { + fail "the used_memory of replica is much larger than master." + } + } +}} diff --git a/tests/unit/printver.tcl b/tests/unit/printver.tcl new file mode 100644 index 0000000..c80f451 --- /dev/null +++ b/tests/unit/printver.tcl @@ -0,0 +1,6 @@ +start_server {} { + set i [r info] + regexp {redis_version:(.*?)\r\n} $i - version + regexp {redis_git_sha1:(.*?)\r\n} $i - sha1 + puts "Testing Redis version $version ($sha1)" +} diff --git a/tests/unit/protocol.tcl b/tests/unit/protocol.tcl new file mode 100644 index 0000000..50305bd --- /dev/null +++ b/tests/unit/protocol.tcl @@ -0,0 +1,245 @@ +start_server {tags {"protocol network"}} { + test "Handle an empty query" { + reconnect + r write "\r\n" + r flush + assert_equal "PONG" [r ping] + } + + test "Negative multibulk length" { + reconnect + r write "*-10\r\n" + r flush + assert_equal PONG [r ping] + } + + test "Out of range multibulk length" { + reconnect + r write "*3000000000\r\n" + r flush + assert_error "*invalid multibulk length*" {r read} + } + + test "Wrong multibulk payload header" { + reconnect + r write "*3\r\n\$3\r\nSET\r\n\$1\r\nx\r\nfooz\r\n" + r flush + assert_error "*expected '$', got 'f'*" {r read} + } + + test "Negative multibulk payload length" { + reconnect + r write "*3\r\n\$3\r\nSET\r\n\$1\r\nx\r\n\$-10\r\n" + r flush + assert_error "*invalid bulk length*" {r read} + } + + test "Out of range multibulk payload length" { + reconnect + r write "*3\r\n\$3\r\nSET\r\n\$1\r\nx\r\n\$2000000000\r\n" + r flush + assert_error "*invalid bulk length*" {r read} + } + + test "Non-number multibulk payload length" { + reconnect + r write "*3\r\n\$3\r\nSET\r\n\$1\r\nx\r\n\$blabla\r\n" + r flush + assert_error "*invalid bulk length*" {r read} + } + + test "Multi bulk request not followed by bulk arguments" { + reconnect + r write "*1\r\nfoo\r\n" + r flush + assert_error "*expected '$', got 'f'*" {r read} + } + + test "Generic wrong number of args" { + reconnect + assert_error "*wrong*arguments*ping*" {r ping x y z} + } + + test "Unbalanced number of quotes" { + reconnect + r write "set \"\"\"test-key\"\"\" test-value\r\n" + r write "ping\r\n" + r flush + assert_error "*unbalanced*" {r read} + } + + set c 0 + foreach seq [list "\x00" "*\x00" "$\x00"] { + incr c + test "Protocol desync regression test #$c" { + if {$::tls} { + set s [::tls::socket [srv 0 host] [srv 0 port]] + } else { + set s [socket [srv 0 host] [srv 0 port]] + } + puts -nonewline $s $seq + set payload [string repeat A 1024]"\n" + set test_start [clock seconds] + set test_time_limit 30 + while 1 { + if {[catch { + puts -nonewline $s payload + flush $s + incr payload_size [string length $payload] + }]} { + set retval [gets $s] + close $s + break + } else { + set elapsed [expr {[clock seconds]-$test_start}] + if {$elapsed > $test_time_limit} { + close $s + error "assertion:Redis did not closed connection after protocol desync" + } + } + } + set retval + } {*Protocol error*} + } + unset c + + # recover the broken connection + reconnect + r ping + + # raw RESP response tests + r readraw 1 + + test "raw protocol response" { + r srandmember nonexisting_key + } {*-1} + + r deferred 1 + + test "raw protocol response - deferred" { + r srandmember nonexisting_key + r read + } {*-1} + + test "raw protocol response - multiline" { + r sadd ss a + assert_equal [r read] {:1} + r srandmember ss 100 + assert_equal [r read] {*1} + assert_equal [r read] {$1} + assert_equal [r read] {a} + } + + # restore connection settings + r readraw 0 + r deferred 0 + + # check the connection still works + assert_equal [r ping] {PONG} + + test {RESP3 attributes} { + r hello 3 + assert_equal {Some real reply following the attribute} [r debug protocol attrib] + assert_equal {key-popularity {key:123 90}} [r attributes] + + # make sure attributes are not kept from previous command + r ping + assert_error {*attributes* no such element in array} {r attributes} + + # restore state + r hello 2 + set _ "" + } {} {needs:debug resp3} + + test {RESP3 attributes readraw} { + r hello 3 + r readraw 1 + r deferred 1 + + r debug protocol attrib + assert_equal [r read] {|1} + assert_equal [r read] {$14} + assert_equal [r read] {key-popularity} + assert_equal [r read] {*2} + assert_equal [r read] {$7} + assert_equal [r read] {key:123} + assert_equal [r read] {:90} + assert_equal [r read] {$39} + assert_equal [r read] {Some real reply following the attribute} + + # restore state + r readraw 0 + r deferred 0 + r hello 2 + set _ {} + } {} {needs:debug resp3} + + test {RESP3 attributes on RESP2} { + r hello 2 + set res [r debug protocol attrib] + set _ $res + } {Some real reply following the attribute} {needs:debug} + + test "test big number parsing" { + r hello 3 + r debug protocol bignum + } {1234567999999999999999999999999999999} {needs:debug resp3} + + test "test bool parsing" { + r hello 3 + assert_equal [r debug protocol true] 1 + assert_equal [r debug protocol false] 0 + r hello 2 + assert_equal [r debug protocol true] 1 + assert_equal [r debug protocol false] 0 + set _ {} + } {} {needs:debug resp3} + + test "test verbatim str parsing" { + r hello 3 + r debug protocol verbatim + } "This is a verbatim\nstring" {needs:debug resp3} + + test "test large number of args" { + r flushdb + set args [split [string trim [string repeat "k v " 10000]]] + lappend args "{k}2" v2 + r mset {*}$args + assert_equal [r get "{k}2"] v2 + } + + test "test argument rewriting - issue 9598" { + # INCRBYFLOAT uses argument rewriting for correct float value propagation. + # We use it to make sure argument rewriting works properly. It's important + # this test is run under valgrind to verify there are no memory leaks in + # arg buffer handling. + r flushdb + + # Test normal argument handling + r set k 0 + assert_equal [r incrbyfloat k 1.0] 1 + + # Test argument handing in multi-state buffers + r multi + r incrbyfloat k 1.0 + assert_equal [r exec] 2 + } + +} + +start_server {tags {"regression"}} { + test "Regression for a crash with blocking ops and pipelining" { + set rd [redis_deferring_client] + set fd [r channel] + set proto "*3\r\n\$5\r\nBLPOP\r\n\$6\r\nnolist\r\n\$1\r\n0\r\n" + puts -nonewline $fd $proto$proto + flush $fd + set res {} + + $rd rpush nolist a + $rd read + $rd rpush nolist a + $rd read + $rd close + } +} diff --git a/tests/unit/pubsub.tcl b/tests/unit/pubsub.tcl new file mode 100644 index 0000000..bede262 --- /dev/null +++ b/tests/unit/pubsub.tcl @@ -0,0 +1,434 @@ +start_server {tags {"pubsub network"}} { + if {$::singledb} { + set db 0 + } else { + set db 9 + } + + test "Pub/Sub PING" { + set rd1 [redis_deferring_client] + subscribe $rd1 somechannel + # While subscribed to non-zero channels PING works in Pub/Sub mode. + $rd1 ping + $rd1 ping "foo" + set reply1 [$rd1 read] + set reply2 [$rd1 read] + unsubscribe $rd1 somechannel + # Now we are unsubscribed, PING should just return PONG. + $rd1 ping + set reply3 [$rd1 read] + $rd1 close + list $reply1 $reply2 $reply3 + } {{pong {}} {pong foo} PONG} + + test "PUBLISH/SUBSCRIBE basics" { + set rd1 [redis_deferring_client] + + # subscribe to two channels + assert_equal {1 2} [subscribe $rd1 {chan1 chan2}] + assert_equal 1 [r publish chan1 hello] + assert_equal 1 [r publish chan2 world] + assert_equal {message chan1 hello} [$rd1 read] + assert_equal {message chan2 world} [$rd1 read] + + # unsubscribe from one of the channels + unsubscribe $rd1 {chan1} + assert_equal 0 [r publish chan1 hello] + assert_equal 1 [r publish chan2 world] + assert_equal {message chan2 world} [$rd1 read] + + # unsubscribe from the remaining channel + unsubscribe $rd1 {chan2} + assert_equal 0 [r publish chan1 hello] + assert_equal 0 [r publish chan2 world] + + # clean up clients + $rd1 close + } + + test "PUBLISH/SUBSCRIBE with two clients" { + set rd1 [redis_deferring_client] + set rd2 [redis_deferring_client] + + assert_equal {1} [subscribe $rd1 {chan1}] + assert_equal {1} [subscribe $rd2 {chan1}] + assert_equal 2 [r publish chan1 hello] + assert_equal {message chan1 hello} [$rd1 read] + assert_equal {message chan1 hello} [$rd2 read] + + # clean up clients + $rd1 close + $rd2 close + } + + test "PUBLISH/SUBSCRIBE after UNSUBSCRIBE without arguments" { + set rd1 [redis_deferring_client] + assert_equal {1 2 3} [subscribe $rd1 {chan1 chan2 chan3}] + unsubscribe $rd1 + assert_equal 0 [r publish chan1 hello] + assert_equal 0 [r publish chan2 hello] + assert_equal 0 [r publish chan3 hello] + + # clean up clients + $rd1 close + } + + test "SUBSCRIBE to one channel more than once" { + set rd1 [redis_deferring_client] + assert_equal {1 1 1} [subscribe $rd1 {chan1 chan1 chan1}] + assert_equal 1 [r publish chan1 hello] + assert_equal {message chan1 hello} [$rd1 read] + + # clean up clients + $rd1 close + } + + test "UNSUBSCRIBE from non-subscribed channels" { + set rd1 [redis_deferring_client] + assert_equal {0 0 0} [unsubscribe $rd1 {foo bar quux}] + + # clean up clients + $rd1 close + } + + test "PUBLISH/PSUBSCRIBE basics" { + set rd1 [redis_deferring_client] + + # subscribe to two patterns + assert_equal {1 2} [psubscribe $rd1 {foo.* bar.*}] + assert_equal 1 [r publish foo.1 hello] + assert_equal 1 [r publish bar.1 hello] + assert_equal 0 [r publish foo1 hello] + assert_equal 0 [r publish barfoo.1 hello] + assert_equal 0 [r publish qux.1 hello] + assert_equal {pmessage foo.* foo.1 hello} [$rd1 read] + assert_equal {pmessage bar.* bar.1 hello} [$rd1 read] + + # unsubscribe from one of the patterns + assert_equal {1} [punsubscribe $rd1 {foo.*}] + assert_equal 0 [r publish foo.1 hello] + assert_equal 1 [r publish bar.1 hello] + assert_equal {pmessage bar.* bar.1 hello} [$rd1 read] + + # unsubscribe from the remaining pattern + assert_equal {0} [punsubscribe $rd1 {bar.*}] + assert_equal 0 [r publish foo.1 hello] + assert_equal 0 [r publish bar.1 hello] + + # clean up clients + $rd1 close + } + + test "PUBLISH/PSUBSCRIBE with two clients" { + set rd1 [redis_deferring_client] + set rd2 [redis_deferring_client] + + assert_equal {1} [psubscribe $rd1 {chan.*}] + assert_equal {1} [psubscribe $rd2 {chan.*}] + assert_equal 2 [r publish chan.foo hello] + assert_equal {pmessage chan.* chan.foo hello} [$rd1 read] + assert_equal {pmessage chan.* chan.foo hello} [$rd2 read] + + # clean up clients + $rd1 close + $rd2 close + } + + test "PUBLISH/PSUBSCRIBE after PUNSUBSCRIBE without arguments" { + set rd1 [redis_deferring_client] + assert_equal {1 2 3} [psubscribe $rd1 {chan1.* chan2.* chan3.*}] + punsubscribe $rd1 + assert_equal 0 [r publish chan1.hi hello] + assert_equal 0 [r publish chan2.hi hello] + assert_equal 0 [r publish chan3.hi hello] + + # clean up clients + $rd1 close + } + + test "PubSub messages with CLIENT REPLY OFF" { + set rd [redis_deferring_client] + $rd hello 3 + $rd read ;# Discard the hello reply + + # Test that the subscribe/psubscribe notification is ok + $rd client reply off + assert_equal {1} [subscribe $rd channel] + assert_equal {2} [psubscribe $rd ch*] + + # Test that the publish notification is ok + $rd client reply off + assert_equal 2 [r publish channel hello] + assert_equal {message channel hello} [$rd read] + assert_equal {pmessage ch* channel hello} [$rd read] + + # Test that the unsubscribe/punsubscribe notification is ok + $rd client reply off + assert_equal {1} [unsubscribe $rd channel] + assert_equal {0} [punsubscribe $rd ch*] + + $rd close + } + + test "PUNSUBSCRIBE from non-subscribed channels" { + set rd1 [redis_deferring_client] + assert_equal {0 0 0} [punsubscribe $rd1 {foo.* bar.* quux.*}] + + # clean up clients + $rd1 close + } + + test "NUMSUB returns numbers, not strings (#1561)" { + r pubsub numsub abc def + } {abc 0 def 0} + + test "NUMPATs returns the number of unique patterns" { + set rd1 [redis_deferring_client] + set rd2 [redis_deferring_client] + + # Three unique patterns and one that overlaps + psubscribe $rd1 "foo*" + psubscribe $rd2 "foo*" + psubscribe $rd1 "bar*" + psubscribe $rd2 "baz*" + + set patterns [r pubsub numpat] + + # clean up clients + punsubscribe $rd1 + punsubscribe $rd2 + assert_equal 3 $patterns + $rd1 close + $rd2 close + } + + test "Mix SUBSCRIBE and PSUBSCRIBE" { + set rd1 [redis_deferring_client] + assert_equal {1} [subscribe $rd1 {foo.bar}] + assert_equal {2} [psubscribe $rd1 {foo.*}] + + assert_equal 2 [r publish foo.bar hello] + assert_equal {message foo.bar hello} [$rd1 read] + assert_equal {pmessage foo.* foo.bar hello} [$rd1 read] + + # clean up clients + $rd1 close + } + + test "PUNSUBSCRIBE and UNSUBSCRIBE should always reply" { + # Make sure we are not subscribed to any channel at all. + r punsubscribe + r unsubscribe + # Now check if the commands still reply correctly. + set reply1 [r punsubscribe] + set reply2 [r unsubscribe] + concat $reply1 $reply2 + } {punsubscribe {} 0 unsubscribe {} 0} + + ### Keyspace events notification tests + + test "Keyspace notifications: we receive keyspace notifications" { + r config set notify-keyspace-events KA + set rd1 [redis_deferring_client] + $rd1 CLIENT REPLY OFF ;# Make sure it works even if replies are silenced + assert_equal {1} [psubscribe $rd1 *] + r set foo bar + assert_equal "pmessage * __keyspace@${db}__:foo set" [$rd1 read] + $rd1 close + } + + test "Keyspace notifications: we receive keyevent notifications" { + r config set notify-keyspace-events EA + set rd1 [redis_deferring_client] + $rd1 CLIENT REPLY SKIP ;# Make sure it works even if replies are silenced + assert_equal {1} [psubscribe $rd1 *] + r set foo bar + assert_equal "pmessage * __keyevent@${db}__:set foo" [$rd1 read] + $rd1 close + } + + test "Keyspace notifications: we can receive both kind of events" { + r config set notify-keyspace-events KEA + set rd1 [redis_deferring_client] + $rd1 CLIENT REPLY ON ;# Just coverage + assert_equal {OK} [$rd1 read] + assert_equal {1} [psubscribe $rd1 *] + r set foo bar + assert_equal "pmessage * __keyspace@${db}__:foo set" [$rd1 read] + assert_equal "pmessage * __keyevent@${db}__:set foo" [$rd1 read] + $rd1 close + } + + test "Keyspace notifications: we are able to mask events" { + r config set notify-keyspace-events KEl + r del mylist + set rd1 [redis_deferring_client] + assert_equal {1} [psubscribe $rd1 *] + r set foo bar + r lpush mylist a + # No notification for set, because only list commands are enabled. + assert_equal "pmessage * __keyspace@${db}__:mylist lpush" [$rd1 read] + assert_equal "pmessage * __keyevent@${db}__:lpush mylist" [$rd1 read] + $rd1 close + } + + test "Keyspace notifications: general events test" { + r config set notify-keyspace-events KEg + set rd1 [redis_deferring_client] + assert_equal {1} [psubscribe $rd1 *] + r set foo bar + r expire foo 1 + r del foo + assert_equal "pmessage * __keyspace@${db}__:foo expire" [$rd1 read] + assert_equal "pmessage * __keyevent@${db}__:expire foo" [$rd1 read] + assert_equal "pmessage * __keyspace@${db}__:foo del" [$rd1 read] + assert_equal "pmessage * __keyevent@${db}__:del foo" [$rd1 read] + $rd1 close + } + + test "Keyspace notifications: list events test" { + r config set notify-keyspace-events KEl + r del mylist + set rd1 [redis_deferring_client] + assert_equal {1} [psubscribe $rd1 *] + r lpush mylist a + r rpush mylist a + r rpop mylist + assert_equal "pmessage * __keyspace@${db}__:mylist lpush" [$rd1 read] + assert_equal "pmessage * __keyevent@${db}__:lpush mylist" [$rd1 read] + assert_equal "pmessage * __keyspace@${db}__:mylist rpush" [$rd1 read] + assert_equal "pmessage * __keyevent@${db}__:rpush mylist" [$rd1 read] + assert_equal "pmessage * __keyspace@${db}__:mylist rpop" [$rd1 read] + assert_equal "pmessage * __keyevent@${db}__:rpop mylist" [$rd1 read] + $rd1 close + } + + test "Keyspace notifications: set events test" { + r config set notify-keyspace-events Ks + r del myset + set rd1 [redis_deferring_client] + assert_equal {1} [psubscribe $rd1 *] + r sadd myset a b c d + r srem myset x + r sadd myset x y z + r srem myset x + assert_equal "pmessage * __keyspace@${db}__:myset sadd" [$rd1 read] + assert_equal "pmessage * __keyspace@${db}__:myset sadd" [$rd1 read] + assert_equal "pmessage * __keyspace@${db}__:myset srem" [$rd1 read] + $rd1 close + } + + test "Keyspace notifications: zset events test" { + r config set notify-keyspace-events Kz + r del myzset + set rd1 [redis_deferring_client] + assert_equal {1} [psubscribe $rd1 *] + r zadd myzset 1 a 2 b + r zrem myzset x + r zadd myzset 3 x 4 y 5 z + r zrem myzset x + assert_equal "pmessage * __keyspace@${db}__:myzset zadd" [$rd1 read] + assert_equal "pmessage * __keyspace@${db}__:myzset zadd" [$rd1 read] + assert_equal "pmessage * __keyspace@${db}__:myzset zrem" [$rd1 read] + $rd1 close + } + + test "Keyspace notifications: hash events test" { + r config set notify-keyspace-events Kh + r del myhash + set rd1 [redis_deferring_client] + assert_equal {1} [psubscribe $rd1 *] + r hmset myhash yes 1 no 0 + r hincrby myhash yes 10 + assert_equal "pmessage * __keyspace@${db}__:myhash hset" [$rd1 read] + assert_equal "pmessage * __keyspace@${db}__:myhash hincrby" [$rd1 read] + $rd1 close + } + + test "Keyspace notifications: stream events test" { + r config set notify-keyspace-events Kt + r del mystream + set rd1 [redis_deferring_client] + assert_equal {1} [psubscribe $rd1 *] + r xgroup create mystream mygroup $ mkstream + r xgroup createconsumer mystream mygroup Bob + set id [r xadd mystream 1 field1 A] + r xreadgroup group mygroup Alice STREAMS mystream > + r xclaim mystream mygroup Mike 0 $id force + # Not notify because of "Lee" not exists. + r xgroup delconsumer mystream mygroup Lee + # Not notify because of "Bob" exists. + r xautoclaim mystream mygroup Bob 0 $id + r xgroup delconsumer mystream mygroup Bob + assert_equal "pmessage * __keyspace@${db}__:mystream xgroup-create" [$rd1 read] + assert_equal "pmessage * __keyspace@${db}__:mystream xgroup-createconsumer" [$rd1 read] + assert_equal "pmessage * __keyspace@${db}__:mystream xadd" [$rd1 read] + assert_equal "pmessage * __keyspace@${db}__:mystream xgroup-createconsumer" [$rd1 read] + assert_equal "pmessage * __keyspace@${db}__:mystream xgroup-createconsumer" [$rd1 read] + assert_equal "pmessage * __keyspace@${db}__:mystream xgroup-delconsumer" [$rd1 read] + $rd1 close + } + + test "Keyspace notifications: expired events (triggered expire)" { + r config set notify-keyspace-events Ex + r del foo + set rd1 [redis_deferring_client] + assert_equal {1} [psubscribe $rd1 *] + r psetex foo 100 1 + wait_for_condition 50 100 { + [r exists foo] == 0 + } else { + fail "Key does not expire?!" + } + assert_equal "pmessage * __keyevent@${db}__:expired foo" [$rd1 read] + $rd1 close + } + + test "Keyspace notifications: expired events (background expire)" { + r config set notify-keyspace-events Ex + r del foo + set rd1 [redis_deferring_client] + assert_equal {1} [psubscribe $rd1 *] + r psetex foo 100 1 + assert_equal "pmessage * __keyevent@${db}__:expired foo" [$rd1 read] + $rd1 close + } + + test "Keyspace notifications: evicted events" { + r config set notify-keyspace-events Ee + r config set maxmemory-policy allkeys-lru + r flushdb + set rd1 [redis_deferring_client] + assert_equal {1} [psubscribe $rd1 *] + r set foo bar + r config set maxmemory 1 + assert_equal "pmessage * __keyevent@${db}__:evicted foo" [$rd1 read] + r config set maxmemory 0 + $rd1 close + r config set maxmemory-policy noeviction + } {OK} {needs:config-maxmemory} + + test "Keyspace notifications: test CONFIG GET/SET of event flags" { + r config set notify-keyspace-events gKE + assert_equal {gKE} [lindex [r config get notify-keyspace-events] 1] + r config set notify-keyspace-events {$lshzxeKE} + assert_equal {$lshzxeKE} [lindex [r config get notify-keyspace-events] 1] + r config set notify-keyspace-events KA + assert_equal {AK} [lindex [r config get notify-keyspace-events] 1] + r config set notify-keyspace-events EA + assert_equal {AE} [lindex [r config get notify-keyspace-events] 1] + } + + test "Keyspace notifications: new key test" { + r config set notify-keyspace-events En + set rd1 [redis_deferring_client] + assert_equal {1} [psubscribe $rd1 *] + r set foo bar + # second set of foo should not cause a 'new' event + r set foo baz + r set bar bar + assert_equal "pmessage * __keyevent@${db}__:new foo" [$rd1 read] + assert_equal "pmessage * __keyevent@${db}__:new bar" [$rd1 read] + $rd1 close + } +} diff --git a/tests/unit/pubsubshard.tcl b/tests/unit/pubsubshard.tcl new file mode 100644 index 0000000..6e3fb61 --- /dev/null +++ b/tests/unit/pubsubshard.tcl @@ -0,0 +1,164 @@ +start_server {tags {"pubsubshard external:skip"}} { + test "SPUBLISH/SSUBSCRIBE basics" { + set rd1 [redis_deferring_client] + + # subscribe to two channels + assert_equal {1} [ssubscribe $rd1 {chan1}] + assert_equal {2} [ssubscribe $rd1 {chan2}] + assert_equal 1 [r SPUBLISH chan1 hello] + assert_equal 1 [r SPUBLISH chan2 world] + assert_equal {smessage chan1 hello} [$rd1 read] + assert_equal {smessage chan2 world} [$rd1 read] + + # unsubscribe from one of the channels + sunsubscribe $rd1 {chan1} + assert_equal 0 [r SPUBLISH chan1 hello] + assert_equal 1 [r SPUBLISH chan2 world] + assert_equal {smessage chan2 world} [$rd1 read] + + # unsubscribe from the remaining channel + sunsubscribe $rd1 {chan2} + assert_equal 0 [r SPUBLISH chan1 hello] + assert_equal 0 [r SPUBLISH chan2 world] + + # clean up clients + $rd1 close + } + + test "SPUBLISH/SSUBSCRIBE with two clients" { + set rd1 [redis_deferring_client] + set rd2 [redis_deferring_client] + + assert_equal {1} [ssubscribe $rd1 {chan1}] + assert_equal {1} [ssubscribe $rd2 {chan1}] + assert_equal 2 [r SPUBLISH chan1 hello] + assert_equal {smessage chan1 hello} [$rd1 read] + assert_equal {smessage chan1 hello} [$rd2 read] + + # clean up clients + $rd1 close + $rd2 close + } + + test "SPUBLISH/SSUBSCRIBE after UNSUBSCRIBE without arguments" { + set rd1 [redis_deferring_client] + assert_equal {1} [ssubscribe $rd1 {chan1}] + assert_equal {2} [ssubscribe $rd1 {chan2}] + assert_equal {3} [ssubscribe $rd1 {chan3}] + sunsubscribe $rd1 + assert_equal 0 [r SPUBLISH chan1 hello] + assert_equal 0 [r SPUBLISH chan2 hello] + assert_equal 0 [r SPUBLISH chan3 hello] + + # clean up clients + $rd1 close + } + + test "SSUBSCRIBE to one channel more than once" { + set rd1 [redis_deferring_client] + assert_equal {1 1 1} [ssubscribe $rd1 {chan1 chan1 chan1}] + assert_equal 1 [r SPUBLISH chan1 hello] + assert_equal {smessage chan1 hello} [$rd1 read] + + # clean up clients + $rd1 close + } + + test "SUNSUBSCRIBE from non-subscribed channels" { + set rd1 [redis_deferring_client] + assert_equal {0} [sunsubscribe $rd1 {foo}] + assert_equal {0} [sunsubscribe $rd1 {bar}] + assert_equal {0} [sunsubscribe $rd1 {quux}] + + # clean up clients + $rd1 close + } + + test "PUBSUB command basics" { + r pubsub shardnumsub abc def + } {abc 0 def 0} + + test "SPUBLISH/SSUBSCRIBE with two clients" { + set rd1 [redis_deferring_client] + set rd2 [redis_deferring_client] + + assert_equal {1} [ssubscribe $rd1 {chan1}] + assert_equal {1} [ssubscribe $rd2 {chan1}] + assert_equal 2 [r SPUBLISH chan1 hello] + assert_equal "chan1 2" [r pubsub shardnumsub chan1] + assert_equal "chan1" [r pubsub shardchannels] + + # clean up clients + $rd1 close + $rd2 close + } + + test "SPUBLISH/SSUBSCRIBE with PUBLISH/SUBSCRIBE" { + set rd1 [redis_deferring_client] + set rd2 [redis_deferring_client] + + assert_equal {1} [ssubscribe $rd1 {chan1}] + assert_equal {1} [subscribe $rd2 {chan1}] + assert_equal 1 [r SPUBLISH chan1 hello] + assert_equal 1 [r publish chan1 hello] + assert_equal "chan1 1" [r pubsub shardnumsub chan1] + assert_equal "chan1 1" [r pubsub numsub chan1] + assert_equal "chan1" [r pubsub shardchannels] + assert_equal "chan1" [r pubsub channels] + + $rd1 close + $rd2 close + } + + test "PubSubShard with CLIENT REPLY OFF" { + set rd [redis_deferring_client] + $rd hello 3 + $rd read ;# Discard the hello reply + + # Test that the ssubscribe notification is ok + $rd client reply off + $rd ping + assert_equal {1} [ssubscribe $rd channel] + + # Test that the spublish notification is ok + $rd client reply off + $rd ping + assert_equal 1 [r spublish channel hello] + assert_equal {smessage channel hello} [$rd read] + + # Test that sunsubscribe notification is ok + $rd client reply off + $rd ping + assert_equal {0} [sunsubscribe $rd channel] + + $rd close + } +} + +start_server {tags {"pubsubshard external:skip"}} { +start_server {tags {"pubsubshard external:skip"}} { + set node_0 [srv 0 client] + set node_0_host [srv 0 host] + set node_0_port [srv 0 port] + + set node_1 [srv -1 client] + set node_1_host [srv -1 host] + set node_1_port [srv -1 port] + + test {setup replication for following tests} { + $node_1 replicaof $node_0_host $node_0_port + wait_for_sync $node_1 + } + + test {publish message to master and receive on replica} { + set rd0 [redis_deferring_client node_0_host node_0_port] + set rd1 [redis_deferring_client node_1_host node_1_port] + + assert_equal {1} [ssubscribe $rd1 {chan1}] + $rd0 SPUBLISH chan1 hello + assert_equal {smessage chan1 hello} [$rd1 read] + $rd0 SPUBLISH chan1 world + assert_equal {smessage chan1 world} [$rd1 read] + } +} +}
\ No newline at end of file diff --git a/tests/unit/querybuf.tcl b/tests/unit/querybuf.tcl new file mode 100644 index 0000000..bbbea12 --- /dev/null +++ b/tests/unit/querybuf.tcl @@ -0,0 +1,66 @@ +proc client_idle_sec {name} { + set clients [split [r client list] "\r\n"] + set c [lsearch -inline $clients *name=$name*] + assert {[regexp {idle=([0-9]+)} $c - idle]} + return $idle +} + +# Calculate query buffer memory of slave +proc client_query_buffer {name} { + set clients [split [r client list] "\r\n"] + set c [lsearch -inline $clients *name=$name*] + if {[string length $c] > 0} { + assert {[regexp {qbuf=([0-9]+)} $c - qbuf]} + assert {[regexp {qbuf-free=([0-9]+)} $c - qbuf_free]} + return [expr $qbuf + $qbuf_free] + } + return 0 +} + +start_server {tags {"querybuf slow"}} { + # The test will run at least 2s to check if client query + # buffer will be resized when client idle 2s. + test "query buffer resized correctly" { + set rd [redis_client] + $rd client setname test_client + set orig_test_client_qbuf [client_query_buffer test_client] + # Make sure query buff has less than the peak resize threshold (PROTO_RESIZE_THRESHOLD) 32k + # but at least the basic IO reading buffer size (PROTO_IOBUF_LEN) 16k + assert {$orig_test_client_qbuf >= 16384 && $orig_test_client_qbuf < 32768} + + # Check that the initial query buffer is resized after 2 sec + wait_for_condition 1000 10 { + [client_idle_sec test_client] >= 3 && [client_query_buffer test_client] == 0 + } else { + fail "query buffer was not resized" + } + $rd close + } + + test "query buffer resized correctly when not idle" { + # Memory will increase by more than 32k due to client query buffer. + set rd [redis_client] + $rd client setname test_client + + # Create a large query buffer (more than PROTO_RESIZE_THRESHOLD - 32k) + $rd set x [string repeat A 400000] + + # Make sure query buff is larger than the peak resize threshold (PROTO_RESIZE_THRESHOLD) 32k + set orig_test_client_qbuf [client_query_buffer test_client] + assert {$orig_test_client_qbuf > 32768} + + # Wait for qbuf to shrink due to lower peak + set t [clock milliseconds] + while true { + # Write something smaller, so query buf peak can shrink + $rd set x [string repeat A 100] + set new_test_client_qbuf [client_query_buffer test_client] + if {$new_test_client_qbuf < $orig_test_client_qbuf} { break } + if {[expr [clock milliseconds] - $t] > 1000} { break } + after 10 + } + # Validate qbuf shrunk but isn't 0 since we maintain room based on latest peak + assert {[client_query_buffer test_client] > 0 && [client_query_buffer test_client] < $orig_test_client_qbuf} + $rd close + } +} diff --git a/tests/unit/quit.tcl b/tests/unit/quit.tcl new file mode 100644 index 0000000..4cf440a --- /dev/null +++ b/tests/unit/quit.tcl @@ -0,0 +1,40 @@ +start_server {tags {"quit"}} { + proc format_command {args} { + set cmd "*[llength $args]\r\n" + foreach a $args { + append cmd "$[string length $a]\r\n$a\r\n" + } + set _ $cmd + } + + test "QUIT returns OK" { + reconnect + assert_equal OK [r quit] + assert_error * {r ping} + } + + test "Pipelined commands after QUIT must not be executed" { + reconnect + r write [format_command quit] + r write [format_command set foo bar] + r flush + assert_equal OK [r read] + assert_error * {r read} + + reconnect + assert_equal {} [r get foo] + } + + test "Pipelined commands after QUIT that exceed read buffer size" { + reconnect + r write [format_command quit] + r write [format_command set foo [string repeat "x" 1024]] + r flush + assert_equal OK [r read] + assert_error * {r read} + + reconnect + assert_equal {} [r get foo] + + } +} diff --git a/tests/unit/replybufsize.tcl b/tests/unit/replybufsize.tcl new file mode 100644 index 0000000..933189e --- /dev/null +++ b/tests/unit/replybufsize.tcl @@ -0,0 +1,47 @@ +proc get_reply_buffer_size {cname} { + + set clients [split [string trim [r client list]] "\r\n"] + set c [lsearch -inline $clients *name=$cname*] + if {![regexp rbs=(\[a-zA-Z0-9-\]+) $c - rbufsize]} { + error "field rbs not found in $c" + } + return $rbufsize +} + +start_server {tags {"replybufsize"}} { + + test {verify reply buffer limits} { + # In order to reduce test time we can set the peak reset time very low + r debug replybuffer peak-reset-time 100 + + # Create a simple idle test client + variable tc [redis_client] + $tc client setname test_client + + # make sure the client is idle for 1 seconds to make it shrink the reply buffer + wait_for_condition 10 100 { + [get_reply_buffer_size test_client] >= 1024 && [get_reply_buffer_size test_client] < 2046 + } else { + set rbs [get_reply_buffer_size test_client] + fail "reply buffer of idle client is $rbs after 1 seconds" + } + + r set bigval [string repeat x 32768] + + # In order to reduce test time we can set the peak reset time very low + r debug replybuffer peak-reset-time never + + wait_for_condition 10 100 { + [$tc get bigval ; get_reply_buffer_size test_client] >= 16384 && [get_reply_buffer_size test_client] < 32768 + } else { + set rbs [get_reply_buffer_size test_client] + fail "reply buffer of busy client is $rbs after 1 seconds" + } + + # Restore the peak reset time to default + r debug replybuffer peak-reset-time reset + + $tc close + } {0} {needs:debug} +} +
\ No newline at end of file diff --git a/tests/unit/scan.tcl b/tests/unit/scan.tcl new file mode 100644 index 0000000..5dea76b --- /dev/null +++ b/tests/unit/scan.tcl @@ -0,0 +1,330 @@ +start_server {tags {"scan network"}} { + test "SCAN basic" { + r flushdb + populate 1000 + + set cur 0 + set keys {} + while 1 { + set res [r scan $cur] + set cur [lindex $res 0] + set k [lindex $res 1] + lappend keys {*}$k + if {$cur == 0} break + } + + set keys [lsort -unique $keys] + assert_equal 1000 [llength $keys] + } + + test "SCAN COUNT" { + r flushdb + populate 1000 + + set cur 0 + set keys {} + while 1 { + set res [r scan $cur count 5] + set cur [lindex $res 0] + set k [lindex $res 1] + lappend keys {*}$k + if {$cur == 0} break + } + + set keys [lsort -unique $keys] + assert_equal 1000 [llength $keys] + } + + test "SCAN MATCH" { + r flushdb + populate 1000 + + set cur 0 + set keys {} + while 1 { + set res [r scan $cur match "key:1??"] + set cur [lindex $res 0] + set k [lindex $res 1] + lappend keys {*}$k + if {$cur == 0} break + } + + set keys [lsort -unique $keys] + assert_equal 100 [llength $keys] + } + + test "SCAN TYPE" { + r flushdb + # populate only creates strings + populate 1000 + + # Check non-strings are excluded + set cur 0 + set keys {} + while 1 { + set res [r scan $cur type "list"] + set cur [lindex $res 0] + set k [lindex $res 1] + lappend keys {*}$k + if {$cur == 0} break + } + + assert_equal 0 [llength $keys] + + # Check strings are included + set cur 0 + set keys {} + while 1 { + set res [r scan $cur type "string"] + set cur [lindex $res 0] + set k [lindex $res 1] + lappend keys {*}$k + if {$cur == 0} break + } + + assert_equal 1000 [llength $keys] + + # Check all three args work together + set cur 0 + set keys {} + while 1 { + set res [r scan $cur type "string" match "key:*" count 10] + set cur [lindex $res 0] + set k [lindex $res 1] + lappend keys {*}$k + if {$cur == 0} break + } + + assert_equal 1000 [llength $keys] + } + + foreach enc {intset hashtable} { + test "SSCAN with encoding $enc" { + # Create the Set + r del set + if {$enc eq {intset}} { + set prefix "" + } else { + set prefix "ele:" + } + set elements {} + for {set j 0} {$j < 100} {incr j} { + lappend elements ${prefix}${j} + } + r sadd set {*}$elements + + # Verify that the encoding matches. + assert_encoding $enc set + + # Test SSCAN + set cur 0 + set keys {} + while 1 { + set res [r sscan set $cur] + set cur [lindex $res 0] + set k [lindex $res 1] + lappend keys {*}$k + if {$cur == 0} break + } + + set keys [lsort -unique $keys] + assert_equal 100 [llength $keys] + } + } + + foreach enc {listpack hashtable} { + test "HSCAN with encoding $enc" { + # Create the Hash + r del hash + if {$enc eq {listpack}} { + set count 30 + } else { + set count 1000 + } + set elements {} + for {set j 0} {$j < $count} {incr j} { + lappend elements key:$j $j + } + r hmset hash {*}$elements + + # Verify that the encoding matches. + assert_encoding $enc hash + + # Test HSCAN + set cur 0 + set keys {} + while 1 { + set res [r hscan hash $cur] + set cur [lindex $res 0] + set k [lindex $res 1] + lappend keys {*}$k + if {$cur == 0} break + } + + set keys2 {} + foreach {k v} $keys { + assert {$k eq "key:$v"} + lappend keys2 $k + } + + set keys2 [lsort -unique $keys2] + assert_equal $count [llength $keys2] + } + } + + foreach enc {listpack skiplist} { + test "ZSCAN with encoding $enc" { + # Create the Sorted Set + r del zset + if {$enc eq {listpack}} { + set count 30 + } else { + set count 1000 + } + set elements {} + for {set j 0} {$j < $count} {incr j} { + lappend elements $j key:$j + } + r zadd zset {*}$elements + + # Verify that the encoding matches. + assert_encoding $enc zset + + # Test ZSCAN + set cur 0 + set keys {} + while 1 { + set res [r zscan zset $cur] + set cur [lindex $res 0] + set k [lindex $res 1] + lappend keys {*}$k + if {$cur == 0} break + } + + set keys2 {} + foreach {k v} $keys { + assert {$k eq "key:$v"} + lappend keys2 $k + } + + set keys2 [lsort -unique $keys2] + assert_equal $count [llength $keys2] + } + } + + test "SCAN guarantees check under write load" { + r flushdb + populate 100 + + # We start scanning here, so keys from 0 to 99 should all be + # reported at the end of the iteration. + set keys {} + while 1 { + set res [r scan $cur] + set cur [lindex $res 0] + set k [lindex $res 1] + lappend keys {*}$k + if {$cur == 0} break + # Write 10 random keys at every SCAN iteration. + for {set j 0} {$j < 10} {incr j} { + r set addedkey:[randomInt 1000] foo + } + } + + set keys2 {} + foreach k $keys { + if {[string length $k] > 6} continue + lappend keys2 $k + } + + set keys2 [lsort -unique $keys2] + assert_equal 100 [llength $keys2] + } + + test "SSCAN with integer encoded object (issue #1345)" { + set objects {1 a} + r del set + r sadd set {*}$objects + set res [r sscan set 0 MATCH *a* COUNT 100] + assert_equal [lsort -unique [lindex $res 1]] {a} + set res [r sscan set 0 MATCH *1* COUNT 100] + assert_equal [lsort -unique [lindex $res 1]] {1} + } + + test "SSCAN with PATTERN" { + r del mykey + r sadd mykey foo fab fiz foobar 1 2 3 4 + set res [r sscan mykey 0 MATCH foo* COUNT 10000] + lsort -unique [lindex $res 1] + } {foo foobar} + + test "HSCAN with PATTERN" { + r del mykey + r hmset mykey foo 1 fab 2 fiz 3 foobar 10 1 a 2 b 3 c 4 d + set res [r hscan mykey 0 MATCH foo* COUNT 10000] + lsort -unique [lindex $res 1] + } {1 10 foo foobar} + + test "ZSCAN with PATTERN" { + r del mykey + r zadd mykey 1 foo 2 fab 3 fiz 10 foobar + set res [r zscan mykey 0 MATCH foo* COUNT 10000] + lsort -unique [lindex $res 1] + } + + test "ZSCAN scores: regression test for issue #2175" { + r del mykey + for {set j 0} {$j < 500} {incr j} { + r zadd mykey 9.8813129168249309e-323 $j + } + set res [lindex [r zscan mykey 0] 1] + set first_score [lindex $res 1] + assert {$first_score != 0} + } + + test "SCAN regression test for issue #4906" { + for {set k 0} {$k < 100} {incr k} { + r del set + r sadd set x; # Make sure it's not intset encoded + set toremove {} + unset -nocomplain found + array set found {} + + # Populate the set + set numele [expr {101+[randomInt 1000]}] + for {set j 0} {$j < $numele} {incr j} { + r sadd set $j + if {$j >= 100} { + lappend toremove $j + } + } + + # Start scanning + set cursor 0 + set iteration 0 + set del_iteration [randomInt 10] + while {!($cursor == 0 && $iteration != 0)} { + lassign [r sscan set $cursor] cursor items + + # Mark found items. We expect to find from 0 to 99 at the end + # since those elements will never be removed during the scanning. + foreach i $items { + set found($i) 1 + } + incr iteration + # At some point remove most of the items to trigger the + # rehashing to a smaller hash table. + if {$iteration == $del_iteration} { + r srem set {*}$toremove + } + } + + # Verify that SSCAN reported everything from 0 to 99 + for {set j 0} {$j < 100} {incr j} { + if {![info exists found($j)]} { + fail "SSCAN element missing $j" + } + } + } + } +} diff --git a/tests/unit/scripting.tcl b/tests/unit/scripting.tcl new file mode 100644 index 0000000..4b65131 --- /dev/null +++ b/tests/unit/scripting.tcl @@ -0,0 +1,2053 @@ +foreach is_eval {0 1} { + +if {$is_eval == 1} { + proc run_script {args} { + r eval {*}$args + } + proc run_script_ro {args} { + r eval_ro {*}$args + } + proc run_script_on_connection {args} { + [lindex $args 0] eval {*}[lrange $args 1 end] + } + proc kill_script {args} { + r script kill + } +} else { + proc run_script {args} { + r function load replace [format "#!lua name=test\nredis.register_function('test', function(KEYS, ARGV)\n %s \nend)" [lindex $args 0]] + if {[r readingraw] eq 1} { + # read name + assert_equal {test} [r read] + } + r fcall test {*}[lrange $args 1 end] + } + proc run_script_ro {args} { + r function load replace [format "#!lua name=test\nredis.register_function{function_name='test', callback=function(KEYS, ARGV)\n %s \nend, flags={'no-writes'}}" [lindex $args 0]] + if {[r readingraw] eq 1} { + # read name + assert_equal {test} [r read] + } + r fcall_ro test {*}[lrange $args 1 end] + } + proc run_script_on_connection {args} { + set rd [lindex $args 0] + $rd function load replace [format "#!lua name=test\nredis.register_function('test', function(KEYS, ARGV)\n %s \nend)" [lindex $args 1]] + # read name + $rd read + $rd fcall test {*}[lrange $args 2 end] + } + proc kill_script {args} { + r function kill + } +} + +start_server {tags {"scripting"}} { + + if {$is_eval eq 1} { + test {Script - disallow write on OOM} { + r config set maxmemory 1 + + catch {[r eval "redis.call('set', 'x', 1)" 0]} e + assert_match {*command not allowed when used memory*} $e + + r config set maxmemory 0 + } {OK} {needs:config-maxmemory} + } ;# is_eval + + test {EVAL - Does Lua interpreter replies to our requests?} { + run_script {return 'hello'} 0 + } {hello} + + test {EVAL - Return _G} { + run_script {return _G} 0 + } {} + + test {EVAL - Return table with a metatable that raise error} { + run_script {local a = {}; setmetatable(a,{__index=function() foo() end}) return a} 0 + } {} + + test {EVAL - Return table with a metatable that call redis} { + run_script {local a = {}; setmetatable(a,{__index=function() redis.call('set', 'x', '1') end}) return a} 0 + # make sure x was not set + r get x + } {} + + test {EVAL - Lua integer -> Redis protocol type conversion} { + run_script {return 100.5} 0 + } {100} + + test {EVAL - Lua string -> Redis protocol type conversion} { + run_script {return 'hello world'} 0 + } {hello world} + + test {EVAL - Lua true boolean -> Redis protocol type conversion} { + run_script {return true} 0 + } {1} + + test {EVAL - Lua false boolean -> Redis protocol type conversion} { + run_script {return false} 0 + } {} + + test {EVAL - Lua status code reply -> Redis protocol type conversion} { + run_script {return {ok='fine'}} 0 + } {fine} + + test {EVAL - Lua error reply -> Redis protocol type conversion} { + catch { + run_script {return {err='ERR this is an error'}} 0 + } e + set _ $e + } {ERR this is an error} + + test {EVAL - Lua table -> Redis protocol type conversion} { + run_script {return {1,2,3,'ciao',{1,2}}} 0 + } {1 2 3 ciao {1 2}} + + test {EVAL - Are the KEYS and ARGV arrays populated correctly?} { + run_script {return {KEYS[1],KEYS[2],ARGV[1],ARGV[2]}} 2 a{t} b{t} c{t} d{t} + } {a{t} b{t} c{t} d{t}} + + test {EVAL - is Lua able to call Redis API?} { + r set mykey myval + run_script {return redis.call('get',KEYS[1])} 1 mykey + } {myval} + + if {$is_eval eq 1} { + # eval sha is only relevant for is_eval Lua + test {EVALSHA - Can we call a SHA1 if already defined?} { + r evalsha fd758d1589d044dd850a6f05d52f2eefd27f033f 1 mykey + } {myval} + + test {EVALSHA - Can we call a SHA1 in uppercase?} { + r evalsha FD758D1589D044DD850A6F05D52F2EEFD27F033F 1 mykey + } {myval} + + test {EVALSHA - Do we get an error on invalid SHA1?} { + catch {r evalsha NotValidShaSUM 0} e + set _ $e + } {NOSCRIPT*} + + test {EVALSHA - Do we get an error on non defined SHA1?} { + catch {r evalsha ffd632c7d33e571e9f24556ebed26c3479a87130 0} e + set _ $e + } {NOSCRIPT*} + } ;# is_eval + + test {EVAL - Redis integer -> Lua type conversion} { + r set x 0 + run_script { + local foo = redis.pcall('incr',KEYS[1]) + return {type(foo),foo} + } 1 x + } {number 1} + + test {EVAL - Redis bulk -> Lua type conversion} { + r set mykey myval + run_script { + local foo = redis.pcall('get',KEYS[1]) + return {type(foo),foo} + } 1 mykey + } {string myval} + + test {EVAL - Redis multi bulk -> Lua type conversion} { + r del mylist + r rpush mylist a + r rpush mylist b + r rpush mylist c + run_script { + local foo = redis.pcall('lrange',KEYS[1],0,-1) + return {type(foo),foo[1],foo[2],foo[3],# foo} + } 1 mylist + } {table a b c 3} + + test {EVAL - Redis status reply -> Lua type conversion} { + run_script { + local foo = redis.pcall('set',KEYS[1],'myval') + return {type(foo),foo['ok']} + } 1 mykey + } {table OK} + + test {EVAL - Redis error reply -> Lua type conversion} { + r set mykey myval + run_script { + local foo = redis.pcall('incr',KEYS[1]) + return {type(foo),foo['err']} + } 1 mykey + } {table {ERR value is not an integer or out of range}} + + test {EVAL - Redis nil bulk reply -> Lua type conversion} { + r del mykey + run_script { + local foo = redis.pcall('get',KEYS[1]) + return {type(foo),foo == false} + } 1 mykey + } {boolean 1} + + test {EVAL - Is the Lua client using the currently selected DB?} { + r set mykey "this is DB 9" + r select 10 + r set mykey "this is DB 10" + run_script {return redis.pcall('get',KEYS[1])} 1 mykey + } {this is DB 10} {singledb:skip} + + test {EVAL - SELECT inside Lua should not affect the caller} { + # here we DB 10 is selected + r set mykey "original value" + run_script {return redis.pcall('select','9')} 0 + set res [r get mykey] + r select 9 + set res + } {original value} {singledb:skip} + + if 0 { + test {EVAL - Script can't run more than configured time limit} { + r config set lua-time-limit 1 + catch { + run_script { + local i = 0 + while true do i=i+1 end + } 0 + } e + set _ $e + } {*execution time*} + } + + test {EVAL - Scripts can't run blpop command} { + set e {} + catch {run_script {return redis.pcall('blpop','x',0)} 0} e + set e + } {*not allowed*} + + test {EVAL - Scripts can't run brpop command} { + set e {} + catch {run_script {return redis.pcall('brpop','empty_list',0)} 0} e + set e + } {*not allowed*} + + test {EVAL - Scripts can't run brpoplpush command} { + set e {} + catch {run_script {return redis.pcall('brpoplpush','empty_list1', 'empty_list2',0)} 0} e + set e + } {*not allowed*} + + test {EVAL - Scripts can't run blmove command} { + set e {} + catch {run_script {return redis.pcall('blmove','empty_list1', 'empty_list2', 'LEFT', 'LEFT', 0)} 0} e + set e + } {*not allowed*} + + test {EVAL - Scripts can't run bzpopmin command} { + set e {} + catch {run_script {return redis.pcall('bzpopmin','empty_zset', 0)} 0} e + set e + } {*not allowed*} + + test {EVAL - Scripts can't run bzpopmax command} { + set e {} + catch {run_script {return redis.pcall('bzpopmax','empty_zset', 0)} 0} e + set e + } {*not allowed*} + + test {EVAL - Scripts can't run XREAD and XREADGROUP with BLOCK option} { + r del s + r xgroup create s g $ MKSTREAM + set res [run_script {return redis.pcall('xread','STREAMS','s','$')} 1 s] + assert {$res eq {}} + assert_error "*xread command is not allowed with BLOCK option from scripts" {run_script {return redis.pcall('xread','BLOCK',0,'STREAMS','s','$')} 1 s} + set res [run_script {return redis.pcall('xreadgroup','group','g','c','STREAMS','s','>')} 1 s] + assert {$res eq {}} + assert_error "*xreadgroup command is not allowed with BLOCK option from scripts" {run_script {return redis.pcall('xreadgroup','group','g','c','BLOCK',0,'STREAMS','s','>')} 1 s} + } + + test {EVAL - Scripts can run non-deterministic commands} { + set e {} + catch { + run_script "redis.pcall('randomkey'); return redis.pcall('set','x','ciao')" 0 + } e + set e + } {*OK*} + + test {EVAL - No arguments to redis.call/pcall is considered an error} { + set e {} + catch {run_script {return redis.call()} 0} e + set e + } {*one argument*} + + test {EVAL - redis.call variant raises a Lua error on Redis cmd error (1)} { + set e {} + catch { + run_script "redis.call('nosuchcommand')" 0 + } e + set e + } {*Unknown Redis*} + + test {EVAL - redis.call variant raises a Lua error on Redis cmd error (1)} { + set e {} + catch { + run_script "redis.call('get','a','b','c')" 0 + } e + set e + } {*number of args*} + + test {EVAL - redis.call variant raises a Lua error on Redis cmd error (1)} { + set e {} + r set foo bar + catch { + run_script {redis.call('lpush',KEYS[1],'val')} 1 foo + } e + set e + } {*against a key*} + + test {EVAL - JSON numeric decoding} { + # We must return the table as a string because otherwise + # Redis converts floats to ints and we get 0 and 1023 instead + # of 0.0003 and 1023.2 as the parsed output. + run_script {return + table.concat( + cjson.decode( + "[0.0, -5e3, -1, 0.3e-3, 1023.2, 0e10]"), " ") + } 0 + } {0 -5000 -1 0.0003 1023.2 0} + + test {EVAL - JSON string decoding} { + run_script {local decoded = cjson.decode('{"keya": "a", "keyb": "b"}') + return {decoded.keya, decoded.keyb} + } 0 + } {a b} + + test {EVAL - JSON smoke test} { + run_script { + local some_map = { + s1="Some string", + n1=100, + a1={"Some","String","Array"}, + nil1=nil, + b1=true, + b2=false} + local encoded = cjson.encode(some_map) + local decoded = cjson.decode(encoded) + assert(table.concat(some_map) == table.concat(decoded)) + + cjson.encode_keep_buffer(false) + encoded = cjson.encode(some_map) + decoded = cjson.decode(encoded) + assert(table.concat(some_map) == table.concat(decoded)) + + -- Table with numeric keys + local table1 = {one="one", [1]="one"} + encoded = cjson.encode(table1) + decoded = cjson.decode(encoded) + assert(decoded["one"] == table1["one"]) + assert(decoded["1"] == table1[1]) + + -- Array + local array1 = {[1]="one", [2]="two"} + encoded = cjson.encode(array1) + decoded = cjson.decode(encoded) + assert(table.concat(array1) == table.concat(decoded)) + + -- Invalid keys + local invalid_map = {} + invalid_map[false] = "false" + local ok, encoded = pcall(cjson.encode, invalid_map) + assert(ok == false) + + -- Max depth + cjson.encode_max_depth(1) + ok, encoded = pcall(cjson.encode, some_map) + assert(ok == false) + + cjson.decode_max_depth(1) + ok, decoded = pcall(cjson.decode, '{"obj": {"array": [1,2,3,4]}}') + assert(ok == false) + + -- Invalid numbers + ok, encoded = pcall(cjson.encode, {num1=0/0}) + assert(ok == false) + cjson.encode_invalid_numbers(true) + ok, encoded = pcall(cjson.encode, {num1=0/0}) + assert(ok == true) + + -- Restore defaults + cjson.decode_max_depth(1000) + cjson.encode_max_depth(1000) + cjson.encode_invalid_numbers(false) + } 0 + } + + test {EVAL - cmsgpack can pack double?} { + run_script {local encoded = cmsgpack.pack(0.1) + local h = "" + for i = 1, #encoded do + h = h .. string.format("%02x",string.byte(encoded,i)) + end + return h + } 0 + } {cb3fb999999999999a} + + test {EVAL - cmsgpack can pack negative int64?} { + run_script {local encoded = cmsgpack.pack(-1099511627776) + local h = "" + for i = 1, #encoded do + h = h .. string.format("%02x",string.byte(encoded,i)) + end + return h + } 0 + } {d3ffffff0000000000} + + test {EVAL - cmsgpack pack/unpack smoke test} { + run_script { + local str_lt_32 = string.rep("x", 30) + local str_lt_255 = string.rep("x", 250) + local str_lt_65535 = string.rep("x", 65530) + local str_long = string.rep("x", 100000) + local array_lt_15 = {1, 2, 3, 4, 5} + local array_lt_65535 = {1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18} + local array_big = {} + for i=1, 100000 do + array_big[i] = i + end + local map_lt_15 = {a=1, b=2} + local map_big = {} + for i=1, 100000 do + map_big[tostring(i)] = i + end + local some_map = { + s1=str_lt_32, + s2=str_lt_255, + s3=str_lt_65535, + s4=str_long, + d1=0.1, + i1=1, + i2=250, + i3=65530, + i4=100000, + i5=2^40, + i6=-1, + i7=-120, + i8=-32000, + i9=-100000, + i10=-3147483648, + a1=array_lt_15, + a2=array_lt_65535, + a3=array_big, + m1=map_lt_15, + m2=map_big, + b1=false, + b2=true, + n=nil + } + local encoded = cmsgpack.pack(some_map) + local decoded = cmsgpack.unpack(encoded) + assert(table.concat(some_map) == table.concat(decoded)) + local offset, decoded_one = cmsgpack.unpack_one(encoded, 0) + assert(table.concat(some_map) == table.concat(decoded_one)) + assert(offset == -1) + + local encoded_multiple = cmsgpack.pack(str_lt_32, str_lt_255, str_lt_65535, str_long) + local offset, obj = cmsgpack.unpack_limit(encoded_multiple, 1, 0) + assert(obj == str_lt_32) + offset, obj = cmsgpack.unpack_limit(encoded_multiple, 1, offset) + assert(obj == str_lt_255) + offset, obj = cmsgpack.unpack_limit(encoded_multiple, 1, offset) + assert(obj == str_lt_65535) + offset, obj = cmsgpack.unpack_limit(encoded_multiple, 1, offset) + assert(obj == str_long) + assert(offset == -1) + } 0 + } + + test {EVAL - cmsgpack can pack and unpack circular references?} { + run_script {local a = {x=nil,y=5} + local b = {x=a} + a['x'] = b + local encoded = cmsgpack.pack(a) + local h = "" + -- cmsgpack encodes to a depth of 16, but can't encode + -- references, so the encoded object has a deep copy recursive + -- depth of 16. + for i = 1, #encoded do + h = h .. string.format("%02x",string.byte(encoded,i)) + end + -- when unpacked, re.x.x != re because the unpack creates + -- individual tables down to a depth of 16. + -- (that's why the encoded output is so large) + local re = cmsgpack.unpack(encoded) + assert(re) + assert(re.x) + assert(re.x.x.y == re.y) + assert(re.x.x.x.x.y == re.y) + assert(re.x.x.x.x.x.x.y == re.y) + assert(re.x.x.x.x.x.x.x.x.x.x.y == re.y) + -- maximum working depth: + assert(re.x.x.x.x.x.x.x.x.x.x.x.x.x.x.y == re.y) + -- now the last x would be b above and has no y + assert(re.x.x.x.x.x.x.x.x.x.x.x.x.x.x.x) + -- so, the final x.x is at the depth limit and was assigned nil + assert(re.x.x.x.x.x.x.x.x.x.x.x.x.x.x.x.x == nil) + return {h, re.x.x.x.x.x.x.x.x.y == re.y, re.y == 5} + } 0 + } {82a17905a17881a17882a17905a17881a17882a17905a17881a17882a17905a17881a17882a17905a17881a17882a17905a17881a17882a17905a17881a17882a17905a17881a178c0 1 1} + + test {EVAL - Numerical sanity check from bitop} { + run_script {assert(0x7fffffff == 2147483647, "broken hex literals"); + assert(0xffffffff == -1 or 0xffffffff == 2^32-1, + "broken hex literals"); + assert(tostring(-1) == "-1", "broken tostring()"); + assert(tostring(0xffffffff) == "-1" or + tostring(0xffffffff) == "4294967295", + "broken tostring()") + } 0 + } {} + + test {EVAL - Verify minimal bitop functionality} { + run_script {assert(bit.tobit(1) == 1); + assert(bit.band(1) == 1); + assert(bit.bxor(1,2) == 3); + assert(bit.bor(1,2,4,8,16,32,64,128) == 255) + } 0 + } {} + + test {EVAL - Able to parse trailing comments} { + run_script {return 'hello' --trailing comment} 0 + } {hello} + + test {EVAL_RO - Successful case} { + r set foo bar + assert_equal bar [run_script_ro {return redis.call('get', KEYS[1]);} 1 foo] + } + + test {EVAL_RO - Cannot run write commands} { + r set foo bar + catch {run_script_ro {redis.call('del', KEYS[1]);} 1 foo} e + set e + } {ERR Write commands are not allowed from read-only scripts*} + + if {$is_eval eq 1} { + # script command is only relevant for is_eval Lua + test {SCRIPTING FLUSH - is able to clear the scripts cache?} { + r set mykey myval + set v [r evalsha fd758d1589d044dd850a6f05d52f2eefd27f033f 1 mykey] + assert_equal $v myval + set e "" + r script flush + catch {r evalsha fd758d1589d044dd850a6f05d52f2eefd27f033f 1 mykey} e + set e + } {NOSCRIPT*} + + test {SCRIPTING FLUSH ASYNC} { + for {set j 0} {$j < 100} {incr j} { + r script load "return $j" + } + assert { [string match "*number_of_cached_scripts:100*" [r info Memory]] } + r script flush async + assert { [string match "*number_of_cached_scripts:0*" [r info Memory]] } + } + + test {SCRIPT EXISTS - can detect already defined scripts?} { + r eval "return 1+1" 0 + r script exists a27e7e8a43702b7046d4f6a7ccf5b60cef6b9bd9 a27e7e8a43702b7046d4f6a7ccf5b60cef6b9bda + } {1 0} + + test {SCRIPT LOAD - is able to register scripts in the scripting cache} { + list \ + [r script load "return 'loaded'"] \ + [r evalsha b534286061d4b9e4026607613b95c06c06015ae8 0] + } {b534286061d4b9e4026607613b95c06c06015ae8 loaded} + + test "SORT is normally not alpha re-ordered for the scripting engine" { + r del myset + r sadd myset 1 2 3 4 10 + r eval {return redis.call('sort',KEYS[1],'desc')} 1 myset + } {10 4 3 2 1} {cluster:skip} + + test "SORT BY <constant> output gets ordered for scripting" { + r del myset + r sadd myset a b c d e f g h i l m n o p q r s t u v z aa aaa azz + r eval {return redis.call('sort',KEYS[1],'by','_')} 1 myset + } {a aa aaa azz b c d e f g h i l m n o p q r s t u v z} {cluster:skip} + + test "SORT BY <constant> with GET gets ordered for scripting" { + r del myset + r sadd myset a b c + r eval {return redis.call('sort',KEYS[1],'by','_','get','#','get','_:*')} 1 myset + } {a {} b {} c {}} {cluster:skip} + } ;# is_eval + + test "redis.sha1hex() implementation" { + list [run_script {return redis.sha1hex('')} 0] \ + [run_script {return redis.sha1hex('Pizza & Mandolino')} 0] + } {da39a3ee5e6b4b0d3255bfef95601890afd80709 74822d82031af7493c20eefa13bd07ec4fada82f} + + test {Globals protection reading an undeclared global variable} { + catch {run_script {return a} 0} e + set e + } {ERR *attempted to access * global*} + + test {Globals protection setting an undeclared global*} { + catch {run_script {a=10} 0} e + set e + } {ERR *Attempt to modify a readonly table*} + + test {Test an example script DECR_IF_GT} { + set decr_if_gt { + local current + + current = redis.call('get',KEYS[1]) + if not current then return nil end + if current > ARGV[1] then + return redis.call('decr',KEYS[1]) + else + return redis.call('get',KEYS[1]) + end + } + r set foo 5 + set res {} + lappend res [run_script $decr_if_gt 1 foo 2] + lappend res [run_script $decr_if_gt 1 foo 2] + lappend res [run_script $decr_if_gt 1 foo 2] + lappend res [run_script $decr_if_gt 1 foo 2] + lappend res [run_script $decr_if_gt 1 foo 2] + set res + } {4 3 2 2 2} + + if {$is_eval eq 1} { + # random handling is only relevant for is_eval Lua + test {random numbers are random now} { + set rand1 [r eval {return tostring(math.random())} 0] + wait_for_condition 100 1 { + $rand1 ne [r eval {return tostring(math.random())} 0] + } else { + fail "random numbers should be random, now it's fixed value" + } + } + + test {Scripting engine PRNG can be seeded correctly} { + set rand1 [r eval { + math.randomseed(ARGV[1]); return tostring(math.random()) + } 0 10] + set rand2 [r eval { + math.randomseed(ARGV[1]); return tostring(math.random()) + } 0 10] + set rand3 [r eval { + math.randomseed(ARGV[1]); return tostring(math.random()) + } 0 20] + assert_equal $rand1 $rand2 + assert {$rand2 ne $rand3} + } + } ;# is_eval + + test {EVAL does not leak in the Lua stack} { + r script flush ;# reset Lua VM + r set x 0 + # Use a non blocking client to speedup the loop. + set rd [redis_deferring_client] + for {set j 0} {$j < 10000} {incr j} { + run_script_on_connection $rd {return redis.call("incr",KEYS[1])} 1 x + } + for {set j 0} {$j < 10000} {incr j} { + $rd read + } + assert {[s used_memory_lua] < 1024*100} + $rd close + r get x + } {10000} + + if {$is_eval eq 1} { + test {SPOP: We can call scripts rewriting client->argv from Lua} { + set repl [attach_to_replication_stream] + #this sadd operation is for external-cluster test. If myset doesn't exist, 'del myset' won't get propagated. + r sadd myset ppp + r del myset + r sadd myset a b c + assert {[r eval {return redis.call('spop', 'myset')} 0] ne {}} + assert {[r eval {return redis.call('spop', 'myset', 1)} 0] ne {}} + assert {[r eval {return redis.call('spop', KEYS[1])} 1 myset] ne {}} + # this one below should not be replicated + assert {[r eval {return redis.call('spop', KEYS[1])} 1 myset] eq {}} + r set trailingkey 1 + assert_replication_stream $repl { + {select *} + {sadd *} + {del *} + {sadd *} + {srem myset *} + {srem myset *} + {srem myset *} + {set *} + } + close_replication_stream $repl + } {} {needs:repl} + + test {MGET: mget shouldn't be propagated in Lua} { + set repl [attach_to_replication_stream] + r mset a{t} 1 b{t} 2 c{t} 3 d{t} 4 + #read-only, won't be replicated + assert {[r eval {return redis.call('mget', 'a{t}', 'b{t}', 'c{t}', 'd{t}')} 0] eq {1 2 3 4}} + r set trailingkey 2 + assert_replication_stream $repl { + {select *} + {mset *} + {set *} + } + close_replication_stream $repl + } {} {needs:repl} + + test {EXPIRE: We can call scripts rewriting client->argv from Lua} { + set repl [attach_to_replication_stream] + r set expirekey 1 + #should be replicated as EXPIREAT + assert {[r eval {return redis.call('expire', KEYS[1], ARGV[1])} 1 expirekey 3] eq 1} + + assert_replication_stream $repl { + {select *} + {set *} + {pexpireat expirekey *} + } + close_replication_stream $repl + } {} {needs:repl} + + test {INCRBYFLOAT: We can call scripts expanding client->argv from Lua} { + # coverage for scripts calling commands that expand the argv array + # an attempt to add coverage for a possible bug in luaArgsToRedisArgv + # this test needs a fresh server so that lua_argv_size is 0. + # glibc realloc can return the same pointer even when the size changes + # still this test isn't able to trigger the issue, but we keep it anyway. + start_server {tags {"scripting"}} { + set repl [attach_to_replication_stream] + # a command with 5 argsument + r eval {redis.call('hmget', KEYS[1], 1, 2, 3)} 1 key + # then a command with 3 that is replicated as one with 4 + r eval {redis.call('incrbyfloat', KEYS[1], 1)} 1 key + # then a command with 4 args + r eval {redis.call('set', KEYS[1], '1', 'KEEPTTL')} 1 key + + assert_replication_stream $repl { + {select *} + {set key 1 KEEPTTL} + {set key 1 KEEPTTL} + } + close_replication_stream $repl + } + } {} {needs:repl} + + } ;# is_eval + + test {Call Redis command with many args from Lua (issue #1764)} { + run_script { + local i + local x={} + redis.call('del','mylist') + for i=1,100 do + table.insert(x,i) + end + redis.call('rpush','mylist',unpack(x)) + return redis.call('lrange','mylist',0,-1) + } 1 mylist + } {1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100} + + test {Number conversion precision test (issue #1118)} { + run_script { + local value = 9007199254740991 + redis.call("set","foo",value) + return redis.call("get","foo") + } 1 foo + } {9007199254740991} + + test {String containing number precision test (regression of issue #1118)} { + run_script { + redis.call("set", "key", "12039611435714932082") + return redis.call("get", "key") + } 1 key + } {12039611435714932082} + + test {Verify negative arg count is error instead of crash (issue #1842)} { + catch { run_script { return "hello" } -12 } e + set e + } {ERR Number of keys can't be negative} + + test {Scripts can handle commands with incorrect arity} { + assert_error "ERR Wrong number of args calling Redis command from script*" {run_script "redis.call('set','invalid')" 0} + assert_error "ERR Wrong number of args calling Redis command from script*" {run_script "redis.call('incr')" 0} + } + + test {Correct handling of reused argv (issue #1939)} { + run_script { + for i = 0, 10 do + redis.call('SET', 'a{t}', '1') + redis.call('MGET', 'a{t}', 'b{t}', 'c{t}') + redis.call('EXPIRE', 'a{t}', 0) + redis.call('GET', 'a{t}') + redis.call('MGET', 'a{t}', 'b{t}', 'c{t}') + end + } 3 a{t} b{t} c{t} + } + + test {Functions in the Redis namespace are able to report errors} { + catch { + run_script { + redis.sha1hex() + } 0 + } e + set e + } {*wrong number*} + + test {CLUSTER RESET can not be invoke from within a script} { + catch { + run_script { + redis.call('cluster', 'reset', 'hard') + } 0 + } e + set _ $e + } {*command is not allowed*} + + test {Script with RESP3 map} { + set expected_dict [dict create field value] + set expected_list [list field value] + + # Sanity test for RESP3 without scripts + r HELLO 3 + r hset hash field value + set res [r hgetall hash] + assert_equal $res $expected_dict + + # Test RESP3 client with script in both RESP2 and RESP3 modes + set res [run_script {redis.setresp(3); return redis.call('hgetall', KEYS[1])} 1 hash] + assert_equal $res $expected_dict + set res [run_script {redis.setresp(2); return redis.call('hgetall', KEYS[1])} 1 hash] + assert_equal $res $expected_list + + # Test RESP2 client with script in both RESP2 and RESP3 modes + r HELLO 2 + set res [run_script {redis.setresp(3); return redis.call('hgetall', KEYS[1])} 1 hash] + assert_equal $res $expected_list + set res [run_script {redis.setresp(2); return redis.call('hgetall', KEYS[1])} 1 hash] + assert_equal $res $expected_list + } + + test {Script return recursive object} { + r readraw 1 + set res [run_script {local a = {}; local b = {a}; a[1] = b; return a} 0] + # drain the response + while {true} { + if {$res == "-ERR reached lua stack limit"} { + break + } + assert_equal $res "*1" + set res [r read] + } + r readraw 0 + # make sure the connection is still valid + assert_equal [r ping] {PONG} + } + + test {Script check unpack with massive arguments} { + run_script { + local a = {} + for i=1,7999 do + a[i] = 1 + end + return redis.call("lpush", "l", unpack(a)) + } 0 + } {7999} + + test "Script read key with expiration set" { + r SET key value EX 10 + assert_equal [run_script { + if redis.call("EXISTS", "key") then + return redis.call("GET", "key") + else + return redis.call("EXISTS", "key") + end + } 0] "value" + } + + test "Script del key with expiration set" { + r SET key value EX 10 + assert_equal [run_script { + redis.call("DEL", "key") + return redis.call("EXISTS", "key") + } 0] 0 + } + + test "Script ACL check" { + r acl setuser bob on {>123} {+@scripting} {+set} {~x*} + assert_equal [r auth bob 123] {OK} + + # Check permission granted + assert_equal [run_script { + return redis.acl_check_cmd('set','xx',1) + } 1 xx] 1 + + # Check permission denied unauthorised command + assert_equal [run_script { + return redis.acl_check_cmd('hset','xx','f',1) + } 1 xx] {} + + # Check permission denied unauthorised key + # Note: we don't pass the "yy" key as an argument to the script so key acl checks won't block the script + assert_equal [run_script { + return redis.acl_check_cmd('set','yy',1) + } 0] {} + + # Check error due to invalid command + assert_error {ERR *Invalid command passed to redis.acl_check_cmd()*} {run_script { + return redis.acl_check_cmd('invalid-cmd','arg') + } 0} + } + + test "Binary code loading failed" { + assert_error {ERR *attempt to call a nil value*} {run_script { + return loadstring(string.dump(function() return 1 end))() + } 0} + } + + test "Try trick global protection 1" { + catch { + run_script { + setmetatable(_G, {}) + } 0 + } e + set _ $e + } {*Attempt to modify a readonly table*} + + test "Try trick global protection 2" { + catch { + run_script { + local g = getmetatable(_G) + g.__index = {} + } 0 + } e + set _ $e + } {*Attempt to modify a readonly table*} + + test "Try trick global protection 3" { + catch { + run_script { + redis = function() return 1 end + } 0 + } e + set _ $e + } {*Attempt to modify a readonly table*} + + test "Try trick global protection 4" { + catch { + run_script { + _G = {} + } 0 + } e + set _ $e + } {*Attempt to modify a readonly table*} + + test "Try trick readonly table on redis table" { + catch { + run_script { + redis.call = function() return 1 end + } 0 + } e + set _ $e + } {*Attempt to modify a readonly table*} + + test "Try trick readonly table on json table" { + catch { + run_script { + cjson.encode = function() return 1 end + } 0 + } e + set _ $e + } {*Attempt to modify a readonly table*} + + test "Try trick readonly table on cmsgpack table" { + catch { + run_script { + cmsgpack.pack = function() return 1 end + } 0 + } e + set _ $e + } {*Attempt to modify a readonly table*} + + test "Try trick readonly table on bit table" { + catch { + run_script { + bit.lshift = function() return 1 end + } 0 + } e + set _ $e + } {*Attempt to modify a readonly table*} + + test "Test loadfile are not available" { + catch { + run_script { + loadfile('some file') + } 0 + } e + set _ $e + } {*Script attempted to access nonexistent global variable 'loadfile'*} + + test "Test dofile are not available" { + catch { + run_script { + dofile('some file') + } 0 + } e + set _ $e + } {*Script attempted to access nonexistent global variable 'dofile'*} + + test "Test print are not available" { + catch { + run_script { + print('some data') + } 0 + } e + set _ $e + } {*Script attempted to access nonexistent global variable 'print'*} +} + +# Start a new server since the last test in this stanza will kill the +# instance at all. +start_server {tags {"scripting"}} { + test {Timedout read-only scripts can be killed by SCRIPT KILL} { + set rd [redis_deferring_client] + r config set lua-time-limit 10 + run_script_on_connection $rd {while true do end} 0 + after 200 + catch {r ping} e + assert_match {BUSY*} $e + kill_script + after 200 ; # Give some time to Lua to call the hook again... + assert_equal [r ping] "PONG" + $rd close + } + + test {Timedout read-only scripts can be killed by SCRIPT KILL even when use pcall} { + set rd [redis_deferring_client] + r config set lua-time-limit 10 + run_script_on_connection $rd {local f = function() while 1 do redis.call('ping') end end while 1 do pcall(f) end} 0 + + wait_for_condition 50 100 { + [catch {r ping} e] == 1 + } else { + fail "Can't wait for script to start running" + } + catch {r ping} e + assert_match {BUSY*} $e + + kill_script + + wait_for_condition 50 100 { + [catch {r ping} e] == 0 + } else { + fail "Can't wait for script to be killed" + } + assert_equal [r ping] "PONG" + + catch {$rd read} res + $rd close + + assert_match {*killed by user*} $res + } + + test {Timedout script does not cause a false dead client} { + set rd [redis_deferring_client] + r config set lua-time-limit 10 + + # senging (in a pipeline): + # 1. eval "while 1 do redis.call('ping') end" 0 + # 2. ping + if {$is_eval == 1} { + set buf "*3\r\n\$4\r\neval\r\n\$33\r\nwhile 1 do redis.call('ping') end\r\n\$1\r\n0\r\n" + append buf "*1\r\n\$4\r\nping\r\n" + } else { + set buf "*4\r\n\$8\r\nfunction\r\n\$4\r\nload\r\n\$7\r\nreplace\r\n\$97\r\n#!lua name=test\nredis.register_function('test', function() while 1 do redis.call('ping') end end)\r\n" + append buf "*3\r\n\$5\r\nfcall\r\n\$4\r\ntest\r\n\$1\r\n0\r\n" + append buf "*1\r\n\$4\r\nping\r\n" + } + $rd write $buf + $rd flush + + wait_for_condition 50 100 { + [catch {r ping} e] == 1 + } else { + fail "Can't wait for script to start running" + } + catch {r ping} e + assert_match {BUSY*} $e + + kill_script + wait_for_condition 50 100 { + [catch {r ping} e] == 0 + } else { + fail "Can't wait for script to be killed" + } + assert_equal [r ping] "PONG" + + if {$is_eval == 0} { + # read the function name + assert_match {test} [$rd read] + } + + catch {$rd read} res + assert_match {*killed by user*} $res + + set res [$rd read] + assert_match {*PONG*} $res + + $rd close + } + + test {Timedout script link is still usable after Lua returns} { + r config set lua-time-limit 10 + run_script {for i=1,100000 do redis.call('ping') end return 'ok'} 0 + r ping + } {PONG} + + test {Timedout scripts and unblocked command} { + # make sure a command that's allowed during BUSY doesn't trigger an unblocked command + + # enable AOF to also expose an assertion if the bug would happen + r flushall + r config set appendonly yes + + # create clients, and set one to block waiting for key 'x' + set rd [redis_deferring_client] + set rd2 [redis_deferring_client] + set r3 [redis_client] + $rd2 blpop x 0 + wait_for_blocked_clients_count 1 + + # hack: allow the script to use client list command so that we can control when it aborts + r DEBUG set-disable-deny-scripts 1 + r config set lua-time-limit 10 + run_script_on_connection $rd { + local clients + redis.call('lpush',KEYS[1],'y'); + while true do + clients = redis.call('client','list') + if string.find(clients, 'abortscript') ~= nil then break end + end + redis.call('lpush',KEYS[1],'z'); + return clients + } 1 x + + # wait for the script to be busy + after 200 + catch {r ping} e + assert_match {BUSY*} $e + + # run cause the script to abort, and run a command that could have processed + # unblocked clients (due to a bug) + $r3 hello 2 setname abortscript + + # make sure the script completed before the pop was processed + assert_equal [$rd2 read] {x z} + assert_match {*abortscript*} [$rd read] + + $rd close + $rd2 close + $r3 close + r DEBUG set-disable-deny-scripts 0 + } {OK} {external:skip needs:debug} + + test {Timedout scripts that modified data can't be killed by SCRIPT KILL} { + set rd [redis_deferring_client] + r config set lua-time-limit 10 + run_script_on_connection $rd {redis.call('set',KEYS[1],'y'); while true do end} 1 x + after 200 + catch {r ping} e + assert_match {BUSY*} $e + catch {kill_script} e + assert_match {UNKILLABLE*} $e + catch {r ping} e + assert_match {BUSY*} $e + } {} {external:skip} + + # Note: keep this test at the end of this server stanza because it + # kills the server. + test {SHUTDOWN NOSAVE can kill a timedout script anyway} { + # The server should be still unresponding to normal commands. + catch {r ping} e + assert_match {BUSY*} $e + catch {r shutdown nosave} + # Make sure the server was killed + catch {set rd [redis_deferring_client]} e + assert_match {*connection refused*} $e + } {} {external:skip} +} + + start_server {tags {"scripting repl needs:debug external:skip"}} { + start_server {} { + test "Before the replica connects we issue two EVAL commands" { + # One with an error, but still executing a command. + # SHA is: 67164fc43fa971f76fd1aaeeaf60c1c178d25876 + catch { + run_script {redis.call('incr',KEYS[1]); redis.call('nonexisting')} 1 x + } + # One command is correct: + # SHA is: 6f5ade10a69975e903c6d07b10ea44c6382381a5 + run_script {return redis.call('incr',KEYS[1])} 1 x + } {2} + + test "Connect a replica to the master instance" { + r -1 slaveof [srv 0 host] [srv 0 port] + wait_for_condition 50 100 { + [s -1 role] eq {slave} && + [string match {*master_link_status:up*} [r -1 info replication]] + } else { + fail "Can't turn the instance into a replica" + } + } + + if {$is_eval eq 1} { + test "Now use EVALSHA against the master, with both SHAs" { + # The server should replicate successful and unsuccessful + # commands as EVAL instead of EVALSHA. + catch { + r evalsha 67164fc43fa971f76fd1aaeeaf60c1c178d25876 1 x + } + r evalsha 6f5ade10a69975e903c6d07b10ea44c6382381a5 1 x + } {4} + + test "'x' should be '4' for EVALSHA being replicated by effects" { + wait_for_condition 50 100 { + [r -1 get x] eq {4} + } else { + fail "Expected 4 in x, but value is '[r -1 get x]'" + } + } + } ;# is_eval + + test "Replication of script multiple pushes to list with BLPOP" { + set rd [redis_deferring_client] + $rd brpop a 0 + run_script { + redis.call("lpush",KEYS[1],"1"); + redis.call("lpush",KEYS[1],"2"); + } 1 a + set res [$rd read] + $rd close + wait_for_condition 50 100 { + [r -1 lrange a 0 -1] eq [r lrange a 0 -1] + } else { + fail "Expected list 'a' in replica and master to be the same, but they are respectively '[r -1 lrange a 0 -1]' and '[r lrange a 0 -1]'" + } + set res + } {a 1} + + if {$is_eval eq 1} { + test "EVALSHA replication when first call is readonly" { + r del x + r eval {if tonumber(ARGV[1]) > 0 then redis.call('incr', KEYS[1]) end} 1 x 0 + r evalsha 6e0e2745aa546d0b50b801a20983b70710aef3ce 1 x 0 + r evalsha 6e0e2745aa546d0b50b801a20983b70710aef3ce 1 x 1 + wait_for_condition 50 100 { + [r -1 get x] eq {1} + } else { + fail "Expected 1 in x, but value is '[r -1 get x]'" + } + } + } ;# is_eval + + test "Lua scripts using SELECT are replicated correctly" { + run_script { + redis.call("set","foo1","bar1") + redis.call("select","10") + redis.call("incr","x") + redis.call("select","11") + redis.call("incr","z") + } 0 + run_script { + redis.call("set","foo1","bar1") + redis.call("select","10") + redis.call("incr","x") + redis.call("select","11") + redis.call("incr","z") + } 0 + wait_for_condition 50 100 { + [debug_digest -1] eq [debug_digest] + } else { + fail "Master-Replica desync after Lua script using SELECT." + } + } {} {singledb:skip} + } + } + +start_server {tags {"scripting repl external:skip"}} { + start_server {overrides {appendonly yes aof-use-rdb-preamble no}} { + test "Connect a replica to the master instance" { + r -1 slaveof [srv 0 host] [srv 0 port] + wait_for_condition 50 100 { + [s -1 role] eq {slave} && + [string match {*master_link_status:up*} [r -1 info replication]] + } else { + fail "Can't turn the instance into a replica" + } + } + + # replicate_commands is the default on Redis Function + test "Redis.replicate_commands() can be issued anywhere now" { + r eval { + redis.call('set','foo','bar'); + return redis.replicate_commands(); + } 0 + } {1} + + test "Redis.set_repl() can be issued before replicate_commands() now" { + catch { + r eval { + redis.set_repl(redis.REPL_ALL); + } 0 + } e + set e + } {} + + test "Redis.set_repl() don't accept invalid values" { + catch { + run_script { + redis.set_repl(12345); + } 0 + } e + set e + } {*Invalid*flags*} + + test "Test selective replication of certain Redis commands from Lua" { + r del a b c d + run_script { + redis.call('set','a','1'); + redis.set_repl(redis.REPL_NONE); + redis.call('set','b','2'); + redis.set_repl(redis.REPL_AOF); + redis.call('set','c','3'); + redis.set_repl(redis.REPL_ALL); + redis.call('set','d','4'); + } 0 + + wait_for_condition 50 100 { + [r -1 mget a b c d] eq {1 {} {} 4} + } else { + fail "Only a and d should be replicated to replica" + } + + # Master should have everything right now + assert {[r mget a b c d] eq {1 2 3 4}} + + # After an AOF reload only a, c and d should exist + r debug loadaof + + assert {[r mget a b c d] eq {1 {} 3 4}} + } + + test "PRNG is seeded randomly for command replication" { + if {$is_eval eq 1} { + # on is_eval Lua we need to call redis.replicate_commands() to get real randomization + set a [ + run_script { + redis.replicate_commands() + return math.random()*100000; + } 0 + ] + set b [ + run_script { + redis.replicate_commands() + return math.random()*100000; + } 0 + ] + } else { + set a [ + run_script { + return math.random()*100000; + } 0 + ] + set b [ + run_script { + return math.random()*100000; + } 0 + ] + } + assert {$a ne $b} + } + + test "Using side effects is not a problem with command replication" { + run_script { + redis.call('set','time',redis.call('time')[1]) + } 0 + + assert {[r get time] ne {}} + + wait_for_condition 50 100 { + [r get time] eq [r -1 get time] + } else { + fail "Time key does not match between master and replica" + } + } + } +} + +if {$is_eval eq 1} { +start_server {tags {"scripting external:skip"}} { + r script debug sync + r eval {return 'hello'} 0 + r eval {return 'hello'} 0 +} + +start_server {tags {"scripting needs:debug external:skip"}} { + test {Test scripting debug protocol parsing} { + r script debug sync + r eval {return 'hello'} 0 + catch {r 'hello\0world'} e + assert_match {*Unknown Redis Lua debugger command*} $e + catch {r 'hello\0'} e + assert_match {*Unknown Redis Lua debugger command*} $e + catch {r '\0hello'} e + assert_match {*Unknown Redis Lua debugger command*} $e + catch {r '\0hello\0'} e + assert_match {*Unknown Redis Lua debugger command*} $e + } + + test {Test scripting debug lua stack overflow} { + r script debug sync + r eval {return 'hello'} 0 + set cmd "*101\r\n\$5\r\nredis\r\n" + append cmd [string repeat "\$4\r\ntest\r\n" 100] + r write $cmd + r flush + set ret [r read] + assert_match {*Unknown Redis command called from script*} $ret + # make sure the server is still ok + reconnect + assert_equal [r ping] {PONG} + } +} +} ;# is_eval + +start_server {tags {"scripting needs:debug"}} { + r debug set-disable-deny-scripts 1 + + for {set i 2} {$i <= 3} {incr i} { + for {set client_proto 2} {$client_proto <= 3} {incr client_proto} { + set extra "RESP$i/$client_proto" + r hello $client_proto + r readraw 1 + + test "test $extra big number protocol parsing" { + set ret [run_script "redis.setresp($i);return redis.call('debug', 'protocol', 'bignum')" 0] + if {$client_proto == 2 || $i == 2} { + # if either Lua or the client is RESP2 the reply will be RESP2 + assert_equal $ret {$37} + assert_equal [r read] {1234567999999999999999999999999999999} + } else { + assert_equal $ret {(1234567999999999999999999999999999999} + } + } + + test "test $extra malformed big number protocol parsing" { + set ret [run_script "return {big_number='123\\r\\n123'}" 0] + if {$client_proto == 2} { + # if either Lua or the client is RESP2 the reply will be RESP2 + assert_equal $ret {$8} + assert_equal [r read] {123 123} + } else { + assert_equal $ret {(123 123} + } + } + + test "test $extra map protocol parsing" { + set ret [run_script "redis.setresp($i);return redis.call('debug', 'protocol', 'map')" 0] + if {$client_proto == 2 || $i == 2} { + # if either Lua or the client is RESP2 the reply will be RESP2 + assert_equal $ret {*6} + } else { + assert_equal $ret {%3} + } + for {set j 0} {$j < 6} {incr j} { + r read + } + } + + test "test $extra set protocol parsing" { + set ret [run_script "redis.setresp($i);return redis.call('debug', 'protocol', 'set')" 0] + if {$client_proto == 2 || $i == 2} { + # if either Lua or the client is RESP2 the reply will be RESP2 + assert_equal $ret {*3} + } else { + assert_equal $ret {~3} + } + for {set j 0} {$j < 3} {incr j} { + r read + } + } + + test "test $extra double protocol parsing" { + set ret [run_script "redis.setresp($i);return redis.call('debug', 'protocol', 'double')" 0] + if {$client_proto == 2 || $i == 2} { + # if either Lua or the client is RESP2 the reply will be RESP2 + assert_equal $ret {$5} + assert_equal [r read] {3.141} + } else { + assert_equal $ret {,3.141} + } + } + + test "test $extra null protocol parsing" { + set ret [run_script "redis.setresp($i);return redis.call('debug', 'protocol', 'null')" 0] + if {$client_proto == 2} { + # null is a special case in which a Lua client format does not effect the reply to the client + assert_equal $ret {$-1} + } else { + assert_equal $ret {_} + } + } {} + + test "test $extra verbatim protocol parsing" { + set ret [run_script "redis.setresp($i);return redis.call('debug', 'protocol', 'verbatim')" 0] + if {$client_proto == 2 || $i == 2} { + # if either Lua or the client is RESP2 the reply will be RESP2 + assert_equal $ret {$25} + assert_equal [r read] {This is a verbatim} + assert_equal [r read] {string} + } else { + assert_equal $ret {=29} + assert_equal [r read] {txt:This is a verbatim} + assert_equal [r read] {string} + } + } + + test "test $extra true protocol parsing" { + set ret [run_script "redis.setresp($i);return redis.call('debug', 'protocol', 'true')" 0] + if {$client_proto == 2 || $i == 2} { + # if either Lua or the client is RESP2 the reply will be RESP2 + assert_equal $ret {:1} + } else { + assert_equal $ret {#t} + } + } + + test "test $extra false protocol parsing" { + set ret [run_script "redis.setresp($i);return redis.call('debug', 'protocol', 'false')" 0] + if {$client_proto == 2 || $i == 2} { + # if either Lua or the client is RESP2 the reply will be RESP2 + assert_equal $ret {:0} + } else { + assert_equal $ret {#f} + } + } + + r readraw 0 + } + } + + # attribute is not relevant to test with resp2 + test {test resp3 attribute protocol parsing} { + # attributes are not (yet) expose to the script + # So here we just check the parser handles them and they are ignored. + run_script "redis.setresp(3);return redis.call('debug', 'protocol', 'attrib')" 0 + } {Some real reply following the attribute} + + test "Script block the time during execution" { + assert_equal [run_script { + redis.call("SET", "key", "value", "PX", "1") + redis.call("DEBUG", "SLEEP", 0.01) + return redis.call("EXISTS", "key") + } 0] 1 + + assert_equal 0 [r EXISTS key] + } + + test "Script delete the expired key" { + r DEBUG set-active-expire 0 + r SET key value PX 1 + after 2 + + # use DEBUG OBJECT to make sure it doesn't error (means the key still exists) + r DEBUG OBJECT key + + assert_equal [run_script "return redis.call('EXISTS', 'key')" 0] 0 + assert_equal 0 [r EXISTS key] + r DEBUG set-active-expire 1 + } + + r debug set-disable-deny-scripts 0 +} +} ;# foreach is_eval + + +# Scripting "shebang" notation tests +start_server {tags {"scripting"}} { + test "Shebang support for lua engine" { + catch { + r eval {#!not-lua + return 1 + } 0 + } e + assert_match {*Unexpected engine in script shebang*} $e + + assert_equal [r eval {#!lua + return 1 + } 0] 1 + } + + test "Unknown shebang option" { + catch { + r eval {#!lua badger=data + return 1 + } 0 + } e + assert_match {*Unknown lua shebang option*} $e + } + + test "Unknown shebang flag" { + catch { + r eval {#!lua flags=allow-oom,what? + return 1 + } 0 + } e + assert_match {*Unexpected flag in script shebang*} $e + } + + test "allow-oom shebang flag" { + r set x 123 + + r config set maxmemory 1 + + # Fail to execute deny-oom command in OOM condition (backwards compatibility mode without flags) + assert_error {OOM command not allowed when used memory > 'maxmemory'*} { + r eval { + redis.call('set','x',1) + return 1 + } 1 x + } + # Can execute non deny-oom commands in OOM condition (backwards compatibility mode without flags) + assert_equal [ + r eval { + return redis.call('get','x') + } 1 x + ] {123} + + # Fail to execute regardless of script content when we use default flags in OOM condition + assert_error {OOM *} { + r eval {#!lua flags= + return 1 + } 0 + } + + # Script with allow-oom can write despite being in OOM state + assert_equal [ + r eval {#!lua flags=allow-oom + redis.call('set','x',1) + return 1 + } 1 x + ] 1 + + # read-only scripts implies allow-oom + assert_equal [ + r eval {#!lua flags=no-writes + redis.call('get','x') + return 1 + } 0 + ] 1 + assert_equal [ + r eval_ro {#!lua flags=no-writes + redis.call('get','x') + return 1 + } 1 x + ] 1 + + # Script with no shebang can read in OOM state + assert_equal [ + r eval { + redis.call('get','x') + return 1 + } 1 x + ] 1 + + # Script with no shebang can read in OOM state (eval_ro variant) + assert_equal [ + r eval_ro { + redis.call('get','x') + return 1 + } 1 x + ] 1 + + r config set maxmemory 0 + } {OK} {needs:config-maxmemory} + + test "no-writes shebang flag" { + assert_error {ERR Write commands are not allowed from read-only scripts*} { + r eval {#!lua flags=no-writes + redis.call('set','x',1) + return 1 + } 1 x + } + } + + start_server {tags {"external:skip"}} { + r -1 set x "some value" + test "no-writes shebang flag on replica" { + r replicaof [srv -1 host] [srv -1 port] + wait_for_condition 50 100 { + [s role] eq {slave} && + [string match {*master_link_status:up*} [r info replication]] + } else { + fail "Can't turn the instance into a replica" + } + + assert_equal [ + r eval {#!lua flags=no-writes + return redis.call('get','x') + } 1 x + ] "some value" + + assert_error {READONLY You can't write against a read only replica.} { + r eval {#!lua + return redis.call('get','x') + } 1 x + } + + # test no-write inside multi-exec + r multi + r eval {#!lua flags=no-writes + redis.call('get','x') + return 1 + } 1 x + assert_equal [r exec] 1 + + # test no shebang without write inside multi-exec + r multi + r eval { + redis.call('get','x') + return 1 + } 1 x + assert_equal [r exec] 1 + + # temporarily set the server to master, so it doesn't block the queuing + # and we can test the evaluation of the flags on exec + r replicaof no one + set rr [redis_client] + set rr2 [redis_client] + $rr multi + $rr2 multi + + # test write inside multi-exec + # we don't need to do any actual write + $rr eval {#!lua + return 1 + } 0 + + # test no shebang with write inside multi-exec + $rr2 eval { + redis.call('set','x',1) + return 1 + } 1 x + + r replicaof [srv -1 host] [srv -1 port] + assert_error {EXECABORT Transaction discarded because of: READONLY *} {$rr exec} + assert_error {READONLY You can't write against a read only replica. script: *} {$rr2 exec} + $rr close + $rr2 close + } + } + + test "not enough good replicas" { + r set x "some value" + r config set min-replicas-to-write 1 + + assert_equal [ + r eval {#!lua flags=no-writes + return redis.call('get','x') + } 1 x + ] "some value" + + assert_equal [ + r eval { + return redis.call('get','x') + } 1 x + ] "some value" + + assert_error {NOREPLICAS *} { + r eval {#!lua + return redis.call('get','x') + } 1 x + } + + assert_error {NOREPLICAS *} { + r eval { + return redis.call('set','x', 1) + } 1 x + } + + r config set min-replicas-to-write 0 + } + + test "not enough good replicas state change during long script" { + r set x "pre-script value" + r config set min-replicas-to-write 1 + r config set lua-time-limit 10 + start_server {tags {"external:skip"}} { + # add a replica and wait for the master to recognize it's online + r slaveof [srv -1 host] [srv -1 port] + wait_replica_online [srv -1 client] + + # run a slow script that does one write, then waits for INFO to indicate + # that the replica dropped, and then runs another write + set rd [redis_deferring_client -1] + $rd eval { + redis.call('set','x',"script value") + while true do + local info = redis.call('info','replication') + if (string.match(info, "connected_slaves:0")) then + redis.call('set','x',info) + break + end + end + return 1 + } 1 x + + # wait for the script to time out and yield + wait_for_condition 100 100 { + [catch {r -1 ping} e] == 1 + } else { + fail "Can't wait for script to start running" + } + catch {r -1 ping} e + assert_match {BUSY*} $e + + # cause the replica to disconnect (triggering the busy script to exit) + r slaveof no one + + # make sure the script was able to write after the replica dropped + assert_equal [$rd read] 1 + assert_match {*connected_slaves:0*} [r -1 get x] + + $rd close + } + r config set min-replicas-to-write 0 + r config set lua-time-limit 5000 + } {OK} {external:skip needs:repl} + + test "allow-stale shebang flag" { + r config set replica-serve-stale-data no + r replicaof 127.0.0.1 1 + + assert_error {MASTERDOWN Link with MASTER is down and replica-serve-stale-data is set to 'no'.} { + r eval { + return redis.call('get','x') + } 1 x + } + + assert_error {MASTERDOWN Link with MASTER is down and replica-serve-stale-data is set to 'no'.} { + r eval {#!lua flags=no-writes + return 1 + } 0 + } + + assert_equal [ + r eval {#!lua flags=allow-stale,no-writes + return 1 + } 0 + ] 1 + + + assert_error {*Can not execute the command on a stale replica*} { + r eval {#!lua flags=allow-stale,no-writes + return redis.call('get','x') + } 1 x + } + + assert_match {foobar} [ + r eval {#!lua flags=allow-stale,no-writes + return redis.call('echo','foobar') + } 0 + ] + + # Test again with EVALSHA + set sha [ + r script load {#!lua flags=allow-stale,no-writes + return redis.call('echo','foobar') + } + ] + assert_match {foobar} [r evalsha $sha 0] + + r replicaof no one + r config set replica-serve-stale-data yes + set _ {} + } {} {external:skip} + + test "reject script do not cause a Lua stack leak" { + r config set maxmemory 1 + for {set i 0} {$i < 50} {incr i} { + assert_error {OOM *} {r eval {#!lua + return 1 + } 0} + } + r config set maxmemory 0 + assert_equal [r eval {#!lua + return 1 + } 0] 1 + } +} + +# Additional eval only tests +start_server {tags {"scripting"}} { + test "Consistent eval error reporting" { + r config resetstat + r config set maxmemory 1 + # Script aborted due to Redis state (OOM) should report script execution error with detailed internal error + assert_error {OOM command not allowed when used memory > 'maxmemory'*} { + r eval {return redis.call('set','x','y')} 1 x + } + assert_equal [errorrstat OOM r] {count=1} + assert_equal [s total_error_replies] {1} + assert_match {calls=0*rejected_calls=1,failed_calls=0*} [cmdrstat set r] + assert_match {calls=1*rejected_calls=0,failed_calls=1*} [cmdrstat eval r] + + # redis.pcall() failure due to Redis state (OOM) returns lua error table with Redis error message without '-' prefix + r config resetstat + assert_equal [ + r eval { + local t = redis.pcall('set','x','y') + if t['err'] == "OOM command not allowed when used memory > 'maxmemory'." then + return 1 + else + return 0 + end + } 1 x + ] 1 + # error stats were not incremented + assert_equal [errorrstat ERR r] {} + assert_equal [errorrstat OOM r] {count=1} + assert_equal [s total_error_replies] {1} + assert_match {calls=0*rejected_calls=1,failed_calls=0*} [cmdrstat set r] + assert_match {calls=1*rejected_calls=0,failed_calls=0*} [cmdrstat eval r] + + # Returning an error object from lua is handled as a valid RESP error result. + r config resetstat + assert_error {OOM command not allowed when used memory > 'maxmemory'.} { + r eval { return redis.pcall('set','x','y') } 1 x + } + assert_equal [errorrstat ERR r] {} + assert_equal [errorrstat OOM r] {count=1} + assert_equal [s total_error_replies] {1} + assert_match {calls=0*rejected_calls=1,failed_calls=0*} [cmdrstat set r] + assert_match {calls=1*rejected_calls=0,failed_calls=1*} [cmdrstat eval r] + + r config set maxmemory 0 + r config resetstat + # Script aborted due to error result of Redis command + assert_error {ERR DB index is out of range*} { + r eval {return redis.call('select',99)} 0 + } + assert_equal [errorrstat ERR r] {count=1} + assert_equal [s total_error_replies] {1} + assert_match {calls=1*rejected_calls=0,failed_calls=1*} [cmdrstat select r] + assert_match {calls=1*rejected_calls=0,failed_calls=1*} [cmdrstat eval r] + + # redis.pcall() failure due to error in Redis command returns lua error table with redis error message without '-' prefix + r config resetstat + assert_equal [ + r eval { + local t = redis.pcall('select',99) + if t['err'] == "ERR DB index is out of range" then + return 1 + else + return 0 + end + } 0 + ] 1 + assert_equal [errorrstat ERR r] {count=1} ; + assert_equal [s total_error_replies] {1} + assert_match {calls=1*rejected_calls=0,failed_calls=1*} [cmdrstat select r] + assert_match {calls=1*rejected_calls=0,failed_calls=0*} [cmdrstat eval r] + + # Script aborted due to scripting specific error state (write cmd with eval_ro) should report script execution error with detailed internal error + r config resetstat + assert_error {ERR Write commands are not allowed from read-only scripts*} { + r eval_ro {return redis.call('set','x','y')} 1 x + } + assert_equal [errorrstat ERR r] {count=1} + assert_equal [s total_error_replies] {1} + assert_match {calls=0*rejected_calls=1,failed_calls=0*} [cmdrstat set r] + assert_match {calls=1*rejected_calls=0,failed_calls=1*} [cmdrstat eval_ro r] + + # redis.pcall() failure due to scripting specific error state (write cmd with eval_ro) returns lua error table with Redis error message without '-' prefix + r config resetstat + assert_equal [ + r eval_ro { + local t = redis.pcall('set','x','y') + if t['err'] == "ERR Write commands are not allowed from read-only scripts." then + return 1 + else + return 0 + end + } 1 x + ] 1 + assert_equal [errorrstat ERR r] {count=1} + assert_equal [s total_error_replies] {1} + assert_match {calls=0*rejected_calls=1,failed_calls=0*} [cmdrstat set r] + assert_match {calls=1*rejected_calls=0,failed_calls=0*} [cmdrstat eval_ro r] + + r config resetstat + # make sure geoadd will failed + r set Sicily 1 + assert_error {WRONGTYPE Operation against a key holding the wrong kind of value*} { + r eval {return redis.call('GEOADD', 'Sicily', '13.361389', '38.115556', 'Palermo', '15.087269', '37.502669', 'Catania')} 1 x + } + assert_equal [errorrstat WRONGTYPE r] {count=1} + assert_equal [s total_error_replies] {1} + assert_match {calls=1*rejected_calls=0,failed_calls=1*} [cmdrstat geoadd r] + assert_match {calls=1*rejected_calls=0,failed_calls=1*} [cmdrstat eval r] + } {} {cluster:skip} + + test "LUA redis.error_reply API" { + r config resetstat + assert_error {MY_ERR_CODE custom msg} { + r eval {return redis.error_reply("MY_ERR_CODE custom msg")} 0 + } + assert_equal [errorrstat MY_ERR_CODE r] {count=1} + } + + test "LUA redis.error_reply API with empty string" { + r config resetstat + assert_error {ERR} { + r eval {return redis.error_reply("")} 0 + } + assert_equal [errorrstat ERR r] {count=1} + } + + test "LUA redis.status_reply API" { + r config resetstat + r readraw 1 + assert_equal [ + r eval {return redis.status_reply("MY_OK_CODE custom msg")} 0 + ] {+MY_OK_CODE custom msg} + r readraw 0 + assert_equal [errorrstat MY_ERR_CODE r] {} ;# error stats were not incremented + } + + test "LUA test pcall" { + assert_equal [ + r eval {local status, res = pcall(function() return 1 end); return 'status: ' .. tostring(status) .. ' result: ' .. res} 0 + ] {status: true result: 1} + } + + test "LUA test pcall with error" { + assert_match {status: false result:*Script attempted to access nonexistent global variable 'foo'} [ + r eval {local status, res = pcall(function() return foo end); return 'status: ' .. tostring(status) .. ' result: ' .. res} 0 + ] + } + + test "LUA test pcall with non string/integer arg" { + assert_error "ERR Lua redis lib command arguments must be strings or integers*" { + r eval { + local x={} + return redis.call("ping", x) + } 0 + } + # run another command, to make sure the cached argv array survived + assert_equal [ + r eval { + return redis.call("ping", "asdf") + } 0 + ] {asdf} + } +} + diff --git a/tests/unit/shutdown.tcl b/tests/unit/shutdown.tcl new file mode 100644 index 0000000..d0a8ffb --- /dev/null +++ b/tests/unit/shutdown.tcl @@ -0,0 +1,104 @@ +start_server {tags {"shutdown external:skip"}} { + test {Temp rdb will be deleted if we use bg_unlink when shutdown} { + for {set i 0} {$i < 20} {incr i} { + r set $i $i + } + # It will cost 2s(20 * 100ms) to dump rdb + r config set rdb-key-save-delay 100000 + + # Child is dumping rdb + r bgsave + after 100 + set dir [lindex [r config get dir] 1] + set child_pid [get_child_pid 0] + set temp_rdb [file join [lindex [r config get dir] 1] temp-${child_pid}.rdb] + # Temp rdb must be existed + assert {[file exists $temp_rdb]} + + catch {r shutdown nosave} + # Make sure the server was killed + catch {set rd [redis_deferring_client]} e + assert_match {*connection refused*} $e + + # Temp rdb file must be deleted + assert {![file exists $temp_rdb]} + } +} + +start_server {tags {"shutdown external:skip"}} { + test {SHUTDOWN ABORT can cancel SIGTERM} { + r debug pause-cron 1 + set pid [s process_id] + exec kill -SIGTERM $pid + after 10; # Give signal handler some time to run + r shutdown abort + verify_log_message 0 "*Shutdown manually aborted*" 0 + r debug pause-cron 0 + r ping + } {PONG} + + test {Temp rdb will be deleted in signal handle} { + for {set i 0} {$i < 20} {incr i} { + r set $i $i + } + # It will cost 2s (20 * 100ms) to dump rdb + r config set rdb-key-save-delay 100000 + + set pid [s process_id] + set temp_rdb [file join [lindex [r config get dir] 1] temp-${pid}.rdb] + + # trigger a shutdown which will save an rdb + exec kill -SIGINT $pid + # Wait for creation of temp rdb + wait_for_condition 50 10 { + [file exists $temp_rdb] + } else { + fail "Can't trigger rdb save on shutdown" + } + + # Insist on immediate shutdown, temp rdb file must be deleted + exec kill -SIGINT $pid + # wait for the rdb file to be deleted + wait_for_condition 50 10 { + ![file exists $temp_rdb] + } else { + fail "Can't trigger rdb save on shutdown" + } + } +} + +start_server {tags {"shutdown external:skip"}} { + set pid [s process_id] + set dump_rdb [file join [lindex [r config get dir] 1] dump.rdb] + + test {RDB save will be failed in shutdown} { + for {set i 0} {$i < 20} {incr i} { + r set $i $i + } + + # create a folder called 'dump.rdb' to trigger temp-rdb rename failure + # and it will cause rdb save to fail eventually. + if {[file exists $dump_rdb]} { + exec rm -f $dump_rdb + } + exec mkdir -p $dump_rdb + } + test {SHUTDOWN will abort if rdb save failed on signal} { + # trigger a shutdown which will save an rdb + exec kill -SIGINT $pid + wait_for_log_messages 0 {"*Error trying to save the DB, can't exit*"} 0 100 10 + } + test {SHUTDOWN will abort if rdb save failed on shutdown command} { + catch {[r shutdown]} err + assert_match {*Errors trying to SHUTDOWN*} $err + # make sure the server is still alive + assert_equal [r ping] {PONG} + } + test {SHUTDOWN can proceed if shutdown command was with nosave} { + catch {[r shutdown nosave]} + wait_for_log_messages 0 {"*ready to exit, bye bye*"} 0 100 10 + } + test {Clean up rdb same named folder} { + exec rm -r $dump_rdb + } +} diff --git a/tests/unit/slowlog.tcl b/tests/unit/slowlog.tcl new file mode 100644 index 0000000..8ce1b1c --- /dev/null +++ b/tests/unit/slowlog.tcl @@ -0,0 +1,203 @@ +start_server {tags {"slowlog"} overrides {slowlog-log-slower-than 1000000}} { + test {SLOWLOG - check that it starts with an empty log} { + if {$::external} { + r slowlog reset + } + r slowlog len + } {0} + + test {SLOWLOG - only logs commands taking more time than specified} { + r config set slowlog-log-slower-than 100000 + r ping + assert_equal [r slowlog len] 0 + r debug sleep 0.2 + assert_equal [r slowlog len] 1 + } {} {needs:debug} + + test {SLOWLOG - max entries is correctly handled} { + r config set slowlog-log-slower-than 0 + r config set slowlog-max-len 10 + for {set i 0} {$i < 100} {incr i} { + r ping + } + r slowlog len + } {10} + + test {SLOWLOG - GET optional argument to limit output len works} { + llength [r slowlog get 5] + } {5} + + test {SLOWLOG - RESET subcommand works} { + r config set slowlog-log-slower-than 100000 + r slowlog reset + r slowlog len + } {0} + + test {SLOWLOG - logged entry sanity check} { + r client setname foobar + r debug sleep 0.2 + set e [lindex [r slowlog get] 0] + assert_equal [llength $e] 6 + if {!$::external} { + assert_equal [lindex $e 0] 105 + } + assert_equal [expr {[lindex $e 2] > 100000}] 1 + assert_equal [lindex $e 3] {debug sleep 0.2} + assert_equal {foobar} [lindex $e 5] + } {} {needs:debug} + + test {SLOWLOG - Certain commands are omitted that contain sensitive information} { + r config set slowlog-log-slower-than 0 + r slowlog reset + catch {r acl setuser "slowlog test user" +get +set} _ + r config set masterauth "" + r acl setuser slowlog-test-user +get +set + r config set slowlog-log-slower-than 0 + r config set slowlog-log-slower-than -1 + set slowlog_resp [r slowlog get] + + # Make sure normal configs work, but the two sensitive + # commands are omitted or redacted + assert_equal 5 [llength $slowlog_resp] + assert_equal {slowlog reset} [lindex [lindex $slowlog_resp 4] 3] + assert_equal {acl setuser (redacted) (redacted) (redacted)} [lindex [lindex $slowlog_resp 3] 3] + assert_equal {config set masterauth (redacted)} [lindex [lindex $slowlog_resp 2] 3] + assert_equal {acl setuser (redacted) (redacted) (redacted)} [lindex [lindex $slowlog_resp 1] 3] + assert_equal {config set slowlog-log-slower-than 0} [lindex [lindex $slowlog_resp 0] 3] + } {} {needs:repl} + + test {SLOWLOG - Some commands can redact sensitive fields} { + r config set slowlog-log-slower-than 0 + r slowlog reset + r migrate [srv 0 host] [srv 0 port] key 9 5000 + r migrate [srv 0 host] [srv 0 port] key 9 5000 AUTH user + r migrate [srv 0 host] [srv 0 port] key 9 5000 AUTH2 user password + r config set slowlog-log-slower-than -1 + set slowlog_resp [r slowlog get] + + # Make sure all 3 commands were logged, but the sensitive fields are omitted + assert_equal 4 [llength $slowlog_resp] + assert_match {* key 9 5000} [lindex [lindex $slowlog_resp 2] 3] + assert_match {* key 9 5000 AUTH (redacted)} [lindex [lindex $slowlog_resp 1] 3] + assert_match {* key 9 5000 AUTH2 (redacted) (redacted)} [lindex [lindex $slowlog_resp 0] 3] + } {} {needs:repl} + + test {SLOWLOG - Rewritten commands are logged as their original command} { + r config set slowlog-log-slower-than 0 + + # Test rewriting client arguments + r sadd set a b c d e + r slowlog reset + + # SPOP is rewritten as DEL when all keys are removed + r spop set 10 + assert_equal {spop set 10} [lindex [lindex [r slowlog get] 0] 3] + + # Test replacing client arguments + r slowlog reset + + # GEOADD is replicated as ZADD + r geoadd cool-cities -122.33207 47.60621 Seattle + assert_equal {geoadd cool-cities -122.33207 47.60621 Seattle} [lindex [lindex [r slowlog get] 0] 3] + + # Test replacing a single command argument + r set A 5 + r slowlog reset + + # GETSET is replicated as SET + r getset a 5 + assert_equal {getset a 5} [lindex [lindex [r slowlog get] 0] 3] + + # INCRBYFLOAT calls rewrite multiple times, so it's a special case + r set A 0 + r slowlog reset + + # INCRBYFLOAT is replicated as SET + r INCRBYFLOAT A 1.0 + assert_equal {INCRBYFLOAT A 1.0} [lindex [lindex [r slowlog get] 0] 3] + + # blocked BLPOP is replicated as LPOP + set rd [redis_deferring_client] + $rd blpop l 0 + wait_for_blocked_clients_count 1 50 100 + r multi + r lpush l foo + r slowlog reset + r exec + $rd read + $rd close + assert_equal {blpop l 0} [lindex [lindex [r slowlog get] 0] 3] + } + + test {SLOWLOG - commands with too many arguments are trimmed} { + r config set slowlog-log-slower-than 0 + r slowlog reset + r sadd set 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 + set e [lindex [r slowlog get] end-1] + lindex $e 3 + } {sadd set 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 {... (2 more arguments)}} + + test {SLOWLOG - too long arguments are trimmed} { + r config set slowlog-log-slower-than 0 + r slowlog reset + set arg [string repeat A 129] + r sadd set foo $arg + set e [lindex [r slowlog get] end-1] + lindex $e 3 + } {sadd set foo {AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA... (1 more bytes)}} + + test {SLOWLOG - EXEC is not logged, just executed commands} { + r config set slowlog-log-slower-than 100000 + r slowlog reset + assert_equal [r slowlog len] 0 + r multi + r debug sleep 0.2 + r exec + assert_equal [r slowlog len] 1 + set e [lindex [r slowlog get] 0] + assert_equal [lindex $e 3] {debug sleep 0.2} + } {} {needs:debug} + + test {SLOWLOG - can clean older entries} { + r client setname lastentry_client + r config set slowlog-max-len 1 + r debug sleep 0.2 + assert {[llength [r slowlog get]] == 1} + set e [lindex [r slowlog get] 0] + assert_equal {lastentry_client} [lindex $e 5] + } {} {needs:debug} + + test {SLOWLOG - can be disabled} { + r config set slowlog-max-len 1 + r config set slowlog-log-slower-than 1 + r slowlog reset + r debug sleep 0.2 + assert_equal [r slowlog len] 1 + r config set slowlog-log-slower-than -1 + r slowlog reset + r debug sleep 0.2 + assert_equal [r slowlog len] 0 + } {} {needs:debug} + + test {SLOWLOG - count must be >= -1} { + assert_error "ERR count should be greater than or equal to -1" {r slowlog get -2} + assert_error "ERR count should be greater than or equal to -1" {r slowlog get -222} + } + + test {SLOWLOG - get all slow logs} { + r config set slowlog-log-slower-than 0 + r config set slowlog-max-len 3 + r slowlog reset + + r set key test + r sadd set a b c + r incr num + r lpush list a + + assert_equal [r slowlog len] 3 + assert_equal 0 [llength [r slowlog get 0]] + assert_equal 1 [llength [r slowlog get 1]] + assert_equal 3 [llength [r slowlog get -1]] + assert_equal 3 [llength [r slowlog get 3]] + } +} diff --git a/tests/unit/sort.tcl b/tests/unit/sort.tcl new file mode 100644 index 0000000..e9f1de0 --- /dev/null +++ b/tests/unit/sort.tcl @@ -0,0 +1,345 @@ +start_server { + tags {"sort"} + overrides { + "list-max-ziplist-size" 32 + "set-max-intset-entries" 32 + } +} { + proc create_random_dataset {num cmd} { + set tosort {} + set result {} + array set seenrand {} + r del tosort + for {set i 0} {$i < $num} {incr i} { + # Make sure all the weights are different because + # Redis does not use a stable sort but Tcl does. + while 1 { + randpath { + set rint [expr int(rand()*1000000)] + } { + set rint [expr rand()] + } + if {![info exists seenrand($rint)]} break + } + set seenrand($rint) x + r $cmd tosort $i + r set weight_$i $rint + r hset wobj_$i weight $rint + lappend tosort [list $i $rint] + } + set sorted [lsort -index 1 -real $tosort] + for {set i 0} {$i < $num} {incr i} { + lappend result [lindex $sorted $i 0] + } + set _ $result + } + + foreach {num cmd enc title} { + 16 lpush quicklist "Old Ziplist" + 1000 lpush quicklist "Old Linked list" + 10000 lpush quicklist "Old Big Linked list" + 16 sadd intset "Intset" + 1000 sadd hashtable "Hash table" + 10000 sadd hashtable "Big Hash table" + } { + set result [create_random_dataset $num $cmd] + assert_encoding $enc tosort + + test "$title: SORT BY key" { + assert_equal $result [r sort tosort BY weight_*] + } {} {cluster:skip} + + test "$title: SORT BY key with limit" { + assert_equal [lrange $result 5 9] [r sort tosort BY weight_* LIMIT 5 5] + } {} {cluster:skip} + + test "$title: SORT BY hash field" { + assert_equal $result [r sort tosort BY wobj_*->weight] + } {} {cluster:skip} + } + + set result [create_random_dataset 16 lpush] + test "SORT GET #" { + assert_equal [lsort -integer $result] [r sort tosort GET #] + } {} {cluster:skip} + + test "SORT GET <const>" { + r del foo + set res [r sort tosort GET foo] + assert_equal 16 [llength $res] + foreach item $res { assert_equal {} $item } + } {} {cluster:skip} + + test "SORT GET (key and hash) with sanity check" { + set l1 [r sort tosort GET # GET weight_*] + set l2 [r sort tosort GET # GET wobj_*->weight] + foreach {id1 w1} $l1 {id2 w2} $l2 { + assert_equal $id1 $id2 + assert_equal $w1 [r get weight_$id1] + assert_equal $w2 [r get weight_$id1] + } + } {} {cluster:skip} + + test "SORT BY key STORE" { + r sort tosort BY weight_* store sort-res + assert_equal $result [r lrange sort-res 0 -1] + assert_equal 16 [r llen sort-res] + assert_encoding quicklist sort-res + } {} {cluster:skip} + + test "SORT BY hash field STORE" { + r sort tosort BY wobj_*->weight store sort-res + assert_equal $result [r lrange sort-res 0 -1] + assert_equal 16 [r llen sort-res] + assert_encoding quicklist sort-res + } {} {cluster:skip} + + test "SORT extracts STORE correctly" { + r command getkeys sort abc store def + } {abc def} + + test "SORT_RO get keys" { + r command getkeys sort_ro abc + } {abc} + + test "SORT extracts multiple STORE correctly" { + r command getkeys sort abc store invalid store stillbad store def + } {abc def} + + test "SORT DESC" { + assert_equal [lsort -decreasing -integer $result] [r sort tosort DESC] + } + + test "SORT ALPHA against integer encoded strings" { + r del mylist + r lpush mylist 2 + r lpush mylist 1 + r lpush mylist 3 + r lpush mylist 10 + r sort mylist alpha + } {1 10 2 3} + + test "SORT sorted set" { + r del zset + r zadd zset 1 a + r zadd zset 5 b + r zadd zset 2 c + r zadd zset 10 d + r zadd zset 3 e + r sort zset alpha desc + } {e d c b a} + + test "SORT sorted set BY nosort should retain ordering" { + r del zset + r zadd zset 1 a + r zadd zset 5 b + r zadd zset 2 c + r zadd zset 10 d + r zadd zset 3 e + r multi + r sort zset by nosort asc + r sort zset by nosort desc + r exec + } {{a c e b d} {d b e c a}} + + test "SORT sorted set BY nosort + LIMIT" { + r del zset + r zadd zset 1 a + r zadd zset 5 b + r zadd zset 2 c + r zadd zset 10 d + r zadd zset 3 e + assert_equal [r sort zset by nosort asc limit 0 1] {a} + assert_equal [r sort zset by nosort desc limit 0 1] {d} + assert_equal [r sort zset by nosort asc limit 0 2] {a c} + assert_equal [r sort zset by nosort desc limit 0 2] {d b} + assert_equal [r sort zset by nosort limit 5 10] {} + assert_equal [r sort zset by nosort limit -10 100] {a c e b d} + } + + test "SORT sorted set BY nosort works as expected from scripts" { + r del zset + r zadd zset 1 a + r zadd zset 5 b + r zadd zset 2 c + r zadd zset 10 d + r zadd zset 3 e + r eval { + return {redis.call('sort',KEYS[1],'by','nosort','asc'), + redis.call('sort',KEYS[1],'by','nosort','desc')} + } 1 zset + } {{a c e b d} {d b e c a}} + + test "SORT sorted set: +inf and -inf handling" { + r del zset + r zadd zset -100 a + r zadd zset 200 b + r zadd zset -300 c + r zadd zset 1000000 d + r zadd zset +inf max + r zadd zset -inf min + r zrange zset 0 -1 + } {min c a b d max} + + test "SORT regression for issue #19, sorting floats" { + r flushdb + set floats {1.1 5.10 3.10 7.44 2.1 5.75 6.12 0.25 1.15} + foreach x $floats { + r lpush mylist $x + } + assert_equal [lsort -real $floats] [r sort mylist] + } + + test "SORT with STORE returns zero if result is empty (github issue 224)" { + r flushdb + r sort foo{t} store bar{t} + } {0} + + test "SORT with STORE does not create empty lists (github issue 224)" { + r flushdb + r lpush foo{t} bar + r sort foo{t} alpha limit 10 10 store zap{t} + r exists zap{t} + } {0} + + test "SORT with STORE removes key if result is empty (github issue 227)" { + r flushdb + r lpush foo{t} bar + r sort emptylist{t} store foo{t} + r exists foo{t} + } {0} + + test "SORT with BY <constant> and STORE should still order output" { + r del myset mylist + r sadd myset a b c d e f g h i l m n o p q r s t u v z aa aaa azz + r sort myset alpha by _ store mylist + r lrange mylist 0 -1 + } {a aa aaa azz b c d e f g h i l m n o p q r s t u v z} {cluster:skip} + + test "SORT will complain with numerical sorting and bad doubles (1)" { + r del myset + r sadd myset 1 2 3 4 not-a-double + set e {} + catch {r sort myset} e + set e + } {*ERR*double*} + + test "SORT will complain with numerical sorting and bad doubles (2)" { + r del myset + r sadd myset 1 2 3 4 + r mset score:1 10 score:2 20 score:3 30 score:4 not-a-double + set e {} + catch {r sort myset by score:*} e + set e + } {*ERR*double*} {cluster:skip} + + test "SORT BY sub-sorts lexicographically if score is the same" { + r del myset + r sadd myset a b c d e f g h i l m n o p q r s t u v z aa aaa azz + foreach ele {a aa aaa azz b c d e f g h i l m n o p q r s t u v z} { + set score:$ele 100 + } + r sort myset by score:* + } {a aa aaa azz b c d e f g h i l m n o p q r s t u v z} {cluster:skip} + + test "SORT GET with pattern ending with just -> does not get hash field" { + r del mylist + r lpush mylist a + r set x:a-> 100 + r sort mylist by num get x:*-> + } {100} {cluster:skip} + + test "SORT by nosort retains native order for lists" { + r del testa + r lpush testa 2 1 4 3 5 + r sort testa by nosort + } {5 3 4 1 2} {cluster:skip} + + test "SORT by nosort plus store retains native order for lists" { + r del testa + r lpush testa 2 1 4 3 5 + r sort testa by nosort store testb + r lrange testb 0 -1 + } {5 3 4 1 2} {cluster:skip} + + test "SORT by nosort with limit returns based on original list order" { + r sort testa by nosort limit 0 3 store testb + r lrange testb 0 -1 + } {5 3 4} {cluster:skip} + + test "SORT_RO - Successful case" { + r del mylist + r lpush mylist a + r set x:a 100 + r sort_ro mylist by nosort get x:*-> + } {100} {cluster:skip} + + test "SORT_RO - Cannot run with STORE arg" { + catch {r sort_ro foolist STORE bar} e + set e + } {ERR syntax error} + + tags {"slow"} { + set num 100 + set res [create_random_dataset $num lpush] + + test "SORT speed, $num element list BY key, 100 times" { + set start [clock clicks -milliseconds] + for {set i 0} {$i < 100} {incr i} { + set sorted [r sort tosort BY weight_* LIMIT 0 10] + } + set elapsed [expr [clock clicks -milliseconds]-$start] + if {$::verbose} { + puts -nonewline "\n Average time to sort: [expr double($elapsed)/100] milliseconds " + flush stdout + } + } {} {cluster:skip} + + test "SORT speed, $num element list BY hash field, 100 times" { + set start [clock clicks -milliseconds] + for {set i 0} {$i < 100} {incr i} { + set sorted [r sort tosort BY wobj_*->weight LIMIT 0 10] + } + set elapsed [expr [clock clicks -milliseconds]-$start] + if {$::verbose} { + puts -nonewline "\n Average time to sort: [expr double($elapsed)/100] milliseconds " + flush stdout + } + } {} {cluster:skip} + + test "SORT speed, $num element list directly, 100 times" { + set start [clock clicks -milliseconds] + for {set i 0} {$i < 100} {incr i} { + set sorted [r sort tosort LIMIT 0 10] + } + set elapsed [expr [clock clicks -milliseconds]-$start] + if {$::verbose} { + puts -nonewline "\n Average time to sort: [expr double($elapsed)/100] milliseconds " + flush stdout + } + } + + test "SORT speed, $num element list BY <const>, 100 times" { + set start [clock clicks -milliseconds] + for {set i 0} {$i < 100} {incr i} { + set sorted [r sort tosort BY nokey LIMIT 0 10] + } + set elapsed [expr [clock clicks -milliseconds]-$start] + if {$::verbose} { + puts -nonewline "\n Average time to sort: [expr double($elapsed)/100] milliseconds " + flush stdout + } + } {} {cluster:skip} + } + + test {SETRANGE with huge offset} { + r lpush L 2 1 0 + # expecting a different outcome on 32 and 64 bit systems + foreach value {9223372036854775807 2147483647} { + catch {[r sort_ro L by a limit 2 $value]} res + if {![string match "2" $res] && ![string match "*out of range*" $res]} { + assert_not_equal $res "expecting an error or 2" + } + } + } +} diff --git a/tests/unit/tls.tcl b/tests/unit/tls.tcl new file mode 100644 index 0000000..29fe39f --- /dev/null +++ b/tests/unit/tls.tcl @@ -0,0 +1,158 @@ +start_server {tags {"tls"}} { + if {$::tls} { + package require tls + + test {TLS: Not accepting non-TLS connections on a TLS port} { + set s [redis [srv 0 host] [srv 0 port]] + catch {$s PING} e + set e + } {*I/O error*} + + test {TLS: Verify tls-auth-clients behaves as expected} { + set s [redis [srv 0 host] [srv 0 port]] + ::tls::import [$s channel] + catch {$s PING} e + assert_match {*error*} $e + + r CONFIG SET tls-auth-clients no + + set s [redis [srv 0 host] [srv 0 port]] + ::tls::import [$s channel] + catch {$s PING} e + assert_match {PONG} $e + + r CONFIG SET tls-auth-clients optional + + set s [redis [srv 0 host] [srv 0 port]] + ::tls::import [$s channel] + catch {$s PING} e + assert_match {PONG} $e + + r CONFIG SET tls-auth-clients yes + + set s [redis [srv 0 host] [srv 0 port]] + ::tls::import [$s channel] + catch {$s PING} e + assert_match {*error*} $e + } + + test {TLS: Verify tls-protocols behaves as expected} { + r CONFIG SET tls-protocols TLSv1.2 + + set s [redis [srv 0 host] [srv 0 port] 0 1 {-tls1.2 0}] + catch {$s PING} e + assert_match {*I/O error*} $e + + set s [redis [srv 0 host] [srv 0 port] 0 1 {-tls1.2 1}] + catch {$s PING} e + assert_match {PONG} $e + + r CONFIG SET tls-protocols "" + } + + test {TLS: Verify tls-ciphers behaves as expected} { + r CONFIG SET tls-protocols TLSv1.2 + r CONFIG SET tls-ciphers "DEFAULT:-AES128-SHA256" + + set s [redis [srv 0 host] [srv 0 port] 0 1 {-cipher "-ALL:AES128-SHA256"}] + catch {$s PING} e + assert_match {*I/O error*} $e + + set s [redis [srv 0 host] [srv 0 port] 0 1 {-cipher "-ALL:AES256-SHA256"}] + catch {$s PING} e + assert_match {PONG} $e + + r CONFIG SET tls-ciphers "DEFAULT" + + set s [redis [srv 0 host] [srv 0 port] 0 1 {-cipher "-ALL:AES128-SHA256"}] + catch {$s PING} e + assert_match {PONG} $e + + r CONFIG SET tls-protocols "" + r CONFIG SET tls-ciphers "DEFAULT" + } + + test {TLS: Verify tls-prefer-server-ciphers behaves as expected} { + r CONFIG SET tls-protocols TLSv1.2 + r CONFIG SET tls-ciphers "AES128-SHA256:AES256-SHA256" + + set s [redis [srv 0 host] [srv 0 port] 0 1 {-cipher "AES256-SHA256:AES128-SHA256"}] + catch {$s PING} e + assert_match {PONG} $e + + assert_equal "AES256-SHA256" [dict get [::tls::status [$s channel]] cipher] + + r CONFIG SET tls-prefer-server-ciphers yes + + set s [redis [srv 0 host] [srv 0 port] 0 1 {-cipher "AES256-SHA256:AES128-SHA256"}] + catch {$s PING} e + assert_match {PONG} $e + + assert_equal "AES128-SHA256" [dict get [::tls::status [$s channel]] cipher] + + r CONFIG SET tls-protocols "" + r CONFIG SET tls-ciphers "DEFAULT" + } + + test {TLS: Verify tls-cert-file is also used as a client cert if none specified} { + set master [srv 0 client] + set master_host [srv 0 host] + set master_port [srv 0 port] + + # Use a non-restricted client/server cert for the replica + set redis_crt [format "%s/tests/tls/redis.crt" [pwd]] + set redis_key [format "%s/tests/tls/redis.key" [pwd]] + + start_server [list overrides [list tls-cert-file $redis_crt tls-key-file $redis_key] \ + omit [list tls-client-cert-file tls-client-key-file]] { + set replica [srv 0 client] + $replica replicaof $master_host $master_port + wait_for_condition 30 100 { + [string match {*master_link_status:up*} [$replica info replication]] + } else { + fail "Can't authenticate to master using just tls-cert-file!" + } + } + } + + test {TLS: switch between tcp and tls ports} { + set srv_port [srv 0 port] + + # TLS + set rd [redis [srv 0 host] $srv_port 0 1] + $rd PING + + # TCP + $rd CONFIG SET tls-port 0 + $rd CONFIG SET port $srv_port + $rd close + + set rd [redis [srv 0 host] $srv_port 0 0] + $rd PING + + # TLS + $rd CONFIG SET port 0 + $rd CONFIG SET tls-port $srv_port + $rd close + + set rd [redis [srv 0 host] $srv_port 0 1] + $rd PING + $rd close + } + + test {TLS: Working with an encrypted keyfile} { + # Create an encrypted version + set keyfile [lindex [r config get tls-key-file] 1] + set keyfile_encrypted "$keyfile.encrypted" + exec -ignorestderr openssl rsa -in $keyfile -out $keyfile_encrypted -aes256 -passout pass:1234 2>/dev/null + + # Using it without a password fails + catch {r config set tls-key-file $keyfile_encrypted} e + assert_match {*Unable to update TLS*} $e + + # Now use a password + r config set tls-key-file-pass 1234 + r config set tls-key-file $keyfile_encrypted + } + } +} diff --git a/tests/unit/tracking.tcl b/tests/unit/tracking.tcl new file mode 100644 index 0000000..de7f67a --- /dev/null +++ b/tests/unit/tracking.tcl @@ -0,0 +1,873 @@ +start_server {tags {"tracking network"}} { + # Create a deferred client we'll use to redirect invalidation + # messages to. + set rd_redirection [redis_deferring_client] + $rd_redirection client id + set redir_id [$rd_redirection read] + $rd_redirection subscribe __redis__:invalidate + $rd_redirection read ; # Consume the SUBSCRIBE reply. + + # Create another client that's not used as a redirection client + # We should always keep this client's buffer clean + set rd [redis_deferring_client] + + # Client to be used for SET and GET commands + # We don't read this client's buffer + set rd_sg [redis_client] + + proc clean_all {} { + uplevel { + # We should make r TRACKING off first. If r is in RESP3, + # r FLUSH ALL will send us tracking-redir-broken or other + # info which will not be consumed. + r CLIENT TRACKING off + $rd QUIT + $rd_redirection QUIT + set rd [redis_deferring_client] + set rd_redirection [redis_deferring_client] + $rd_redirection client id + set redir_id [$rd_redirection read] + $rd_redirection subscribe __redis__:invalidate + $rd_redirection read ; # Consume the SUBSCRIBE reply. + r FLUSHALL + r HELLO 2 + r config set tracking-table-max-keys 1000000 + } + } + + test {Clients are able to enable tracking and redirect it} { + r CLIENT TRACKING on REDIRECT $redir_id + } {*OK} + + test {The other connection is able to get invalidations} { + r SET a{t} 1 + r SET b{t} 1 + r GET a{t} + r INCR b{t} ; # This key should not be notified, since it wasn't fetched. + r INCR a{t} + set keys [lindex [$rd_redirection read] 2] + assert {[llength $keys] == 1} + assert {[lindex $keys 0] eq {a{t}}} + } + + test {The client is now able to disable tracking} { + # Make sure to add a few more keys in the tracking list + # so that we can check for leaks, as a side effect. + r MGET a{t} b{t} c{t} d{t} e{t} f{t} g{t} + r CLIENT TRACKING off + } {*OK} + + test {Clients can enable the BCAST mode with the empty prefix} { + r CLIENT TRACKING on BCAST REDIRECT $redir_id + } {*OK*} + + test {The connection gets invalidation messages about all the keys} { + r MSET a{t} 1 b{t} 2 c{t} 3 + set keys [lsort [lindex [$rd_redirection read] 2]] + assert {$keys eq {a{t} b{t} c{t}}} + } + + test {Clients can enable the BCAST mode with prefixes} { + r CLIENT TRACKING off + r CLIENT TRACKING on BCAST REDIRECT $redir_id PREFIX a: PREFIX b: + r MULTI + r INCR a:1{t} + r INCR a:2{t} + r INCR b:1{t} + r INCR b:2{t} + # we should not get this key + r INCR c:1{t} + r EXEC + # Because of the internals, we know we are going to receive + # two separated notifications for the two different prefixes. + set keys1 [lsort [lindex [$rd_redirection read] 2]] + set keys2 [lsort [lindex [$rd_redirection read] 2]] + set keys [lsort [list {*}$keys1 {*}$keys2]] + assert {$keys eq {a:1{t} a:2{t} b:1{t} b:2{t}}} + } + + test {Adding prefixes to BCAST mode works} { + r CLIENT TRACKING on BCAST REDIRECT $redir_id PREFIX c: + r INCR c:1234 + set keys [lsort [lindex [$rd_redirection read] 2]] + assert {$keys eq {c:1234}} + } + + test {Tracking NOLOOP mode in standard mode works} { + r CLIENT TRACKING off + r CLIENT TRACKING on REDIRECT $redir_id NOLOOP + r MGET otherkey1{t} loopkey{t} otherkey2{t} + $rd_sg SET otherkey1{t} 1; # We should get this + r SET loopkey{t} 1 ; # We should not get this + $rd_sg SET otherkey2{t} 1; # We should get this + # Because of the internals, we know we are going to receive + # two separated notifications for the two different keys. + set keys1 [lsort [lindex [$rd_redirection read] 2]] + set keys2 [lsort [lindex [$rd_redirection read] 2]] + set keys [lsort [list {*}$keys1 {*}$keys2]] + assert {$keys eq {otherkey1{t} otherkey2{t}}} + } + + test {Tracking NOLOOP mode in BCAST mode works} { + r CLIENT TRACKING off + r CLIENT TRACKING on BCAST REDIRECT $redir_id NOLOOP + $rd_sg SET otherkey1 1; # We should get this + r SET loopkey 1 ; # We should not get this + $rd_sg SET otherkey2 1; # We should get this + # Because $rd_sg send command synchronously, we know we are + # going to receive two separated notifications. + set keys1 [lsort [lindex [$rd_redirection read] 2]] + set keys2 [lsort [lindex [$rd_redirection read] 2]] + set keys [lsort [list {*}$keys1 {*}$keys2]] + assert {$keys eq {otherkey1 otherkey2}} + } + + test {Tracking gets notification of expired keys} { + r CLIENT TRACKING off + r CLIENT TRACKING on BCAST REDIRECT $redir_id NOLOOP + r SET mykey myval px 1 + r SET mykeyotherkey myval ; # We should not get it + after 1000 + set keys [lsort [lindex [$rd_redirection read] 2]] + assert {$keys eq {mykey}} + } + + test {Tracking gets notification of lazy expired keys} { + r CLIENT TRACKING off + r CLIENT TRACKING on BCAST REDIRECT $redir_id NOLOOP + # Use multi-exec to expose a race where the key gets an two invalidations + # in the same event loop, once by the client so filtered by NOLOOP, and + # the second one by the lazy expire + r MULTI + r SET mykey{t} myval px 1 + r SET mykeyotherkey{t} myval ; # We should not get it + r DEBUG SLEEP 0.1 + r GET mykey{t} + r EXEC + set keys [lsort [lindex [$rd_redirection read] 2]] + assert {$keys eq {mykey{t}}} + } {} {needs:debug} + + test {HELLO 3 reply is correct} { + set reply [r HELLO 3] + assert_equal [dict get $reply proto] 3 + } + + test {HELLO without protover} { + set reply [r HELLO 3] + assert_equal [dict get $reply proto] 3 + + set reply [r HELLO] + assert_equal [dict get $reply proto] 3 + + set reply [r HELLO 2] + assert_equal [dict get $reply proto] 2 + + set reply [r HELLO] + assert_equal [dict get $reply proto] 2 + + # restore RESP3 for next test + r HELLO 3 + } + + test {RESP3 based basic invalidation} { + r CLIENT TRACKING off + r CLIENT TRACKING on + $rd_sg SET key1 1 + r GET key1 + $rd_sg SET key1 2 + r read + } {invalidate key1} + + test {RESP3 tracking redirection} { + r CLIENT TRACKING off + r CLIENT TRACKING on REDIRECT $redir_id + $rd_sg SET key1 1 + r GET key1 + $rd_sg SET key1 2 + set res [lindex [$rd_redirection read] 2] + assert {$res eq {key1}} + } + + test {Invalidations of previous keys can be redirected after switching to RESP3} { + r HELLO 2 + $rd_sg SET key1 1 + r GET key1 + r HELLO 3 + $rd_sg SET key1 2 + set res [lindex [$rd_redirection read] 2] + assert {$res eq {key1}} + } + + test {Invalidations of new keys can be redirected after switching to RESP3} { + r HELLO 3 + $rd_sg SET key1 1 + r GET key1 + $rd_sg SET key1 2 + set res [lindex [$rd_redirection read] 2] + assert {$res eq {key1}} + } + + test {Invalid keys should not be tracked for scripts in NOLOOP mode} { + $rd_sg CLIENT TRACKING off + $rd_sg CLIENT TRACKING on NOLOOP + $rd_sg HELLO 3 + $rd_sg SET key1 1 + assert_equal "1" [$rd_sg GET key1] + + # For write command in script, invalid key should not be tracked with NOLOOP flag + $rd_sg eval "return redis.call('set', 'key1', '2')" 1 key1 + assert_equal "2" [$rd_sg GET key1] + $rd_sg CLIENT TRACKING off + } + + test {Tracking only occurs for scripts when a command calls a read-only command} { + r CLIENT TRACKING off + r CLIENT TRACKING on + $rd_sg MSET key2{t} 1 key2{t} 1 + + # If a script doesn't call any read command, don't track any keys + r EVAL "redis.call('set', 'key3{t}', 'bar')" 2 key1{t} key2{t} + $rd_sg MSET key2{t} 2 key1{t} 2 + + # If a script calls a read command, track all declared keys + r EVAL "redis.call('get', 'key3{t}')" 2 key1{t} key2{t} + $rd_sg MSET key2{t} 2 key1{t} 2 + assert_equal {invalidate key2{t}} [r read] + assert_equal {invalidate key1{t}} [r read] + + # RO variants work like the normal variants + r EVAL_RO "redis.call('ping')" 2 key1{t} key2{t} + $rd_sg MSET key2{t} 2 key1{t} 2 + + r EVAL_RO "redis.call('get', 'key1{t}')" 2 key1{t} key2{t} + $rd_sg MSET key2{t} 3 key1{t} 3 + assert_equal {invalidate key2{t}} [r read] + assert_equal {invalidate key1{t}} [r read] + + assert_equal "PONG" [r ping] + } + + test {RESP3 Client gets tracking-redir-broken push message after cached key changed when rediretion client is terminated} { + r CLIENT TRACKING on REDIRECT $redir_id + $rd_sg SET key1 1 + r GET key1 + $rd_redirection QUIT + assert_equal OK [$rd_redirection read] + $rd_sg SET key1 2 + set MAX_TRIES 100 + set res -1 + for {set i 0} {$i <= $MAX_TRIES && $res < 0} {incr i} { + set res [lsearch -exact [r PING] "tracking-redir-broken"] + } + assert {$res >= 0} + # Consume PING reply + assert_equal PONG [r read] + + # Reinstantiating after QUIT + set rd_redirection [redis_deferring_client] + $rd_redirection CLIENT ID + set redir_id [$rd_redirection read] + $rd_redirection SUBSCRIBE __redis__:invalidate + $rd_redirection read ; # Consume the SUBSCRIBE reply + } + + test {Different clients can redirect to the same connection} { + r CLIENT TRACKING on REDIRECT $redir_id + $rd CLIENT TRACKING on REDIRECT $redir_id + assert_equal OK [$rd read] ; # Consume the TRACKING reply + $rd_sg MSET key1{t} 1 key2{t} 1 + r GET key1{t} + $rd GET key2{t} + assert_equal 1 [$rd read] ; # Consume the GET reply + $rd_sg INCR key1{t} + $rd_sg INCR key2{t} + set res1 [lindex [$rd_redirection read] 2] + set res2 [lindex [$rd_redirection read] 2] + assert {$res1 eq {key1{t}}} + assert {$res2 eq {key2{t}}} + } + + test {Different clients using different protocols can track the same key} { + $rd HELLO 3 + set reply [$rd read] ; # Consume the HELLO reply + assert_equal 3 [dict get $reply proto] + $rd CLIENT TRACKING on + assert_equal OK [$rd read] ; # Consume the TRACKING reply + $rd_sg set key1 1 + r GET key1 + $rd GET key1 + assert_equal 1 [$rd read] ; # Consume the GET reply + $rd_sg INCR key1 + set res1 [lindex [$rd_redirection read] 2] + $rd PING ; # Non redirecting client has to talk to the server in order to get invalidation message + set res2 [lindex [split [$rd read] " "] 1] + assert_equal PONG [$rd read] ; # Consume the PING reply, which comes together with the invalidation message + assert {$res1 eq {key1}} + assert {$res2 eq {key1}} + } + + test {No invalidation message when using OPTIN option} { + r CLIENT TRACKING on OPTIN REDIRECT $redir_id + $rd_sg SET key1 1 + r GET key1 ; # This key should not be notified, since OPTIN is on and CLIENT CACHING yes wasn't called + $rd_sg SET key1 2 + # Preparing some message to consume on $rd_redirection so we don't get blocked + r CLIENT TRACKING off + r CLIENT TRACKING on REDIRECT $redir_id + $rd_sg SET key2 1 + r GET key2 ; # This key should be notified + $rd_sg SET key2 2 + set res [lindex [$rd_redirection read] 2] + assert {$res eq {key2}} + } + + test {Invalidation message sent when using OPTIN option with CLIENT CACHING yes} { + r CLIENT TRACKING on OPTIN REDIRECT $redir_id + $rd_sg SET key1 3 + r CLIENT CACHING yes + r GET key1 + $rd_sg SET key1 4 + set res [lindex [$rd_redirection read] 2] + assert {$res eq {key1}} + } + + test {Invalidation message sent when using OPTOUT option} { + r CLIENT TRACKING off + r CLIENT TRACKING on OPTOUT REDIRECT $redir_id + $rd_sg SET key1 1 + r GET key1 + $rd_sg SET key1 2 + set res [lindex [$rd_redirection read] 2] + assert {$res eq {key1}} + } + + test {No invalidation message when using OPTOUT option with CLIENT CACHING no} { + $rd_sg SET key1 1 + r CLIENT CACHING no + r GET key1 ; # This key should not be notified, since OPTOUT is on and CLIENT CACHING no was called + $rd_sg SET key1 2 + # Preparing some message to consume on $rd_redirection so we don't get blocked + $rd_sg SET key2 1 + r GET key2 ; # This key should be notified + $rd_sg SET key2 2 + set res [lindex [$rd_redirection read] 2] + assert {$res eq {key2}} + } + + test {Able to redirect to a RESP3 client} { + $rd_redirection UNSUBSCRIBE __redis__:invalidate ; # Need to unsub first before we can do HELLO 3 + set res [$rd_redirection read] ; # Consume the UNSUBSCRIBE reply + assert_equal {__redis__:invalidate} [lindex $res 1] + $rd_redirection HELLO 3 + set res [$rd_redirection read] ; # Consume the HELLO reply + assert_equal [dict get $reply proto] 3 + $rd_redirection SUBSCRIBE __redis__:invalidate + set res [$rd_redirection read] ; # Consume the SUBSCRIBE reply + assert_equal {__redis__:invalidate} [lindex $res 1] + r CLIENT TRACKING on REDIRECT $redir_id + $rd_sg SET key1 1 + r GET key1 + $rd_sg INCR key1 + set res [lindex [$rd_redirection read] 1] + assert {$res eq {key1}} + $rd_redirection HELLO 2 + set res [$rd_redirection read] ; # Consume the HELLO reply + assert_equal [dict get $res proto] 2 + } + + test {After switching from normal tracking to BCAST mode, no invalidation message is produced for pre-BCAST keys} { + r CLIENT TRACKING off + r HELLO 3 + r CLIENT TRACKING on + $rd_sg SET key1 1 + r GET key1 + r CLIENT TRACKING off + r CLIENT TRACKING on BCAST + $rd_sg INCR key1 + set inv_msg [r PING] + set ping_reply [r read] + assert {$inv_msg eq {invalidate key1}} + assert {$ping_reply eq {PONG}} + } + + test {BCAST with prefix collisions throw errors} { + set r [redis_client] + catch {$r CLIENT TRACKING ON BCAST PREFIX FOOBAR PREFIX FOO} output + assert_match {ERR Prefix 'FOOBAR'*'FOO'*} $output + + catch {$r CLIENT TRACKING ON BCAST PREFIX FOO PREFIX FOOBAR} output + assert_match {ERR Prefix 'FOO'*'FOOBAR'*} $output + + $r CLIENT TRACKING ON BCAST PREFIX FOO PREFIX BAR + catch {$r CLIENT TRACKING ON BCAST PREFIX FO} output + assert_match {ERR Prefix 'FO'*'FOO'*} $output + + catch {$r CLIENT TRACKING ON BCAST PREFIX BARB} output + assert_match {ERR Prefix 'BARB'*'BAR'*} $output + + $r CLIENT TRACKING OFF + } + + test {hdel deliver invalidate message after response in the same connection} { + r CLIENT TRACKING off + r HELLO 3 + r CLIENT TRACKING on + r HSET myhash f 1 + r HGET myhash f + set res [r HDEL myhash f] + assert_equal $res 1 + set res [r read] + assert_equal $res {invalidate myhash} + } + + test {Tracking invalidation message is not interleaved with multiple keys response} { + r CLIENT TRACKING off + r HELLO 3 + r CLIENT TRACKING on + # We need disable active expire, so we can trigger lazy expire + r DEBUG SET-ACTIVE-EXPIRE 0 + r MULTI + r MSET x{t} 1 y{t} 2 + r PEXPIRE y{t} 100 + r GET y{t} + r EXEC + after 110 + # Read expired key y{t}, generate invalidate message about this key + set res [r MGET x{t} y{t}] + assert_equal $res {1 {}} + # Consume the invalidate message which is after command response + set res [r read] + assert_equal $res {invalidate y{t}} + r DEBUG SET-ACTIVE-EXPIRE 1 + } {OK} {needs:debug} + + test {Tracking invalidation message is not interleaved with transaction response} { + r CLIENT TRACKING off + r HELLO 3 + r CLIENT TRACKING on + r MSET a{t} 1 b{t} 2 + r GET a{t} + # Start a transaction, make a{t} generate an invalidate message + r MULTI + r INCR a{t} + r GET b{t} + set res [r EXEC] + assert_equal $res {2 2} + set res [r read] + # Consume the invalidate message which is after command response + assert_equal $res {invalidate a{t}} + } + + test {Tracking invalidation message of eviction keys should be before response} { + # Get the current memory limit and calculate a new limit. + r CLIENT TRACKING off + r HELLO 3 + r CLIENT TRACKING on + + # make the previous test is really done before sampling used_memory + wait_lazyfree_done r + + set used [expr {[s used_memory] - [s mem_not_counted_for_evict]}] + set limit [expr {$used+100*1024}] + set old_policy [lindex [r config get maxmemory-policy] 1] + r config set maxmemory $limit + # We set policy volatile-random, so only keys with ttl will be evicted + r config set maxmemory-policy volatile-random + # Add a volatile key and tracking it. + r setex volatile-key 10000 x + r get volatile-key + # We use SETBIT here, so we can set a big key and get the used_memory + # bigger than maxmemory. Next command will evict volatile keys. We + # can't use SET, as SET uses big input buffer, so it will fail. + r setbit big-key 1600000 0 ;# this will consume 200kb + # volatile-key is evicted before response. + set res [r getbit big-key 0] + assert_equal $res {invalidate volatile-key} + set res [r read] + assert_equal $res 0 + r config set maxmemory-policy $old_policy + r config set maxmemory 0 + } + + test {Unblocked BLMOVE gets notification after response} { + r RPUSH list2{t} a + $rd HELLO 3 + $rd read + $rd CLIENT TRACKING on + $rd read + # Tracking key list2{t} + $rd LRANGE list2{t} 0 -1 + $rd read + # We block on list1{t} + $rd BLMOVE list1{t} list2{t} left left 0 + wait_for_blocked_clients_count 1 + # unblock $rd, list2{t} gets element and generate invalidation message + r rpush list1{t} foo + assert_equal [$rd read] {foo} + assert_equal [$rd read] {invalidate list2{t}} + } + + test {Tracking gets notification on tracking table key eviction} { + r CLIENT TRACKING off + r CLIENT TRACKING on REDIRECT $redir_id NOLOOP + r MSET key1{t} 1 key2{t} 2 + # Let the server track the two keys for us + r MGET key1{t} key2{t} + # Force the eviction of all the keys but one: + r config set tracking-table-max-keys 1 + # Note that we may have other keys in the table for this client, + # since we disabled/enabled tracking multiple time with the same + # ID, and tracking does not do ID cleanups for performance reasons. + # So we check that eventually we'll receive one or the other key, + # otherwise the test will die for timeout. + while 1 { + set keys [lindex [$rd_redirection read] 2] + if {$keys eq {key1{t}} || $keys eq {key2{t}}} break + } + # We should receive an expire notification for one of + # the two keys (only one must remain) + assert {$keys eq {key1{t}} || $keys eq {key2{t}}} + } + + test {Invalidation message received for flushall} { + clean_all + r CLIENT TRACKING on REDIRECT $redir_id + $rd_sg SET key1 1 + r GET key1 + $rd_sg FLUSHALL + set msg [$rd_redirection read] + assert {[lindex msg 2] eq {} } + } + + test {Invalidation message received for flushdb} { + clean_all + r CLIENT TRACKING on REDIRECT $redir_id + $rd_sg SET key1 1 + r GET key1 + $rd_sg FLUSHDB + set msg [$rd_redirection read] + assert {[lindex msg 2] eq {} } + } + + test {Test ASYNC flushall} { + clean_all + r CLIENT TRACKING on REDIRECT $redir_id + r GET key1 + r GET key2 + assert_equal [s 0 tracking_total_keys] 2 + $rd_sg FLUSHALL ASYNC + assert_equal [s 0 tracking_total_keys] 0 + assert_equal [lindex [$rd_redirection read] 2] {} + } + + test {flushdb tracking invalidation message is not interleaved with transaction response} { + clean_all + r HELLO 3 + r CLIENT TRACKING on + r SET a{t} 1 + r GET a{t} + r MULTI + r FLUSHDB + set res [r EXEC] + assert_equal $res {OK} + # Consume the invalidate message which is after command response + r read + } {invalidate {}} + + # Keys are defined to be evicted 100 at a time by default. + # If after eviction the number of keys still surpasses the limit + # defined in tracking-table-max-keys, we increases eviction + # effort to 200, and then 300, etc. + # This test tests this effort incrementation. + test {Server is able to evacuate enough keys when num of keys surpasses limit by more than defined initial effort} { + clean_all + set NUM_OF_KEYS_TO_TEST 250 + set TRACKING_TABLE_MAX_KEYS 1 + r CLIENT TRACKING on REDIRECT $redir_id + for {set i 0} {$i < $NUM_OF_KEYS_TO_TEST} {incr i} { + $rd_sg SET key$i $i + r GET key$i + } + r config set tracking-table-max-keys $TRACKING_TABLE_MAX_KEYS + # If not enough keys are evicted, we won't get enough invalidation + # messages, and "$rd_redirection read" will block. + # If too many keys are evicted, we will get too many invalidation + # messages, and the assert will fail. + for {set i 0} {$i < $NUM_OF_KEYS_TO_TEST - $TRACKING_TABLE_MAX_KEYS} {incr i} { + $rd_redirection read + } + $rd_redirection PING + assert {[$rd_redirection read] eq {pong {}}} + } + + test {Tracking info is correct} { + clean_all + r CLIENT TRACKING on REDIRECT $redir_id + $rd_sg SET key1 1 + $rd_sg SET key2 2 + r GET key1 + r GET key2 + $rd CLIENT TRACKING on BCAST PREFIX prefix: + assert [string match *OK* [$rd read]] + $rd_sg SET prefix:key1 1 + $rd_sg SET prefix:key2 2 + set info [r info] + regexp "\r\ntracking_total_items:(.*?)\r\n" $info _ total_items + regexp "\r\ntracking_total_keys:(.*?)\r\n" $info _ total_keys + regexp "\r\ntracking_total_prefixes:(.*?)\r\n" $info _ total_prefixes + regexp "\r\ntracking_clients:(.*?)\r\n" $info _ tracking_clients + assert {$total_items == 2} + assert {$total_keys == 2} + assert {$total_prefixes == 1} + assert {$tracking_clients == 2} + } + + test {CLIENT GETREDIR provides correct client id} { + set res [r CLIENT GETREDIR] + assert_equal $redir_id $res + r CLIENT TRACKING off + set res [r CLIENT GETREDIR] + assert_equal -1 $res + r CLIENT TRACKING on + set res [r CLIENT GETREDIR] + assert_equal 0 $res + } + + test {CLIENT TRACKINGINFO provides reasonable results when tracking off} { + r CLIENT TRACKING off + set res [r client trackinginfo] + set flags [dict get $res flags] + assert_equal {off} $flags + set redirect [dict get $res redirect] + assert_equal {-1} $redirect + set prefixes [dict get $res prefixes] + assert_equal {} $prefixes + } + + test {CLIENT TRACKINGINFO provides reasonable results when tracking on} { + r CLIENT TRACKING on + set res [r client trackinginfo] + set flags [dict get $res flags] + assert_equal {on} $flags + set redirect [dict get $res redirect] + assert_equal {0} $redirect + set prefixes [dict get $res prefixes] + assert_equal {} $prefixes + } + + test {CLIENT TRACKINGINFO provides reasonable results when tracking on with options} { + r CLIENT TRACKING on REDIRECT $redir_id noloop + set res [r client trackinginfo] + set flags [dict get $res flags] + assert_equal {on noloop} $flags + set redirect [dict get $res redirect] + assert_equal $redir_id $redirect + set prefixes [dict get $res prefixes] + assert_equal {} $prefixes + } + + test {CLIENT TRACKINGINFO provides reasonable results when tracking optin} { + r CLIENT TRACKING off + r CLIENT TRACKING on optin + set res [r client trackinginfo] + set flags [dict get $res flags] + assert_equal {on optin} $flags + set redirect [dict get $res redirect] + assert_equal {0} $redirect + set prefixes [dict get $res prefixes] + assert_equal {} $prefixes + + r CLIENT CACHING yes + set res [r client trackinginfo] + set flags [dict get $res flags] + assert_equal {on optin caching-yes} $flags + } + + test {CLIENT TRACKINGINFO provides reasonable results when tracking optout} { + r CLIENT TRACKING off + r CLIENT TRACKING on optout + set res [r client trackinginfo] + set flags [dict get $res flags] + assert_equal {on optout} $flags + set redirect [dict get $res redirect] + assert_equal {0} $redirect + set prefixes [dict get $res prefixes] + assert_equal {} $prefixes + + r CLIENT CACHING no + set res [r client trackinginfo] + set flags [dict get $res flags] + assert_equal {on optout caching-no} $flags + } + + test {CLIENT TRACKINGINFO provides reasonable results when tracking bcast mode} { + r CLIENT TRACKING off + r CLIENT TRACKING on BCAST PREFIX foo PREFIX bar + set res [r client trackinginfo] + set flags [dict get $res flags] + assert_equal {on bcast} $flags + set redirect [dict get $res redirect] + assert_equal {0} $redirect + set prefixes [lsort [dict get $res prefixes]] + assert_equal {bar foo} $prefixes + + r CLIENT TRACKING off + r CLIENT TRACKING on BCAST + set res [r client trackinginfo] + set prefixes [dict get $res prefixes] + assert_equal {{}} $prefixes + } + + test {CLIENT TRACKINGINFO provides reasonable results when tracking redir broken} { + clean_all + r HELLO 3 + r CLIENT TRACKING on REDIRECT $redir_id + $rd_sg SET key1 1 + r GET key1 + $rd_redirection QUIT + assert_equal OK [$rd_redirection read] + $rd_sg SET key1 2 + set res [lsearch -exact [r read] "tracking-redir-broken"] + assert {$res >= 0} + set res [r client trackinginfo] + set flags [dict get $res flags] + assert_equal {on broken_redirect} $flags + set redirect [dict get $res redirect] + assert_equal $redir_id $redirect + set prefixes [dict get $res prefixes] + assert_equal {} $prefixes + } + + test {Regression test for #11715} { + # This issue manifests when a client invalidates keys through the max key + # limit, which invalidates keys to get Redis below the limit, but no command is + # then executed. This can occur in several ways but the simplest is through + # multi-exec which queues commands. + clean_all + r config set tracking-table-max-keys 2 + + # The cron will invalidate keys if we're above the limit, so disable it. + r debug pause-cron 1 + + # Set up a client that has listened to 2 keys and start a multi, this + # sets up the crash for later. + $rd HELLO 3 + $rd read + $rd CLIENT TRACKING on + assert_match "OK" [$rd read] + $rd mget "1{tag}" "2{tag}" + assert_match "{} {}" [$rd read] + $rd multi + assert_match "OK" [$rd read] + + # Reduce the tracking table keys to 1, this doesn't immediately take affect, but + # instead will apply on the next command. + r config set tracking-table-max-keys 1 + + # This command will get queued, so make sure this command doesn't crash. + $rd ping + $rd exec + + # Validate we got some invalidation message and then the command was queued. + assert_match "invalidate *{tag}" [$rd read] + assert_match "QUEUED" [$rd read] + assert_match "PONG" [$rd read] + + r debug pause-cron 0 + } {OK} {needs:debug} + + foreach resp {3 2} { + test "RESP$resp based basic invalidation with client reply off" { + # This entire test is mostly irrelevant for RESP2, but we run it anyway just for some extra coverage. + clean_all + + $rd hello $resp + $rd read + $rd client tracking on + $rd read + + $rd_sg set foo bar + $rd get foo + $rd read + + $rd client reply off + + $rd_sg set foo bar2 + + if {$resp == 3} { + assert_equal {invalidate foo} [$rd read] + } elseif {$resp == 2} { } ;# Just coverage + + # Verify things didn't get messed up and no unexpected reply was pushed to the client. + $rd client reply on + assert_equal {OK} [$rd read] + $rd ping + assert_equal {PONG} [$rd read] + } + } + + test {RESP3 based basic redirect invalidation with client reply off} { + clean_all + + set rd_redir [redis_deferring_client] + $rd_redir hello 3 + $rd_redir read + + $rd_redir client id + set rd_redir_id [$rd_redir read] + + $rd client tracking on redirect $rd_redir_id + $rd read + + $rd_sg set foo bar + $rd get foo + $rd read + + $rd_redir client reply off + + $rd_sg set foo bar2 + assert_equal {invalidate foo} [$rd_redir read] + + # Verify things didn't get messed up and no unexpected reply was pushed to the client. + $rd_redir client reply on + assert_equal {OK} [$rd_redir read] + $rd_redir ping + assert_equal {PONG} [$rd_redir read] + + $rd_redir close + } + + test {RESP3 based basic tracking-redir-broken with client reply off} { + clean_all + + $rd hello 3 + $rd read + $rd client tracking on redirect $redir_id + $rd read + + $rd_sg set foo bar + $rd get foo + $rd read + + $rd client reply off + + $rd_redirection quit + $rd_redirection read + + $rd_sg set foo bar2 + + set res [lsearch -exact [$rd read] "tracking-redir-broken"] + assert_morethan_equal $res 0 + + # Verify things didn't get messed up and no unexpected reply was pushed to the client. + $rd client reply on + assert_equal {OK} [$rd read] + $rd ping + assert_equal {PONG} [$rd read] + } + + $rd_redirection close + $rd_sg close + $rd close +} diff --git a/tests/unit/type/hash.tcl b/tests/unit/type/hash.tcl new file mode 100644 index 0000000..17e3ba4 --- /dev/null +++ b/tests/unit/type/hash.tcl @@ -0,0 +1,836 @@ +start_server {tags {"hash"}} { + test {HSET/HLEN - Small hash creation} { + array set smallhash {} + for {set i 0} {$i < 8} {incr i} { + set key __avoid_collisions__[randstring 0 8 alpha] + set val __avoid_collisions__[randstring 0 8 alpha] + if {[info exists smallhash($key)]} { + incr i -1 + continue + } + r hset smallhash $key $val + set smallhash($key) $val + } + list [r hlen smallhash] + } {8} + + test {Is the small hash encoded with a listpack?} { + assert_encoding listpack smallhash + } + + proc create_hash {key entries} { + r del $key + foreach entry $entries { + r hset $key [lindex $entry 0] [lindex $entry 1] + } + } + + proc get_keys {l} { + set res {} + foreach entry $l { + set key [lindex $entry 0] + lappend res $key + } + return $res + } + + foreach {type contents} "listpack {{a 1} {b 2} {c 3}} hashtable {{a 1} {b 2} {[randstring 70 90 alpha] 3}}" { + set original_max_value [lindex [r config get hash-max-ziplist-value] 1] + r config set hash-max-ziplist-value 10 + create_hash myhash $contents + assert_encoding $type myhash + + # coverage for objectComputeSize + assert_morethan [memory_usage myhash] 0 + + test "HRANDFIELD - $type" { + unset -nocomplain myhash + array set myhash {} + for {set i 0} {$i < 100} {incr i} { + set key [r hrandfield myhash] + set myhash($key) 1 + } + assert_equal [lsort [get_keys $contents]] [lsort [array names myhash]] + } + r config set hash-max-ziplist-value $original_max_value + } + + test "HRANDFIELD with RESP3" { + r hello 3 + set res [r hrandfield myhash 3 withvalues] + assert_equal [llength $res] 3 + assert_equal [llength [lindex $res 1]] 2 + + set res [r hrandfield myhash 3] + assert_equal [llength $res] 3 + assert_equal [llength [lindex $res 1]] 1 + r hello 2 + } + + test "HRANDFIELD count of 0 is handled correctly" { + r hrandfield myhash 0 + } {} + + test "HRANDFIELD count overflow" { + r hmset myhash a 1 + assert_error {*value is out of range*} {r hrandfield myhash -9223372036854770000 withvalues} + assert_error {*value is out of range*} {r hrandfield myhash -9223372036854775808 withvalues} + assert_error {*value is out of range*} {r hrandfield myhash -9223372036854775808} + } {} + + test "HRANDFIELD with <count> against non existing key" { + r hrandfield nonexisting_key 100 + } {} + + # Make sure we can distinguish between an empty array and a null response + r readraw 1 + + test "HRANDFIELD count of 0 is handled correctly - emptyarray" { + r hrandfield myhash 0 + } {*0} + + test "HRANDFIELD with <count> against non existing key - emptyarray" { + r hrandfield nonexisting_key 100 + } {*0} + + r readraw 0 + + foreach {type contents} " + hashtable {{a 1} {b 2} {c 3} {d 4} {e 5} {6 f} {7 g} {8 h} {9 i} {[randstring 70 90 alpha] 10}} + listpack {{a 1} {b 2} {c 3} {d 4} {e 5} {6 f} {7 g} {8 h} {9 i} {10 j}} " { + test "HRANDFIELD with <count> - $type" { + set original_max_value [lindex [r config get hash-max-ziplist-value] 1] + r config set hash-max-ziplist-value 10 + create_hash myhash $contents + assert_encoding $type myhash + + # create a dict for easy lookup + set mydict [dict create {*}[r hgetall myhash]] + + # We'll stress different parts of the code, see the implementation + # of HRANDFIELD for more information, but basically there are + # four different code paths. + + # PATH 1: Use negative count. + + # 1) Check that it returns repeated elements with and without values. + set res [r hrandfield myhash -20] + assert_equal [llength $res] 20 + set res [r hrandfield myhash -1001] + assert_equal [llength $res] 1001 + # again with WITHVALUES + set res [r hrandfield myhash -20 withvalues] + assert_equal [llength $res] 40 + set res [r hrandfield myhash -1001 withvalues] + assert_equal [llength $res] 2002 + + # Test random uniform distribution + # df = 9, 40 means 0.00001 probability + set res [r hrandfield myhash -1000] + assert_lessthan [chi_square_value $res] 40 + + # 2) Check that all the elements actually belong to the original hash. + foreach {key val} $res { + assert {[dict exists $mydict $key]} + } + + # 3) Check that eventually all the elements are returned. + # Use both WITHVALUES and without + unset -nocomplain auxset + set iterations 1000 + while {$iterations != 0} { + incr iterations -1 + if {[expr {$iterations % 2}] == 0} { + set res [r hrandfield myhash -3 withvalues] + foreach {key val} $res { + dict append auxset $key $val + } + } else { + set res [r hrandfield myhash -3] + foreach key $res { + dict append auxset $key $val + } + } + if {[lsort [dict keys $mydict]] eq + [lsort [dict keys $auxset]]} { + break; + } + } + assert {$iterations != 0} + + # PATH 2: positive count (unique behavior) with requested size + # equal or greater than set size. + foreach size {10 20} { + set res [r hrandfield myhash $size] + assert_equal [llength $res] 10 + assert_equal [lsort $res] [lsort [dict keys $mydict]] + + # again with WITHVALUES + set res [r hrandfield myhash $size withvalues] + assert_equal [llength $res] 20 + assert_equal [lsort $res] [lsort $mydict] + } + + # PATH 3: Ask almost as elements as there are in the set. + # In this case the implementation will duplicate the original + # set and will remove random elements up to the requested size. + # + # PATH 4: Ask a number of elements definitely smaller than + # the set size. + # + # We can test both the code paths just changing the size but + # using the same code. + foreach size {8 2} { + set res [r hrandfield myhash $size] + assert_equal [llength $res] $size + # again with WITHVALUES + set res [r hrandfield myhash $size withvalues] + assert_equal [llength $res] [expr {$size * 2}] + + # 1) Check that all the elements actually belong to the + # original set. + foreach ele [dict keys $res] { + assert {[dict exists $mydict $ele]} + } + + # 2) Check that eventually all the elements are returned. + # Use both WITHVALUES and without + unset -nocomplain auxset + unset -nocomplain allkey + set iterations [expr {1000 / $size}] + set all_ele_return false + while {$iterations != 0} { + incr iterations -1 + if {[expr {$iterations % 2}] == 0} { + set res [r hrandfield myhash $size withvalues] + foreach {key value} $res { + dict append auxset $key $value + lappend allkey $key + } + } else { + set res [r hrandfield myhash $size] + foreach key $res { + dict append auxset $key + lappend allkey $key + } + } + if {[lsort [dict keys $mydict]] eq + [lsort [dict keys $auxset]]} { + set all_ele_return true + } + } + assert_equal $all_ele_return true + # df = 9, 40 means 0.00001 probability + assert_lessthan [chi_square_value $allkey] 40 + } + } + r config set hash-max-ziplist-value $original_max_value + } + + + test {HSET/HLEN - Big hash creation} { + array set bighash {} + for {set i 0} {$i < 1024} {incr i} { + set key __avoid_collisions__[randstring 0 8 alpha] + set val __avoid_collisions__[randstring 0 8 alpha] + if {[info exists bighash($key)]} { + incr i -1 + continue + } + r hset bighash $key $val + set bighash($key) $val + } + list [r hlen bighash] + } {1024} + + test {Is the big hash encoded with an hash table?} { + assert_encoding hashtable bighash + } + + test {HGET against the small hash} { + set err {} + foreach k [array names smallhash *] { + if {$smallhash($k) ne [r hget smallhash $k]} { + set err "$smallhash($k) != [r hget smallhash $k]" + break + } + } + set _ $err + } {} + + test {HGET against the big hash} { + set err {} + foreach k [array names bighash *] { + if {$bighash($k) ne [r hget bighash $k]} { + set err "$bighash($k) != [r hget bighash $k]" + break + } + } + set _ $err + } {} + + test {HGET against non existing key} { + set rv {} + lappend rv [r hget smallhash __123123123__] + lappend rv [r hget bighash __123123123__] + set _ $rv + } {{} {}} + + test {HSET in update and insert mode} { + set rv {} + set k [lindex [array names smallhash *] 0] + lappend rv [r hset smallhash $k newval1] + set smallhash($k) newval1 + lappend rv [r hget smallhash $k] + lappend rv [r hset smallhash __foobar123__ newval] + set k [lindex [array names bighash *] 0] + lappend rv [r hset bighash $k newval2] + set bighash($k) newval2 + lappend rv [r hget bighash $k] + lappend rv [r hset bighash __foobar123__ newval] + lappend rv [r hdel smallhash __foobar123__] + lappend rv [r hdel bighash __foobar123__] + set _ $rv + } {0 newval1 1 0 newval2 1 1 1} + + test {HSETNX target key missing - small hash} { + r hsetnx smallhash __123123123__ foo + r hget smallhash __123123123__ + } {foo} + + test {HSETNX target key exists - small hash} { + r hsetnx smallhash __123123123__ bar + set result [r hget smallhash __123123123__] + r hdel smallhash __123123123__ + set _ $result + } {foo} + + test {HSETNX target key missing - big hash} { + r hsetnx bighash __123123123__ foo + r hget bighash __123123123__ + } {foo} + + test {HSETNX target key exists - big hash} { + r hsetnx bighash __123123123__ bar + set result [r hget bighash __123123123__] + r hdel bighash __123123123__ + set _ $result + } {foo} + + test {HSET/HMSET wrong number of args} { + assert_error {*wrong number of arguments for 'hset' command} {r hset smallhash key1 val1 key2} + assert_error {*wrong number of arguments for 'hmset' command} {r hmset smallhash key1 val1 key2} + } + + test {HMSET - small hash} { + set args {} + foreach {k v} [array get smallhash] { + set newval [randstring 0 8 alpha] + set smallhash($k) $newval + lappend args $k $newval + } + r hmset smallhash {*}$args + } {OK} + + test {HMSET - big hash} { + set args {} + foreach {k v} [array get bighash] { + set newval [randstring 0 8 alpha] + set bighash($k) $newval + lappend args $k $newval + } + r hmset bighash {*}$args + } {OK} + + test {HMGET against non existing key and fields} { + set rv {} + lappend rv [r hmget doesntexist __123123123__ __456456456__] + lappend rv [r hmget smallhash __123123123__ __456456456__] + lappend rv [r hmget bighash __123123123__ __456456456__] + set _ $rv + } {{{} {}} {{} {}} {{} {}}} + + test {HMGET against wrong type} { + r set wrongtype somevalue + assert_error "*wrong*" {r hmget wrongtype field1 field2} + } + + test {HMGET - small hash} { + set keys {} + set vals {} + foreach {k v} [array get smallhash] { + lappend keys $k + lappend vals $v + } + set err {} + set result [r hmget smallhash {*}$keys] + if {$vals ne $result} { + set err "$vals != $result" + break + } + set _ $err + } {} + + test {HMGET - big hash} { + set keys {} + set vals {} + foreach {k v} [array get bighash] { + lappend keys $k + lappend vals $v + } + set err {} + set result [r hmget bighash {*}$keys] + if {$vals ne $result} { + set err "$vals != $result" + break + } + set _ $err + } {} + + test {HKEYS - small hash} { + lsort [r hkeys smallhash] + } [lsort [array names smallhash *]] + + test {HKEYS - big hash} { + lsort [r hkeys bighash] + } [lsort [array names bighash *]] + + test {HVALS - small hash} { + set vals {} + foreach {k v} [array get smallhash] { + lappend vals $v + } + set _ [lsort $vals] + } [lsort [r hvals smallhash]] + + test {HVALS - big hash} { + set vals {} + foreach {k v} [array get bighash] { + lappend vals $v + } + set _ [lsort $vals] + } [lsort [r hvals bighash]] + + test {HGETALL - small hash} { + lsort [r hgetall smallhash] + } [lsort [array get smallhash]] + + test {HGETALL - big hash} { + lsort [r hgetall bighash] + } [lsort [array get bighash]] + + test {HDEL and return value} { + set rv {} + lappend rv [r hdel smallhash nokey] + lappend rv [r hdel bighash nokey] + set k [lindex [array names smallhash *] 0] + lappend rv [r hdel smallhash $k] + lappend rv [r hdel smallhash $k] + lappend rv [r hget smallhash $k] + unset smallhash($k) + set k [lindex [array names bighash *] 0] + lappend rv [r hdel bighash $k] + lappend rv [r hdel bighash $k] + lappend rv [r hget bighash $k] + unset bighash($k) + set _ $rv + } {0 0 1 0 {} 1 0 {}} + + test {HDEL - more than a single value} { + set rv {} + r del myhash + r hmset myhash a 1 b 2 c 3 + assert_equal 0 [r hdel myhash x y] + assert_equal 2 [r hdel myhash a c f] + r hgetall myhash + } {b 2} + + test {HDEL - hash becomes empty before deleting all specified fields} { + r del myhash + r hmset myhash a 1 b 2 c 3 + assert_equal 3 [r hdel myhash a b c d e] + assert_equal 0 [r exists myhash] + } + + test {HEXISTS} { + set rv {} + set k [lindex [array names smallhash *] 0] + lappend rv [r hexists smallhash $k] + lappend rv [r hexists smallhash nokey] + set k [lindex [array names bighash *] 0] + lappend rv [r hexists bighash $k] + lappend rv [r hexists bighash nokey] + } {1 0 1 0} + + test {Is a ziplist encoded Hash promoted on big payload?} { + r hset smallhash foo [string repeat a 1024] + r debug object smallhash + } {*hashtable*} {needs:debug} + + test {HINCRBY against non existing database key} { + r del htest + list [r hincrby htest foo 2] + } {2} + + test {HINCRBY against non existing hash key} { + set rv {} + r hdel smallhash tmp + r hdel bighash tmp + lappend rv [r hincrby smallhash tmp 2] + lappend rv [r hget smallhash tmp] + lappend rv [r hincrby bighash tmp 2] + lappend rv [r hget bighash tmp] + } {2 2 2 2} + + test {HINCRBY against hash key created by hincrby itself} { + set rv {} + lappend rv [r hincrby smallhash tmp 3] + lappend rv [r hget smallhash tmp] + lappend rv [r hincrby bighash tmp 3] + lappend rv [r hget bighash tmp] + } {5 5 5 5} + + test {HINCRBY against hash key originally set with HSET} { + r hset smallhash tmp 100 + r hset bighash tmp 100 + list [r hincrby smallhash tmp 2] [r hincrby bighash tmp 2] + } {102 102} + + test {HINCRBY over 32bit value} { + r hset smallhash tmp 17179869184 + r hset bighash tmp 17179869184 + list [r hincrby smallhash tmp 1] [r hincrby bighash tmp 1] + } {17179869185 17179869185} + + test {HINCRBY over 32bit value with over 32bit increment} { + r hset smallhash tmp 17179869184 + r hset bighash tmp 17179869184 + list [r hincrby smallhash tmp 17179869184] [r hincrby bighash tmp 17179869184] + } {34359738368 34359738368} + + test {HINCRBY fails against hash value with spaces (left)} { + r hset smallhash str " 11" + r hset bighash str " 11" + catch {r hincrby smallhash str 1} smallerr + catch {r hincrby bighash str 1} bigerr + set rv {} + lappend rv [string match "ERR *not an integer*" $smallerr] + lappend rv [string match "ERR *not an integer*" $bigerr] + } {1 1} + + test {HINCRBY fails against hash value with spaces (right)} { + r hset smallhash str "11 " + r hset bighash str "11 " + catch {r hincrby smallhash str 1} smallerr + catch {r hincrby bighash str 1} bigerr + set rv {} + lappend rv [string match "ERR *not an integer*" $smallerr] + lappend rv [string match "ERR *not an integer*" $bigerr] + } {1 1} + + test {HINCRBY can detect overflows} { + set e {} + r hset hash n -9223372036854775484 + assert {[r hincrby hash n -1] == -9223372036854775485} + catch {r hincrby hash n -10000} e + set e + } {*overflow*} + + test {HINCRBYFLOAT against non existing database key} { + r del htest + list [r hincrbyfloat htest foo 2.5] + } {2.5} + + test {HINCRBYFLOAT against non existing hash key} { + set rv {} + r hdel smallhash tmp + r hdel bighash tmp + lappend rv [roundFloat [r hincrbyfloat smallhash tmp 2.5]] + lappend rv [roundFloat [r hget smallhash tmp]] + lappend rv [roundFloat [r hincrbyfloat bighash tmp 2.5]] + lappend rv [roundFloat [r hget bighash tmp]] + } {2.5 2.5 2.5 2.5} + + test {HINCRBYFLOAT against hash key created by hincrby itself} { + set rv {} + lappend rv [roundFloat [r hincrbyfloat smallhash tmp 3.5]] + lappend rv [roundFloat [r hget smallhash tmp]] + lappend rv [roundFloat [r hincrbyfloat bighash tmp 3.5]] + lappend rv [roundFloat [r hget bighash tmp]] + } {6 6 6 6} + + test {HINCRBYFLOAT against hash key originally set with HSET} { + r hset smallhash tmp 100 + r hset bighash tmp 100 + list [roundFloat [r hincrbyfloat smallhash tmp 2.5]] \ + [roundFloat [r hincrbyfloat bighash tmp 2.5]] + } {102.5 102.5} + + test {HINCRBYFLOAT over 32bit value} { + r hset smallhash tmp 17179869184 + r hset bighash tmp 17179869184 + list [r hincrbyfloat smallhash tmp 1] \ + [r hincrbyfloat bighash tmp 1] + } {17179869185 17179869185} + + test {HINCRBYFLOAT over 32bit value with over 32bit increment} { + r hset smallhash tmp 17179869184 + r hset bighash tmp 17179869184 + list [r hincrbyfloat smallhash tmp 17179869184] \ + [r hincrbyfloat bighash tmp 17179869184] + } {34359738368 34359738368} + + test {HINCRBYFLOAT fails against hash value with spaces (left)} { + r hset smallhash str " 11" + r hset bighash str " 11" + catch {r hincrbyfloat smallhash str 1} smallerr + catch {r hincrbyfloat bighash str 1} bigerr + set rv {} + lappend rv [string match "ERR *not*float*" $smallerr] + lappend rv [string match "ERR *not*float*" $bigerr] + } {1 1} + + test {HINCRBYFLOAT fails against hash value with spaces (right)} { + r hset smallhash str "11 " + r hset bighash str "11 " + catch {r hincrbyfloat smallhash str 1} smallerr + catch {r hincrbyfloat bighash str 1} bigerr + set rv {} + lappend rv [string match "ERR *not*float*" $smallerr] + lappend rv [string match "ERR *not*float*" $bigerr] + } {1 1} + + test {HINCRBYFLOAT fails against hash value that contains a null-terminator in the middle} { + r hset h f "1\x002" + catch {r hincrbyfloat h f 1} err + set rv {} + lappend rv [string match "ERR *not*float*" $err] + } {1} + + test {HSTRLEN against the small hash} { + set err {} + foreach k [array names smallhash *] { + if {[string length $smallhash($k)] ne [r hstrlen smallhash $k]} { + set err "[string length $smallhash($k)] != [r hstrlen smallhash $k]" + break + } + } + set _ $err + } {} + + test {HSTRLEN against the big hash} { + set err {} + foreach k [array names bighash *] { + if {[string length $bighash($k)] ne [r hstrlen bighash $k]} { + set err "[string length $bighash($k)] != [r hstrlen bighash $k]" + puts "HSTRLEN and logical length mismatch:" + puts "key: $k" + puts "Logical content: $bighash($k)" + puts "Server content: [r hget bighash $k]" + } + } + set _ $err + } {} + + test {HSTRLEN against non existing field} { + set rv {} + lappend rv [r hstrlen smallhash __123123123__] + lappend rv [r hstrlen bighash __123123123__] + set _ $rv + } {0 0} + + test {HSTRLEN corner cases} { + set vals { + -9223372036854775808 9223372036854775807 9223372036854775808 + {} 0 -1 x + } + foreach v $vals { + r hmset smallhash field $v + r hmset bighash field $v + set len1 [string length $v] + set len2 [r hstrlen smallhash field] + set len3 [r hstrlen bighash field] + assert {$len1 == $len2} + assert {$len2 == $len3} + } + } + + test {HINCRBYFLOAT over hash-max-listpack-value encoded with a listpack} { + set original_max_value [lindex [r config get hash-max-ziplist-value] 1] + r config set hash-max-listpack-value 8 + + # hash's value exceeds hash-max-listpack-value + r del smallhash + r del bighash + r hset smallhash tmp 0 + r hset bighash tmp 0 + r hincrbyfloat smallhash tmp 0.000005 + r hincrbyfloat bighash tmp 0.0000005 + assert_encoding listpack smallhash + assert_encoding hashtable bighash + + # hash's field exceeds hash-max-listpack-value + r del smallhash + r del bighash + r hincrbyfloat smallhash abcdefgh 1 + r hincrbyfloat bighash abcdefghi 1 + assert_encoding listpack smallhash + assert_encoding hashtable bighash + + r config set hash-max-listpack-value $original_max_value + } + + test {Hash ziplist regression test for large keys} { + r hset hash kkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkk a + r hset hash kkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkk b + r hget hash kkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkk + } {b} + + foreach size {10 512} { + test "Hash fuzzing #1 - $size fields" { + for {set times 0} {$times < 10} {incr times} { + catch {unset hash} + array set hash {} + r del hash + + # Create + for {set j 0} {$j < $size} {incr j} { + set field [randomValue] + set value [randomValue] + r hset hash $field $value + set hash($field) $value + } + + # Verify + foreach {k v} [array get hash] { + assert_equal $v [r hget hash $k] + } + assert_equal [array size hash] [r hlen hash] + } + } + + test "Hash fuzzing #2 - $size fields" { + for {set times 0} {$times < 10} {incr times} { + catch {unset hash} + array set hash {} + r del hash + + # Create + for {set j 0} {$j < $size} {incr j} { + randpath { + set field [randomValue] + set value [randomValue] + r hset hash $field $value + set hash($field) $value + } { + set field [randomSignedInt 512] + set value [randomSignedInt 512] + r hset hash $field $value + set hash($field) $value + } { + randpath { + set field [randomValue] + } { + set field [randomSignedInt 512] + } + r hdel hash $field + unset -nocomplain hash($field) + } + } + + # Verify + foreach {k v} [array get hash] { + assert_equal $v [r hget hash $k] + } + assert_equal [array size hash] [r hlen hash] + } + } + } + + test {Stress test the hash ziplist -> hashtable encoding conversion} { + r config set hash-max-ziplist-entries 32 + for {set j 0} {$j < 100} {incr j} { + r del myhash + for {set i 0} {$i < 64} {incr i} { + r hset myhash [randomValue] [randomValue] + } + assert_encoding hashtable myhash + } + } + + # The following test can only be executed if we don't use Valgrind, and if + # we are using x86_64 architecture, because: + # + # 1) Valgrind has floating point limitations, no support for 80 bits math. + # 2) Other archs may have the same limits. + # + # 1.23 cannot be represented correctly with 64 bit doubles, so we skip + # the test, since we are only testing pretty printing here and is not + # a bug if the program outputs things like 1.299999... + if {!$::valgrind && [string match *x86_64* [exec uname -a]]} { + test {Test HINCRBYFLOAT for correct float representation (issue #2846)} { + r del myhash + assert {[r hincrbyfloat myhash float 1.23] eq {1.23}} + assert {[r hincrbyfloat myhash float 0.77] eq {2}} + assert {[r hincrbyfloat myhash float -0.1] eq {1.9}} + } + } + + test {Hash ziplist of various encodings} { + r del k + config_set hash-max-ziplist-entries 1000000000 + config_set hash-max-ziplist-value 1000000000 + r hset k ZIP_INT_8B 127 + r hset k ZIP_INT_16B 32767 + r hset k ZIP_INT_32B 2147483647 + r hset k ZIP_INT_64B 9223372036854775808 + r hset k ZIP_INT_IMM_MIN 0 + r hset k ZIP_INT_IMM_MAX 12 + r hset k ZIP_STR_06B [string repeat x 31] + r hset k ZIP_STR_14B [string repeat x 8191] + r hset k ZIP_STR_32B [string repeat x 65535] + set k [r hgetall k] + set dump [r dump k] + + # will be converted to dict at RESTORE + config_set hash-max-ziplist-entries 2 + config_set sanitize-dump-payload no mayfail + r restore kk 0 $dump + set kk [r hgetall kk] + + # make sure the values are right + assert_equal [lsort $k] [lsort $kk] + assert_equal [dict get $k ZIP_STR_06B] [string repeat x 31] + set k [dict remove $k ZIP_STR_06B] + assert_equal [dict get $k ZIP_STR_14B] [string repeat x 8191] + set k [dict remove $k ZIP_STR_14B] + assert_equal [dict get $k ZIP_STR_32B] [string repeat x 65535] + set k [dict remove $k ZIP_STR_32B] + set _ $k + } {ZIP_INT_8B 127 ZIP_INT_16B 32767 ZIP_INT_32B 2147483647 ZIP_INT_64B 9223372036854775808 ZIP_INT_IMM_MIN 0 ZIP_INT_IMM_MAX 12} + + test {Hash ziplist of various encodings - sanitize dump} { + config_set sanitize-dump-payload yes mayfail + r restore kk 0 $dump replace + set k [r hgetall k] + set kk [r hgetall kk] + + # make sure the values are right + assert_equal [lsort $k] [lsort $kk] + assert_equal [dict get $k ZIP_STR_06B] [string repeat x 31] + set k [dict remove $k ZIP_STR_06B] + assert_equal [dict get $k ZIP_STR_14B] [string repeat x 8191] + set k [dict remove $k ZIP_STR_14B] + assert_equal [dict get $k ZIP_STR_32B] [string repeat x 65535] + set k [dict remove $k ZIP_STR_32B] + set _ $k + } {ZIP_INT_8B 127 ZIP_INT_16B 32767 ZIP_INT_32B 2147483647 ZIP_INT_64B 9223372036854775808 ZIP_INT_IMM_MIN 0 ZIP_INT_IMM_MAX 12} + + # On some platforms strtold("+inf") with valgrind returns a non-inf result + if {!$::valgrind} { + test {HINCRBYFLOAT does not allow NaN or Infinity} { + assert_error "*value is NaN or Infinity*" {r hincrbyfloat hfoo field +inf} + assert_equal 0 [r exists hfoo] + } + } +} diff --git a/tests/unit/type/incr.tcl b/tests/unit/type/incr.tcl new file mode 100644 index 0000000..b744685 --- /dev/null +++ b/tests/unit/type/incr.tcl @@ -0,0 +1,170 @@ +start_server {tags {"incr"}} { + test {INCR against non existing key} { + set res {} + append res [r incr novar] + append res [r get novar] + } {11} + + test {INCR against key created by incr itself} { + r incr novar + } {2} + + test {INCR against key originally set with SET} { + r set novar 100 + r incr novar + } {101} + + test {INCR over 32bit value} { + r set novar 17179869184 + r incr novar + } {17179869185} + + test {INCRBY over 32bit value with over 32bit increment} { + r set novar 17179869184 + r incrby novar 17179869184 + } {34359738368} + + test {INCR fails against key with spaces (left)} { + r set novar " 11" + catch {r incr novar} err + format $err + } {ERR*} + + test {INCR fails against key with spaces (right)} { + r set novar "11 " + catch {r incr novar} err + format $err + } {ERR*} + + test {INCR fails against key with spaces (both)} { + r set novar " 11 " + catch {r incr novar} err + format $err + } {ERR*} + + test {DECRBY negation overflow} { + r set x 0 + catch {r decrby x -9223372036854775808} err + format $err + } {ERR*} + + test {INCR fails against a key holding a list} { + r rpush mylist 1 + catch {r incr mylist} err + r rpop mylist + format $err + } {WRONGTYPE*} + + test {DECRBY over 32bit value with over 32bit increment, negative res} { + r set novar 17179869184 + r decrby novar 17179869185 + } {-1} + + test {INCR uses shared objects in the 0-9999 range} { + r set foo -1 + r incr foo + assert {[r object refcount foo] > 1} + r set foo 9998 + r incr foo + assert {[r object refcount foo] > 1} + r incr foo + assert {[r object refcount foo] == 1} + } {} {needs:debug} + + test {INCR can modify objects in-place} { + r set foo 20000 + r incr foo + assert {[r object refcount foo] == 1} + set old [lindex [split [r debug object foo]] 1] + r incr foo + set new [lindex [split [r debug object foo]] 1] + assert {[string range $old 0 2] eq "at:"} + assert {[string range $new 0 2] eq "at:"} + assert {$old eq $new} + } {} {needs:debug} + + test {INCRBYFLOAT against non existing key} { + r del novar + list [roundFloat [r incrbyfloat novar 1]] \ + [roundFloat [r get novar]] \ + [roundFloat [r incrbyfloat novar 0.25]] \ + [roundFloat [r get novar]] + } {1 1 1.25 1.25} + + test {INCRBYFLOAT against key originally set with SET} { + r set novar 1.5 + roundFloat [r incrbyfloat novar 1.5] + } {3} + + test {INCRBYFLOAT over 32bit value} { + r set novar 17179869184 + r incrbyfloat novar 1.5 + } {17179869185.5} + + test {INCRBYFLOAT over 32bit value with over 32bit increment} { + r set novar 17179869184 + r incrbyfloat novar 17179869184 + } {34359738368} + + test {INCRBYFLOAT fails against key with spaces (left)} { + set err {} + r set novar " 11" + catch {r incrbyfloat novar 1.0} err + format $err + } {ERR *valid*} + + test {INCRBYFLOAT fails against key with spaces (right)} { + set err {} + r set novar "11 " + catch {r incrbyfloat novar 1.0} err + format $err + } {ERR *valid*} + + test {INCRBYFLOAT fails against key with spaces (both)} { + set err {} + r set novar " 11 " + catch {r incrbyfloat novar 1.0} err + format $err + } {ERR *valid*} + + test {INCRBYFLOAT fails against a key holding a list} { + r del mylist + set err {} + r rpush mylist 1 + catch {r incrbyfloat mylist 1.0} err + r del mylist + format $err + } {WRONGTYPE*} + + # On some platforms strtold("+inf") with valgrind returns a non-inf result + if {!$::valgrind} { + test {INCRBYFLOAT does not allow NaN or Infinity} { + r set foo 0 + set err {} + catch {r incrbyfloat foo +inf} err + set err + # p.s. no way I can force NaN to test it from the API because + # there is no way to increment / decrement by infinity nor to + # perform divisions. + } {ERR *would produce*} + } + + test {INCRBYFLOAT decrement} { + r set foo 1 + roundFloat [r incrbyfloat foo -1.1] + } {-0.1} + + test {string to double with null terminator} { + r set foo 1 + r setrange foo 2 2 + catch {r incrbyfloat foo 1} err + format $err + } {ERR *valid*} + + test {No negative zero} { + r del foo + r incrbyfloat foo [expr double(1)/41] + r incrbyfloat foo [expr double(-1)/41] + r get foo + } {0} +} diff --git a/tests/unit/type/list-2.tcl b/tests/unit/type/list-2.tcl new file mode 100644 index 0000000..5874a90 --- /dev/null +++ b/tests/unit/type/list-2.tcl @@ -0,0 +1,47 @@ +start_server { + tags {"list"} + overrides { + "list-max-ziplist-size" 4 + } +} { + source "tests/unit/type/list-common.tcl" + + foreach {type large} [array get largevalue] { + tags {"slow"} { + test "LTRIM stress testing - $type" { + set mylist {} + set startlen 32 + r del mylist + + # Start with the large value to ensure the + # right encoding is used. + r rpush mylist $large + lappend mylist $large + + for {set i 0} {$i < $startlen} {incr i} { + set str [randomInt 9223372036854775807] + r rpush mylist $str + lappend mylist $str + } + + for {set i 0} {$i < 1000} {incr i} { + set min [expr {int(rand()*$startlen)}] + set max [expr {$min+int(rand()*$startlen)}] + set before_len [llength $mylist] + set before_len_r [r llen mylist] + assert_equal $before_len $before_len_r + set mylist [lrange $mylist $min $max] + r ltrim mylist $min $max + assert_equal $mylist [r lrange mylist 0 -1] "failed trim" + + for {set j [r llen mylist]} {$j < $startlen} {incr j} { + set str [randomInt 9223372036854775807] + r rpush mylist $str + lappend mylist $str + assert_equal $mylist [r lrange mylist 0 -1] "failed append match" + } + } + } + } + } +} diff --git a/tests/unit/type/list-3.tcl b/tests/unit/type/list-3.tcl new file mode 100644 index 0000000..45df593 --- /dev/null +++ b/tests/unit/type/list-3.tcl @@ -0,0 +1,232 @@ +proc generate_cmd_on_list_key {key} { + set op [randomInt 7] + set small_signed_count [expr 5-[randomInt 10]] + if {[randomInt 2] == 0} { + set ele [randomInt 1000] + } else { + set ele [string repeat x [randomInt 10000]][randomInt 1000] + } + switch $op { + 0 {return "lpush $key $ele"} + 1 {return "rpush $key $ele"} + 2 {return "lpop $key"} + 3 {return "rpop $key"} + 4 { + return "lset $key $small_signed_count $ele" + } + 5 { + set otherele [randomInt 1000] + if {[randomInt 2] == 0} { + set where before + } else { + set where after + } + return "linsert $key $where $otherele $ele" + } + 6 { + set otherele "" + catch { + set index [randomInt [r llen $key]] + set otherele [r lindex $key $index] + } + return "lrem $key 1 $otherele" + } + } +} + +start_server { + tags {"list ziplist"} + overrides { + "list-max-ziplist-size" 16 + } +} { + test {Explicit regression for a list bug} { + set mylist {49376042582 {BkG2o\pIC]4YYJa9cJ4GWZalG[4tin;1D2whSkCOW`mX;SFXGyS8sedcff3fQI^tgPCC@^Nu1J6o]meM@Lko]t_jRyo<xSJ1oObDYd`ppZuW6P@fS278YaOx=s6lvdFlMbP0[SbkI^Kr\HBXtuFaA^mDx:yzS4a[skiiPWhT<nNfAf=aQVfclcuwDrfe;iVuKdNvB9kbfq>tK?tH[\EvWqS]b`o2OCtjg:?nUTwdjpcUm]y:pg5q24q7LlCOwQE^}} + r del l + r rpush l [lindex $mylist 0] + r rpush l [lindex $mylist 1] + assert_equal [r lindex l 0] [lindex $mylist 0] + assert_equal [r lindex l 1] [lindex $mylist 1] + } + + test {Regression for quicklist #3343 bug} { + r del mylist + r lpush mylist 401 + r lpush mylist 392 + r rpush mylist [string repeat x 5105]"799" + r lset mylist -1 [string repeat x 1014]"702" + r lpop mylist + r lset mylist -1 [string repeat x 4149]"852" + r linsert mylist before 401 [string repeat x 9927]"12" + r lrange mylist 0 -1 + r ping ; # It's enough if the server is still alive + } {PONG} + + test {Check compression with recompress} { + r del key + config_set list-compress-depth 1 + config_set list-max-ziplist-size 16 + r rpush key a + r rpush key [string repeat b 50000] + r rpush key c + r lset key 1 d + r rpop key + r rpush key [string repeat e 5000] + r linsert key before f 1 + r rpush key g + r ping + } + + test {Crash due to wrongly recompress after lrem} { + r del key + config_set list-compress-depth 2 + r lpush key a + r lpush key [string repeat a 5000] + r lpush key [string repeat b 5000] + r lpush key [string repeat c 5000] + r rpush key [string repeat x 10000]"969" + r rpush key b + r lrem key 1 a + r rpop key + r lrem key 1 [string repeat x 10000]"969" + r rpush key crash + r ping + } + + test {LINSERT correctly recompress full quicklistNode after inserting a element before it} { + r del key + config_set list-compress-depth 1 + r rpush key b + r rpush key c + r lset key -1 [string repeat x 8192]"969" + r lpush key a + r rpush key d + r linsert key before b f + r rpop key + r ping + } + + test {LINSERT correctly recompress full quicklistNode after inserting a element after it} { + r del key + config_set list-compress-depth 1 + r rpush key b + r rpush key c + r lset key 0 [string repeat x 8192]"969" + r lpush key a + r rpush key d + r linsert key after c f + r lpop key + r ping + } + +foreach comp {2 1 0} { + set cycles 1000 + if {$::accurate} { set cycles 10000 } + config_set list-compress-depth $comp + + test "Stress tester for #3343-alike bugs comp: $comp" { + r del key + set sent {} + for {set j 0} {$j < $cycles} {incr j} { + catch { + set cmd [generate_cmd_on_list_key key] + lappend sent $cmd + + # execute the command, we expect commands to fail on syntax errors + r {*}$cmd + } + } + + set print_commands false + set crash false + if {[catch {r ping}]} { + puts "Server crashed" + set print_commands true + set crash true + } + + if {!$::external} { + # check valgrind and asan report for invalid reads after execute + # command so that we have a report that is easier to reproduce + set valgrind_errors [find_valgrind_errors [srv 0 stderr] false] + set asan_errors [sanitizer_errors_from_file [srv 0 stderr]] + if {$valgrind_errors != "" || $asan_errors != ""} { + puts "valgrind or asan found an issue" + set print_commands true + } + } + + if {$print_commands} { + puts "violating commands:" + foreach cmd $sent { + puts $cmd + } + } + + assert_equal $crash false + } +} ;# foreach comp + + tags {slow} { + test {ziplist implementation: value encoding and backlink} { + if {$::accurate} {set iterations 100} else {set iterations 10} + for {set j 0} {$j < $iterations} {incr j} { + r del l + set l {} + for {set i 0} {$i < 200} {incr i} { + randpath { + set data [string repeat x [randomInt 100000]] + } { + set data [randomInt 65536] + } { + set data [randomInt 4294967296] + } { + set data [randomInt 18446744073709551616] + } { + set data -[randomInt 65536] + if {$data eq {-0}} {set data 0} + } { + set data -[randomInt 4294967296] + if {$data eq {-0}} {set data 0} + } { + set data -[randomInt 18446744073709551616] + if {$data eq {-0}} {set data 0} + } + lappend l $data + r rpush l $data + } + assert_equal [llength $l] [r llen l] + # Traverse backward + for {set i 199} {$i >= 0} {incr i -1} { + if {[lindex $l $i] ne [r lindex l $i]} { + assert_equal [lindex $l $i] [r lindex l $i] + } + } + } + } + + test {ziplist implementation: encoding stress testing} { + for {set j 0} {$j < 200} {incr j} { + r del l + set l {} + set len [randomInt 400] + for {set i 0} {$i < $len} {incr i} { + set rv [randomValue] + randpath { + lappend l $rv + r rpush l $rv + } { + set l [concat [list $rv] $l] + r lpush l $rv + } + } + assert_equal [llength $l] [r llen l] + for {set i 0} {$i < $len} {incr i} { + if {[lindex $l $i] ne [r lindex l $i]} { + assert_equal [lindex $l $i] [r lindex l $i] + } + } + } + } + } +} diff --git a/tests/unit/type/list-common.tcl b/tests/unit/type/list-common.tcl new file mode 100644 index 0000000..ab45f0b --- /dev/null +++ b/tests/unit/type/list-common.tcl @@ -0,0 +1,5 @@ +# We need a value larger than list-max-ziplist-value to make sure +# the list has the right encoding when it is swapped in again. +array set largevalue {} +set largevalue(ziplist) "hello" +set largevalue(linkedlist) [string repeat "hello" 4] diff --git a/tests/unit/type/list.tcl b/tests/unit/type/list.tcl new file mode 100644 index 0000000..0c52dd8 --- /dev/null +++ b/tests/unit/type/list.tcl @@ -0,0 +1,2018 @@ +# check functionality compression of plain and zipped nodes +start_server [list overrides [list save ""] ] { + r config set list-compress-depth 2 + r config set list-max-ziplist-size 1 + + # 3 test to check compression with regular ziplist nodes + # 1. using push + insert + # 2. using push + insert + trim + # 3. using push + insert + set + + test {reg node check compression with insert and pop} { + r lpush list1 [string repeat a 500] + r lpush list1 [string repeat b 500] + r lpush list1 [string repeat c 500] + r lpush list1 [string repeat d 500] + r linsert list1 after [string repeat d 500] [string repeat e 500] + r linsert list1 after [string repeat d 500] [string repeat f 500] + r linsert list1 after [string repeat d 500] [string repeat g 500] + r linsert list1 after [string repeat d 500] [string repeat j 500] + assert_equal [r lpop list1] [string repeat d 500] + assert_equal [r lpop list1] [string repeat j 500] + assert_equal [r lpop list1] [string repeat g 500] + assert_equal [r lpop list1] [string repeat f 500] + assert_equal [r lpop list1] [string repeat e 500] + assert_equal [r lpop list1] [string repeat c 500] + assert_equal [r lpop list1] [string repeat b 500] + assert_equal [r lpop list1] [string repeat a 500] + }; + + test {reg node check compression combined with trim} { + r lpush list2 [string repeat a 500] + r linsert list2 after [string repeat a 500] [string repeat b 500] + r rpush list2 [string repeat c 500] + assert_equal [string repeat b 500] [r lindex list2 1] + r LTRIM list2 1 -1 + r llen list2 + } {2} + + test {reg node check compression with lset} { + r lpush list3 [string repeat a 500] + r LSET list3 0 [string repeat b 500] + assert_equal [string repeat b 500] [r lindex list3 0] + r lpush list3 [string repeat c 500] + r LSET list3 0 [string repeat d 500] + assert_equal [string repeat d 500] [r lindex list3 0] + } + + # repeating the 3 tests with plain nodes + # (by adjusting quicklist-packed-threshold) + + test {plain node check compression} { + r debug quicklist-packed-threshold 1b + r lpush list4 [string repeat a 500] + r lpush list4 [string repeat b 500] + r lpush list4 [string repeat c 500] + r lpush list4 [string repeat d 500] + r linsert list4 after [string repeat d 500] [string repeat e 500] + r linsert list4 after [string repeat d 500] [string repeat f 500] + r linsert list4 after [string repeat d 500] [string repeat g 500] + r linsert list4 after [string repeat d 500] [string repeat j 500] + assert_equal [r lpop list4] [string repeat d 500] + assert_equal [r lpop list4] [string repeat j 500] + assert_equal [r lpop list4] [string repeat g 500] + assert_equal [r lpop list4] [string repeat f 500] + assert_equal [r lpop list4] [string repeat e 500] + assert_equal [r lpop list4] [string repeat c 500] + assert_equal [r lpop list4] [string repeat b 500] + assert_equal [r lpop list4] [string repeat a 500] + r debug quicklist-packed-threshold 0 + } {OK} {needs:debug} + + test {plain node check compression with ltrim} { + r debug quicklist-packed-threshold 1b + r lpush list5 [string repeat a 500] + r linsert list5 after [string repeat a 500] [string repeat b 500] + r rpush list5 [string repeat c 500] + assert_equal [string repeat b 500] [r lindex list5 1] + r LTRIM list5 1 -1 + assert_equal [r llen list5] 2 + r debug quicklist-packed-threshold 0 + } {OK} {needs:debug} + + test {plain node check compression using lset} { + r debug quicklist-packed-threshold 1b + r lpush list6 [string repeat a 500] + r LSET list6 0 [string repeat b 500] + assert_equal [string repeat b 500] [r lindex list6 0] + r lpush list6 [string repeat c 500] + r LSET list6 0 [string repeat d 500] + assert_equal [string repeat d 500] [r lindex list6 0] + r debug quicklist-packed-threshold 0 + } {OK} {needs:debug} + + # revert config for external mode tests. + r config set list-compress-depth 0 +} + +# check functionality of plain nodes using low packed-threshold +start_server [list overrides [list save ""] ] { + # basic command check for plain nodes - "LPUSH & LPOP" + test {Test LPUSH and LPOP on plain nodes} { + r flushdb + r debug quicklist-packed-threshold 1b + r lpush lst 9 + r lpush lst xxxxxxxxxx + r lpush lst xxxxxxxxxx + set s0 [s used_memory] + assert {$s0 > 10} + assert {[r llen lst] == 3} + set s0 [r rpop lst] + set s1 [r rpop lst] + assert {$s0 eq "9"} + assert {[r llen lst] == 1} + r lpop lst + assert {[string length $s1] == 10} + # check rdb + r lpush lst xxxxxxxxxx + r lpush lst bb + r debug reload + assert_equal [r rpop lst] "xxxxxxxxxx" + r debug quicklist-packed-threshold 0 + } {OK} {needs:debug} + + # basic command check for plain nodes - "LINDEX & LINSERT" + test {Test LINDEX and LINSERT on plain nodes} { + r flushdb + r debug quicklist-packed-threshold 1b + r lpush lst xxxxxxxxxxx + r lpush lst 9 + r lpush lst xxxxxxxxxxx + r linsert lst before "9" "8" + assert {[r lindex lst 1] eq "8"} + r linsert lst BEFORE "9" "7" + r linsert lst BEFORE "9" "xxxxxxxxxxx" + assert {[r lindex lst 3] eq "xxxxxxxxxxx"} + r debug quicklist-packed-threshold 0 + } {OK} {needs:debug} + + # basic command check for plain nodes - "LTRIM" + test {Test LTRIM on plain nodes} { + r flushdb + r debug quicklist-packed-threshold 1b + r lpush lst1 9 + r lpush lst1 xxxxxxxxxxx + r lpush lst1 9 + r LTRIM lst1 1 -1 + assert_equal [r llen lst1] 2 + r debug quicklist-packed-threshold 0 + } {OK} {needs:debug} + + # basic command check for plain nodes - "LREM" + test {Test LREM on plain nodes} { + r flushdb + r debug quicklist-packed-threshold 1b + r lpush lst one + r lpush lst xxxxxxxxxxx + set s0 [s used_memory] + assert {$s0 > 10} + r lpush lst 9 + r LREM lst -2 "one" + assert_equal [r llen lst] 2 + r debug quicklist-packed-threshold 0 + } {OK} {needs:debug} + + # basic command check for plain nodes - "LPOS" + test {Test LPOS on plain nodes} { + r flushdb + r debug quicklist-packed-threshold 1b + r RPUSH lst "aa" + r RPUSH lst "bb" + r RPUSH lst "cc" + r LSET lst 0 "xxxxxxxxxxx" + assert_equal [r LPOS lst "xxxxxxxxxxx"] 0 + r debug quicklist-packed-threshold 0 + } {OK} {needs:debug} + + # basic command check for plain nodes - "LMOVE" + test {Test LMOVE on plain nodes} { + r flushdb + r debug quicklist-packed-threshold 1b + r RPUSH lst2{t} "aa" + r RPUSH lst2{t} "bb" + r LSET lst2{t} 0 xxxxxxxxxxx + r RPUSH lst2{t} "cc" + r RPUSH lst2{t} "dd" + r LMOVE lst2{t} lst{t} RIGHT LEFT + r LMOVE lst2{t} lst{t} LEFT RIGHT + assert_equal [r llen lst{t}] 2 + assert_equal [r llen lst2{t}] 2 + assert_equal [r lpop lst2{t}] "bb" + assert_equal [r lpop lst2{t}] "cc" + assert_equal [r lpop lst{t}] "dd" + assert_equal [r lpop lst{t}] "xxxxxxxxxxx" + r debug quicklist-packed-threshold 0 + } {OK} {needs:debug} + + # testing LSET with combinations of node types + # plain->packed , packed->plain, plain->plain, packed->packed + test {Test LSET with packed / plain combinations} { + r debug quicklist-packed-threshold 5b + r RPUSH lst "aa" + r RPUSH lst "bb" + r lset lst 0 [string repeat d 50001] + set s1 [r lpop lst] + assert_equal $s1 [string repeat d 50001] + r RPUSH lst [string repeat f 50001] + r lset lst 0 [string repeat e 50001] + set s1 [r lpop lst] + assert_equal $s1 [string repeat e 50001] + r RPUSH lst [string repeat m 50001] + r lset lst 0 "bb" + set s1 [r lpop lst] + assert_equal $s1 "bb" + r RPUSH lst "bb" + r lset lst 0 "cc" + set s1 [r lpop lst] + assert_equal $s1 "cc" + r debug quicklist-packed-threshold 0 + } {OK} {needs:debug} + + # checking LSET in case ziplist needs to be split + test {Test LSET with packed is split in the middle} { + r flushdb + r debug quicklist-packed-threshold 5b + r RPUSH lst "aa" + r RPUSH lst "bb" + r RPUSH lst "cc" + r RPUSH lst "dd" + r RPUSH lst "ee" + r lset lst 2 [string repeat e 10] + assert_equal [r lpop lst] "aa" + assert_equal [r lpop lst] "bb" + assert_equal [r lpop lst] [string repeat e 10] + assert_equal [r lpop lst] "dd" + assert_equal [r lpop lst] "ee" + r debug quicklist-packed-threshold 0 + } {OK} {needs:debug} + + + # repeating "plain check LSET with combinations" + # but now with single item in each ziplist + test {Test LSET with packed consist only one item} { + r flushdb + set original_config [config_get_set list-max-ziplist-size 1] + r debug quicklist-packed-threshold 1b + r RPUSH lst "aa" + r RPUSH lst "bb" + r lset lst 0 [string repeat d 50001] + set s1 [r lpop lst] + assert_equal $s1 [string repeat d 50001] + r RPUSH lst [string repeat f 50001] + r lset lst 0 [string repeat e 50001] + set s1 [r lpop lst] + assert_equal $s1 [string repeat e 50001] + r RPUSH lst [string repeat m 50001] + r lset lst 0 "bb" + set s1 [r lpop lst] + assert_equal $s1 "bb" + r RPUSH lst "bb" + r lset lst 0 "cc" + set s1 [r lpop lst] + assert_equal $s1 "cc" + r debug quicklist-packed-threshold 0 + r config set list-max-ziplist-size $original_config + } {OK} {needs:debug} + + test {Crash due to delete entry from a compress quicklist node} { + r flushdb + r debug quicklist-packed-threshold 100b + set original_config [config_get_set list-compress-depth 1] + + set small_ele [string repeat x 32] + set large_ele [string repeat x 100] + + # Push a large element + r RPUSH lst $large_ele + + # Insert two elements and keep them in the same node + r RPUSH lst $small_ele + r RPUSH lst $small_ele + + # When setting the position of -1 to a large element, we first insert + # a large element at the end and then delete its previous element. + r LSET lst -1 $large_ele + assert_equal "$large_ele $small_ele $large_ele" [r LRANGE lst 0 -1] + + r debug quicklist-packed-threshold 0 + r config set list-compress-depth $original_config + } {OK} {needs:debug} + + test {Crash due to split quicklist node wrongly} { + r flushdb + r debug quicklist-packed-threshold 10b + + r LPUSH lst "aa" + r LPUSH lst "bb" + r LSET lst -2 [string repeat x 10] + r RPOP lst + assert_equal [string repeat x 10] [r LRANGE lst 0 -1] + + r debug quicklist-packed-threshold 0 + } {OK} {needs:debug} +} + +run_solo {list-large-memory} { +start_server [list overrides [list save ""] ] { + +# test if the server supports such large configs (avoid 32 bit builds) +catch { + r config set proto-max-bulk-len 10000000000 ;#10gb + r config set client-query-buffer-limit 10000000000 ;#10gb +} +if {[lindex [r config get proto-max-bulk-len] 1] == 10000000000} { + + set str_length 5000000000 + + # repeating all the plain nodes basic checks with 5gb values + test {Test LPUSH and LPOP on plain nodes over 4GB} { + r flushdb + r lpush lst 9 + r write "*3\r\n\$5\r\nLPUSH\r\n\$3\r\nlst\r\n" + write_big_bulk $str_length; + r write "*3\r\n\$5\r\nLPUSH\r\n\$3\r\nlst\r\n" + write_big_bulk $str_length; + set s0 [s used_memory] + assert {$s0 > $str_length} + assert {[r llen lst] == 3} + assert_equal [r rpop lst] "9" + assert_equal [read_big_bulk {r rpop lst}] $str_length + assert {[r llen lst] == 1} + assert_equal [read_big_bulk {r rpop lst}] $str_length + } {} {large-memory} + + test {Test LINDEX and LINSERT on plain nodes over 4GB} { + r flushdb + r write "*3\r\n\$5\r\nLPUSH\r\n\$3\r\nlst\r\n" + write_big_bulk $str_length; + r lpush lst 9 + r write "*3\r\n\$5\r\nLPUSH\r\n\$3\r\nlst\r\n" + write_big_bulk $str_length; + r linsert lst before "9" "8" + assert_equal [r lindex lst 1] "8" + r LINSERT lst BEFORE "9" "7" + r write "*5\r\n\$7\r\nLINSERT\r\n\$3\r\nlst\r\n\$6\r\nBEFORE\r\n\$3\r\n\"9\"\r\n" + write_big_bulk 10; + assert_equal [read_big_bulk {r rpop lst}] $str_length + } {} {large-memory} + + test {Test LTRIM on plain nodes over 4GB} { + r flushdb + r lpush lst 9 + r write "*3\r\n\$5\r\nLPUSH\r\n\$3\r\nlst\r\n" + write_big_bulk $str_length; + r lpush lst 9 + r LTRIM lst 1 -1 + assert_equal [r llen lst] 2 + assert_equal [r rpop lst] 9 + assert_equal [read_big_bulk {r rpop lst}] $str_length + } {} {large-memory} + + test {Test LREM on plain nodes over 4GB} { + r flushdb + r lpush lst one + r write "*3\r\n\$5\r\nLPUSH\r\n\$3\r\nlst\r\n" + write_big_bulk $str_length; + r lpush lst 9 + r LREM lst -2 "one" + assert_equal [read_big_bulk {r rpop lst}] $str_length + r llen lst + } {1} {large-memory} + + test {Test LSET on plain nodes over 4GB} { + r flushdb + r RPUSH lst "aa" + r RPUSH lst "bb" + r RPUSH lst "cc" + r write "*4\r\n\$4\r\nLSET\r\n\$3\r\nlst\r\n\$1\r\n0\r\n" + write_big_bulk $str_length; + assert_equal [r rpop lst] "cc" + assert_equal [r rpop lst] "bb" + assert_equal [read_big_bulk {r rpop lst}] $str_length + } {} {large-memory} + + test {Test LMOVE on plain nodes over 4GB} { + r flushdb + r RPUSH lst2{t} "aa" + r RPUSH lst2{t} "bb" + r write "*4\r\n\$4\r\nLSET\r\n\$7\r\nlst2{t}\r\n\$1\r\n0\r\n" + write_big_bulk $str_length; + r RPUSH lst2{t} "cc" + r RPUSH lst2{t} "dd" + r LMOVE lst2{t} lst{t} RIGHT LEFT + assert_equal [read_big_bulk {r LMOVE lst2{t} lst{t} LEFT RIGHT}] $str_length + assert_equal [r llen lst{t}] 2 + assert_equal [r llen lst2{t}] 2 + assert_equal [r lpop lst2{t}] "bb" + assert_equal [r lpop lst2{t}] "cc" + assert_equal [r lpop lst{t}] "dd" + assert_equal [read_big_bulk {r rpop lst{t}}] $str_length + } {} {large-memory} +} ;# skip 32bit builds +} +} ;# run_solo + +start_server { + tags {"list"} + overrides { + "list-max-ziplist-size" 5 + } +} { + source "tests/unit/type/list-common.tcl" + + # A helper function to execute either B*POP or BLMPOP* with one input key. + proc bpop_command {rd pop key timeout} { + if {$pop == "BLMPOP_LEFT"} { + $rd blmpop $timeout 1 $key left count 1 + } elseif {$pop == "BLMPOP_RIGHT"} { + $rd blmpop $timeout 1 $key right count 1 + } else { + $rd $pop $key $timeout + } + } + + # A helper function to execute either B*POP or BLMPOP* with two input keys. + proc bpop_command_two_key {rd pop key key2 timeout} { + if {$pop == "BLMPOP_LEFT"} { + $rd blmpop $timeout 2 $key $key2 left count 1 + } elseif {$pop == "BLMPOP_RIGHT"} { + $rd blmpop $timeout 2 $key $key2 right count 1 + } else { + $rd $pop $key $key2 $timeout + } + } + + test {LPOS basic usage} { + r DEL mylist + r RPUSH mylist a b c 1 2 3 c c + assert {[r LPOS mylist a] == 0} + assert {[r LPOS mylist c] == 2} + } + + test {LPOS RANK (positive, negative and zero rank) option} { + assert {[r LPOS mylist c RANK 1] == 2} + assert {[r LPOS mylist c RANK 2] == 6} + assert {[r LPOS mylist c RANK 4] eq ""} + assert {[r LPOS mylist c RANK -1] == 7} + assert {[r LPOS mylist c RANK -2] == 6} + assert_error "*RANK can't be zero: use 1 to start from the first match, 2 from the second ... or use negative to start*" {r LPOS mylist c RANK 0} + } + + test {LPOS COUNT option} { + assert {[r LPOS mylist c COUNT 0] == {2 6 7}} + assert {[r LPOS mylist c COUNT 1] == {2}} + assert {[r LPOS mylist c COUNT 2] == {2 6}} + assert {[r LPOS mylist c COUNT 100] == {2 6 7}} + } + + test {LPOS COUNT + RANK option} { + assert {[r LPOS mylist c COUNT 0 RANK 2] == {6 7}} + assert {[r LPOS mylist c COUNT 2 RANK -1] == {7 6}} + } + + test {LPOS non existing key} { + assert {[r LPOS mylistxxx c COUNT 0 RANK 2] eq {}} + } + + test {LPOS no match} { + assert {[r LPOS mylist x COUNT 2 RANK -1] eq {}} + assert {[r LPOS mylist x RANK -1] eq {}} + } + + test {LPOS MAXLEN} { + assert {[r LPOS mylist a COUNT 0 MAXLEN 1] == {0}} + assert {[r LPOS mylist c COUNT 0 MAXLEN 1] == {}} + assert {[r LPOS mylist c COUNT 0 MAXLEN 3] == {2}} + assert {[r LPOS mylist c COUNT 0 MAXLEN 3 RANK -1] == {7 6}} + assert {[r LPOS mylist c COUNT 0 MAXLEN 7 RANK 2] == {6}} + } + + test {LPOS when RANK is greater than matches} { + r DEL mylist + r LPUSH mylist a + assert {[r LPOS mylist b COUNT 10 RANK 5] eq {}} + } + + test {LPUSH, RPUSH, LLENGTH, LINDEX, LPOP - ziplist} { + # first lpush then rpush + assert_equal 1 [r lpush myziplist1 aa] + assert_equal 2 [r rpush myziplist1 bb] + assert_equal 3 [r rpush myziplist1 cc] + assert_equal 3 [r llen myziplist1] + assert_equal aa [r lindex myziplist1 0] + assert_equal bb [r lindex myziplist1 1] + assert_equal cc [r lindex myziplist1 2] + assert_equal {} [r lindex myziplist2 3] + assert_equal cc [r rpop myziplist1] + assert_equal aa [r lpop myziplist1] + assert_encoding quicklist myziplist1 + + # first rpush then lpush + assert_equal 1 [r rpush myziplist2 a] + assert_equal 2 [r lpush myziplist2 b] + assert_equal 3 [r lpush myziplist2 c] + assert_equal 3 [r llen myziplist2] + assert_equal c [r lindex myziplist2 0] + assert_equal b [r lindex myziplist2 1] + assert_equal a [r lindex myziplist2 2] + assert_equal {} [r lindex myziplist2 3] + assert_equal a [r rpop myziplist2] + assert_equal c [r lpop myziplist2] + assert_encoding quicklist myziplist2 + } + + test {LPUSH, RPUSH, LLENGTH, LINDEX, LPOP - regular list} { + # first lpush then rpush + assert_equal 1 [r lpush mylist1 $largevalue(linkedlist)] + assert_encoding quicklist mylist1 + assert_equal 2 [r rpush mylist1 b] + assert_equal 3 [r rpush mylist1 c] + assert_equal 3 [r llen mylist1] + assert_equal $largevalue(linkedlist) [r lindex mylist1 0] + assert_equal b [r lindex mylist1 1] + assert_equal c [r lindex mylist1 2] + assert_equal {} [r lindex mylist1 3] + assert_equal c [r rpop mylist1] + assert_equal $largevalue(linkedlist) [r lpop mylist1] + + # first rpush then lpush + assert_equal 1 [r rpush mylist2 $largevalue(linkedlist)] + assert_encoding quicklist mylist2 + assert_equal 2 [r lpush mylist2 b] + assert_equal 3 [r lpush mylist2 c] + assert_equal 3 [r llen mylist2] + assert_equal c [r lindex mylist2 0] + assert_equal b [r lindex mylist2 1] + assert_equal $largevalue(linkedlist) [r lindex mylist2 2] + assert_equal {} [r lindex mylist2 3] + assert_equal $largevalue(linkedlist) [r rpop mylist2] + assert_equal c [r lpop mylist2] + } + + test "LPOP/RPOP with wrong number of arguments" { + assert_error {*wrong number of arguments for 'lpop' command} {r lpop key 1 1} + assert_error {*wrong number of arguments for 'rpop' command} {r rpop key 2 2} + } + + test {RPOP/LPOP with the optional count argument} { + assert_equal 7 [r lpush listcount aa bb cc dd ee ff gg] + assert_equal {gg} [r lpop listcount 1] + assert_equal {ff ee} [r lpop listcount 2] + assert_equal {aa bb} [r rpop listcount 2] + assert_equal {cc} [r rpop listcount 1] + assert_equal {dd} [r rpop listcount 123] + assert_error "*ERR*range*" {r lpop forbarqaz -123} + } + + proc verify_resp_response {resp response resp2_response resp3_response} { + if {$resp == 2} { + assert_equal $response $resp2_response + } elseif {$resp == 3} { + assert_equal $response $resp3_response + } + } + + foreach resp {3 2} { + if {[lsearch $::denytags "resp3"] >= 0} { + if {$resp == 3} {continue} + } else { + r hello $resp + } + + # Make sure we can distinguish between an empty array and a null response + r readraw 1 + + test "LPOP/RPOP with the count 0 returns an empty array in RESP$resp" { + r lpush listcount zero + assert_equal {*0} [r lpop listcount 0] + assert_equal {*0} [r rpop listcount 0] + } + + test "LPOP/RPOP against non existing key in RESP$resp" { + r del non_existing_key + + verify_resp_response $resp [r lpop non_existing_key] {$-1} {_} + verify_resp_response $resp [r rpop non_existing_key] {$-1} {_} + } + + test "LPOP/RPOP with <count> against non existing key in RESP$resp" { + r del non_existing_key + + verify_resp_response $resp [r lpop non_existing_key 0] {*-1} {_} + verify_resp_response $resp [r lpop non_existing_key 1] {*-1} {_} + + verify_resp_response $resp [r rpop non_existing_key 0] {*-1} {_} + verify_resp_response $resp [r rpop non_existing_key 1] {*-1} {_} + } + + r readraw 0 + } + + test {Variadic RPUSH/LPUSH} { + r del mylist + assert_equal 4 [r lpush mylist a b c d] + assert_equal 8 [r rpush mylist 0 1 2 3] + assert_equal {d c b a 0 1 2 3} [r lrange mylist 0 -1] + } + + test {DEL a list} { + assert_equal 1 [r del mylist2] + assert_equal 0 [r exists mylist2] + assert_equal 0 [r llen mylist2] + } + + proc create_list {key entries} { + r del $key + foreach entry $entries { r rpush $key $entry } + assert_encoding quicklist $key + } + + foreach {type large} [array get largevalue] { + foreach {pop} {BLPOP BLMPOP_LEFT} { + test "$pop: single existing list - $type" { + set rd [redis_deferring_client] + create_list blist "a b $large c d" + + bpop_command $rd $pop blist 1 + assert_equal {blist a} [$rd read] + if {$pop == "BLPOP"} { + bpop_command $rd BRPOP blist 1 + } else { + bpop_command $rd BLMPOP_RIGHT blist 1 + } + assert_equal {blist d} [$rd read] + + bpop_command $rd $pop blist 1 + assert_equal {blist b} [$rd read] + if {$pop == "BLPOP"} { + bpop_command $rd BRPOP blist 1 + } else { + bpop_command $rd BLMPOP_RIGHT blist 1 + } + assert_equal {blist c} [$rd read] + + assert_equal 1 [r llen blist] + $rd close + } + + test "$pop: multiple existing lists - $type" { + set rd [redis_deferring_client] + create_list blist1{t} "a $large c" + create_list blist2{t} "d $large f" + + bpop_command_two_key $rd $pop blist1{t} blist2{t} 1 + assert_equal {blist1{t} a} [$rd read] + if {$pop == "BLPOP"} { + bpop_command_two_key $rd BRPOP blist1{t} blist2{t} 1 + } else { + bpop_command_two_key $rd BLMPOP_RIGHT blist1{t} blist2{t} 1 + } + assert_equal {blist1{t} c} [$rd read] + assert_equal 1 [r llen blist1{t}] + assert_equal 3 [r llen blist2{t}] + + bpop_command_two_key $rd $pop blist2{t} blist1{t} 1 + assert_equal {blist2{t} d} [$rd read] + if {$pop == "BLPOP"} { + bpop_command_two_key $rd BRPOP blist2{t} blist1{t} 1 + } else { + bpop_command_two_key $rd BLMPOP_RIGHT blist2{t} blist1{t} 1 + } + assert_equal {blist2{t} f} [$rd read] + assert_equal 1 [r llen blist1{t}] + assert_equal 1 [r llen blist2{t}] + $rd close + } + + test "$pop: second list has an entry - $type" { + set rd [redis_deferring_client] + r del blist1{t} + create_list blist2{t} "d $large f" + + bpop_command_two_key $rd $pop blist1{t} blist2{t} 1 + assert_equal {blist2{t} d} [$rd read] + if {$pop == "BLPOP"} { + bpop_command_two_key $rd BRPOP blist1{t} blist2{t} 1 + } else { + bpop_command_two_key $rd BLMPOP_RIGHT blist1{t} blist2{t} 1 + } + assert_equal {blist2{t} f} [$rd read] + assert_equal 0 [r llen blist1{t}] + assert_equal 1 [r llen blist2{t}] + $rd close + } + } + + test "BRPOPLPUSH - $type" { + r del target{t} + r rpush target{t} bar + + set rd [redis_deferring_client] + create_list blist{t} "a b $large c d" + + $rd brpoplpush blist{t} target{t} 1 + assert_equal d [$rd read] + + assert_equal d [r lpop target{t}] + assert_equal "a b $large c" [r lrange blist{t} 0 -1] + $rd close + } + + foreach wherefrom {left right} { + foreach whereto {left right} { + test "BLMOVE $wherefrom $whereto - $type" { + r del target{t} + r rpush target{t} bar + + set rd [redis_deferring_client] + create_list blist{t} "a b $large c d" + + $rd blmove blist{t} target{t} $wherefrom $whereto 1 + set poppedelement [$rd read] + + if {$wherefrom eq "right"} { + assert_equal d $poppedelement + assert_equal "a b $large c" [r lrange blist{t} 0 -1] + } else { + assert_equal a $poppedelement + assert_equal "b $large c d" [r lrange blist{t} 0 -1] + } + + if {$whereto eq "right"} { + assert_equal $poppedelement [r rpop target{t}] + } else { + assert_equal $poppedelement [r lpop target{t}] + } + $rd close + } + } + } + } + +foreach {pop} {BLPOP BLMPOP_LEFT} { + test "$pop, LPUSH + DEL should not awake blocked client" { + set rd [redis_deferring_client] + r del list + + bpop_command $rd $pop list 0 + after 100 ;# Make sure rd is blocked before MULTI + wait_for_blocked_client + + r multi + r lpush list a + r del list + r exec + r del list + r lpush list b + assert_equal {list b} [$rd read] + $rd close + } + + test "$pop, LPUSH + DEL + SET should not awake blocked client" { + set rd [redis_deferring_client] + r del list + + bpop_command $rd $pop list 0 + after 100 ;# Make sure rd is blocked before MULTI + wait_for_blocked_client + + r multi + r lpush list a + r del list + r set list foo + r exec + r del list + r lpush list b + assert_equal {list b} [$rd read] + $rd close + } +} + + test "BLPOP with same key multiple times should work (issue #801)" { + set rd [redis_deferring_client] + r del list1{t} list2{t} + + # Data arriving after the BLPOP. + $rd blpop list1{t} list2{t} list2{t} list1{t} 0 + r lpush list1{t} a + assert_equal [$rd read] {list1{t} a} + $rd blpop list1{t} list2{t} list2{t} list1{t} 0 + r lpush list2{t} b + assert_equal [$rd read] {list2{t} b} + + # Data already there. + r lpush list1{t} a + r lpush list2{t} b + $rd blpop list1{t} list2{t} list2{t} list1{t} 0 + assert_equal [$rd read] {list1{t} a} + $rd blpop list1{t} list2{t} list2{t} list1{t} 0 + assert_equal [$rd read] {list2{t} b} + $rd close + } + +foreach {pop} {BLPOP BLMPOP_LEFT} { + test "MULTI/EXEC is isolated from the point of view of $pop" { + set rd [redis_deferring_client] + r del list + + bpop_command $rd $pop list 0 + after 100 ;# Make sure rd is blocked before MULTI + wait_for_blocked_client + + r multi + r lpush list a + r lpush list b + r lpush list c + r exec + assert_equal {list c} [$rd read] + $rd close + } + + test "$pop with variadic LPUSH" { + set rd [redis_deferring_client] + r del blist + if {$::valgrind} {after 100} + bpop_command $rd $pop blist 0 + if {$::valgrind} {after 100} + wait_for_blocked_client + assert_equal 2 [r lpush blist foo bar] + if {$::valgrind} {after 100} + assert_equal {blist bar} [$rd read] + assert_equal foo [lindex [r lrange blist 0 -1] 0] + $rd close + } +} + + test "BRPOPLPUSH with zero timeout should block indefinitely" { + set rd [redis_deferring_client] + r del blist{t} target{t} + r rpush target{t} bar + $rd brpoplpush blist{t} target{t} 0 + wait_for_blocked_clients_count 1 + r rpush blist{t} foo + assert_equal foo [$rd read] + assert_equal {foo bar} [r lrange target{t} 0 -1] + $rd close + } + + foreach wherefrom {left right} { + foreach whereto {left right} { + test "BLMOVE $wherefrom $whereto with zero timeout should block indefinitely" { + set rd [redis_deferring_client] + r del blist{t} target{t} + r rpush target{t} bar + $rd blmove blist{t} target{t} $wherefrom $whereto 0 + wait_for_blocked_clients_count 1 + r rpush blist{t} foo + assert_equal foo [$rd read] + if {$whereto eq "right"} { + assert_equal {bar foo} [r lrange target{t} 0 -1] + } else { + assert_equal {foo bar} [r lrange target{t} 0 -1] + } + $rd close + } + } + } + + foreach wherefrom {left right} { + foreach whereto {left right} { + test "BLMOVE ($wherefrom, $whereto) with a client BLPOPing the target list" { + set rd [redis_deferring_client] + set rd2 [redis_deferring_client] + r del blist{t} target{t} + $rd2 blpop target{t} 0 + wait_for_blocked_clients_count 1 + $rd blmove blist{t} target{t} $wherefrom $whereto 0 + wait_for_blocked_clients_count 2 + r rpush blist{t} foo + assert_equal foo [$rd read] + assert_equal {target{t} foo} [$rd2 read] + assert_equal 0 [r exists target{t}] + $rd close + $rd2 close + } + } + } + + test "BRPOPLPUSH with wrong source type" { + set rd [redis_deferring_client] + r del blist{t} target{t} + r set blist{t} nolist + $rd brpoplpush blist{t} target{t} 1 + assert_error "WRONGTYPE*" {$rd read} + $rd close + } + + test "BRPOPLPUSH with wrong destination type" { + set rd [redis_deferring_client] + r del blist{t} target{t} + r set target{t} nolist + r lpush blist{t} foo + $rd brpoplpush blist{t} target{t} 1 + assert_error "WRONGTYPE*" {$rd read} + $rd close + + set rd [redis_deferring_client] + r del blist{t} target{t} + r set target{t} nolist + $rd brpoplpush blist{t} target{t} 0 + wait_for_blocked_clients_count 1 + r rpush blist{t} foo + assert_error "WRONGTYPE*" {$rd read} + assert_equal {foo} [r lrange blist{t} 0 -1] + $rd close + } + + test "BRPOPLPUSH maintains order of elements after failure" { + set rd [redis_deferring_client] + r del blist{t} target{t} + r set target{t} nolist + $rd brpoplpush blist{t} target{t} 0 + r rpush blist{t} a b c + assert_error "WRONGTYPE*" {$rd read} + $rd close + r lrange blist{t} 0 -1 + } {a b c} + + test "BRPOPLPUSH with multiple blocked clients" { + set rd1 [redis_deferring_client] + set rd2 [redis_deferring_client] + r del blist{t} target1{t} target2{t} + r set target1{t} nolist + $rd1 brpoplpush blist{t} target1{t} 0 + $rd2 brpoplpush blist{t} target2{t} 0 + r lpush blist{t} foo + + assert_error "WRONGTYPE*" {$rd1 read} + assert_equal {foo} [$rd2 read] + assert_equal {foo} [r lrange target2{t} 0 -1] + $rd1 close + $rd2 close + } + + test "BLMPOP with multiple blocked clients" { + set rd1 [redis_deferring_client] + set rd2 [redis_deferring_client] + set rd3 [redis_deferring_client] + set rd4 [redis_deferring_client] + r del blist{t} blist2{t} + + $rd1 blmpop 0 2 blist{t} blist2{t} left count 1 + wait_for_blocked_clients_count 1 + $rd2 blmpop 0 2 blist{t} blist2{t} right count 10 + wait_for_blocked_clients_count 2 + $rd3 blmpop 0 2 blist{t} blist2{t} left count 10 + wait_for_blocked_clients_count 3 + $rd4 blmpop 0 2 blist{t} blist2{t} right count 1 + wait_for_blocked_clients_count 4 + + r multi + r lpush blist{t} a b c d e + r lpush blist2{t} 1 2 3 4 5 + r exec + + assert_equal {blist{t} e} [$rd1 read] + assert_equal {blist{t} {a b c d}} [$rd2 read] + assert_equal {blist2{t} {5 4 3 2 1}} [$rd3 read] + + r lpush blist2{t} 1 2 3 + assert_equal {blist2{t} 1} [$rd4 read] + $rd1 close + $rd2 close + $rd3 close + $rd4 close + } + + test "Linked LMOVEs" { + set rd1 [redis_deferring_client] + set rd2 [redis_deferring_client] + + r del list1{t} list2{t} list3{t} + + $rd1 blmove list1{t} list2{t} right left 0 + wait_for_blocked_clients_count 1 + $rd2 blmove list2{t} list3{t} left right 0 + wait_for_blocked_clients_count 2 + + r rpush list1{t} foo + + assert_equal {} [r lrange list1{t} 0 -1] + assert_equal {} [r lrange list2{t} 0 -1] + assert_equal {foo} [r lrange list3{t} 0 -1] + $rd1 close + $rd2 close + } + + test "Circular BRPOPLPUSH" { + set rd1 [redis_deferring_client] + set rd2 [redis_deferring_client] + + r del list1{t} list2{t} + + $rd1 brpoplpush list1{t} list2{t} 0 + wait_for_blocked_clients_count 1 + $rd2 brpoplpush list2{t} list1{t} 0 + wait_for_blocked_clients_count 2 + + r rpush list1{t} foo + + assert_equal {foo} [r lrange list1{t} 0 -1] + assert_equal {} [r lrange list2{t} 0 -1] + $rd1 close + $rd2 close + } + + test "Self-referential BRPOPLPUSH" { + set rd [redis_deferring_client] + + r del blist{t} + + $rd brpoplpush blist{t} blist{t} 0 + wait_for_blocked_client + + r rpush blist{t} foo + + assert_equal {foo} [r lrange blist{t} 0 -1] + $rd close + } + + test "BRPOPLPUSH inside a transaction" { + r del xlist{t} target{t} + r lpush xlist{t} foo + r lpush xlist{t} bar + + r multi + r brpoplpush xlist{t} target{t} 0 + r brpoplpush xlist{t} target{t} 0 + r brpoplpush xlist{t} target{t} 0 + r lrange xlist{t} 0 -1 + r lrange target{t} 0 -1 + r exec + } {foo bar {} {} {bar foo}} + + test "PUSH resulting from BRPOPLPUSH affect WATCH" { + set blocked_client [redis_deferring_client] + set watching_client [redis_deferring_client] + r del srclist{t} dstlist{t} somekey{t} + r set somekey{t} somevalue + $blocked_client brpoplpush srclist{t} dstlist{t} 0 + wait_for_blocked_client + $watching_client watch dstlist{t} + $watching_client read + $watching_client multi + $watching_client read + $watching_client get somekey{t} + $watching_client read + r lpush srclist{t} element + $watching_client exec + set res [$watching_client read] + $blocked_client close + $watching_client close + set _ $res + } {} + + test "BRPOPLPUSH does not affect WATCH while still blocked" { + set blocked_client [redis_deferring_client] + set watching_client [redis_deferring_client] + r del srclist{t} dstlist{t} somekey{t} + r set somekey{t} somevalue + $blocked_client brpoplpush srclist{t} dstlist{t} 0 + wait_for_blocked_client + $watching_client watch dstlist{t} + $watching_client read + $watching_client multi + $watching_client read + $watching_client get somekey{t} + $watching_client read + $watching_client exec + # Blocked BLPOPLPUSH may create problems, unblock it. + r lpush srclist{t} element + set res [$watching_client read] + $blocked_client close + $watching_client close + set _ $res + } {somevalue} + + test {BRPOPLPUSH timeout} { + set rd [redis_deferring_client] + + $rd brpoplpush foo_list{t} bar_list{t} 1 + wait_for_blocked_clients_count 1 + wait_for_blocked_clients_count 0 500 10 + set res [$rd read] + $rd close + set _ $res + } {} + + test {SWAPDB awakes blocked client} { + r flushall + r select 1 + r rpush k hello + r select 9 + set rd [redis_deferring_client] + $rd brpop k 5 + wait_for_blocked_clients_count 1 + r swapdb 1 9 + $rd read + } {k hello} {singledb:skip} + + test {SWAPDB wants to wake blocked client, but the key already expired} { + set repl [attach_to_replication_stream] + r flushall + r debug set-active-expire 0 + r select 1 + r rpush k hello + r pexpire k 100 + set rd [redis_deferring_client] + $rd select 9 + assert_equal {OK} [$rd read] + $rd client id + set id [$rd read] + $rd brpop k 1 + wait_for_blocked_clients_count 1 + after 101 + r swapdb 1 9 + # The SWAPDB command tries to awake the blocked client, but it remains + # blocked because the key is expired. Check that the deferred client is + # still blocked. Then unblock it. + assert_match "*flags=b*" [r client list id $id] + r client unblock $id + assert_equal {} [$rd read] + assert_replication_stream $repl { + {select *} + {flushall} + {select 1} + {rpush k hello} + {pexpireat k *} + {swapdb 1 9} + {select 9} + {del k} + } + close_replication_stream $repl + # Restore server and client state + r debug set-active-expire 1 + r select 9 + } {OK} {singledb:skip needs:debug} + + test {MULTI + LPUSH + EXPIRE + DEBUG SLEEP on blocked client, key already expired} { + set repl [attach_to_replication_stream] + r flushall + r debug set-active-expire 0 + + set rd [redis_deferring_client] + $rd client id + set id [$rd read] + $rd brpop k 0 + wait_for_blocked_clients_count 1 + + r multi + r rpush k hello + r pexpire k 100 + r debug sleep 0.2 + r exec + + # The EXEC command tries to awake the blocked client, but it remains + # blocked because the key is expired. Check that the deferred client is + # still blocked. Then unblock it. + assert_match "*flags=b*" [r client list id $id] + r client unblock $id + assert_equal {} [$rd read] + assert_replication_stream $repl { + {select *} + {flushall} + {multi} + {rpush k hello} + {pexpireat k *} + {exec} + {del k} + } + close_replication_stream $repl + # Restore server and client state + r debug set-active-expire 1 + r select 9 + } {OK} {singledb:skip needs:debug} + +foreach {pop} {BLPOP BLMPOP_LEFT} { + test "$pop when new key is moved into place" { + set rd [redis_deferring_client] + r del foo{t} + + bpop_command $rd $pop foo{t} 0 + wait_for_blocked_client + r lpush bob{t} abc def hij + r rename bob{t} foo{t} + set res [$rd read] + $rd close + set _ $res + } {foo{t} hij} + + test "$pop when result key is created by SORT..STORE" { + set rd [redis_deferring_client] + + # zero out list from previous test without explicit delete + r lpop foo{t} + r lpop foo{t} + r lpop foo{t} + + bpop_command $rd $pop foo{t} 5 + wait_for_blocked_client + r lpush notfoo{t} hello hola aguacate konichiwa zanzibar + r sort notfoo{t} ALPHA store foo{t} + set res [$rd read] + $rd close + set _ $res + } {foo{t} aguacate} +} + + foreach {pop} {BLPOP BRPOP BLMPOP_LEFT BLMPOP_RIGHT} { + test "$pop: with single empty list argument" { + set rd [redis_deferring_client] + r del blist1 + bpop_command $rd $pop blist1 1 + wait_for_blocked_client + r rpush blist1 foo + assert_equal {blist1 foo} [$rd read] + assert_equal 0 [r exists blist1] + $rd close + } + + test "$pop: with negative timeout" { + set rd [redis_deferring_client] + bpop_command $rd $pop blist1 -1 + assert_error "ERR *is negative*" {$rd read} + $rd close + } + + test "$pop: with non-integer timeout" { + set rd [redis_deferring_client] + r del blist1 + bpop_command $rd $pop blist1 0.1 + r rpush blist1 foo + assert_equal {blist1 foo} [$rd read] + assert_equal 0 [r exists blist1] + $rd close + } + + test "$pop: with zero timeout should block indefinitely" { + # To test this, use a timeout of 0 and wait a second. + # The blocking pop should still be waiting for a push. + set rd [redis_deferring_client] + bpop_command $rd $pop blist1 0 + wait_for_blocked_client + after 1000 + r rpush blist1 foo + assert_equal {blist1 foo} [$rd read] + $rd close + } + + test "$pop: with 0.001 timeout should not block indefinitely" { + # Use a timeout of 0.001 and wait for the number of blocked clients to equal 0. + # Validate the empty read from the deferring client. + set rd [redis_deferring_client] + bpop_command $rd $pop blist1 0.001 + wait_for_blocked_clients_count 0 + assert_equal {} [$rd read] + $rd close + } + + test "$pop: second argument is not a list" { + set rd [redis_deferring_client] + r del blist1{t} blist2{t} + r set blist2{t} nolist{t} + bpop_command_two_key $rd $pop blist1{t} blist2{t} 1 + $rd $pop blist1{t} blist2{t} 1 + assert_error "WRONGTYPE*" {$rd read} + $rd close + } + + test "$pop: timeout" { + set rd [redis_deferring_client] + r del blist1{t} blist2{t} + bpop_command_two_key $rd $pop blist1{t} blist2{t} 1 + wait_for_blocked_client + assert_equal {} [$rd read] + $rd close + } + + test "$pop: arguments are empty" { + set rd [redis_deferring_client] + r del blist1{t} blist2{t} + + bpop_command_two_key $rd $pop blist1{t} blist2{t} 1 + wait_for_blocked_client + r rpush blist1{t} foo + assert_equal {blist1{t} foo} [$rd read] + assert_equal 0 [r exists blist1{t}] + assert_equal 0 [r exists blist2{t}] + + bpop_command_two_key $rd $pop blist1{t} blist2{t} 1 + wait_for_blocked_client + r rpush blist2{t} foo + assert_equal {blist2{t} foo} [$rd read] + assert_equal 0 [r exists blist1{t}] + assert_equal 0 [r exists blist2{t}] + $rd close + } + } + +foreach {pop} {BLPOP BLMPOP_LEFT} { + test "$pop inside a transaction" { + r del xlist + r lpush xlist foo + r lpush xlist bar + r multi + + bpop_command r $pop xlist 0 + bpop_command r $pop xlist 0 + bpop_command r $pop xlist 0 + r exec + } {{xlist bar} {xlist foo} {}} +} + + test {BLMPOP propagate as pop with count command to replica} { + set rd [redis_deferring_client] + set repl [attach_to_replication_stream] + + # BLMPOP without being blocked. + r lpush mylist{t} a b c + r rpush mylist2{t} 1 2 3 + r blmpop 0 1 mylist{t} left count 1 + r blmpop 0 2 mylist{t} mylist2{t} right count 10 + r blmpop 0 2 mylist{t} mylist2{t} right count 10 + + # BLMPOP that gets blocked. + $rd blmpop 0 1 mylist{t} left count 1 + wait_for_blocked_client + r lpush mylist{t} a + $rd blmpop 0 2 mylist{t} mylist2{t} left count 5 + wait_for_blocked_client + r lpush mylist{t} a b c + $rd blmpop 0 2 mylist{t} mylist2{t} right count 10 + wait_for_blocked_client + r rpush mylist2{t} a b c + + # Released on timeout. + assert_equal {} [r blmpop 0.01 1 mylist{t} left count 10] + r set foo{t} bar ;# something else to propagate after, so we can make sure the above pop didn't. + + $rd close + + assert_replication_stream $repl { + {select *} + {lpush mylist{t} a b c} + {rpush mylist2{t} 1 2 3} + {lpop mylist{t} 1} + {rpop mylist{t} 2} + {rpop mylist2{t} 3} + {lpush mylist{t} a} + {lpop mylist{t} 1} + {lpush mylist{t} a b c} + {lpop mylist{t} 3} + {rpush mylist2{t} a b c} + {rpop mylist2{t} 3} + {set foo{t} bar} + } + close_replication_stream $repl + } {} {needs:repl} + + test {LPUSHX, RPUSHX - generic} { + r del xlist + assert_equal 0 [r lpushx xlist a] + assert_equal 0 [r llen xlist] + assert_equal 0 [r rpushx xlist a] + assert_equal 0 [r llen xlist] + } + + foreach {type large} [array get largevalue] { + test "LPUSHX, RPUSHX - $type" { + create_list xlist "$large c" + assert_equal 3 [r rpushx xlist d] + assert_equal 4 [r lpushx xlist a] + assert_equal 6 [r rpushx xlist 42 x] + assert_equal 9 [r lpushx xlist y3 y2 y1] + assert_equal "y1 y2 y3 a $large c d 42 x" [r lrange xlist 0 -1] + } + + test "LINSERT - $type" { + create_list xlist "a $large c d" + assert_equal 5 [r linsert xlist before c zz] "before c" + assert_equal "a $large zz c d" [r lrange xlist 0 10] "lrangeA" + assert_equal 6 [r linsert xlist after c yy] "after c" + assert_equal "a $large zz c yy d" [r lrange xlist 0 10] "lrangeB" + assert_equal 7 [r linsert xlist after d dd] "after d" + assert_equal -1 [r linsert xlist after bad ddd] "after bad" + assert_equal "a $large zz c yy d dd" [r lrange xlist 0 10] "lrangeC" + assert_equal 8 [r linsert xlist before a aa] "before a" + assert_equal -1 [r linsert xlist before bad aaa] "before bad" + assert_equal "aa a $large zz c yy d dd" [r lrange xlist 0 10] "lrangeD" + + # check inserting integer encoded value + assert_equal 9 [r linsert xlist before aa 42] "before aa" + assert_equal 42 [r lrange xlist 0 0] "lrangeE" + } + } + + test {LINSERT raise error on bad syntax} { + catch {[r linsert xlist aft3r aa 42]} e + set e + } {*ERR*syntax*error*} + + foreach {type num} {quicklist 250 quicklist 500} { + proc check_numbered_list_consistency {key} { + set len [r llen $key] + for {set i 0} {$i < $len} {incr i} { + assert_equal $i [r lindex $key $i] + assert_equal [expr $len-1-$i] [r lindex $key [expr (-$i)-1]] + } + } + + proc check_random_access_consistency {key} { + set len [r llen $key] + for {set i 0} {$i < $len} {incr i} { + set rint [expr int(rand()*$len)] + assert_equal $rint [r lindex $key $rint] + assert_equal [expr $len-1-$rint] [r lindex $key [expr (-$rint)-1]] + } + } + + test "LINDEX consistency test - $type" { + r del mylist + for {set i 0} {$i < $num} {incr i} { + r rpush mylist $i + } + assert_encoding $type mylist + check_numbered_list_consistency mylist + } + + test "LINDEX random access - $type" { + assert_encoding $type mylist + check_random_access_consistency mylist + } + + test "Check if list is still ok after a DEBUG RELOAD - $type" { + r debug reload + assert_encoding $type mylist + check_numbered_list_consistency mylist + check_random_access_consistency mylist + } {} {needs:debug} + } + + test {LLEN against non-list value error} { + r del mylist + r set mylist foobar + assert_error WRONGTYPE* {r llen mylist} + } + + test {LLEN against non existing key} { + assert_equal 0 [r llen not-a-key] + } + + test {LINDEX against non-list value error} { + assert_error WRONGTYPE* {r lindex mylist 0} + } + + test {LINDEX against non existing key} { + assert_equal "" [r lindex not-a-key 10] + } + + test {LPUSH against non-list value error} { + assert_error WRONGTYPE* {r lpush mylist 0} + } + + test {RPUSH against non-list value error} { + assert_error WRONGTYPE* {r rpush mylist 0} + } + + foreach {type large} [array get largevalue] { + test "RPOPLPUSH base case - $type" { + r del mylist1{t} mylist2{t} + create_list mylist1{t} "a $large c d" + assert_equal d [r rpoplpush mylist1{t} mylist2{t}] + assert_equal c [r rpoplpush mylist1{t} mylist2{t}] + assert_equal "a $large" [r lrange mylist1{t} 0 -1] + assert_equal "c d" [r lrange mylist2{t} 0 -1] + assert_encoding quicklist mylist2{t} + } + + foreach wherefrom {left right} { + foreach whereto {left right} { + test "LMOVE $wherefrom $whereto base case - $type" { + r del mylist1{t} mylist2{t} + + if {$wherefrom eq "right"} { + create_list mylist1{t} "c d $large a" + } else { + create_list mylist1{t} "a $large c d" + } + assert_equal a [r lmove mylist1{t} mylist2{t} $wherefrom $whereto] + assert_equal $large [r lmove mylist1{t} mylist2{t} $wherefrom $whereto] + assert_equal "c d" [r lrange mylist1{t} 0 -1] + if {$whereto eq "right"} { + assert_equal "a $large" [r lrange mylist2{t} 0 -1] + } else { + assert_equal "$large a" [r lrange mylist2{t} 0 -1] + } + assert_encoding quicklist mylist2{t} + } + } + } + + test "RPOPLPUSH with the same list as src and dst - $type" { + create_list mylist{t} "a $large c" + assert_equal "a $large c" [r lrange mylist{t} 0 -1] + assert_equal c [r rpoplpush mylist{t} mylist{t}] + assert_equal "c a $large" [r lrange mylist{t} 0 -1] + } + + foreach wherefrom {left right} { + foreach whereto {left right} { + test "LMOVE $wherefrom $whereto with the same list as src and dst - $type" { + if {$wherefrom eq "right"} { + create_list mylist{t} "a $large c" + assert_equal "a $large c" [r lrange mylist{t} 0 -1] + } else { + create_list mylist{t} "c a $large" + assert_equal "c a $large" [r lrange mylist{t} 0 -1] + } + assert_equal c [r lmove mylist{t} mylist{t} $wherefrom $whereto] + if {$whereto eq "right"} { + assert_equal "a $large c" [r lrange mylist{t} 0 -1] + } else { + assert_equal "c a $large" [r lrange mylist{t} 0 -1] + } + } + } + } + + foreach {othertype otherlarge} [array get largevalue] { + test "RPOPLPUSH with $type source and existing target $othertype" { + create_list srclist{t} "a b c $large" + create_list dstlist{t} "$otherlarge" + assert_equal $large [r rpoplpush srclist{t} dstlist{t}] + assert_equal c [r rpoplpush srclist{t} dstlist{t}] + assert_equal "a b" [r lrange srclist{t} 0 -1] + assert_equal "c $large $otherlarge" [r lrange dstlist{t} 0 -1] + + # When we rpoplpush'ed a large value, dstlist should be + # converted to the same encoding as srclist. + if {$type eq "linkedlist"} { + assert_encoding quicklist dstlist{t} + } + } + + foreach wherefrom {left right} { + foreach whereto {left right} { + test "LMOVE $wherefrom $whereto with $type source and existing target $othertype" { + create_list dstlist{t} "$otherlarge" + + if {$wherefrom eq "right"} { + create_list srclist{t} "a b c $large" + } else { + create_list srclist{t} "$large c a b" + } + assert_equal $large [r lmove srclist{t} dstlist{t} $wherefrom $whereto] + assert_equal c [r lmove srclist{t} dstlist{t} $wherefrom $whereto] + assert_equal "a b" [r lrange srclist{t} 0 -1] + + if {$whereto eq "right"} { + assert_equal "$otherlarge $large c" [r lrange dstlist{t} 0 -1] + } else { + assert_equal "c $large $otherlarge" [r lrange dstlist{t} 0 -1] + } + + # When we lmoved a large value, dstlist should be + # converted to the same encoding as srclist. + if {$type eq "linkedlist"} { + assert_encoding quicklist dstlist{t} + } + } + } + } + } + } + + test {RPOPLPUSH against non existing key} { + r del srclist{t} dstlist{t} + assert_equal {} [r rpoplpush srclist{t} dstlist{t}] + assert_equal 0 [r exists srclist{t}] + assert_equal 0 [r exists dstlist{t}] + } + + test {RPOPLPUSH against non list src key} { + r del srclist{t} dstlist{t} + r set srclist{t} x + assert_error WRONGTYPE* {r rpoplpush srclist{t} dstlist{t}} + assert_type string srclist{t} + assert_equal 0 [r exists newlist{t}] + } + + test {RPOPLPUSH against non list dst key} { + create_list srclist{t} {a b c d} + r set dstlist{t} x + assert_error WRONGTYPE* {r rpoplpush srclist{t} dstlist{t}} + assert_type string dstlist{t} + assert_equal {a b c d} [r lrange srclist{t} 0 -1] + } + + test {RPOPLPUSH against non existing src key} { + r del srclist{t} dstlist{t} + assert_equal {} [r rpoplpush srclist{t} dstlist{t}] + } {} + + foreach {type large} [array get largevalue] { + test "Basic LPOP/RPOP/LMPOP - $type" { + create_list mylist "$large 1 2" + assert_equal $large [r lpop mylist] + assert_equal 2 [r rpop mylist] + assert_equal 1 [r lpop mylist] + assert_equal 0 [r llen mylist] + + create_list mylist "$large 1 2" + assert_equal "mylist $large" [r lmpop 1 mylist left count 1] + assert_equal {mylist {2 1}} [r lmpop 2 mylist mylist right count 2] + } + } + + test {LPOP/RPOP/LMPOP against empty list} { + r del non-existing-list{t} non-existing-list2{t} + + assert_equal {} [r lpop non-existing-list{t}] + assert_equal {} [r rpop non-existing-list2{t}] + + assert_equal {} [r lmpop 1 non-existing-list{t} left count 1] + assert_equal {} [r lmpop 1 non-existing-list{t} left count 10] + assert_equal {} [r lmpop 2 non-existing-list{t} non-existing-list2{t} right count 1] + assert_equal {} [r lmpop 2 non-existing-list{t} non-existing-list2{t} right count 10] + } + + test {LPOP/RPOP/LMPOP NON-BLOCK or BLOCK against non list value} { + r set notalist{t} foo + assert_error WRONGTYPE* {r lpop notalist{t}} + assert_error WRONGTYPE* {r blpop notalist{t} 0} + assert_error WRONGTYPE* {r rpop notalist{t}} + assert_error WRONGTYPE* {r brpop notalist{t} 0} + + r del notalist2{t} + assert_error "WRONGTYPE*" {r lmpop 2 notalist{t} notalist2{t} left count 1} + assert_error "WRONGTYPE*" {r blmpop 0 2 notalist{t} notalist2{t} left count 1} + + r del notalist{t} + r set notalist2{t} nolist + assert_error "WRONGTYPE*" {r lmpop 2 notalist{t} notalist2{t} right count 10} + assert_error "WRONGTYPE*" {r blmpop 0 2 notalist{t} notalist2{t} left count 1} + } + + foreach {type num} {quicklist 250 quicklist 500} { + test "Mass RPOP/LPOP - $type" { + r del mylist + set sum1 0 + for {set i 0} {$i < $num} {incr i} { + r lpush mylist $i + incr sum1 $i + } + assert_encoding $type mylist + set sum2 0 + for {set i 0} {$i < [expr $num/2]} {incr i} { + incr sum2 [r lpop mylist] + incr sum2 [r rpop mylist] + } + assert_equal $sum1 $sum2 + } + } + + test {LMPOP with illegal argument} { + assert_error "ERR wrong number of arguments for 'lmpop' command" {r lmpop} + assert_error "ERR wrong number of arguments for 'lmpop' command" {r lmpop 1} + assert_error "ERR wrong number of arguments for 'lmpop' command" {r lmpop 1 mylist{t}} + + assert_error "ERR numkeys*" {r lmpop 0 mylist{t} LEFT} + assert_error "ERR numkeys*" {r lmpop a mylist{t} LEFT} + assert_error "ERR numkeys*" {r lmpop -1 mylist{t} RIGHT} + + assert_error "ERR syntax error*" {r lmpop 1 mylist{t} bad_where} + assert_error "ERR syntax error*" {r lmpop 1 mylist{t} LEFT bar_arg} + assert_error "ERR syntax error*" {r lmpop 1 mylist{t} RIGHT LEFT} + assert_error "ERR syntax error*" {r lmpop 1 mylist{t} COUNT} + assert_error "ERR syntax error*" {r lmpop 1 mylist{t} LEFT COUNT 1 COUNT 2} + assert_error "ERR syntax error*" {r lmpop 2 mylist{t} mylist2{t} bad_arg} + + assert_error "ERR count*" {r lmpop 1 mylist{t} LEFT COUNT 0} + assert_error "ERR count*" {r lmpop 1 mylist{t} RIGHT COUNT a} + assert_error "ERR count*" {r lmpop 1 mylist{t} LEFT COUNT -1} + assert_error "ERR count*" {r lmpop 2 mylist{t} mylist2{t} RIGHT COUNT -1} + } + + test {LMPOP single existing list} { + # Same key multiple times. + create_list mylist{t} "a b c d e f" + assert_equal {mylist{t} {a b}} [r lmpop 2 mylist{t} mylist{t} left count 2] + assert_equal {mylist{t} {f e}} [r lmpop 2 mylist{t} mylist{t} right count 2] + assert_equal 2 [r llen mylist{t}] + + # First one exists, second one does not exist. + create_list mylist{t} "a b c d e" + r del mylist2{t} + assert_equal {mylist{t} a} [r lmpop 2 mylist{t} mylist2{t} left count 1] + assert_equal 4 [r llen mylist{t}] + assert_equal {mylist{t} {e d c b}} [r lmpop 2 mylist{t} mylist2{t} right count 10] + assert_equal {} [r lmpop 2 mylist{t} mylist2{t} right count 1] + + # First one does not exist, second one exists. + r del mylist{t} + create_list mylist2{t} "1 2 3 4 5" + assert_equal {mylist2{t} 5} [r lmpop 2 mylist{t} mylist2{t} right count 1] + assert_equal 4 [r llen mylist2{t}] + assert_equal {mylist2{t} {1 2 3 4}} [r lmpop 2 mylist{t} mylist2{t} left count 10] + + assert_equal 0 [r exists mylist{t} mylist2{t}] + } + + test {LMPOP multiple existing lists} { + create_list mylist{t} "a b c d e" + create_list mylist2{t} "1 2 3 4 5" + + # Pop up from the first key. + assert_equal {mylist{t} {a b}} [r lmpop 2 mylist{t} mylist2{t} left count 2] + assert_equal 3 [r llen mylist{t}] + assert_equal {mylist{t} {e d c}} [r lmpop 2 mylist{t} mylist2{t} right count 3] + assert_equal 0 [r exists mylist{t}] + + # Pop up from the second key. + assert_equal {mylist2{t} {1 2 3}} [r lmpop 2 mylist{t} mylist2{t} left count 3] + assert_equal 2 [r llen mylist2{t}] + assert_equal {mylist2{t} {5 4}} [r lmpop 2 mylist{t} mylist2{t} right count 2] + assert_equal 0 [r exists mylist{t}] + + # Pop up all elements. + create_list mylist{t} "a b c" + create_list mylist2{t} "1 2 3" + assert_equal {mylist{t} {a b c}} [r lmpop 2 mylist{t} mylist2{t} left count 10] + assert_equal 0 [r llen mylist{t}] + assert_equal {mylist2{t} {3 2 1}} [r lmpop 2 mylist{t} mylist2{t} right count 10] + assert_equal 0 [r llen mylist2{t}] + assert_equal 0 [r exists mylist{t} mylist2{t}] + } + + test {LMPOP propagate as pop with count command to replica} { + set repl [attach_to_replication_stream] + + # left/right propagate as lpop/rpop with count + r lpush mylist{t} a b c + + # Pop elements from one list. + r lmpop 1 mylist{t} left count 1 + r lmpop 1 mylist{t} right count 1 + + # Now the list have only one element + r lmpop 2 mylist{t} mylist2{t} left count 10 + + # No elements so we don't propagate. + r lmpop 2 mylist{t} mylist2{t} left count 10 + + # Pop elements from the second list. + r rpush mylist2{t} 1 2 3 + r lmpop 2 mylist{t} mylist2{t} left count 2 + r lmpop 2 mylist{t} mylist2{t} right count 1 + + # Pop all elements. + r rpush mylist{t} a b c + r rpush mylist2{t} 1 2 3 + r lmpop 2 mylist{t} mylist2{t} left count 10 + r lmpop 2 mylist{t} mylist2{t} right count 10 + + assert_replication_stream $repl { + {select *} + {lpush mylist{t} a b c} + {lpop mylist{t} 1} + {rpop mylist{t} 1} + {lpop mylist{t} 1} + {rpush mylist2{t} 1 2 3} + {lpop mylist2{t} 2} + {rpop mylist2{t} 1} + {rpush mylist{t} a b c} + {rpush mylist2{t} 1 2 3} + {lpop mylist{t} 3} + {rpop mylist2{t} 3} + } + close_replication_stream $repl + } {} {needs:repl} + + foreach {type large} [array get largevalue] { + test "LRANGE basics - $type" { + create_list mylist "$large 1 2 3 4 5 6 7 8 9" + assert_equal {1 2 3 4 5 6 7 8} [r lrange mylist 1 -2] + assert_equal {7 8 9} [r lrange mylist -3 -1] + assert_equal {4} [r lrange mylist 4 4] + } + + test "LRANGE inverted indexes - $type" { + create_list mylist "$large 1 2 3 4 5 6 7 8 9" + assert_equal {} [r lrange mylist 6 2] + } + + test "LRANGE out of range indexes including the full list - $type" { + create_list mylist "$large 1 2 3" + assert_equal "$large 1 2 3" [r lrange mylist -1000 1000] + } + + test "LRANGE out of range negative end index - $type" { + create_list mylist "$large 1 2 3" + assert_equal $large [r lrange mylist 0 -4] + assert_equal {} [r lrange mylist 0 -5] + } + } + + test {LRANGE against non existing key} { + assert_equal {} [r lrange nosuchkey 0 1] + } + + test {LRANGE with start > end yields an empty array for backward compatibility} { + create_list mylist "1 2 3" + assert_equal {} [r lrange mylist 1 0] + assert_equal {} [r lrange mylist -1 -2] + } + + foreach {type large} [array get largevalue] { + proc trim_list {type min max} { + upvar 1 large large + r del mylist + create_list mylist "1 2 3 4 $large" + r ltrim mylist $min $max + r lrange mylist 0 -1 + } + + test "LTRIM basics - $type" { + assert_equal "1" [trim_list $type 0 0] + assert_equal "1 2" [trim_list $type 0 1] + assert_equal "1 2 3" [trim_list $type 0 2] + assert_equal "2 3" [trim_list $type 1 2] + assert_equal "2 3 4 $large" [trim_list $type 1 -1] + assert_equal "2 3 4" [trim_list $type 1 -2] + assert_equal "4 $large" [trim_list $type -2 -1] + assert_equal "$large" [trim_list $type -1 -1] + assert_equal "1 2 3 4 $large" [trim_list $type -5 -1] + assert_equal "1 2 3 4 $large" [trim_list $type -10 10] + assert_equal "1 2 3 4 $large" [trim_list $type 0 5] + assert_equal "1 2 3 4 $large" [trim_list $type 0 10] + } + + test "LTRIM out of range negative end index - $type" { + assert_equal {1} [trim_list $type 0 -5] + assert_equal {} [trim_list $type 0 -6] + } + + } + + foreach {type large} [array get largevalue] { + test "LSET - $type" { + create_list mylist "99 98 $large 96 95" + r lset mylist 1 foo + r lset mylist -1 bar + assert_equal "99 foo $large 96 bar" [r lrange mylist 0 -1] + } + + test "LSET out of range index - $type" { + assert_error ERR*range* {r lset mylist 10 foo} + } + } + + test {LSET against non existing key} { + assert_error ERR*key* {r lset nosuchkey 10 foo} + } + + test {LSET against non list value} { + r set nolist foobar + assert_error WRONGTYPE* {r lset nolist 0 foo} + } + + foreach {type e} [array get largevalue] { + test "LREM remove all the occurrences - $type" { + create_list mylist "$e foo bar foobar foobared zap bar test foo" + assert_equal 2 [r lrem mylist 0 bar] + assert_equal "$e foo foobar foobared zap test foo" [r lrange mylist 0 -1] + } + + test "LREM remove the first occurrence - $type" { + assert_equal 1 [r lrem mylist 1 foo] + assert_equal "$e foobar foobared zap test foo" [r lrange mylist 0 -1] + } + + test "LREM remove non existing element - $type" { + assert_equal 0 [r lrem mylist 1 nosuchelement] + assert_equal "$e foobar foobared zap test foo" [r lrange mylist 0 -1] + } + + test "LREM starting from tail with negative count - $type" { + create_list mylist "$e foo bar foobar foobared zap bar test foo foo" + assert_equal 1 [r lrem mylist -1 bar] + assert_equal "$e foo bar foobar foobared zap test foo foo" [r lrange mylist 0 -1] + } + + test "LREM starting from tail with negative count (2) - $type" { + assert_equal 2 [r lrem mylist -2 foo] + assert_equal "$e foo bar foobar foobared zap test" [r lrange mylist 0 -1] + } + + test "LREM deleting objects that may be int encoded - $type" { + create_list myotherlist "$e 1 2 3" + assert_equal 1 [r lrem myotherlist 1 2] + assert_equal 3 [r llen myotherlist] + } + } + + test "Regression for bug 593 - chaining BRPOPLPUSH with other blocking cmds" { + set rd1 [redis_deferring_client] + set rd2 [redis_deferring_client] + + $rd1 brpoplpush a b 0 + $rd1 brpoplpush a b 0 + $rd2 brpoplpush b c 0 + after 1000 + r lpush a data + $rd1 close + $rd2 close + r ping + } {PONG} + +foreach {pop} {BLPOP BLMPOP_RIGHT} { + test "client unblock tests" { + r del l + set rd [redis_deferring_client] + $rd client id + set id [$rd read] + + # test default args + bpop_command $rd $pop l 0 + wait_for_blocked_client + r client unblock $id + assert_equal {} [$rd read] + + # test with timeout + bpop_command $rd $pop l 0 + wait_for_blocked_client + r client unblock $id TIMEOUT + assert_equal {} [$rd read] + + # test with error + bpop_command $rd $pop l 0 + wait_for_blocked_client + r client unblock $id ERROR + catch {[$rd read]} e + assert_equal $e "UNBLOCKED client unblocked via CLIENT UNBLOCK" + + # test with invalid client id + catch {[r client unblock asd]} e + assert_equal $e "ERR value is not an integer or out of range" + + # test with non blocked client + set myid [r client id] + catch {[r client unblock $myid]} e + assert_equal $e {invalid command name "0"} + + # finally, see the this client and list are still functional + bpop_command $rd $pop l 0 + wait_for_blocked_client + r lpush l foo + assert_equal {l foo} [$rd read] + $rd close + } +} + + test {List ziplist of various encodings} { + r del k + r lpush k 127 ;# ZIP_INT_8B + r lpush k 32767 ;# ZIP_INT_16B + r lpush k 2147483647 ;# ZIP_INT_32B + r lpush k 9223372036854775808 ;# ZIP_INT_64B + r lpush k 0 ;# ZIP_INT_IMM_MIN + r lpush k 12 ;# ZIP_INT_IMM_MAX + r lpush k [string repeat x 31] ;# ZIP_STR_06B + r lpush k [string repeat x 8191] ;# ZIP_STR_14B + r lpush k [string repeat x 65535] ;# ZIP_STR_32B + set k [r lrange k 0 -1] + set dump [r dump k] + + config_set sanitize-dump-payload no mayfail + r restore kk 0 $dump + set kk [r lrange kk 0 -1] + + # try some forward and backward searches to make sure all encodings + # can be traversed + assert_equal [r lindex kk 5] {9223372036854775808} + assert_equal [r lindex kk -5] {0} + assert_equal [r lpos kk foo rank 1] {} + assert_equal [r lpos kk foo rank -1] {} + + # make sure the values are right + assert_equal $k $kk + assert_equal [lpop k] [string repeat x 65535] + assert_equal [lpop k] [string repeat x 8191] + assert_equal [lpop k] [string repeat x 31] + set _ $k + } {12 0 9223372036854775808 2147483647 32767 127} + + test {List ziplist of various encodings - sanitize dump} { + config_set sanitize-dump-payload yes mayfail + r restore kk 0 $dump replace + set k [r lrange k 0 -1] + set kk [r lrange kk 0 -1] + + # make sure the values are right + assert_equal $k $kk + assert_equal [lpop k] [string repeat x 65535] + assert_equal [lpop k] [string repeat x 8191] + assert_equal [lpop k] [string repeat x 31] + set _ $k + } {12 0 9223372036854775808 2147483647 32767 127} +} diff --git a/tests/unit/type/set.tcl b/tests/unit/type/set.tcl new file mode 100644 index 0000000..561a604 --- /dev/null +++ b/tests/unit/type/set.tcl @@ -0,0 +1,1109 @@ +start_server { + tags {"set"} + overrides { + "set-max-intset-entries" 512 + } +} { + proc create_set {key entries} { + r del $key + foreach entry $entries { r sadd $key $entry } + } + + test {SADD, SCARD, SISMEMBER, SMISMEMBER, SMEMBERS basics - regular set} { + create_set myset {foo} + assert_encoding hashtable myset + assert_equal 1 [r sadd myset bar] + assert_equal 0 [r sadd myset bar] + assert_equal 2 [r scard myset] + assert_equal 1 [r sismember myset foo] + assert_equal 1 [r sismember myset bar] + assert_equal 0 [r sismember myset bla] + assert_equal {1} [r smismember myset foo] + assert_equal {1 1} [r smismember myset foo bar] + assert_equal {1 0} [r smismember myset foo bla] + assert_equal {0 1} [r smismember myset bla foo] + assert_equal {0} [r smismember myset bla] + assert_equal {bar foo} [lsort [r smembers myset]] + } + + test {SADD, SCARD, SISMEMBER, SMISMEMBER, SMEMBERS basics - intset} { + create_set myset {17} + assert_encoding intset myset + assert_equal 1 [r sadd myset 16] + assert_equal 0 [r sadd myset 16] + assert_equal 2 [r scard myset] + assert_equal 1 [r sismember myset 16] + assert_equal 1 [r sismember myset 17] + assert_equal 0 [r sismember myset 18] + assert_equal {1} [r smismember myset 16] + assert_equal {1 1} [r smismember myset 16 17] + assert_equal {1 0} [r smismember myset 16 18] + assert_equal {0 1} [r smismember myset 18 16] + assert_equal {0} [r smismember myset 18] + assert_equal {16 17} [lsort [r smembers myset]] + } + + test {SMISMEMBER against non set} { + r lpush mylist foo + assert_error WRONGTYPE* {r smismember mylist bar} + } + + test {SMISMEMBER non existing key} { + assert_equal {0} [r smismember myset1 foo] + assert_equal {0 0} [r smismember myset1 foo bar] + } + + test {SMISMEMBER requires one or more members} { + r del zmscoretest + r zadd zmscoretest 10 x + r zadd zmscoretest 20 y + + catch {r smismember zmscoretest} e + assert_match {*ERR*wrong*number*arg*} $e + } + + test {SADD against non set} { + r lpush mylist foo + assert_error WRONGTYPE* {r sadd mylist bar} + } + + test "SADD a non-integer against an intset" { + create_set myset {1 2 3} + assert_encoding intset myset + assert_equal 1 [r sadd myset a] + assert_encoding hashtable myset + } + + test "SADD an integer larger than 64 bits" { + create_set myset {213244124402402314402033402} + assert_encoding hashtable myset + assert_equal 1 [r sismember myset 213244124402402314402033402] + assert_equal {1} [r smismember myset 213244124402402314402033402] + } + + test "SADD overflows the maximum allowed integers in an intset" { + r del myset + for {set i 0} {$i < 512} {incr i} { r sadd myset $i } + assert_encoding intset myset + assert_equal 1 [r sadd myset 512] + assert_encoding hashtable myset + } + + test {Variadic SADD} { + r del myset + assert_equal 3 [r sadd myset a b c] + assert_equal 2 [r sadd myset A a b c B] + assert_equal [lsort {A a b c B}] [lsort [r smembers myset]] + } + + test "Set encoding after DEBUG RELOAD" { + r del myintset + r del myhashset + r del mylargeintset + for {set i 0} {$i < 100} {incr i} { r sadd myintset $i } + for {set i 0} {$i < 1280} {incr i} { r sadd mylargeintset $i } + for {set i 0} {$i < 256} {incr i} { r sadd myhashset [format "i%03d" $i] } + assert_encoding intset myintset + assert_encoding hashtable mylargeintset + assert_encoding hashtable myhashset + + r debug reload + assert_encoding intset myintset + assert_encoding hashtable mylargeintset + assert_encoding hashtable myhashset + } {} {needs:debug} + + test {SREM basics - regular set} { + create_set myset {foo bar ciao} + assert_encoding hashtable myset + assert_equal 0 [r srem myset qux] + assert_equal 1 [r srem myset foo] + assert_equal {bar ciao} [lsort [r smembers myset]] + } + + test {SREM basics - intset} { + create_set myset {3 4 5} + assert_encoding intset myset + assert_equal 0 [r srem myset 6] + assert_equal 1 [r srem myset 4] + assert_equal {3 5} [lsort [r smembers myset]] + } + + test {SREM with multiple arguments} { + r del myset + r sadd myset a b c d + assert_equal 0 [r srem myset k k k] + assert_equal 2 [r srem myset b d x y] + lsort [r smembers myset] + } {a c} + + test {SREM variadic version with more args needed to destroy the key} { + r del myset + r sadd myset 1 2 3 + r srem myset 1 2 3 4 5 6 7 8 + } {3} + + test "SINTERCARD with illegal arguments" { + assert_error "ERR wrong number of arguments for 'sintercard' command" {r sintercard} + assert_error "ERR wrong number of arguments for 'sintercard' command" {r sintercard 1} + + assert_error "ERR numkeys*" {r sintercard 0 myset{t}} + assert_error "ERR numkeys*" {r sintercard a myset{t}} + + assert_error "ERR Number of keys*" {r sintercard 2 myset{t}} + assert_error "ERR Number of keys*" {r sintercard 3 myset{t} myset2{t}} + + assert_error "ERR syntax error*" {r sintercard 1 myset{t} myset2{t}} + assert_error "ERR syntax error*" {r sintercard 1 myset{t} bar_arg} + assert_error "ERR syntax error*" {r sintercard 1 myset{t} LIMIT} + + assert_error "ERR LIMIT*" {r sintercard 1 myset{t} LIMIT -1} + assert_error "ERR LIMIT*" {r sintercard 1 myset{t} LIMIT a} + } + + test "SINTERCARD against non-set should throw error" { + r del set{t} + r sadd set{t} a b c + r set key1{t} x + + assert_error "WRONGTYPE*" {r sintercard 1 key1{t}} + assert_error "WRONGTYPE*" {r sintercard 2 set{t} key1{t}} + assert_error "WRONGTYPE*" {r sintercard 2 key1{t} noset{t}} + } + + test "SINTERCARD against non-existing key" { + assert_equal 0 [r sintercard 1 non-existing-key] + assert_equal 0 [r sintercard 1 non-existing-key limit 0] + assert_equal 0 [r sintercard 1 non-existing-key limit 10] + } + + foreach {type} {hashtable intset} { + for {set i 1} {$i <= 5} {incr i} { + r del [format "set%d{t}" $i] + } + for {set i 0} {$i < 200} {incr i} { + r sadd set1{t} $i + r sadd set2{t} [expr $i+195] + } + foreach i {199 195 1000 2000} { + r sadd set3{t} $i + } + for {set i 5} {$i < 200} {incr i} { + r sadd set4{t} $i + } + r sadd set5{t} 0 + + # To make sure the sets are encoded as the type we are testing -- also + # when the VM is enabled and the values may be swapped in and out + # while the tests are running -- an extra element is added to every + # set that determines its encoding. + set large 200 + if {$type eq "hashtable"} { + set large foo + } + + for {set i 1} {$i <= 5} {incr i} { + r sadd [format "set%d{t}" $i] $large + } + + test "Generated sets must be encoded as $type" { + for {set i 1} {$i <= 5} {incr i} { + assert_encoding $type [format "set%d{t}" $i] + } + } + + test "SINTER with two sets - $type" { + assert_equal [list 195 196 197 198 199 $large] [lsort [r sinter set1{t} set2{t}]] + } + + test "SINTERCARD with two sets - $type" { + assert_equal 6 [r sintercard 2 set1{t} set2{t}] + assert_equal 6 [r sintercard 2 set1{t} set2{t} limit 0] + assert_equal 3 [r sintercard 2 set1{t} set2{t} limit 3] + assert_equal 6 [r sintercard 2 set1{t} set2{t} limit 10] + } + + test "SINTERSTORE with two sets - $type" { + r sinterstore setres{t} set1{t} set2{t} + assert_encoding $type setres{t} + assert_equal [list 195 196 197 198 199 $large] [lsort [r smembers setres{t}]] + } + + test "SINTERSTORE with two sets, after a DEBUG RELOAD - $type" { + r debug reload + r sinterstore setres{t} set1{t} set2{t} + assert_encoding $type setres{t} + assert_equal [list 195 196 197 198 199 $large] [lsort [r smembers setres{t}]] + } {} {needs:debug} + + test "SUNION with two sets - $type" { + set expected [lsort -uniq "[r smembers set1{t}] [r smembers set2{t}]"] + assert_equal $expected [lsort [r sunion set1{t} set2{t}]] + } + + test "SUNIONSTORE with two sets - $type" { + r sunionstore setres{t} set1{t} set2{t} + assert_encoding $type setres{t} + set expected [lsort -uniq "[r smembers set1{t}] [r smembers set2{t}]"] + assert_equal $expected [lsort [r smembers setres{t}]] + } + + test "SINTER against three sets - $type" { + assert_equal [list 195 199 $large] [lsort [r sinter set1{t} set2{t} set3{t}]] + } + + test "SINTERCARD against three sets - $type" { + assert_equal 3 [r sintercard 3 set1{t} set2{t} set3{t}] + assert_equal 3 [r sintercard 3 set1{t} set2{t} set3{t} limit 0] + assert_equal 2 [r sintercard 3 set1{t} set2{t} set3{t} limit 2] + assert_equal 3 [r sintercard 3 set1{t} set2{t} set3{t} limit 10] + } + + test "SINTERSTORE with three sets - $type" { + r sinterstore setres{t} set1{t} set2{t} set3{t} + assert_equal [list 195 199 $large] [lsort [r smembers setres{t}]] + } + + test "SUNION with non existing keys - $type" { + set expected [lsort -uniq "[r smembers set1{t}] [r smembers set2{t}]"] + assert_equal $expected [lsort [r sunion nokey1{t} set1{t} set2{t} nokey2{t}]] + } + + test "SDIFF with two sets - $type" { + assert_equal {0 1 2 3 4} [lsort [r sdiff set1{t} set4{t}]] + } + + test "SDIFF with three sets - $type" { + assert_equal {1 2 3 4} [lsort [r sdiff set1{t} set4{t} set5{t}]] + } + + test "SDIFFSTORE with three sets - $type" { + r sdiffstore setres{t} set1{t} set4{t} set5{t} + # When we start with intsets, we should always end with intsets. + if {$type eq {intset}} { + assert_encoding intset setres{t} + } + assert_equal {1 2 3 4} [lsort [r smembers setres{t}]] + } + + test "SINTER/SUNION/SDIFF with three same sets - $type" { + set expected [lsort "[r smembers set1{t}]"] + assert_equal $expected [lsort [r sinter set1{t} set1{t} set1{t}]] + assert_equal $expected [lsort [r sunion set1{t} set1{t} set1{t}]] + assert_equal {} [lsort [r sdiff set1{t} set1{t} set1{t}]] + } + } + + test "SDIFF with first set empty" { + r del set1{t} set2{t} set3{t} + r sadd set2{t} 1 2 3 4 + r sadd set3{t} a b c d + r sdiff set1{t} set2{t} set3{t} + } {} + + test "SDIFF with same set two times" { + r del set1 + r sadd set1 a b c 1 2 3 4 5 6 + r sdiff set1 set1 + } {} + + test "SDIFF fuzzing" { + for {set j 0} {$j < 100} {incr j} { + unset -nocomplain s + array set s {} + set args {} + set num_sets [expr {[randomInt 10]+1}] + for {set i 0} {$i < $num_sets} {incr i} { + set num_elements [randomInt 100] + r del set_$i{t} + lappend args set_$i{t} + while {$num_elements} { + set ele [randomValue] + r sadd set_$i{t} $ele + if {$i == 0} { + set s($ele) x + } else { + unset -nocomplain s($ele) + } + incr num_elements -1 + } + } + set result [lsort [r sdiff {*}$args]] + assert_equal $result [lsort [array names s]] + } + } + + test "SDIFF against non-set should throw error" { + # with an empty set + r set key1{t} x + assert_error "WRONGTYPE*" {r sdiff key1{t} noset{t}} + # different order + assert_error "WRONGTYPE*" {r sdiff noset{t} key1{t}} + + # with a legal set + r del set1{t} + r sadd set1{t} a b c + assert_error "WRONGTYPE*" {r sdiff key1{t} set1{t}} + # different order + assert_error "WRONGTYPE*" {r sdiff set1{t} key1{t}} + } + + test "SDIFF should handle non existing key as empty" { + r del set1{t} set2{t} set3{t} + + r sadd set1{t} a b c + r sadd set2{t} b c d + assert_equal {a} [lsort [r sdiff set1{t} set2{t} set3{t}]] + assert_equal {} [lsort [r sdiff set3{t} set2{t} set1{t}]] + } + + test "SDIFFSTORE against non-set should throw error" { + r del set1{t} set2{t} set3{t} key1{t} + r set key1{t} x + + # with en empty dstkey + assert_error "WRONGTYPE*" {r SDIFFSTORE set3{t} key1{t} noset{t}} + assert_equal 0 [r exists set3{t}] + assert_error "WRONGTYPE*" {r SDIFFSTORE set3{t} noset{t} key1{t}} + assert_equal 0 [r exists set3{t}] + + # with a legal dstkey + r sadd set1{t} a b c + r sadd set2{t} b c d + r sadd set3{t} e + assert_error "WRONGTYPE*" {r SDIFFSTORE set3{t} key1{t} set1{t} noset{t}} + assert_equal 1 [r exists set3{t}] + assert_equal {e} [lsort [r smembers set3{t}]] + + assert_error "WRONGTYPE*" {r SDIFFSTORE set3{t} set1{t} key1{t} set2{t}} + assert_equal 1 [r exists set3{t}] + assert_equal {e} [lsort [r smembers set3{t}]] + } + + test "SDIFFSTORE should handle non existing key as empty" { + r del set1{t} set2{t} set3{t} + + r set setres{t} xxx + assert_equal 0 [r sdiffstore setres{t} foo111{t} bar222{t}] + assert_equal 0 [r exists setres{t}] + + # with a legal dstkey, should delete dstkey + r sadd set3{t} a b c + assert_equal 0 [r sdiffstore set3{t} set1{t} set2{t}] + assert_equal 0 [r exists set3{t}] + + r sadd set1{t} a b c + assert_equal 3 [r sdiffstore set3{t} set1{t} set2{t}] + assert_equal 1 [r exists set3{t}] + assert_equal {a b c} [lsort [r smembers set3{t}]] + + # with a legal dstkey and empty set2, should delete the dstkey + r sadd set3{t} a b c + assert_equal 0 [r sdiffstore set3{t} set2{t} set1{t}] + assert_equal 0 [r exists set3{t}] + } + + test "SINTER against non-set should throw error" { + r set key1{t} x + assert_error "WRONGTYPE*" {r sinter key1{t} noset{t}} + # different order + assert_error "WRONGTYPE*" {r sinter noset{t} key1{t}} + + r sadd set1{t} a b c + assert_error "WRONGTYPE*" {r sinter key1{t} set1{t}} + # different order + assert_error "WRONGTYPE*" {r sinter set1{t} key1{t}} + } + + test "SINTER should handle non existing key as empty" { + r del set1{t} set2{t} set3{t} + r sadd set1{t} a b c + r sadd set2{t} b c d + r sinter set1{t} set2{t} set3{t} + } {} + + test "SINTER with same integer elements but different encoding" { + r del set1{t} set2{t} + r sadd set1{t} 1 2 3 + r sadd set2{t} 1 2 3 a + r srem set2{t} a + assert_encoding intset set1{t} + assert_encoding hashtable set2{t} + lsort [r sinter set1{t} set2{t}] + } {1 2 3} + + test "SINTERSTORE against non-set should throw error" { + r del set1{t} set2{t} set3{t} key1{t} + r set key1{t} x + + # with en empty dstkey + assert_error "WRONGTYPE*" {r sinterstore set3{t} key1{t} noset{t}} + assert_equal 0 [r exists set3{t}] + assert_error "WRONGTYPE*" {r sinterstore set3{t} noset{t} key1{t}} + assert_equal 0 [r exists set3{t}] + + # with a legal dstkey + r sadd set1{t} a b c + r sadd set2{t} b c d + r sadd set3{t} e + assert_error "WRONGTYPE*" {r sinterstore set3{t} key1{t} set2{t} noset{t}} + assert_equal 1 [r exists set3{t}] + assert_equal {e} [lsort [r smembers set3{t}]] + + assert_error "WRONGTYPE*" {r sinterstore set3{t} noset{t} key1{t} set2{t}} + assert_equal 1 [r exists set3{t}] + assert_equal {e} [lsort [r smembers set3{t}]] + } + + test "SINTERSTORE against non existing keys should delete dstkey" { + r del set1{t} set2{t} set3{t} + + r set setres{t} xxx + assert_equal 0 [r sinterstore setres{t} foo111{t} bar222{t}] + assert_equal 0 [r exists setres{t}] + + # with a legal dstkey + r sadd set3{t} a b c + assert_equal 0 [r sinterstore set3{t} set1{t} set2{t}] + assert_equal 0 [r exists set3{t}] + + r sadd set1{t} a b c + assert_equal 0 [r sinterstore set3{t} set1{t} set2{t}] + assert_equal 0 [r exists set3{t}] + + assert_equal 0 [r sinterstore set3{t} set2{t} set1{t}] + assert_equal 0 [r exists set3{t}] + } + + test "SUNION against non-set should throw error" { + r set key1{t} x + assert_error "WRONGTYPE*" {r sunion key1{t} noset{t}} + # different order + assert_error "WRONGTYPE*" {r sunion noset{t} key1{t}} + + r del set1{t} + r sadd set1{t} a b c + assert_error "WRONGTYPE*" {r sunion key1{t} set1{t}} + # different order + assert_error "WRONGTYPE*" {r sunion set1{t} key1{t}} + } + + test "SUNION should handle non existing key as empty" { + r del set1{t} set2{t} set3{t} + + r sadd set1{t} a b c + r sadd set2{t} b c d + assert_equal {a b c d} [lsort [r sunion set1{t} set2{t} set3{t}]] + } + + test "SUNIONSTORE against non-set should throw error" { + r del set1{t} set2{t} set3{t} key1{t} + r set key1{t} x + + # with en empty dstkey + assert_error "WRONGTYPE*" {r sunionstore set3{t} key1{t} noset{t}} + assert_equal 0 [r exists set3{t}] + assert_error "WRONGTYPE*" {r sunionstore set3{t} noset{t} key1{t}} + assert_equal 0 [r exists set3{t}] + + # with a legal dstkey + r sadd set1{t} a b c + r sadd set2{t} b c d + r sadd set3{t} e + assert_error "WRONGTYPE*" {r sunionstore set3{t} key1{t} key2{t} noset{t}} + assert_equal 1 [r exists set3{t}] + assert_equal {e} [lsort [r smembers set3{t}]] + + assert_error "WRONGTYPE*" {r sunionstore set3{t} noset{t} key1{t} key2{t}} + assert_equal 1 [r exists set3{t}] + assert_equal {e} [lsort [r smembers set3{t}]] + } + + test "SUNIONSTORE should handle non existing key as empty" { + r del set1{t} set2{t} set3{t} + + r set setres{t} xxx + assert_equal 0 [r sunionstore setres{t} foo111{t} bar222{t}] + assert_equal 0 [r exists setres{t}] + + # set1 set2 both empty, should delete the dstkey + r sadd set3{t} a b c + assert_equal 0 [r sunionstore set3{t} set1{t} set2{t}] + assert_equal 0 [r exists set3{t}] + + r sadd set1{t} a b c + r sadd set3{t} e f + assert_equal 3 [r sunionstore set3{t} set1{t} set2{t}] + assert_equal 1 [r exists set3{t}] + assert_equal {a b c} [lsort [r smembers set3{t}]] + + r sadd set3{t} d + assert_equal 3 [r sunionstore set3{t} set2{t} set1{t}] + assert_equal 1 [r exists set3{t}] + assert_equal {a b c} [lsort [r smembers set3{t}]] + } + + test "SUNIONSTORE against non existing keys should delete dstkey" { + r set setres{t} xxx + assert_equal 0 [r sunionstore setres{t} foo111{t} bar222{t}] + assert_equal 0 [r exists setres{t}] + } + + foreach {type contents} {hashtable {a b c} intset {1 2 3}} { + test "SPOP basics - $type" { + create_set myset $contents + assert_encoding $type myset + assert_equal $contents [lsort [list [r spop myset] [r spop myset] [r spop myset]]] + assert_equal 0 [r scard myset] + } + + test "SPOP with <count>=1 - $type" { + create_set myset $contents + assert_encoding $type myset + assert_equal $contents [lsort [list [r spop myset 1] [r spop myset 1] [r spop myset 1]]] + assert_equal 0 [r scard myset] + } + + test "SRANDMEMBER - $type" { + create_set myset $contents + unset -nocomplain myset + array set myset {} + for {set i 0} {$i < 100} {incr i} { + set myset([r srandmember myset]) 1 + } + assert_equal $contents [lsort [array names myset]] + } + } + + foreach {type contents} { + hashtable {a b c d e f g h i j k l m n o p q r s t u v w x y z} + intset {1 10 11 12 13 14 15 16 17 18 19 2 20 21 22 23 24 25 26 3 4 5 6 7 8 9} + } { + test "SPOP with <count>" { + create_set myset $contents + assert_encoding $type myset + assert_equal $contents [lsort [concat [r spop myset 11] [r spop myset 9] [r spop myset 0] [r spop myset 4] [r spop myset 1] [r spop myset 0] [r spop myset 1] [r spop myset 0]]] + assert_equal 0 [r scard myset] + } + } + + # As seen in intsetRandomMembers + test "SPOP using integers, testing Knuth's and Floyd's algorithm" { + create_set myset {1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20} + assert_encoding intset myset + assert_equal 20 [r scard myset] + r spop myset 1 + assert_equal 19 [r scard myset] + r spop myset 2 + assert_equal 17 [r scard myset] + r spop myset 3 + assert_equal 14 [r scard myset] + r spop myset 10 + assert_equal 4 [r scard myset] + r spop myset 10 + assert_equal 0 [r scard myset] + r spop myset 1 + assert_equal 0 [r scard myset] + } {} + + test "SPOP using integers with Knuth's algorithm" { + r spop nonexisting_key 100 + } {} + + test "SPOP new implementation: code path #1" { + set content {1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20} + create_set myset $content + set res [r spop myset 30] + assert {[lsort $content] eq [lsort $res]} + } + + test "SPOP new implementation: code path #2" { + set content {1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20} + create_set myset $content + set res [r spop myset 2] + assert {[llength $res] == 2} + assert {[r scard myset] == 18} + set union [concat [r smembers myset] $res] + assert {[lsort $union] eq [lsort $content]} + } + + test "SPOP new implementation: code path #3" { + set content {1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20} + create_set myset $content + set res [r spop myset 18] + assert {[llength $res] == 18} + assert {[r scard myset] == 2} + set union [concat [r smembers myset] $res] + assert {[lsort $union] eq [lsort $content]} + } + + test "SRANDMEMBER count of 0 is handled correctly" { + r srandmember myset 0 + } {} + + test "SRANDMEMBER with <count> against non existing key" { + r srandmember nonexisting_key 100 + } {} + + test "SRANDMEMBER count overflow" { + r sadd myset a + assert_error {*value is out of range*} {r srandmember myset -9223372036854775808} + } {} + + # Make sure we can distinguish between an empty array and a null response + r readraw 1 + + test "SRANDMEMBER count of 0 is handled correctly - emptyarray" { + r srandmember myset 0 + } {*0} + + test "SRANDMEMBER with <count> against non existing key - emptyarray" { + r srandmember nonexisting_key 100 + } {*0} + + r readraw 0 + + foreach {type contents} { + hashtable { + 1 5 10 50 125 50000 33959417 4775547 65434162 + 12098459 427716 483706 2726473884 72615637475 + MARY PATRICIA LINDA BARBARA ELIZABETH JENNIFER MARIA + SUSAN MARGARET DOROTHY LISA NANCY KAREN BETTY HELEN + SANDRA DONNA CAROL RUTH SHARON MICHELLE LAURA SARAH + KIMBERLY DEBORAH JESSICA SHIRLEY CYNTHIA ANGELA MELISSA + BRENDA AMY ANNA REBECCA VIRGINIA KATHLEEN + } + intset { + 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 + 20 21 22 23 24 25 26 27 28 29 + 30 31 32 33 34 35 36 37 38 39 + 40 41 42 43 44 45 46 47 48 49 + } + } { + test "SRANDMEMBER with <count> - $type" { + create_set myset $contents + unset -nocomplain myset + array set myset {} + foreach ele [r smembers myset] { + set myset($ele) 1 + } + assert_equal [lsort $contents] [lsort [array names myset]] + + # Make sure that a count of 0 is handled correctly. + assert_equal [r srandmember myset 0] {} + + # We'll stress different parts of the code, see the implementation + # of SRANDMEMBER for more information, but basically there are + # four different code paths. + # + # PATH 1: Use negative count. + # + # 1) Check that it returns repeated elements. + set res [r srandmember myset -100] + assert_equal [llength $res] 100 + + # 2) Check that all the elements actually belong to the + # original set. + foreach ele $res { + assert {[info exists myset($ele)]} + } + + # 3) Check that eventually all the elements are returned. + unset -nocomplain auxset + set iterations 1000 + while {$iterations != 0} { + incr iterations -1 + set res [r srandmember myset -10] + foreach ele $res { + set auxset($ele) 1 + } + if {[lsort [array names myset]] eq + [lsort [array names auxset]]} { + break; + } + } + assert {$iterations != 0} + + # PATH 2: positive count (unique behavior) with requested size + # equal or greater than set size. + foreach size {50 100} { + set res [r srandmember myset $size] + assert_equal [llength $res] 50 + assert_equal [lsort $res] [lsort [array names myset]] + } + + # PATH 3: Ask almost as elements as there are in the set. + # In this case the implementation will duplicate the original + # set and will remove random elements up to the requested size. + # + # PATH 4: Ask a number of elements definitely smaller than + # the set size. + # + # We can test both the code paths just changing the size but + # using the same code. + + foreach size {45 5} { + set res [r srandmember myset $size] + assert_equal [llength $res] $size + + # 1) Check that all the elements actually belong to the + # original set. + foreach ele $res { + assert {[info exists myset($ele)]} + } + + # 2) Check that eventually all the elements are returned. + unset -nocomplain auxset + set iterations 1000 + while {$iterations != 0} { + incr iterations -1 + set res [r srandmember myset $size] + foreach ele $res { + set auxset($ele) 1 + } + if {[lsort [array names myset]] eq + [lsort [array names auxset]]} { + break; + } + } + assert {$iterations != 0} + } + } + } + + foreach {type contents} { + hashtable { + 1 5 10 50 125 + MARY PATRICIA LINDA BARBARA ELIZABETH + } + intset { + 0 1 2 3 4 5 6 7 8 9 + } + } { + test "SRANDMEMBER histogram distribution - $type" { + create_set myset $contents + unset -nocomplain myset + array set myset {} + foreach ele [r smembers myset] { + set myset($ele) 1 + } + + # Use negative count (PATH 1). + # df = 9, 40 means 0.00001 probability + set res [r srandmember myset -1000] + assert_lessthan [chi_square_value $res] 40 + + # Use positive count (both PATH 3 and PATH 4). + foreach size {8 2} { + unset -nocomplain allkey + set iterations [expr {1000 / $size}] + while {$iterations != 0} { + incr iterations -1 + set res [r srandmember myset $size] + foreach ele $res { + lappend allkey $ele + } + } + # df = 9, 40 means 0.00001 probability + assert_lessthan [chi_square_value $allkey] 40 + } + } + } + + proc is_rehashing {myset} { + set htstats [r debug HTSTATS-KEY $myset] + return [string match {*rehashing target*} $htstats] + } + + proc rem_hash_set_top_N {myset n} { + set cursor 0 + set members {} + set enough 0 + while 1 { + set res [r sscan $myset $cursor] + set cursor [lindex $res 0] + set k [lindex $res 1] + foreach m $k { + lappend members $m + if {[llength $members] >= $n} { + set enough 1 + break + } + } + if {$enough || $cursor == 0} { + break + } + } + r srem $myset {*}$members + } + + test "SRANDMEMBER with a dict containing long chain" { + set origin_save [config_get_set save ""] + set origin_max_is [config_get_set set-max-intset-entries 0] + set origin_save_delay [config_get_set rdb-key-save-delay 2147483647] + + # 1) Create a hash set with 100000 members. + set members {} + for {set i 0} {$i < 100000} {incr i} { + lappend members [format "m:%d" $i] + } + create_set myset $members + + # 2) Wait for the hash set rehashing to finish. + while {[is_rehashing myset]} { + r srandmember myset 100 + } + + # 3) Turn off the rehashing of this set, and remove the members to 500. + r bgsave + rem_hash_set_top_N myset [expr {[r scard myset] - 500}] + assert_equal [r scard myset] 500 + + # 4) Kill RDB child process to restart rehashing. + set pid1 [get_child_pid 0] + catch {exec kill -9 $pid1} + waitForBgsave r + + # 5) Let the set hash to start rehashing + r spop myset 1 + assert [is_rehashing myset] + + # 6) Verify that when rdb saving is in progress, rehashing will still be performed (because + # the ratio is extreme) by waiting for it to finish during an active bgsave. + r bgsave + + while {[is_rehashing myset]} { + r srandmember myset 1 + } + if {$::verbose} { + puts [r debug HTSTATS-KEY myset] + } + + set pid1 [get_child_pid 0] + catch {exec kill -9 $pid1} + waitForBgsave r + + # 7) Check that eventually, SRANDMEMBER returns all elements. + array set allmyset {} + foreach ele [r smembers myset] { + set allmyset($ele) 1 + } + unset -nocomplain auxset + set iterations 1000 + while {$iterations != 0} { + incr iterations -1 + set res [r srandmember myset -10] + foreach ele $res { + set auxset($ele) 1 + } + if {[lsort [array names allmyset]] eq + [lsort [array names auxset]]} { + break; + } + } + assert {$iterations != 0} + + # 8) Remove the members to 30 in order to calculate the value of Chi-Square Distribution, + # otherwise we would need more iterations. + rem_hash_set_top_N myset [expr {[r scard myset] - 30}] + assert_equal [r scard myset] 30 + assert {[is_rehashing myset]} + + # Now that we have a hash set with only one long chain bucket. + set htstats [r debug HTSTATS-KEY myset] + assert {[regexp {different slots: ([0-9]+)} $htstats - different_slots]} + assert {[regexp {max chain length: ([0-9]+)} $htstats - max_chain_length]} + assert {$different_slots == 1 && $max_chain_length == 30} + + # 9) Use positive count (PATH 4) to get 10 elements (out of 30) each time. + unset -nocomplain allkey + set iterations 1000 + while {$iterations != 0} { + incr iterations -1 + set res [r srandmember myset 10] + foreach ele $res { + lappend allkey $ele + } + } + # validate even distribution of random sampling (df = 29, 73 means 0.00001 probability) + assert_lessthan [chi_square_value $allkey] 73 + + r config set save $origin_save + r config set set-max-intset-entries $origin_max_is + r config set rdb-key-save-delay $origin_save_delay + r save + } {OK} {needs:debug slow} + + proc setup_move {} { + r del myset3{t} myset4{t} + create_set myset1{t} {1 a b} + create_set myset2{t} {2 3 4} + assert_encoding hashtable myset1{t} + assert_encoding intset myset2{t} + } + + test "SMOVE basics - from regular set to intset" { + # move a non-integer element to an intset should convert encoding + setup_move + assert_equal 1 [r smove myset1{t} myset2{t} a] + assert_equal {1 b} [lsort [r smembers myset1{t}]] + assert_equal {2 3 4 a} [lsort [r smembers myset2{t}]] + assert_encoding hashtable myset2{t} + + # move an integer element should not convert the encoding + setup_move + assert_equal 1 [r smove myset1{t} myset2{t} 1] + assert_equal {a b} [lsort [r smembers myset1{t}]] + assert_equal {1 2 3 4} [lsort [r smembers myset2{t}]] + assert_encoding intset myset2{t} + } + + test "SMOVE basics - from intset to regular set" { + setup_move + assert_equal 1 [r smove myset2{t} myset1{t} 2] + assert_equal {1 2 a b} [lsort [r smembers myset1{t}]] + assert_equal {3 4} [lsort [r smembers myset2{t}]] + } + + test "SMOVE non existing key" { + setup_move + assert_equal 0 [r smove myset1{t} myset2{t} foo] + assert_equal 0 [r smove myset1{t} myset1{t} foo] + assert_equal {1 a b} [lsort [r smembers myset1{t}]] + assert_equal {2 3 4} [lsort [r smembers myset2{t}]] + } + + test "SMOVE non existing src set" { + setup_move + assert_equal 0 [r smove noset{t} myset2{t} foo] + assert_equal {2 3 4} [lsort [r smembers myset2{t}]] + } + + test "SMOVE from regular set to non existing destination set" { + setup_move + assert_equal 1 [r smove myset1{t} myset3{t} a] + assert_equal {1 b} [lsort [r smembers myset1{t}]] + assert_equal {a} [lsort [r smembers myset3{t}]] + assert_encoding hashtable myset3{t} + } + + test "SMOVE from intset to non existing destination set" { + setup_move + assert_equal 1 [r smove myset2{t} myset3{t} 2] + assert_equal {3 4} [lsort [r smembers myset2{t}]] + assert_equal {2} [lsort [r smembers myset3{t}]] + assert_encoding intset myset3{t} + } + + test "SMOVE wrong src key type" { + r set x{t} 10 + assert_error "WRONGTYPE*" {r smove x{t} myset2{t} foo} + } + + test "SMOVE wrong dst key type" { + r set x{t} 10 + assert_error "WRONGTYPE*" {r smove myset2{t} x{t} foo} + } + + test "SMOVE with identical source and destination" { + r del set{t} + r sadd set{t} a b c + r smove set{t} set{t} b + lsort [r smembers set{t}] + } {a b c} + + test "SMOVE only notify dstset when the addition is successful" { + r del srcset{t} + r del dstset{t} + + r sadd srcset{t} a b + r sadd dstset{t} a + + r watch dstset{t} + + r multi + r sadd dstset{t} c + + set r2 [redis_client] + $r2 smove srcset{t} dstset{t} a + + # The dstset is actually unchanged, multi should success + r exec + set res [r scard dstset{t}] + assert_equal $res 2 + $r2 close + } + + tags {slow} { + test {intsets implementation stress testing} { + for {set j 0} {$j < 20} {incr j} { + unset -nocomplain s + array set s {} + r del s + set len [randomInt 1024] + for {set i 0} {$i < $len} {incr i} { + randpath { + set data [randomInt 65536] + } { + set data [randomInt 4294967296] + } { + set data [randomInt 18446744073709551616] + } + set s($data) {} + r sadd s $data + } + assert_equal [lsort [r smembers s]] [lsort [array names s]] + set len [array size s] + for {set i 0} {$i < $len} {incr i} { + set e [r spop s] + if {![info exists s($e)]} { + puts "Can't find '$e' on local array" + puts "Local array: [lsort [r smembers s]]" + puts "Remote array: [lsort [array names s]]" + error "exception" + } + array unset s $e + } + assert_equal [r scard s] 0 + assert_equal [array size s] 0 + } + } + } +} + +run_solo {set-large-memory} { +start_server [list overrides [list save ""] ] { + +# test if the server supports such large configs (avoid 32 bit builds) +catch { + r config set proto-max-bulk-len 10000000000 ;#10gb + r config set client-query-buffer-limit 10000000000 ;#10gb +} +if {[lindex [r config get proto-max-bulk-len] 1] == 10000000000} { + + set str_length 4400000000 ;#~4.4GB + + test {SADD, SCARD, SISMEMBER - large data} { + r flushdb + r write "*3\r\n\$4\r\nSADD\r\n\$5\r\nmyset\r\n" + assert_equal 1 [write_big_bulk $str_length "aaa"] + r write "*3\r\n\$4\r\nSADD\r\n\$5\r\nmyset\r\n" + assert_equal 1 [write_big_bulk $str_length "bbb"] + r write "*3\r\n\$4\r\nSADD\r\n\$5\r\nmyset\r\n" + assert_equal 0 [write_big_bulk $str_length "aaa"] + assert_encoding hashtable myset + set s0 [s used_memory] + assert {$s0 > [expr $str_length * 2]} + assert_equal 2 [r scard myset] + + r write "*3\r\n\$9\r\nSISMEMBER\r\n\$5\r\nmyset\r\n" + assert_equal 1 [write_big_bulk $str_length "aaa"] + r write "*3\r\n\$9\r\nSISMEMBER\r\n\$5\r\nmyset\r\n" + assert_equal 0 [write_big_bulk $str_length "ccc"] + r write "*3\r\n\$4\r\nSREM\r\n\$5\r\nmyset\r\n" + assert_equal 1 [write_big_bulk $str_length "bbb"] + assert_equal [read_big_bulk {r spop myset} yes "aaa"] $str_length + } {} {large-memory} +} ;# skip 32bit builds +} +} ;# run_solo diff --git a/tests/unit/type/stream-cgroups.tcl b/tests/unit/type/stream-cgroups.tcl new file mode 100644 index 0000000..1fcfe87 --- /dev/null +++ b/tests/unit/type/stream-cgroups.tcl @@ -0,0 +1,1131 @@ +start_server { + tags {"stream"} +} { + test {XGROUP CREATE: creation and duplicate group name detection} { + r DEL mystream + r XADD mystream * foo bar + r XGROUP CREATE mystream mygroup $ + catch {r XGROUP CREATE mystream mygroup $} err + set err + } {BUSYGROUP*} + + test {XGROUP CREATE: automatic stream creation fails without MKSTREAM} { + r DEL mystream + catch {r XGROUP CREATE mystream mygroup $} err + set err + } {ERR*} + + test {XGROUP CREATE: automatic stream creation works with MKSTREAM} { + r DEL mystream + r XGROUP CREATE mystream mygroup $ MKSTREAM + } {OK} + + test {XREADGROUP will return only new elements} { + r XADD mystream * a 1 + r XADD mystream * b 2 + # XREADGROUP should return only the new elements "a 1" "b 1" + # and not the element "foo bar" which was pre existing in the + # stream (see previous test) + set reply [ + r XREADGROUP GROUP mygroup consumer-1 STREAMS mystream ">" + ] + assert {[llength [lindex $reply 0 1]] == 2} + lindex $reply 0 1 0 1 + } {a 1} + + test {XREADGROUP can read the history of the elements we own} { + # Add a few more elements + r XADD mystream * c 3 + r XADD mystream * d 4 + # Read a few elements using a different consumer name + set reply [ + r XREADGROUP GROUP mygroup consumer-2 STREAMS mystream ">" + ] + assert {[llength [lindex $reply 0 1]] == 2} + assert {[lindex $reply 0 1 0 1] eq {c 3}} + + set r1 [r XREADGROUP GROUP mygroup consumer-1 COUNT 10 STREAMS mystream 0] + set r2 [r XREADGROUP GROUP mygroup consumer-2 COUNT 10 STREAMS mystream 0] + assert {[lindex $r1 0 1 0 1] eq {a 1}} + assert {[lindex $r2 0 1 0 1] eq {c 3}} + } + + test {XPENDING is able to return pending items} { + set pending [r XPENDING mystream mygroup - + 10] + assert {[llength $pending] == 4} + for {set j 0} {$j < 4} {incr j} { + set item [lindex $pending $j] + if {$j < 2} { + set owner consumer-1 + } else { + set owner consumer-2 + } + assert {[lindex $item 1] eq $owner} + assert {[lindex $item 1] eq $owner} + } + } + + test {XPENDING can return single consumer items} { + set pending [r XPENDING mystream mygroup - + 10 consumer-1] + assert {[llength $pending] == 2} + } + + test {XPENDING only group} { + set pending [r XPENDING mystream mygroup] + assert {[llength $pending] == 4} + } + + test {XPENDING with IDLE} { + after 20 + set pending [r XPENDING mystream mygroup IDLE 99999999 - + 10 consumer-1] + assert {[llength $pending] == 0} + set pending [r XPENDING mystream mygroup IDLE 1 - + 10 consumer-1] + assert {[llength $pending] == 2} + set pending [r XPENDING mystream mygroup IDLE 99999999 - + 10] + assert {[llength $pending] == 0} + set pending [r XPENDING mystream mygroup IDLE 1 - + 10] + assert {[llength $pending] == 4} + } + + test {XPENDING with exclusive range intervals works as expected} { + set pending [r XPENDING mystream mygroup - + 10] + assert {[llength $pending] == 4} + set startid [lindex [lindex $pending 0] 0] + set endid [lindex [lindex $pending 3] 0] + set expending [r XPENDING mystream mygroup ($startid ($endid 10] + assert {[llength $expending] == 2} + for {set j 0} {$j < 2} {incr j} { + set itemid [lindex [lindex $expending $j] 0] + assert {$itemid ne $startid} + assert {$itemid ne $endid} + } + } + + test {XACK is able to remove items from the consumer/group PEL} { + set pending [r XPENDING mystream mygroup - + 10 consumer-1] + set id1 [lindex $pending 0 0] + set id2 [lindex $pending 1 0] + assert {[r XACK mystream mygroup $id1] eq 1} + set pending [r XPENDING mystream mygroup - + 10 consumer-1] + assert {[llength $pending] == 1} + set id [lindex $pending 0 0] + assert {$id eq $id2} + set global_pel [r XPENDING mystream mygroup - + 10] + assert {[llength $global_pel] == 3} + } + + test {XACK can't remove the same item multiple times} { + assert {[r XACK mystream mygroup $id1] eq 0} + } + + test {XACK is able to accept multiple arguments} { + # One of the IDs was already removed, so it should ack + # just ID2. + assert {[r XACK mystream mygroup $id1 $id2] eq 1} + } + + test {XACK should fail if got at least one invalid ID} { + r del mystream + r xgroup create s g $ MKSTREAM + r xadd s * f1 v1 + set c [llength [lindex [r xreadgroup group g c streams s >] 0 1]] + assert {$c == 1} + set pending [r xpending s g - + 10 c] + set id1 [lindex $pending 0 0] + assert_error "*Invalid stream ID specified*" {r xack s g $id1 invalid-id} + assert {[r xack s g $id1] eq 1} + } + + test {PEL NACK reassignment after XGROUP SETID event} { + r del events + r xadd events * f1 v1 + r xadd events * f1 v1 + r xadd events * f1 v1 + r xadd events * f1 v1 + r xgroup create events g1 $ + r xadd events * f1 v1 + set c [llength [lindex [r xreadgroup group g1 c1 streams events >] 0 1]] + assert {$c == 1} + r xgroup setid events g1 - + set c [llength [lindex [r xreadgroup group g1 c2 streams events >] 0 1]] + assert {$c == 5} + } + + test {XREADGROUP will not report data on empty history. Bug #5577} { + r del events + r xadd events * a 1 + r xadd events * b 2 + r xadd events * c 3 + r xgroup create events mygroup 0 + + # Current local PEL should be empty + set res [r xpending events mygroup - + 10] + assert {[llength $res] == 0} + + # So XREADGROUP should read an empty history as well + set res [r xreadgroup group mygroup myconsumer count 3 streams events 0] + assert {[llength [lindex $res 0 1]] == 0} + + # We should fetch all the elements in the stream asking for > + set res [r xreadgroup group mygroup myconsumer count 3 streams events >] + assert {[llength [lindex $res 0 1]] == 3} + + # Now the history is populated with three not acked entries + set res [r xreadgroup group mygroup myconsumer count 3 streams events 0] + assert {[llength [lindex $res 0 1]] == 3} + } + + test {XREADGROUP history reporting of deleted entries. Bug #5570} { + r del mystream + r XGROUP CREATE mystream mygroup $ MKSTREAM + r XADD mystream 1 field1 A + r XREADGROUP GROUP mygroup myconsumer STREAMS mystream > + r XADD mystream MAXLEN 1 2 field1 B + r XREADGROUP GROUP mygroup myconsumer STREAMS mystream > + + # Now we have two pending entries, however one should be deleted + # and one should be ok (we should only see "B") + set res [r XREADGROUP GROUP mygroup myconsumer STREAMS mystream 0-1] + assert {[lindex $res 0 1 0] == {1-0 {}}} + assert {[lindex $res 0 1 1] == {2-0 {field1 B}}} + } + + test {Blocking XREADGROUP will not reply with an empty array} { + r del mystream + r XGROUP CREATE mystream mygroup $ MKSTREAM + r XADD mystream 666 f v + set res [r XREADGROUP GROUP mygroup Alice BLOCK 10 STREAMS mystream ">"] + assert {[lindex $res 0 1 0] == {666-0 {f v}}} + r XADD mystream 667 f2 v2 + r XDEL mystream 667 + set rd [redis_deferring_client] + $rd XREADGROUP GROUP mygroup Alice BLOCK 10 STREAMS mystream ">" + after 20 + assert {[$rd read] == {}} ;# before the fix, client didn't even block, but was served synchronously with {mystream {}} + $rd close + } + + test {Blocking XREADGROUP: key deleted} { + r DEL mystream + r XADD mystream 666 f v + r XGROUP CREATE mystream mygroup $ + set rd [redis_deferring_client] + $rd XREADGROUP GROUP mygroup Alice BLOCK 0 STREAMS mystream ">" + r DEL mystream + assert_error "*no longer exists*" {$rd read} + $rd close + } + + test {Blocking XREADGROUP: key type changed with SET} { + r DEL mystream + r XADD mystream 666 f v + r XGROUP CREATE mystream mygroup $ + set rd [redis_deferring_client] + $rd XREADGROUP GROUP mygroup Alice BLOCK 0 STREAMS mystream ">" + r SET mystream val1 + assert_error "*no longer exists*" {$rd read} + $rd close + } + + test {Blocking XREADGROUP: key type changed with transaction} { + r DEL mystream + r XADD mystream 666 f v + r XGROUP CREATE mystream mygroup $ + set rd [redis_deferring_client] + $rd XREADGROUP GROUP mygroup Alice BLOCK 0 STREAMS mystream ">" + r MULTI + r DEL mystream + r SADD mystream e1 + r EXEC + assert_error "*no longer exists*" {$rd read} + $rd close + } + + test {Blocking XREADGROUP: flushed DB} { + r DEL mystream + r XADD mystream 666 f v + r XGROUP CREATE mystream mygroup $ + set rd [redis_deferring_client] + $rd XREADGROUP GROUP mygroup Alice BLOCK 0 STREAMS mystream ">" + r FLUSHALL + assert_error "*no longer exists*" {$rd read} + $rd close + } + + test {Blocking XREADGROUP: swapped DB, key doesn't exist} { + r SELECT 4 + r FLUSHDB + r SELECT 9 + r DEL mystream + r XADD mystream 666 f v + r XGROUP CREATE mystream mygroup $ + set rd [redis_deferring_client] + $rd SELECT 9 + $rd read + $rd XREADGROUP GROUP mygroup Alice BLOCK 0 STREAMS mystream ">" + r SWAPDB 4 9 + assert_error "*no longer exists*" {$rd read} + $rd close + } {0} {external:skip} + + test {Blocking XREADGROUP: swapped DB, key is not a stream} { + r SELECT 4 + r FLUSHDB + r LPUSH mystream e1 + r SELECT 9 + r DEL mystream + r XADD mystream 666 f v + r XGROUP CREATE mystream mygroup $ + set rd [redis_deferring_client] + $rd SELECT 9 + $rd read + $rd XREADGROUP GROUP mygroup Alice BLOCK 0 STREAMS mystream ">" + r SWAPDB 4 9 + assert_error "*no longer exists*" {$rd read} + $rd close + } {0} {external:skip} + + test {Blocking XREAD: key deleted} { + r DEL mystream + r XADD mystream 666 f v + set rd [redis_deferring_client] + $rd XREAD BLOCK 0 STREAMS mystream "$" + r DEL mystream + + r XADD mystream 667 f v + set res [$rd read] + assert_equal [lindex $res 0 1 0] {667-0 {f v}} + $rd close + } + + test {Blocking XREAD: key type changed with SET} { + r DEL mystream + r XADD mystream 666 f v + set rd [redis_deferring_client] + $rd XREAD BLOCK 0 STREAMS mystream "$" + r SET mystream val1 + + r DEL mystream + r XADD mystream 667 f v + set res [$rd read] + assert_equal [lindex $res 0 1 0] {667-0 {f v}} + $rd close + } + + test {Blocking XREADGROUP for stream that ran dry (issue #5299)} { + set rd [redis_deferring_client] + + # Add a entry then delete it, now stream's last_id is 666. + r DEL mystream + r XGROUP CREATE mystream mygroup $ MKSTREAM + r XADD mystream 666 key value + r XDEL mystream 666 + + # Pass a special `>` ID but without new entry, released on timeout. + $rd XREADGROUP GROUP mygroup myconsumer BLOCK 10 STREAMS mystream > + assert_equal [$rd read] {} + + # Throw an error if the ID equal or smaller than the last_id. + assert_error ERR*equal*smaller* {r XADD mystream 665 key value} + assert_error ERR*equal*smaller* {r XADD mystream 666 key value} + + # Entered blocking state and then release because of the new entry. + $rd XREADGROUP GROUP mygroup myconsumer BLOCK 0 STREAMS mystream > + wait_for_blocked_clients_count 1 + r XADD mystream 667 key value + assert_equal [$rd read] {{mystream {{667-0 {key value}}}}} + + $rd close + } + + test "Blocking XREADGROUP will ignore BLOCK if ID is not >" { + set rd [redis_deferring_client] + + # Add a entry then delete it, now stream's last_id is 666. + r DEL mystream + r XGROUP CREATE mystream mygroup $ MKSTREAM + r XADD mystream 666 key value + r XDEL mystream 666 + + # Return right away instead of blocking, return the stream with an + # empty list instead of NIL if the ID specified is not the special `>` ID. + foreach id {0 600 666 700} { + $rd XREADGROUP GROUP mygroup myconsumer BLOCK 0 STREAMS mystream $id + assert_equal [$rd read] {{mystream {}}} + } + + # After adding a new entry, `XREADGROUP BLOCK` still return the stream + # with an empty list because the pending list is empty. + r XADD mystream 667 key value + foreach id {0 600 666 667 700} { + $rd XREADGROUP GROUP mygroup myconsumer BLOCK 0 STREAMS mystream $id + assert_equal [$rd read] {{mystream {}}} + } + + # After we read it once, the pending list is not empty at this time, + # pass any ID smaller than 667 will return one of the pending entry. + set res [r XREADGROUP GROUP mygroup myconsumer BLOCK 0 STREAMS mystream >] + assert_equal $res {{mystream {{667-0 {key value}}}}} + foreach id {0 600 666} { + $rd XREADGROUP GROUP mygroup myconsumer BLOCK 0 STREAMS mystream $id + assert_equal [$rd read] {{mystream {{667-0 {key value}}}}} + } + + # Pass ID equal or greater than 667 will return the stream with an empty list. + foreach id {667 700} { + $rd XREADGROUP GROUP mygroup myconsumer BLOCK 0 STREAMS mystream $id + assert_equal [$rd read] {{mystream {}}} + } + + # After we ACK the pending entry, return the stream with an empty list. + r XACK mystream mygroup 667 + foreach id {0 600 666 667 700} { + $rd XREADGROUP GROUP mygroup myconsumer BLOCK 0 STREAMS mystream $id + assert_equal [$rd read] {{mystream {}}} + } + + $rd close + } + + test {XGROUP DESTROY should unblock XREADGROUP with -NOGROUP} { + r config resetstat + r del mystream + r XGROUP CREATE mystream mygroup $ MKSTREAM + set rd [redis_deferring_client] + $rd XREADGROUP GROUP mygroup Alice BLOCK 0 STREAMS mystream ">" + wait_for_blocked_clients_count 1 + r XGROUP DESTROY mystream mygroup + assert_error "NOGROUP*" {$rd read} + $rd close + + # verify command stats, error stats and error counter work on failed blocked command + assert_match {*count=1*} [errorrstat NOGROUP r] + assert_match {*calls=1,*,rejected_calls=0,failed_calls=1} [cmdrstat xreadgroup r] + assert_equal [s total_error_replies] 1 + } + + test {RENAME can unblock XREADGROUP with data} { + r del mystream{t} + r XGROUP CREATE mystream{t} mygroup $ MKSTREAM + set rd [redis_deferring_client] + $rd XREADGROUP GROUP mygroup Alice BLOCK 0 STREAMS mystream{t} ">" + wait_for_blocked_clients_count 1 + r XGROUP CREATE mystream2{t} mygroup $ MKSTREAM + r XADD mystream2{t} 100 f1 v1 + r RENAME mystream2{t} mystream{t} + assert_equal "{mystream{t} {{100-0 {f1 v1}}}}" [$rd read] ;# mystream2{t} had mygroup before RENAME + $rd close + } + + test {RENAME can unblock XREADGROUP with -NOGROUP} { + r del mystream{t} + r XGROUP CREATE mystream{t} mygroup $ MKSTREAM + set rd [redis_deferring_client] + $rd XREADGROUP GROUP mygroup Alice BLOCK 0 STREAMS mystream{t} ">" + wait_for_blocked_clients_count 1 + r XADD mystream2{t} 100 f1 v1 + r RENAME mystream2{t} mystream{t} + assert_error "*NOGROUP*" {$rd read} ;# mystream2{t} didn't have mygroup before RENAME + $rd close + } + + test {XCLAIM can claim PEL items from another consumer} { + # Add 3 items into the stream, and create a consumer group + r del mystream + set id1 [r XADD mystream * a 1] + set id2 [r XADD mystream * b 2] + set id3 [r XADD mystream * c 3] + r XGROUP CREATE mystream mygroup 0 + + # Consumer 1 reads item 1 from the stream without acknowledgements. + # Consumer 2 then claims pending item 1 from the PEL of consumer 1 + set reply [ + r XREADGROUP GROUP mygroup consumer1 count 1 STREAMS mystream > + ] + assert {[llength [lindex $reply 0 1 0 1]] == 2} + assert {[lindex $reply 0 1 0 1] eq {a 1}} + + # make sure the entry is present in both the gorup, and the right consumer + assert {[llength [r XPENDING mystream mygroup - + 10]] == 1} + assert {[llength [r XPENDING mystream mygroup - + 10 consumer1]] == 1} + assert {[llength [r XPENDING mystream mygroup - + 10 consumer2]] == 0} + + after 200 + set reply [ + r XCLAIM mystream mygroup consumer2 10 $id1 + ] + assert {[llength [lindex $reply 0 1]] == 2} + assert {[lindex $reply 0 1] eq {a 1}} + + # make sure the entry is present in both the gorup, and the right consumer + assert {[llength [r XPENDING mystream mygroup - + 10]] == 1} + assert {[llength [r XPENDING mystream mygroup - + 10 consumer1]] == 0} + assert {[llength [r XPENDING mystream mygroup - + 10 consumer2]] == 1} + + # Consumer 1 reads another 2 items from stream + r XREADGROUP GROUP mygroup consumer1 count 2 STREAMS mystream > + after 200 + + # Delete item 2 from the stream. Now consumer 1 has PEL that contains + # only item 3. Try to use consumer 2 to claim the deleted item 2 + # from the PEL of consumer 1, this should be NOP + r XDEL mystream $id2 + set reply [ + r XCLAIM mystream mygroup consumer2 10 $id2 + ] + assert {[llength $reply] == 0} + + # Delete item 3 from the stream. Now consumer 1 has PEL that is empty. + # Try to use consumer 2 to claim the deleted item 3 from the PEL + # of consumer 1, this should be NOP + after 200 + r XDEL mystream $id3 + set reply [ + r XCLAIM mystream mygroup consumer2 10 $id3 + ] + assert {[llength $reply] == 0} + } + + test {XCLAIM without JUSTID increments delivery count} { + # Add 3 items into the stream, and create a consumer group + r del mystream + set id1 [r XADD mystream * a 1] + set id2 [r XADD mystream * b 2] + set id3 [r XADD mystream * c 3] + r XGROUP CREATE mystream mygroup 0 + + # Consumer 1 reads item 1 from the stream without acknowledgements. + # Consumer 2 then claims pending item 1 from the PEL of consumer 1 + set reply [ + r XREADGROUP GROUP mygroup consumer1 count 1 STREAMS mystream > + ] + assert {[llength [lindex $reply 0 1 0 1]] == 2} + assert {[lindex $reply 0 1 0 1] eq {a 1}} + after 200 + set reply [ + r XCLAIM mystream mygroup consumer2 10 $id1 + ] + assert {[llength [lindex $reply 0 1]] == 2} + assert {[lindex $reply 0 1] eq {a 1}} + + set reply [ + r XPENDING mystream mygroup - + 10 + ] + assert {[llength [lindex $reply 0]] == 4} + assert {[lindex $reply 0 3] == 2} + + # Consumer 3 then claims pending item 1 from the PEL of consumer 2 using JUSTID + after 200 + set reply [ + r XCLAIM mystream mygroup consumer3 10 $id1 JUSTID + ] + assert {[llength $reply] == 1} + assert {[lindex $reply 0] eq $id1} + + set reply [ + r XPENDING mystream mygroup - + 10 + ] + assert {[llength [lindex $reply 0]] == 4} + assert {[lindex $reply 0 3] == 2} + } + + test {XCLAIM same consumer} { + # Add 3 items into the stream, and create a consumer group + r del mystream + set id1 [r XADD mystream * a 1] + set id2 [r XADD mystream * b 2] + set id3 [r XADD mystream * c 3] + r XGROUP CREATE mystream mygroup 0 + + set reply [r XREADGROUP GROUP mygroup consumer1 count 1 STREAMS mystream >] + assert {[llength [lindex $reply 0 1 0 1]] == 2} + assert {[lindex $reply 0 1 0 1] eq {a 1}} + after 200 + # re-claim with the same consumer that already has it + assert {[llength [r XCLAIM mystream mygroup consumer1 10 $id1]] == 1} + + # make sure the entry is still in the PEL + set reply [r XPENDING mystream mygroup - + 10] + assert {[llength $reply] == 1} + assert {[lindex $reply 0 1] eq {consumer1}} + } + + test {XAUTOCLAIM can claim PEL items from another consumer} { + # Add 3 items into the stream, and create a consumer group + r del mystream + set id1 [r XADD mystream * a 1] + set id2 [r XADD mystream * b 2] + set id3 [r XADD mystream * c 3] + set id4 [r XADD mystream * d 4] + r XGROUP CREATE mystream mygroup 0 + + # Consumer 1 reads item 1 from the stream without acknowledgements. + # Consumer 2 then claims pending item 1 from the PEL of consumer 1 + set reply [r XREADGROUP GROUP mygroup consumer1 count 1 STREAMS mystream >] + assert_equal [llength [lindex $reply 0 1 0 1]] 2 + assert_equal [lindex $reply 0 1 0 1] {a 1} + after 200 + set reply [r XAUTOCLAIM mystream mygroup consumer2 10 - COUNT 1] + assert_equal [llength $reply] 3 + assert_equal [lindex $reply 0] "0-0" + assert_equal [llength [lindex $reply 1]] 1 + assert_equal [llength [lindex $reply 1 0]] 2 + assert_equal [llength [lindex $reply 1 0 1]] 2 + assert_equal [lindex $reply 1 0 1] {a 1} + + # Consumer 1 reads another 2 items from stream + r XREADGROUP GROUP mygroup consumer1 count 3 STREAMS mystream > + + # For min-idle-time + after 200 + + # Delete item 2 from the stream. Now consumer 1 has PEL that contains + # only item 3. Try to use consumer 2 to claim the deleted item 2 + # from the PEL of consumer 1, this should return nil + r XDEL mystream $id2 + + # id1 and id3 are self-claimed here but not id2 ('count' was set to 3) + # we make sure id2 is indeed skipped (the cursor points to id4) + set reply [r XAUTOCLAIM mystream mygroup consumer2 10 - COUNT 3] + + assert_equal [llength $reply] 3 + assert_equal [lindex $reply 0] $id4 + assert_equal [llength [lindex $reply 1]] 2 + assert_equal [llength [lindex $reply 1 0]] 2 + assert_equal [llength [lindex $reply 1 0 1]] 2 + assert_equal [lindex $reply 1 0 1] {a 1} + assert_equal [lindex $reply 1 1 1] {c 3} + assert_equal [llength [lindex $reply 2]] 1 + assert_equal [llength [lindex $reply 2 0]] 1 + + # Delete item 3 from the stream. Now consumer 1 has PEL that is empty. + # Try to use consumer 2 to claim the deleted item 3 from the PEL + # of consumer 1, this should return nil + after 200 + + r XDEL mystream $id4 + + # id1 and id3 are self-claimed here but not id2 and id4 ('count' is default 100) + set reply [r XAUTOCLAIM mystream mygroup consumer2 10 - JUSTID] + + # we also test the JUSTID modifier here. note that, when using JUSTID, + # deleted entries are returned in reply (consistent with XCLAIM). + + assert_equal [llength $reply] 3 + assert_equal [lindex $reply 0] {0-0} + assert_equal [llength [lindex $reply 1]] 2 + assert_equal [lindex $reply 1 0] $id1 + assert_equal [lindex $reply 1 1] $id3 + } + + test {XAUTOCLAIM as an iterator} { + # Add 5 items into the stream, and create a consumer group + r del mystream + set id1 [r XADD mystream * a 1] + set id2 [r XADD mystream * b 2] + set id3 [r XADD mystream * c 3] + set id4 [r XADD mystream * d 4] + set id5 [r XADD mystream * e 5] + r XGROUP CREATE mystream mygroup 0 + + # Read 5 messages into consumer1 + r XREADGROUP GROUP mygroup consumer1 count 90 STREAMS mystream > + + # For min-idle-time + after 200 + + # Claim 2 entries + set reply [r XAUTOCLAIM mystream mygroup consumer2 10 - COUNT 2] + assert_equal [llength $reply] 3 + set cursor [lindex $reply 0] + assert_equal $cursor $id3 + assert_equal [llength [lindex $reply 1]] 2 + assert_equal [llength [lindex $reply 1 0 1]] 2 + assert_equal [lindex $reply 1 0 1] {a 1} + + # Claim 2 more entries + set reply [r XAUTOCLAIM mystream mygroup consumer2 10 $cursor COUNT 2] + assert_equal [llength $reply] 3 + set cursor [lindex $reply 0] + assert_equal $cursor $id5 + assert_equal [llength [lindex $reply 1]] 2 + assert_equal [llength [lindex $reply 1 0 1]] 2 + assert_equal [lindex $reply 1 0 1] {c 3} + + # Claim last entry + set reply [r XAUTOCLAIM mystream mygroup consumer2 10 $cursor COUNT 1] + assert_equal [llength $reply] 3 + set cursor [lindex $reply 0] + assert_equal $cursor {0-0} + assert_equal [llength [lindex $reply 1]] 1 + assert_equal [llength [lindex $reply 1 0 1]] 2 + assert_equal [lindex $reply 1 0 1] {e 5} + } + + test {XAUTOCLAIM COUNT must be > 0} { + assert_error "ERR COUNT must be > 0" {r XAUTOCLAIM key group consumer 1 1 COUNT 0} + } + + test {XCLAIM with XDEL} { + r DEL x + r XADD x 1-0 f v + r XADD x 2-0 f v + r XADD x 3-0 f v + r XGROUP CREATE x grp 0 + assert_equal [r XREADGROUP GROUP grp Alice STREAMS x >] {{x {{1-0 {f v}} {2-0 {f v}} {3-0 {f v}}}}} + r XDEL x 2-0 + assert_equal [r XCLAIM x grp Bob 0 1-0 2-0 3-0] {{1-0 {f v}} {3-0 {f v}}} + assert_equal [r XPENDING x grp - + 10 Alice] {} + } + + test {XCLAIM with trimming} { + r DEL x + r config set stream-node-max-entries 2 + r XADD x 1-0 f v + r XADD x 2-0 f v + r XADD x 3-0 f v + r XGROUP CREATE x grp 0 + assert_equal [r XREADGROUP GROUP grp Alice STREAMS x >] {{x {{1-0 {f v}} {2-0 {f v}} {3-0 {f v}}}}} + r XTRIM x MAXLEN 1 + assert_equal [r XCLAIM x grp Bob 0 1-0 2-0 3-0] {{3-0 {f v}}} + assert_equal [r XPENDING x grp - + 10 Alice] {} + } + + test {XAUTOCLAIM with XDEL} { + r DEL x + r XADD x 1-0 f v + r XADD x 2-0 f v + r XADD x 3-0 f v + r XGROUP CREATE x grp 0 + assert_equal [r XREADGROUP GROUP grp Alice STREAMS x >] {{x {{1-0 {f v}} {2-0 {f v}} {3-0 {f v}}}}} + r XDEL x 2-0 + assert_equal [r XAUTOCLAIM x grp Bob 0 0-0] {0-0 {{1-0 {f v}} {3-0 {f v}}} 2-0} + assert_equal [r XPENDING x grp - + 10 Alice] {} + } + + test {XAUTOCLAIM with XDEL and count} { + r DEL x + r XADD x 1-0 f v + r XADD x 2-0 f v + r XADD x 3-0 f v + r XGROUP CREATE x grp 0 + assert_equal [r XREADGROUP GROUP grp Alice STREAMS x >] {{x {{1-0 {f v}} {2-0 {f v}} {3-0 {f v}}}}} + r XDEL x 1-0 + r XDEL x 2-0 + assert_equal [r XAUTOCLAIM x grp Bob 0 0-0 COUNT 1] {2-0 {} 1-0} + assert_equal [r XAUTOCLAIM x grp Bob 0 2-0 COUNT 1] {3-0 {} 2-0} + assert_equal [r XAUTOCLAIM x grp Bob 0 3-0 COUNT 1] {0-0 {{3-0 {f v}}} {}} + assert_equal [r XPENDING x grp - + 10 Alice] {} + } + + test {XAUTOCLAIM with out of range count} { + assert_error {ERR COUNT*} {r XAUTOCLAIM x grp Bob 0 3-0 COUNT 8070450532247928833} + } + + test {XCLAIM with trimming} { + r DEL x + r config set stream-node-max-entries 2 + r XADD x 1-0 f v + r XADD x 2-0 f v + r XADD x 3-0 f v + r XGROUP CREATE x grp 0 + assert_equal [r XREADGROUP GROUP grp Alice STREAMS x >] {{x {{1-0 {f v}} {2-0 {f v}} {3-0 {f v}}}}} + r XTRIM x MAXLEN 1 + assert_equal [r XAUTOCLAIM x grp Bob 0 0-0] {0-0 {{3-0 {f v}}} {1-0 2-0}} + assert_equal [r XPENDING x grp - + 10 Alice] {} + } + + test {XINFO FULL output} { + r del x + r XADD x 100 a 1 + r XADD x 101 b 1 + r XADD x 102 c 1 + r XADD x 103 e 1 + r XADD x 104 f 1 + r XGROUP CREATE x g1 0 + r XGROUP CREATE x g2 0 + r XREADGROUP GROUP g1 Alice COUNT 1 STREAMS x > + r XREADGROUP GROUP g1 Bob COUNT 1 STREAMS x > + r XREADGROUP GROUP g1 Bob NOACK COUNT 1 STREAMS x > + r XREADGROUP GROUP g2 Charlie COUNT 4 STREAMS x > + r XDEL x 103 + + set reply [r XINFO STREAM x FULL] + assert_equal [llength $reply] 18 + assert_equal [dict get $reply length] 4 + assert_equal [dict get $reply entries] "{100-0 {a 1}} {101-0 {b 1}} {102-0 {c 1}} {104-0 {f 1}}" + + # First consumer group + set group [lindex [dict get $reply groups] 0] + assert_equal [dict get $group name] "g1" + assert_equal [lindex [dict get $group pending] 0 0] "100-0" + set consumer [lindex [dict get $group consumers] 0] + assert_equal [dict get $consumer name] "Alice" + assert_equal [lindex [dict get $consumer pending] 0 0] "100-0" ;# first entry in first consumer's PEL + + # Second consumer group + set group [lindex [dict get $reply groups] 1] + assert_equal [dict get $group name] "g2" + set consumer [lindex [dict get $group consumers] 0] + assert_equal [dict get $consumer name] "Charlie" + assert_equal [lindex [dict get $consumer pending] 0 0] "100-0" ;# first entry in first consumer's PEL + assert_equal [lindex [dict get $consumer pending] 1 0] "101-0" ;# second entry in first consumer's PEL + + set reply [r XINFO STREAM x FULL COUNT 1] + assert_equal [llength $reply] 18 + assert_equal [dict get $reply length] 4 + assert_equal [dict get $reply entries] "{100-0 {a 1}}" + } + + test {XGROUP CREATECONSUMER: create consumer if does not exist} { + r del mystream + r XGROUP CREATE mystream mygroup $ MKSTREAM + r XADD mystream * f v + + set reply [r xinfo groups mystream] + set group_info [lindex $reply 0] + set n_consumers [lindex $group_info 3] + assert_equal $n_consumers 0 ;# consumers number in cg + + # create consumer using XREADGROUP + r XREADGROUP GROUP mygroup Alice COUNT 1 STREAMS mystream > + + set reply [r xinfo groups mystream] + set group_info [lindex $reply 0] + set n_consumers [lindex $group_info 3] + assert_equal $n_consumers 1 ;# consumers number in cg + + set reply [r xinfo consumers mystream mygroup] + set consumer_info [lindex $reply 0] + assert_equal [lindex $consumer_info 1] "Alice" ;# consumer name + + # create group using XGROUP CREATECONSUMER when Alice already exists + set created [r XGROUP CREATECONSUMER mystream mygroup Alice] + assert_equal $created 0 + + # create group using XGROUP CREATECONSUMER when Bob does not exist + set created [r XGROUP CREATECONSUMER mystream mygroup Bob] + assert_equal $created 1 + + set reply [r xinfo groups mystream] + set group_info [lindex $reply 0] + set n_consumers [lindex $group_info 3] + assert_equal $n_consumers 2 ;# consumers number in cg + + set reply [r xinfo consumers mystream mygroup] + set consumer_info [lindex $reply 0] + assert_equal [lindex $consumer_info 1] "Alice" ;# consumer name + set consumer_info [lindex $reply 1] + assert_equal [lindex $consumer_info 1] "Bob" ;# consumer name + } + + test {XGROUP CREATECONSUMER: group must exist} { + r del mystream + r XADD mystream * f v + assert_error "*NOGROUP*" {r XGROUP CREATECONSUMER mystream mygroup consumer} + } + + start_server {tags {"stream needs:debug"} overrides {appendonly yes aof-use-rdb-preamble no appendfsync always}} { + test {XREADGROUP with NOACK creates consumer} { + r del mystream + r XGROUP CREATE mystream mygroup $ MKSTREAM + r XADD mystream * f1 v1 + r XREADGROUP GROUP mygroup Alice NOACK STREAMS mystream ">" + set rd [redis_deferring_client] + $rd XREADGROUP GROUP mygroup Bob BLOCK 0 NOACK STREAMS mystream ">" + wait_for_blocked_clients_count 1 + r XADD mystream * f2 v2 + set grpinfo [r xinfo groups mystream] + + r debug loadaof + assert_equal [r xinfo groups mystream] $grpinfo + set reply [r xinfo consumers mystream mygroup] + set consumer_info [lindex $reply 0] + assert_equal [lindex $consumer_info 1] "Alice" ;# consumer name + set consumer_info [lindex $reply 1] + assert_equal [lindex $consumer_info 1] "Bob" ;# consumer name + $rd close + } + + test {Consumer without PEL is present in AOF after AOFRW} { + r del mystream + r XGROUP CREATE mystream mygroup $ MKSTREAM + r XADD mystream * f v + r XREADGROUP GROUP mygroup Alice NOACK STREAMS mystream ">" + set rd [redis_deferring_client] + $rd XREADGROUP GROUP mygroup Bob BLOCK 0 NOACK STREAMS mystream ">" + wait_for_blocked_clients_count 1 + r XGROUP CREATECONSUMER mystream mygroup Charlie + set grpinfo [lindex [r xinfo groups mystream] 0] + + r bgrewriteaof + waitForBgrewriteaof r + r debug loadaof + + set curr_grpinfo [lindex [r xinfo groups mystream] 0] + assert {$curr_grpinfo == $grpinfo} + set n_consumers [lindex $grpinfo 3] + + # Bob should be created only when there will be new data for this consumer + assert_equal $n_consumers 2 + set reply [r xinfo consumers mystream mygroup] + set consumer_info [lindex $reply 0] + assert_equal [lindex $consumer_info 1] "Alice" + set consumer_info [lindex $reply 1] + assert_equal [lindex $consumer_info 1] "Charlie" + $rd close + } + } + + test {Consumer group read counter and lag in empty streams} { + r DEL x + r XGROUP CREATE x g1 0 MKSTREAM + + set reply [r XINFO STREAM x FULL] + set group [lindex [dict get $reply groups] 0] + assert_equal [dict get $reply max-deleted-entry-id] "0-0" + assert_equal [dict get $reply entries-added] 0 + assert_equal [dict get $group entries-read] {} + assert_equal [dict get $group lag] 0 + + r XADD x 1-0 data a + r XDEL x 1-0 + + set reply [r XINFO STREAM x FULL] + set group [lindex [dict get $reply groups] 0] + assert_equal [dict get $reply max-deleted-entry-id] "1-0" + assert_equal [dict get $reply entries-added] 1 + assert_equal [dict get $group entries-read] {} + assert_equal [dict get $group lag] 0 + } + + test {Consumer group read counter and lag sanity} { + r DEL x + r XADD x 1-0 data a + r XADD x 2-0 data b + r XADD x 3-0 data c + r XADD x 4-0 data d + r XADD x 5-0 data e + r XGROUP CREATE x g1 0 + + set reply [r XINFO STREAM x FULL] + set group [lindex [dict get $reply groups] 0] + assert_equal [dict get $group entries-read] {} + assert_equal [dict get $group lag] 5 + + r XREADGROUP GROUP g1 c11 COUNT 1 STREAMS x > + set reply [r XINFO STREAM x FULL] + set group [lindex [dict get $reply groups] 0] + assert_equal [dict get $group entries-read] 1 + assert_equal [dict get $group lag] 4 + + r XREADGROUP GROUP g1 c12 COUNT 10 STREAMS x > + set reply [r XINFO STREAM x FULL] + set group [lindex [dict get $reply groups] 0] + assert_equal [dict get $group entries-read] 5 + assert_equal [dict get $group lag] 0 + + r XADD x 6-0 data f + set reply [r XINFO STREAM x FULL] + set group [lindex [dict get $reply groups] 0] + assert_equal [dict get $group entries-read] 5 + assert_equal [dict get $group lag] 1 + } + + test {Consumer group lag with XDELs} { + r DEL x + r XADD x 1-0 data a + r XADD x 2-0 data b + r XADD x 3-0 data c + r XADD x 4-0 data d + r XADD x 5-0 data e + r XDEL x 3-0 + r XGROUP CREATE x g1 0 + r XGROUP CREATE x g2 0 + + set reply [r XINFO STREAM x FULL] + set group [lindex [dict get $reply groups] 0] + assert_equal [dict get $group entries-read] {} + assert_equal [dict get $group lag] {} + + r XREADGROUP GROUP g1 c11 COUNT 1 STREAMS x > + set reply [r XINFO STREAM x FULL] + set group [lindex [dict get $reply groups] 0] + assert_equal [dict get $group entries-read] {} + assert_equal [dict get $group lag] {} + + r XREADGROUP GROUP g1 c11 COUNT 1 STREAMS x > + set reply [r XINFO STREAM x FULL] + set group [lindex [dict get $reply groups] 0] + assert_equal [dict get $group entries-read] {} + assert_equal [dict get $group lag] {} + + r XREADGROUP GROUP g1 c11 COUNT 1 STREAMS x > + set reply [r XINFO STREAM x FULL] + set group [lindex [dict get $reply groups] 0] + assert_equal [dict get $group entries-read] {} + assert_equal [dict get $group lag] {} + + r XREADGROUP GROUP g1 c11 COUNT 1 STREAMS x > + set reply [r XINFO STREAM x FULL] + set group [lindex [dict get $reply groups] 0] + assert_equal [dict get $group entries-read] 5 + assert_equal [dict get $group lag] 0 + + r XADD x 6-0 data f + set reply [r XINFO STREAM x FULL] + set group [lindex [dict get $reply groups] 0] + assert_equal [dict get $group entries-read] 5 + assert_equal [dict get $group lag] 1 + + r XTRIM x MINID = 3-0 + set reply [r XINFO STREAM x FULL] + set group [lindex [dict get $reply groups] 0] + assert_equal [dict get $group entries-read] 5 + assert_equal [dict get $group lag] 1 + set group [lindex [dict get $reply groups] 1] + assert_equal [dict get $group entries-read] {} + assert_equal [dict get $group lag] 3 + + r XTRIM x MINID = 5-0 + set reply [r XINFO STREAM x FULL] + set group [lindex [dict get $reply groups] 0] + assert_equal [dict get $group entries-read] 5 + assert_equal [dict get $group lag] 1 + set group [lindex [dict get $reply groups] 1] + assert_equal [dict get $group entries-read] {} + assert_equal [dict get $group lag] 2 + } + + test {Loading from legacy (Redis <= v6.2.x, rdb_ver < 10) persistence} { + # The payload was DUMPed from a v5 instance after: + # XADD x 1-0 data a + # XADD x 2-0 data b + # XADD x 3-0 data c + # XADD x 4-0 data d + # XADD x 5-0 data e + # XADD x 6-0 data f + # XDEL x 3-0 + # XGROUP CREATE x g1 0 + # XGROUP CREATE x g2 0 + # XREADGROUP GROUP g1 c11 COUNT 4 STREAMS x > + # XTRIM x MAXLEN = 2 + + r DEL x + r RESTORE x 0 "\x0F\x01\x10\x00\x00\x00\x00\x00\x00\x00\x01\x00\x00\x00\x00\x00\x00\x00\x00\xC3\x40\x4A\x40\x57\x16\x57\x00\x00\x00\x23\x00\x02\x01\x04\x01\x01\x01\x84\x64\x61\x74\x61\x05\x00\x01\x03\x01\x00\x20\x01\x03\x81\x61\x02\x04\x20\x0A\x00\x01\x40\x0A\x00\x62\x60\x0A\x00\x02\x40\x0A\x00\x63\x60\x0A\x40\x22\x01\x81\x64\x20\x0A\x40\x39\x20\x0A\x00\x65\x60\x0A\x00\x05\x40\x0A\x00\x66\x20\x0A\x00\xFF\x02\x06\x00\x02\x02\x67\x31\x05\x00\x04\x00\x00\x00\x00\x00\x00\x00\x01\x00\x00\x00\x00\x00\x00\x00\x00\x3E\xF7\x83\x43\x7A\x01\x00\x00\x01\x00\x00\x00\x00\x00\x00\x00\x02\x00\x00\x00\x00\x00\x00\x00\x00\x3E\xF7\x83\x43\x7A\x01\x00\x00\x01\x00\x00\x00\x00\x00\x00\x00\x04\x00\x00\x00\x00\x00\x00\x00\x00\x3E\xF7\x83\x43\x7A\x01\x00\x00\x01\x00\x00\x00\x00\x00\x00\x00\x05\x00\x00\x00\x00\x00\x00\x00\x00\x3E\xF7\x83\x43\x7A\x01\x00\x00\x01\x01\x03\x63\x31\x31\x3E\xF7\x83\x43\x7A\x01\x00\x00\x04\x00\x00\x00\x00\x00\x00\x00\x01\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x02\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x04\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x05\x00\x00\x00\x00\x00\x00\x00\x00\x02\x67\x32\x00\x00\x00\x00\x09\x00\x3D\x52\xEF\x68\x67\x52\x1D\xFA" + + set reply [r XINFO STREAM x FULL] + assert_equal [dict get $reply max-deleted-entry-id] "0-0" + assert_equal [dict get $reply entries-added] 2 + set group [lindex [dict get $reply groups] 0] + assert_equal [dict get $group entries-read] 1 + assert_equal [dict get $group lag] 1 + set group [lindex [dict get $reply groups] 1] + assert_equal [dict get $group entries-read] 0 + assert_equal [dict get $group lag] 2 + } + + start_server {tags {"external:skip"}} { + set master [srv -1 client] + set master_host [srv -1 host] + set master_port [srv -1 port] + set slave [srv 0 client] + + foreach noack {0 1} { + test "Consumer group last ID propagation to slave (NOACK=$noack)" { + $slave slaveof $master_host $master_port + wait_for_condition 50 100 { + [s 0 master_link_status] eq {up} + } else { + fail "Replication not started." + } + + $master del stream + $master xadd stream * a 1 + $master xadd stream * a 2 + $master xadd stream * a 3 + $master xgroup create stream mygroup 0 + + # Consume the first two items on the master + for {set j 0} {$j < 2} {incr j} { + if {$noack} { + set item [$master xreadgroup group mygroup \ + myconsumer COUNT 1 NOACK STREAMS stream >] + } else { + set item [$master xreadgroup group mygroup \ + myconsumer COUNT 1 STREAMS stream >] + } + set id [lindex $item 0 1 0 0] + if {$noack == 0} { + assert {[$master xack stream mygroup $id] eq "1"} + } + } + + wait_for_ofs_sync $master $slave + + # Turn slave into master + $slave slaveof no one + + set item [$slave xreadgroup group mygroup myconsumer \ + COUNT 1 STREAMS stream >] + + # The consumed entry should be the third + set myentry [lindex $item 0 1 0 1] + assert {$myentry eq {a 3}} + } + } + } + + start_server {tags {"external:skip"}} { + set master [srv -1 client] + set master_host [srv -1 host] + set master_port [srv -1 port] + set replica [srv 0 client] + + foreach autoclaim {0 1} { + test "Replication tests of XCLAIM with deleted entries (autclaim=$autoclaim)" { + $replica replicaof $master_host $master_port + wait_for_condition 50 100 { + [s 0 master_link_status] eq {up} + } else { + fail "Replication not started." + } + + $master DEL x + $master XADD x 1-0 f v + $master XADD x 2-0 f v + $master XADD x 3-0 f v + $master XADD x 4-0 f v + $master XADD x 5-0 f v + $master XGROUP CREATE x grp 0 + assert_equal [$master XREADGROUP GROUP grp Alice STREAMS x >] {{x {{1-0 {f v}} {2-0 {f v}} {3-0 {f v}} {4-0 {f v}} {5-0 {f v}}}}} + wait_for_ofs_sync $master $replica + assert_equal [llength [$replica XPENDING x grp - + 10 Alice]] 5 + $master XDEL x 2-0 + $master XDEL x 4-0 + if {$autoclaim} { + assert_equal [$master XAUTOCLAIM x grp Bob 0 0-0] {0-0 {{1-0 {f v}} {3-0 {f v}} {5-0 {f v}}} {2-0 4-0}} + wait_for_ofs_sync $master $replica + assert_equal [llength [$replica XPENDING x grp - + 10 Alice]] 0 + } else { + assert_equal [$master XCLAIM x grp Bob 0 1-0 2-0 3-0 4-0] {{1-0 {f v}} {3-0 {f v}}} + wait_for_ofs_sync $master $replica + assert_equal [llength [$replica XPENDING x grp - + 10 Alice]] 1 + } + } + } + } + + start_server {tags {"stream needs:debug"} overrides {appendonly yes aof-use-rdb-preamble no}} { + test {Empty stream with no lastid can be rewrite into AOF correctly} { + r XGROUP CREATE mystream group-name $ MKSTREAM + assert {[dict get [r xinfo stream mystream] length] == 0} + set grpinfo [r xinfo groups mystream] + r bgrewriteaof + waitForBgrewriteaof r + r debug loadaof + assert {[dict get [r xinfo stream mystream] length] == 0} + assert_equal [r xinfo groups mystream] $grpinfo + } + } +} diff --git a/tests/unit/type/stream.tcl b/tests/unit/type/stream.tcl new file mode 100644 index 0000000..83d29bb --- /dev/null +++ b/tests/unit/type/stream.tcl @@ -0,0 +1,907 @@ +# return value is like strcmp() and similar. +proc streamCompareID {a b} { + if {$a eq $b} {return 0} + lassign [split $a -] a_ms a_seq + lassign [split $b -] b_ms b_seq + if {$a_ms > $b_ms} {return 1} + if {$a_ms < $b_ms} {return -1} + # Same ms case, compare seq. + if {$a_seq > $b_seq} {return 1} + if {$a_seq < $b_seq} {return -1} +} + +# return the ID immediately greater than the specified one. +# Note that this function does not care to handle 'seq' overflow +# since it's a 64 bit value. +proc streamNextID {id} { + lassign [split $id -] ms seq + incr seq + join [list $ms $seq] - +} + +# Generate a random stream entry ID with the ms part between min and max +# and a low sequence number (0 - 999 range), in order to stress test +# XRANGE against a Tcl implementation implementing the same concept +# with Tcl-only code in a linear array. +proc streamRandomID {min_id max_id} { + lassign [split $min_id -] min_ms min_seq + lassign [split $max_id -] max_ms max_seq + set delta [expr {$max_ms-$min_ms+1}] + set ms [expr {$min_ms+[randomInt $delta]}] + set seq [randomInt 1000] + return $ms-$seq +} + +# Tcl-side implementation of XRANGE to perform fuzz testing in the Redis +# XRANGE implementation. +proc streamSimulateXRANGE {items start end} { + set res {} + foreach i $items { + set this_id [lindex $i 0] + if {[streamCompareID $this_id $start] >= 0} { + if {[streamCompareID $this_id $end] <= 0} { + lappend res $i + } + } + } + return $res +} + +set content {} ;# Will be populated with Tcl side copy of the stream content. + +start_server { + tags {"stream"} +} { + test "XADD wrong number of args" { + assert_error {*wrong number of arguments for 'xadd' command} {r XADD mystream} + assert_error {*wrong number of arguments for 'xadd' command} {r XADD mystream *} + assert_error {*wrong number of arguments for 'xadd' command} {r XADD mystream * field} + } + + test {XADD can add entries into a stream that XRANGE can fetch} { + r XADD mystream * item 1 value a + r XADD mystream * item 2 value b + assert_equal 2 [r XLEN mystream] + set items [r XRANGE mystream - +] + assert_equal [lindex $items 0 1] {item 1 value a} + assert_equal [lindex $items 1 1] {item 2 value b} + } + + test {XADD IDs are incremental} { + set id1 [r XADD mystream * item 1 value a] + set id2 [r XADD mystream * item 2 value b] + set id3 [r XADD mystream * item 3 value c] + assert {[streamCompareID $id1 $id2] == -1} + assert {[streamCompareID $id2 $id3] == -1} + } + + test {XADD IDs are incremental when ms is the same as well} { + r multi + r XADD mystream * item 1 value a + r XADD mystream * item 2 value b + r XADD mystream * item 3 value c + lassign [r exec] id1 id2 id3 + assert {[streamCompareID $id1 $id2] == -1} + assert {[streamCompareID $id2 $id3] == -1} + } + + test {XADD IDs correctly report an error when overflowing} { + r DEL mystream + r xadd mystream 18446744073709551615-18446744073709551615 a b + assert_error ERR* {r xadd mystream * c d} + } + + test {XADD auto-generated sequence is incremented for last ID} { + r DEL mystream + set id1 [r XADD mystream 123-456 item 1 value a] + set id2 [r XADD mystream 123-* item 2 value b] + lassign [split $id2 -] _ seq + assert {$seq == 457} + assert {[streamCompareID $id1 $id2] == -1} + } + + test {XADD auto-generated sequence is zero for future timestamp ID} { + r DEL mystream + set id1 [r XADD mystream 123-456 item 1 value a] + set id2 [r XADD mystream 789-* item 2 value b] + lassign [split $id2 -] _ seq + assert {$seq == 0} + assert {[streamCompareID $id1 $id2] == -1} + } + + test {XADD auto-generated sequence can't be smaller than last ID} { + r DEL mystream + r XADD mystream 123-456 item 1 value a + assert_error ERR* {r XADD mystream 42-* item 2 value b} + } + + test {XADD auto-generated sequence can't overflow} { + r DEL mystream + r xadd mystream 1-18446744073709551615 a b + assert_error ERR* {r xadd mystream 1-* c d} + } + + test {XADD 0-* should succeed} { + r DEL mystream + set id [r xadd mystream 0-* a b] + lassign [split $id -] _ seq + assert {$seq == 1} + } + + test {XADD with MAXLEN option} { + r DEL mystream + for {set j 0} {$j < 1000} {incr j} { + if {rand() < 0.9} { + r XADD mystream MAXLEN 5 * xitem $j + } else { + r XADD mystream MAXLEN 5 * yitem $j + } + } + assert {[r xlen mystream] == 5} + set res [r xrange mystream - +] + set expected 995 + foreach r $res { + assert {[lindex $r 1 1] == $expected} + incr expected + } + } + + test {XADD with MAXLEN option and the '=' argument} { + r DEL mystream + for {set j 0} {$j < 1000} {incr j} { + if {rand() < 0.9} { + r XADD mystream MAXLEN = 5 * xitem $j + } else { + r XADD mystream MAXLEN = 5 * yitem $j + } + } + assert {[r XLEN mystream] == 5} + } + + test {XADD with MAXLEN option and the '~' argument} { + r DEL mystream + r config set stream-node-max-entries 100 + for {set j 0} {$j < 1000} {incr j} { + if {rand() < 0.9} { + r XADD mystream MAXLEN ~ 555 * xitem $j + } else { + r XADD mystream MAXLEN ~ 555 * yitem $j + } + } + assert {[r XLEN mystream] == 600} + } + + test {XADD with NOMKSTREAM option} { + r DEL mystream + assert_equal "" [r XADD mystream NOMKSTREAM * item 1 value a] + assert_equal 0 [r EXISTS mystream] + r XADD mystream * item 1 value a + r XADD mystream NOMKSTREAM * item 2 value b + assert_equal 2 [r XLEN mystream] + set items [r XRANGE mystream - +] + assert_equal [lindex $items 0 1] {item 1 value a} + assert_equal [lindex $items 1 1] {item 2 value b} + } + + test {XADD with MINID option} { + r DEL mystream + for {set j 1} {$j < 1001} {incr j} { + set minid 1000 + if {$j >= 5} { + set minid [expr {$j-5}] + } + if {rand() < 0.9} { + r XADD mystream MINID $minid $j xitem $j + } else { + r XADD mystream MINID $minid $j yitem $j + } + } + assert {[r xlen mystream] == 6} + set res [r xrange mystream - +] + set expected 995 + foreach r $res { + assert {[lindex $r 1 1] == $expected} + incr expected + } + } + + test {XTRIM with MINID option} { + r DEL mystream + r XADD mystream 1-0 f v + r XADD mystream 2-0 f v + r XADD mystream 3-0 f v + r XADD mystream 4-0 f v + r XADD mystream 5-0 f v + r XTRIM mystream MINID = 3-0 + assert_equal [r XRANGE mystream - +] {{3-0 {f v}} {4-0 {f v}} {5-0 {f v}}} + } + + test {XTRIM with MINID option, big delta from master record} { + r DEL mystream + r XADD mystream 1-0 f v + r XADD mystream 1641544570597-0 f v + r XADD mystream 1641544570597-1 f v + r XTRIM mystream MINID 1641544570597-0 + assert_equal [r XRANGE mystream - +] {{1641544570597-0 {f v}} {1641544570597-1 {f v}}} + } + + proc insert_into_stream_key {key {count 10000}} { + r multi + for {set j 0} {$j < $count} {incr j} { + # From time to time insert a field with a different set + # of fields in order to stress the stream compression code. + if {rand() < 0.9} { + r XADD $key * item $j + } else { + r XADD $key * item $j otherfield foo + } + } + r exec + } + + test {XADD mass insertion and XLEN} { + r DEL mystream + insert_into_stream_key mystream + + set items [r XRANGE mystream - +] + for {set j 0} {$j < 10000} {incr j} { + assert {[lrange [lindex $items $j 1] 0 1] eq [list item $j]} + } + assert {[r xlen mystream] == $j} + } + + test {XADD with ID 0-0} { + r DEL otherstream + catch {r XADD otherstream 0-0 k v} err + assert {[r EXISTS otherstream] == 0} + } + + test {XADD with LIMIT delete entries no more than limit} { + r del yourstream + for {set j 0} {$j < 3} {incr j} { + r XADD yourstream * xitem v + } + r XADD yourstream MAXLEN ~ 0 limit 1 * xitem v + assert {[r XLEN yourstream] == 4} + } + + test {XRANGE COUNT works as expected} { + assert {[llength [r xrange mystream - + COUNT 10]] == 10} + } + + test {XREVRANGE COUNT works as expected} { + assert {[llength [r xrevrange mystream + - COUNT 10]] == 10} + } + + test {XRANGE can be used to iterate the whole stream} { + set last_id "-" + set j 0 + while 1 { + set elements [r xrange mystream $last_id + COUNT 100] + if {[llength $elements] == 0} break + foreach e $elements { + assert {[lrange [lindex $e 1] 0 1] eq [list item $j]} + incr j; + } + set last_id [streamNextID [lindex $elements end 0]] + } + assert {$j == 10000} + } + + test {XREVRANGE returns the reverse of XRANGE} { + assert {[r xrange mystream - +] == [lreverse [r xrevrange mystream + -]]} + } + + test {XRANGE exclusive ranges} { + set ids {0-1 0-18446744073709551615 1-0 42-0 42-42 + 18446744073709551615-18446744073709551614 + 18446744073709551615-18446744073709551615} + set total [llength $ids] + r multi + r DEL vipstream + foreach id $ids { + r XADD vipstream $id foo bar + } + r exec + assert {[llength [r xrange vipstream - +]] == $total} + assert {[llength [r xrange vipstream ([lindex $ids 0] +]] == $total-1} + assert {[llength [r xrange vipstream - ([lindex $ids $total-1]]] == $total-1} + assert {[llength [r xrange vipstream (0-1 (1-0]] == 1} + assert {[llength [r xrange vipstream (1-0 (42-42]] == 1} + catch {r xrange vipstream (- +} e + assert_match {ERR*} $e + catch {r xrange vipstream - (+} e + assert_match {ERR*} $e + catch {r xrange vipstream (18446744073709551615-18446744073709551615 +} e + assert_match {ERR*} $e + catch {r xrange vipstream - (0-0} e + assert_match {ERR*} $e + } + + test {XREAD with non empty stream} { + set res [r XREAD COUNT 1 STREAMS mystream 0-0] + assert {[lrange [lindex $res 0 1 0 1] 0 1] eq {item 0}} + } + + test {Non blocking XREAD with empty streams} { + set res [r XREAD STREAMS s1{t} s2{t} 0-0 0-0] + assert {$res eq {}} + } + + test {XREAD with non empty second stream} { + insert_into_stream_key mystream{t} + set res [r XREAD COUNT 1 STREAMS nostream{t} mystream{t} 0-0 0-0] + assert {[lindex $res 0 0] eq {mystream{t}}} + assert {[lrange [lindex $res 0 1 0 1] 0 1] eq {item 0}} + } + + test {Blocking XREAD waiting new data} { + r XADD s2{t} * old abcd1234 + set rd [redis_deferring_client] + $rd XREAD BLOCK 20000 STREAMS s1{t} s2{t} s3{t} $ $ $ + wait_for_blocked_client + r XADD s2{t} * new abcd1234 + set res [$rd read] + assert {[lindex $res 0 0] eq {s2{t}}} + assert {[lindex $res 0 1 0 1] eq {new abcd1234}} + $rd close + } + + test {Blocking XREAD waiting old data} { + set rd [redis_deferring_client] + $rd XREAD BLOCK 20000 STREAMS s1{t} s2{t} s3{t} $ 0-0 $ + r XADD s2{t} * foo abcd1234 + set res [$rd read] + assert {[lindex $res 0 0] eq {s2{t}}} + assert {[lindex $res 0 1 0 1] eq {old abcd1234}} + $rd close + } + + test {Blocking XREAD will not reply with an empty array} { + r del s1 + r XADD s1 666 f v + r XADD s1 667 f2 v2 + r XDEL s1 667 + set rd [redis_deferring_client] + $rd XREAD BLOCK 10 STREAMS s1 666 + after 20 + assert {[$rd read] == {}} ;# before the fix, client didn't even block, but was served synchronously with {s1 {}} + $rd close + } + + test "Blocking XREAD for stream that ran dry (issue #5299)" { + set rd [redis_deferring_client] + + # Add a entry then delete it, now stream's last_id is 666. + r DEL mystream + r XADD mystream 666 key value + r XDEL mystream 666 + + # Pass a ID smaller than stream's last_id, released on timeout. + $rd XREAD BLOCK 10 STREAMS mystream 665 + assert_equal [$rd read] {} + + # Throw an error if the ID equal or smaller than the last_id. + assert_error ERR*equal*smaller* {r XADD mystream 665 key value} + assert_error ERR*equal*smaller* {r XADD mystream 666 key value} + + # Entered blocking state and then release because of the new entry. + $rd XREAD BLOCK 0 STREAMS mystream 665 + wait_for_blocked_clients_count 1 + r XADD mystream 667 key value + assert_equal [$rd read] {{mystream {{667-0 {key value}}}}} + + $rd close + } + + test "XREAD: XADD + DEL should not awake client" { + set rd [redis_deferring_client] + r del s1 + $rd XREAD BLOCK 20000 STREAMS s1 $ + wait_for_blocked_clients_count 1 + r multi + r XADD s1 * old abcd1234 + r DEL s1 + r exec + r XADD s1 * new abcd1234 + set res [$rd read] + assert {[lindex $res 0 0] eq {s1}} + assert {[lindex $res 0 1 0 1] eq {new abcd1234}} + $rd close + } + + test "XREAD: XADD + DEL + LPUSH should not awake client" { + set rd [redis_deferring_client] + r del s1 + $rd XREAD BLOCK 20000 STREAMS s1 $ + wait_for_blocked_clients_count 1 + r multi + r XADD s1 * old abcd1234 + r DEL s1 + r LPUSH s1 foo bar + r exec + r DEL s1 + r XADD s1 * new abcd1234 + set res [$rd read] + assert {[lindex $res 0 0] eq {s1}} + assert {[lindex $res 0 1 0 1] eq {new abcd1234}} + $rd close + } + + test {XREAD with same stream name multiple times should work} { + r XADD s2 * old abcd1234 + set rd [redis_deferring_client] + $rd XREAD BLOCK 20000 STREAMS s2 s2 s2 $ $ $ + wait_for_blocked_clients_count 1 + r XADD s2 * new abcd1234 + set res [$rd read] + assert {[lindex $res 0 0] eq {s2}} + assert {[lindex $res 0 1 0 1] eq {new abcd1234}} + $rd close + } + + test {XREAD + multiple XADD inside transaction} { + r XADD s2 * old abcd1234 + set rd [redis_deferring_client] + $rd XREAD BLOCK 20000 STREAMS s2 s2 s2 $ $ $ + wait_for_blocked_clients_count 1 + r MULTI + r XADD s2 * field one + r XADD s2 * field two + r XADD s2 * field three + r EXEC + set res [$rd read] + assert {[lindex $res 0 0] eq {s2}} + assert {[lindex $res 0 1 0 1] eq {field one}} + assert {[lindex $res 0 1 1 1] eq {field two}} + $rd close + } + + test {XDEL basic test} { + r del somestream + r xadd somestream * foo value0 + set id [r xadd somestream * foo value1] + r xadd somestream * foo value2 + r xdel somestream $id + assert {[r xlen somestream] == 2} + set result [r xrange somestream - +] + assert {[lindex $result 0 1 1] eq {value0}} + assert {[lindex $result 1 1 1] eq {value2}} + } + + # Here the idea is to check the consistency of the stream data structure + # as we remove all the elements down to zero elements. + test {XDEL fuzz test} { + r del somestream + set ids {} + set x 0; # Length of the stream + while 1 { + lappend ids [r xadd somestream * item $x] + incr x + # Add enough elements to have a few radix tree nodes inside the stream. + if {[dict get [r xinfo stream somestream] radix-tree-keys] > 20} break + } + + # Now remove all the elements till we reach an empty stream + # and after every deletion, check that the stream is sane enough + # to report the right number of elements with XRANGE: this will also + # force accessing the whole data structure to check sanity. + assert {[r xlen somestream] == $x} + + # We want to remove elements in random order to really test the + # implementation in a better way. + set ids [lshuffle $ids] + foreach id $ids { + assert {[r xdel somestream $id] == 1} + incr x -1 + assert {[r xlen somestream] == $x} + # The test would be too slow calling XRANGE for every iteration. + # Do it every 100 removal. + if {$x % 100 == 0} { + set res [r xrange somestream - +] + assert {[llength $res] == $x} + } + } + } + + test {XRANGE fuzzing} { + set items [r XRANGE mystream{t} - +] + set low_id [lindex $items 0 0] + set high_id [lindex $items end 0] + for {set j 0} {$j < 100} {incr j} { + set start [streamRandomID $low_id $high_id] + set end [streamRandomID $low_id $high_id] + set range [r xrange mystream{t} $start $end] + set tcl_range [streamSimulateXRANGE $items $start $end] + if {$range ne $tcl_range} { + puts "*** WARNING *** - XRANGE fuzzing mismatch: $start - $end" + puts "---" + puts "XRANGE: '$range'" + puts "---" + puts "TCL: '$tcl_range'" + puts "---" + fail "XRANGE fuzzing failed, check logs for details" + } + } + } + + test {XREVRANGE regression test for issue #5006} { + # Add non compressed entries + r xadd teststream 1234567891230 key1 value1 + r xadd teststream 1234567891240 key2 value2 + r xadd teststream 1234567891250 key3 value3 + + # Add SAMEFIELD compressed entries + r xadd teststream2 1234567891230 key1 value1 + r xadd teststream2 1234567891240 key1 value2 + r xadd teststream2 1234567891250 key1 value3 + + assert_equal [r xrevrange teststream 1234567891245 -] {{1234567891240-0 {key2 value2}} {1234567891230-0 {key1 value1}}} + + assert_equal [r xrevrange teststream2 1234567891245 -] {{1234567891240-0 {key1 value2}} {1234567891230-0 {key1 value1}}} + } + + test {XREAD streamID edge (no-blocking)} { + r del x + r XADD x 1-1 f v + r XADD x 1-18446744073709551615 f v + r XADD x 2-1 f v + set res [r XREAD BLOCK 0 STREAMS x 1-18446744073709551615] + assert {[lindex $res 0 1 0] == {2-1 {f v}}} + } + + test {XREAD streamID edge (blocking)} { + r del x + set rd [redis_deferring_client] + $rd XREAD BLOCK 0 STREAMS x 1-18446744073709551615 + wait_for_blocked_clients_count 1 + r XADD x 1-1 f v + r XADD x 1-18446744073709551615 f v + r XADD x 2-1 f v + set res [$rd read] + assert {[lindex $res 0 1 0] == {2-1 {f v}}} + $rd close + } + + test {XADD streamID edge} { + r del x + r XADD x 2577343934890-18446744073709551615 f v ;# we need the timestamp to be in the future + r XADD x * f2 v2 + assert_equal [r XRANGE x - +] {{2577343934890-18446744073709551615 {f v}} {2577343934891-0 {f2 v2}}} + } + + test {XTRIM with MAXLEN option basic test} { + r DEL mystream + for {set j 0} {$j < 1000} {incr j} { + if {rand() < 0.9} { + r XADD mystream * xitem $j + } else { + r XADD mystream * yitem $j + } + } + r XTRIM mystream MAXLEN 666 + assert {[r XLEN mystream] == 666} + r XTRIM mystream MAXLEN = 555 + assert {[r XLEN mystream] == 555} + r XTRIM mystream MAXLEN ~ 444 + assert {[r XLEN mystream] == 500} + r XTRIM mystream MAXLEN ~ 400 + assert {[r XLEN mystream] == 400} + } + + test {XADD with LIMIT consecutive calls} { + r del mystream + r config set stream-node-max-entries 10 + for {set j 0} {$j < 100} {incr j} { + r XADD mystream * xitem v + } + r XADD mystream MAXLEN ~ 55 LIMIT 30 * xitem v + assert {[r xlen mystream] == 71} + r XADD mystream MAXLEN ~ 55 LIMIT 30 * xitem v + assert {[r xlen mystream] == 62} + r config set stream-node-max-entries 100 + } + + test {XTRIM with ~ is limited} { + r del mystream + r config set stream-node-max-entries 1 + for {set j 0} {$j < 102} {incr j} { + r XADD mystream * xitem v + } + r XTRIM mystream MAXLEN ~ 1 + assert {[r xlen mystream] == 2} + r config set stream-node-max-entries 100 + } + + test {XTRIM without ~ is not limited} { + r del mystream + r config set stream-node-max-entries 1 + for {set j 0} {$j < 102} {incr j} { + r XADD mystream * xitem v + } + r XTRIM mystream MAXLEN 1 + assert {[r xlen mystream] == 1} + r config set stream-node-max-entries 100 + } + + test {XTRIM without ~ and with LIMIT} { + r del mystream + r config set stream-node-max-entries 1 + for {set j 0} {$j < 102} {incr j} { + r XADD mystream * xitem v + } + assert_error ERR* {r XTRIM mystream MAXLEN 1 LIMIT 30} + } + + test {XTRIM with LIMIT delete entries no more than limit} { + r del mystream + r config set stream-node-max-entries 2 + for {set j 0} {$j < 3} {incr j} { + r XADD mystream * xitem v + } + assert {[r XTRIM mystream MAXLEN ~ 0 LIMIT 1] == 0} + assert {[r XTRIM mystream MAXLEN ~ 0 LIMIT 2] == 2} + } +} + +start_server {tags {"stream needs:debug"} overrides {appendonly yes}} { + test {XADD with MAXLEN > xlen can propagate correctly} { + for {set j 0} {$j < 100} {incr j} { + r XADD mystream * xitem v + } + r XADD mystream MAXLEN 200 * xitem v + incr j + assert {[r xlen mystream] == $j} + r debug loadaof + r XADD mystream * xitem v + incr j + assert {[r xlen mystream] == $j} + } +} + +start_server {tags {"stream needs:debug"} overrides {appendonly yes}} { + test {XADD with MINID > lastid can propagate correctly} { + for {set j 0} {$j < 100} {incr j} { + set id [expr {$j+1}] + r XADD mystream $id xitem v + } + r XADD mystream MINID 1 * xitem v + incr j + assert {[r xlen mystream] == $j} + r debug loadaof + r XADD mystream * xitem v + incr j + assert {[r xlen mystream] == $j} + } +} + +start_server {tags {"stream needs:debug"} overrides {appendonly yes stream-node-max-entries 100}} { + test {XADD with ~ MAXLEN can propagate correctly} { + for {set j 0} {$j < 100} {incr j} { + r XADD mystream * xitem v + } + r XADD mystream MAXLEN ~ $j * xitem v + incr j + assert {[r xlen mystream] == $j} + r config set stream-node-max-entries 1 + r debug loadaof + r XADD mystream * xitem v + incr j + assert {[r xlen mystream] == $j} + } +} + +start_server {tags {"stream needs:debug"} overrides {appendonly yes stream-node-max-entries 10}} { + test {XADD with ~ MAXLEN and LIMIT can propagate correctly} { + for {set j 0} {$j < 100} {incr j} { + r XADD mystream * xitem v + } + r XADD mystream MAXLEN ~ 55 LIMIT 30 * xitem v + assert {[r xlen mystream] == 71} + r config set stream-node-max-entries 1 + r debug loadaof + r XADD mystream * xitem v + assert {[r xlen mystream] == 72} + } +} + +start_server {tags {"stream needs:debug"} overrides {appendonly yes stream-node-max-entries 100}} { + test {XADD with ~ MINID can propagate correctly} { + for {set j 0} {$j < 100} {incr j} { + set id [expr {$j+1}] + r XADD mystream $id xitem v + } + r XADD mystream MINID ~ $j * xitem v + incr j + assert {[r xlen mystream] == $j} + r config set stream-node-max-entries 1 + r debug loadaof + r XADD mystream * xitem v + incr j + assert {[r xlen mystream] == $j} + } +} + +start_server {tags {"stream needs:debug"} overrides {appendonly yes stream-node-max-entries 10}} { + test {XADD with ~ MINID and LIMIT can propagate correctly} { + for {set j 0} {$j < 100} {incr j} { + set id [expr {$j+1}] + r XADD mystream $id xitem v + } + r XADD mystream MINID ~ 55 LIMIT 30 * xitem v + assert {[r xlen mystream] == 71} + r config set stream-node-max-entries 1 + r debug loadaof + r XADD mystream * xitem v + assert {[r xlen mystream] == 72} + } +} + +start_server {tags {"stream needs:debug"} overrides {appendonly yes stream-node-max-entries 10}} { + test {XTRIM with ~ MAXLEN can propagate correctly} { + for {set j 0} {$j < 100} {incr j} { + r XADD mystream * xitem v + } + r XTRIM mystream MAXLEN ~ 85 + assert {[r xlen mystream] == 90} + r config set stream-node-max-entries 1 + r debug loadaof + r XADD mystream * xitem v + incr j + assert {[r xlen mystream] == 91} + } +} + +start_server {tags {"stream xsetid"}} { + test {XADD can CREATE an empty stream} { + r XADD mystream MAXLEN 0 * a b + assert {[dict get [r xinfo stream mystream] length] == 0} + } + + test {XSETID can set a specific ID} { + r XSETID mystream "200-0" + set reply [r XINFO stream mystream] + assert_equal [dict get $reply last-generated-id] "200-0" + assert_equal [dict get $reply entries-added] 1 + } + + test {XSETID cannot SETID with smaller ID} { + r XADD mystream * a b + catch {r XSETID mystream "1-1"} err + r XADD mystream MAXLEN 0 * a b + set err + } {ERR *smaller*} + + test {XSETID cannot SETID on non-existent key} { + catch {r XSETID stream 1-1} err + set _ $err + } {ERR no such key} + + test {XSETID cannot run with an offset but without a maximal tombstone} { + catch {r XSETID stream 1-1 0} err + set _ $err + } {ERR syntax error} + + test {XSETID cannot run with a maximal tombstone but without an offset} { + catch {r XSETID stream 1-1 0-0} err + set _ $err + } {ERR syntax error} + + test {XSETID errors on negstive offset} { + catch {r XSETID stream 1-1 ENTRIESADDED -1 MAXDELETEDID 0-0} err + set _ $err + } {ERR *must be positive} + + test {XSETID cannot set the maximal tombstone with larger ID} { + r DEL x + r XADD x 1-0 a b + + catch {r XSETID x "1-0" ENTRIESADDED 1 MAXDELETEDID "2-0" } err + r XADD mystream MAXLEN 0 * a b + set err + } {ERR *smaller*} + + test {XSETID cannot set the offset to less than the length} { + r DEL x + r XADD x 1-0 a b + + catch {r XSETID x "1-0" ENTRIESADDED 0 MAXDELETEDID "0-0" } err + r XADD mystream MAXLEN 0 * a b + set err + } {ERR *smaller*} +} + +start_server {tags {"stream offset"}} { + test {XADD advances the entries-added counter and sets the recorded-first-entry-id} { + r DEL x + r XADD x 1-0 data a + + set reply [r XINFO STREAM x FULL] + assert_equal [dict get $reply entries-added] 1 + assert_equal [dict get $reply recorded-first-entry-id] "1-0" + + r XADD x 2-0 data a + set reply [r XINFO STREAM x FULL] + assert_equal [dict get $reply entries-added] 2 + assert_equal [dict get $reply recorded-first-entry-id] "1-0" + } + + test {XDEL/TRIM are reflected by recorded first entry} { + r DEL x + r XADD x 1-0 data a + r XADD x 2-0 data a + r XADD x 3-0 data a + r XADD x 4-0 data a + r XADD x 5-0 data a + + set reply [r XINFO STREAM x FULL] + assert_equal [dict get $reply entries-added] 5 + assert_equal [dict get $reply recorded-first-entry-id] "1-0" + + r XDEL x 2-0 + set reply [r XINFO STREAM x FULL] + assert_equal [dict get $reply recorded-first-entry-id] "1-0" + + r XDEL x 1-0 + set reply [r XINFO STREAM x FULL] + assert_equal [dict get $reply recorded-first-entry-id] "3-0" + + r XTRIM x MAXLEN = 2 + set reply [r XINFO STREAM x FULL] + assert_equal [dict get $reply recorded-first-entry-id] "4-0" + } + + test {Maxmimum XDEL ID behaves correctly} { + r DEL x + r XADD x 1-0 data a + r XADD x 2-0 data b + r XADD x 3-0 data c + + set reply [r XINFO STREAM x FULL] + assert_equal [dict get $reply max-deleted-entry-id] "0-0" + + r XDEL x 2-0 + set reply [r XINFO STREAM x FULL] + assert_equal [dict get $reply max-deleted-entry-id] "2-0" + + r XDEL x 1-0 + set reply [r XINFO STREAM x FULL] + assert_equal [dict get $reply max-deleted-entry-id] "2-0" + } +} + +start_server {tags {"stream needs:debug"} overrides {appendonly yes aof-use-rdb-preamble no}} { + test {Empty stream can be rewrite into AOF correctly} { + r XADD mystream MAXLEN 0 * a b + assert {[dict get [r xinfo stream mystream] length] == 0} + r bgrewriteaof + waitForBgrewriteaof r + r debug loadaof + assert {[dict get [r xinfo stream mystream] length] == 0} + } + + test {Stream can be rewrite into AOF correctly after XDEL lastid} { + r XSETID mystream 0-0 + r XADD mystream 1-1 a b + r XADD mystream 2-2 a b + assert {[dict get [r xinfo stream mystream] length] == 2} + r XDEL mystream 2-2 + r bgrewriteaof + waitForBgrewriteaof r + r debug loadaof + assert {[dict get [r xinfo stream mystream] length] == 1} + assert_equal [dict get [r xinfo stream mystream] last-generated-id] "2-2" + } +} + +start_server {tags {"stream"}} { + test {XGROUP HELP should not have unexpected options} { + catch {r XGROUP help xxx} e + assert_match "*wrong number of arguments for 'xgroup|help' command" $e + } + + test {XINFO HELP should not have unexpected options} { + catch {r XINFO help xxx} e + assert_match "*wrong number of arguments for 'xinfo|help' command" $e + } +} diff --git a/tests/unit/type/string.tcl b/tests/unit/type/string.tcl new file mode 100644 index 0000000..04530e9 --- /dev/null +++ b/tests/unit/type/string.tcl @@ -0,0 +1,631 @@ +start_server {tags {"string"}} { + test {SET and GET an item} { + r set x foobar + r get x + } {foobar} + + test {SET and GET an empty item} { + r set x {} + r get x + } {} + + test {Very big payload in GET/SET} { + set buf [string repeat "abcd" 1000000] + r set foo $buf + r get foo + } [string repeat "abcd" 1000000] + + tags {"slow"} { + test {Very big payload random access} { + set err {} + array set payload {} + for {set j 0} {$j < 100} {incr j} { + set size [expr 1+[randomInt 100000]] + set buf [string repeat "pl-$j" $size] + set payload($j) $buf + r set bigpayload_$j $buf + } + for {set j 0} {$j < 1000} {incr j} { + set index [randomInt 100] + set buf [r get bigpayload_$index] + if {$buf != $payload($index)} { + set err "Values differ: I set '$payload($index)' but I read back '$buf'" + break + } + } + unset payload + set _ $err + } {} + + test {SET 10000 numeric keys and access all them in reverse order} { + r flushdb + set err {} + for {set x 0} {$x < 10000} {incr x} { + r set $x $x + } + set sum 0 + for {set x 9999} {$x >= 0} {incr x -1} { + set val [r get $x] + if {$val ne $x} { + set err "Element at position $x is $val instead of $x" + break + } + } + set _ $err + } {} + + test {DBSIZE should be 10000 now} { + r dbsize + } {10000} + } + + test "SETNX target key missing" { + r del novar + assert_equal 1 [r setnx novar foobared] + assert_equal "foobared" [r get novar] + } + + test "SETNX target key exists" { + r set novar foobared + assert_equal 0 [r setnx novar blabla] + assert_equal "foobared" [r get novar] + } + + test "SETNX against not-expired volatile key" { + r set x 10 + r expire x 10000 + assert_equal 0 [r setnx x 20] + assert_equal 10 [r get x] + } + + test "SETNX against expired volatile key" { + # Make it very unlikely for the key this test uses to be expired by the + # active expiry cycle. This is tightly coupled to the implementation of + # active expiry and dbAdd() but currently the only way to test that + # SETNX expires a key when it should have been. + for {set x 0} {$x < 9999} {incr x} { + r setex key-$x 3600 value + } + + # This will be one of 10000 expiring keys. A cycle is executed every + # 100ms, sampling 10 keys for being expired or not. This key will be + # expired for at most 1s when we wait 2s, resulting in a total sample + # of 100 keys. The probability of the success of this test being a + # false positive is therefore approx. 1%. + r set x 10 + r expire x 1 + + # Wait for the key to expire + after 2000 + + assert_equal 1 [r setnx x 20] + assert_equal 20 [r get x] + } + + test "GETEX EX option" { + r del foo + r set foo bar + r getex foo ex 10 + assert_range [r ttl foo] 5 10 + } + + test "GETEX PX option" { + r del foo + r set foo bar + r getex foo px 10000 + assert_range [r pttl foo] 5000 10000 + } + + test "GETEX EXAT option" { + r del foo + r set foo bar + r getex foo exat [expr [clock seconds] + 10] + assert_range [r ttl foo] 5 10 + } + + test "GETEX PXAT option" { + r del foo + r set foo bar + r getex foo pxat [expr [clock milliseconds] + 10000] + assert_range [r pttl foo] 5000 10000 + } + + test "GETEX PERSIST option" { + r del foo + r set foo bar ex 10 + assert_range [r ttl foo] 5 10 + r getex foo persist + assert_equal -1 [r ttl foo] + } + + test "GETEX no option" { + r del foo + r set foo bar + r getex foo + assert_equal bar [r getex foo] + } + + test "GETEX syntax errors" { + set ex {} + catch {r getex foo non-existent-option} ex + set ex + } {*syntax*} + + test "GETEX no arguments" { + set ex {} + catch {r getex} ex + set ex + } {*wrong number of arguments for 'getex' command} + + test "GETDEL command" { + r del foo + r set foo bar + assert_equal bar [r getdel foo ] + assert_equal {} [r getdel foo ] + } + + test {GETDEL propagate as DEL command to replica} { + set repl [attach_to_replication_stream] + r set foo bar + r getdel foo + assert_replication_stream $repl { + {select *} + {set foo bar} + {del foo} + } + close_replication_stream $repl + } {} {needs:repl} + + test {GETEX without argument does not propagate to replica} { + set repl [attach_to_replication_stream] + r set foo bar + r getex foo + r del foo + assert_replication_stream $repl { + {select *} + {set foo bar} + {del foo} + } + close_replication_stream $repl + } {} {needs:repl} + + test {MGET} { + r flushdb + r set foo{t} BAR + r set bar{t} FOO + r mget foo{t} bar{t} + } {BAR FOO} + + test {MGET against non existing key} { + r mget foo{t} baazz{t} bar{t} + } {BAR {} FOO} + + test {MGET against non-string key} { + r sadd myset{t} ciao + r sadd myset{t} bau + r mget foo{t} baazz{t} bar{t} myset{t} + } {BAR {} FOO {}} + + test {GETSET (set new value)} { + r del foo + list [r getset foo xyz] [r get foo] + } {{} xyz} + + test {GETSET (replace old value)} { + r set foo bar + list [r getset foo xyz] [r get foo] + } {bar xyz} + + test {MSET base case} { + r mset x{t} 10 y{t} "foo bar" z{t} "x x x x x x x\n\n\r\n" + r mget x{t} y{t} z{t} + } [list 10 {foo bar} "x x x x x x x\n\n\r\n"] + + test {MSET/MSETNX wrong number of args} { + assert_error {*wrong number of arguments for 'mset' command} {r mset x{t} 10 y{t} "foo bar" z{t}} + assert_error {*wrong number of arguments for 'msetnx' command} {r msetnx x{t} 20 y{t} "foo bar" z{t}} + } + + test {MSETNX with already existent key} { + list [r msetnx x1{t} xxx y2{t} yyy x{t} 20] [r exists x1{t}] [r exists y2{t}] + } {0 0 0} + + test {MSETNX with not existing keys} { + list [r msetnx x1{t} xxx y2{t} yyy] [r get x1{t}] [r get y2{t}] + } {1 xxx yyy} + + test {MSETNX with not existing keys - same key twice} { + r del x1{t} + list [r msetnx x1{t} xxx x1{t} yyy] [r get x1{t}] + } {1 yyy} + + test {MSETNX with already existing keys - same key twice} { + list [r msetnx x1{t} xxx x1{t} zzz] [r get x1{t}] + } {0 yyy} + + test "STRLEN against non-existing key" { + assert_equal 0 [r strlen notakey] + } + + test "STRLEN against integer-encoded value" { + r set myinteger -555 + assert_equal 4 [r strlen myinteger] + } + + test "STRLEN against plain string" { + r set mystring "foozzz0123456789 baz" + assert_equal 20 [r strlen mystring] + } + + test "SETBIT against non-existing key" { + r del mykey + assert_equal 0 [r setbit mykey 1 1] + assert_equal [binary format B* 01000000] [r get mykey] + } + + test "SETBIT against string-encoded key" { + # Ascii "@" is integer 64 = 01 00 00 00 + r set mykey "@" + + assert_equal 0 [r setbit mykey 2 1] + assert_equal [binary format B* 01100000] [r get mykey] + assert_equal 1 [r setbit mykey 1 0] + assert_equal [binary format B* 00100000] [r get mykey] + } + + test "SETBIT against integer-encoded key" { + # Ascii "1" is integer 49 = 00 11 00 01 + r set mykey 1 + assert_encoding int mykey + + assert_equal 0 [r setbit mykey 6 1] + assert_equal [binary format B* 00110011] [r get mykey] + assert_equal 1 [r setbit mykey 2 0] + assert_equal [binary format B* 00010011] [r get mykey] + } + + test "SETBIT against key with wrong type" { + r del mykey + r lpush mykey "foo" + assert_error "WRONGTYPE*" {r setbit mykey 0 1} + } + + test "SETBIT with out of range bit offset" { + r del mykey + assert_error "*out of range*" {r setbit mykey [expr 4*1024*1024*1024] 1} + assert_error "*out of range*" {r setbit mykey -1 1} + } + + test "SETBIT with non-bit argument" { + r del mykey + assert_error "*out of range*" {r setbit mykey 0 -1} + assert_error "*out of range*" {r setbit mykey 0 2} + assert_error "*out of range*" {r setbit mykey 0 10} + assert_error "*out of range*" {r setbit mykey 0 20} + } + + test "SETBIT fuzzing" { + set str "" + set len [expr 256*8] + r del mykey + + for {set i 0} {$i < 2000} {incr i} { + set bitnum [randomInt $len] + set bitval [randomInt 2] + set fmt [format "%%-%ds%%d%%-s" $bitnum] + set head [string range $str 0 $bitnum-1] + set tail [string range $str $bitnum+1 end] + set str [string map {" " 0} [format $fmt $head $bitval $tail]] + + r setbit mykey $bitnum $bitval + assert_equal [binary format B* $str] [r get mykey] + } + } + + test "GETBIT against non-existing key" { + r del mykey + assert_equal 0 [r getbit mykey 0] + } + + test "GETBIT against string-encoded key" { + # Single byte with 2nd and 3rd bit set + r set mykey "`" + + # In-range + assert_equal 0 [r getbit mykey 0] + assert_equal 1 [r getbit mykey 1] + assert_equal 1 [r getbit mykey 2] + assert_equal 0 [r getbit mykey 3] + + # Out-range + assert_equal 0 [r getbit mykey 8] + assert_equal 0 [r getbit mykey 100] + assert_equal 0 [r getbit mykey 10000] + } + + test "GETBIT against integer-encoded key" { + r set mykey 1 + assert_encoding int mykey + + # Ascii "1" is integer 49 = 00 11 00 01 + assert_equal 0 [r getbit mykey 0] + assert_equal 0 [r getbit mykey 1] + assert_equal 1 [r getbit mykey 2] + assert_equal 1 [r getbit mykey 3] + + # Out-range + assert_equal 0 [r getbit mykey 8] + assert_equal 0 [r getbit mykey 100] + assert_equal 0 [r getbit mykey 10000] + } + + test "SETRANGE against non-existing key" { + r del mykey + assert_equal 3 [r setrange mykey 0 foo] + assert_equal "foo" [r get mykey] + + r del mykey + assert_equal 0 [r setrange mykey 0 ""] + assert_equal 0 [r exists mykey] + + r del mykey + assert_equal 4 [r setrange mykey 1 foo] + assert_equal "\000foo" [r get mykey] + } + + test "SETRANGE against string-encoded key" { + r set mykey "foo" + assert_equal 3 [r setrange mykey 0 b] + assert_equal "boo" [r get mykey] + + r set mykey "foo" + assert_equal 3 [r setrange mykey 0 ""] + assert_equal "foo" [r get mykey] + + r set mykey "foo" + assert_equal 3 [r setrange mykey 1 b] + assert_equal "fbo" [r get mykey] + + r set mykey "foo" + assert_equal 7 [r setrange mykey 4 bar] + assert_equal "foo\000bar" [r get mykey] + } + + test "SETRANGE against integer-encoded key" { + r set mykey 1234 + assert_encoding int mykey + assert_equal 4 [r setrange mykey 0 2] + assert_encoding raw mykey + assert_equal 2234 [r get mykey] + + # Shouldn't change encoding when nothing is set + r set mykey 1234 + assert_encoding int mykey + assert_equal 4 [r setrange mykey 0 ""] + assert_encoding int mykey + assert_equal 1234 [r get mykey] + + r set mykey 1234 + assert_encoding int mykey + assert_equal 4 [r setrange mykey 1 3] + assert_encoding raw mykey + assert_equal 1334 [r get mykey] + + r set mykey 1234 + assert_encoding int mykey + assert_equal 6 [r setrange mykey 5 2] + assert_encoding raw mykey + assert_equal "1234\0002" [r get mykey] + } + + test "SETRANGE against key with wrong type" { + r del mykey + r lpush mykey "foo" + assert_error "WRONGTYPE*" {r setrange mykey 0 bar} + } + + test "SETRANGE with out of range offset" { + r del mykey + assert_error "*maximum allowed size*" {r setrange mykey [expr 512*1024*1024-4] world} + + r set mykey "hello" + assert_error "*out of range*" {r setrange mykey -1 world} + assert_error "*maximum allowed size*" {r setrange mykey [expr 512*1024*1024-4] world} + } + + test "GETRANGE against non-existing key" { + r del mykey + assert_equal "" [r getrange mykey 0 -1] + } + + test "GETRANGE against string value" { + r set mykey "Hello World" + assert_equal "Hell" [r getrange mykey 0 3] + assert_equal "Hello World" [r getrange mykey 0 -1] + assert_equal "orld" [r getrange mykey -4 -1] + assert_equal "" [r getrange mykey 5 3] + assert_equal " World" [r getrange mykey 5 5000] + assert_equal "Hello World" [r getrange mykey -5000 10000] + } + + test "GETRANGE against integer-encoded value" { + r set mykey 1234 + assert_equal "123" [r getrange mykey 0 2] + assert_equal "1234" [r getrange mykey 0 -1] + assert_equal "234" [r getrange mykey -3 -1] + assert_equal "" [r getrange mykey 5 3] + assert_equal "4" [r getrange mykey 3 5000] + assert_equal "1234" [r getrange mykey -5000 10000] + } + + test "GETRANGE fuzzing" { + for {set i 0} {$i < 1000} {incr i} { + r set bin [set bin [randstring 0 1024 binary]] + set _start [set start [randomInt 1500]] + set _end [set end [randomInt 1500]] + if {$_start < 0} {set _start "end-[abs($_start)-1]"} + if {$_end < 0} {set _end "end-[abs($_end)-1]"} + assert_equal [string range $bin $_start $_end] [r getrange bin $start $end] + } + } + +if {[string match {*jemalloc*} [s mem_allocator]]} { + test {trim on SET with big value} { + # set a big value to trigger increasing the query buf + r set key [string repeat A 100000] + # set a smaller value but > PROTO_MBULK_BIG_ARG (32*1024) Redis will try to save the query buf itself on the DB. + r set key [string repeat A 33000] + # asset the value was trimmed + assert {[r memory usage key] < 42000}; # 42K to count for Jemalloc's additional memory overhead. + } +} ;# if jemalloc + + test {Extended SET can detect syntax errors} { + set e {} + catch {r set foo bar non-existing-option} e + set e + } {*syntax*} + + test {Extended SET NX option} { + r del foo + set v1 [r set foo 1 nx] + set v2 [r set foo 2 nx] + list $v1 $v2 [r get foo] + } {OK {} 1} + + test {Extended SET XX option} { + r del foo + set v1 [r set foo 1 xx] + r set foo bar + set v2 [r set foo 2 xx] + list $v1 $v2 [r get foo] + } {{} OK 2} + + test {Extended SET GET option} { + r del foo + r set foo bar + set old_value [r set foo bar2 GET] + set new_value [r get foo] + list $old_value $new_value + } {bar bar2} + + test {Extended SET GET option with no previous value} { + r del foo + set old_value [r set foo bar GET] + set new_value [r get foo] + list $old_value $new_value + } {{} bar} + + test {Extended SET GET option with XX} { + r del foo + r set foo bar + set old_value [r set foo baz GET XX] + set new_value [r get foo] + list $old_value $new_value + } {bar baz} + + test {Extended SET GET option with XX and no previous value} { + r del foo + set old_value [r set foo bar GET XX] + set new_value [r get foo] + list $old_value $new_value + } {{} {}} + + test {Extended SET GET option with NX} { + r del foo + set old_value [r set foo bar GET NX] + set new_value [r get foo] + list $old_value $new_value + } {{} bar} + + test {Extended SET GET option with NX and previous value} { + r del foo + r set foo bar + set old_value [r set foo baz GET NX] + set new_value [r get foo] + list $old_value $new_value + } {bar bar} + + test {Extended SET GET with incorrect type should result in wrong type error} { + r del foo + r rpush foo waffle + catch {r set foo bar GET} err1 + assert_equal "waffle" [r rpop foo] + set err1 + } {*WRONGTYPE*} + + test {Extended SET EX option} { + r del foo + r set foo bar ex 10 + set ttl [r ttl foo] + assert {$ttl <= 10 && $ttl > 5} + } + + test {Extended SET PX option} { + r del foo + r set foo bar px 10000 + set ttl [r ttl foo] + assert {$ttl <= 10 && $ttl > 5} + } + + test "Extended SET EXAT option" { + r del foo + r set foo bar exat [expr [clock seconds] + 10] + assert_range [r ttl foo] 5 10 + } + + test "Extended SET PXAT option" { + r del foo + r set foo bar pxat [expr [clock milliseconds] + 10000] + assert_range [r ttl foo] 5 10 + } + test {Extended SET using multiple options at once} { + r set foo val + assert {[r set foo bar xx px 10000] eq {OK}} + set ttl [r ttl foo] + assert {$ttl <= 10 && $ttl > 5} + } + + test {GETRANGE with huge ranges, Github issue #1844} { + r set foo bar + r getrange foo 0 4294967297 + } {bar} + + set rna1 {CACCTTCCCAGGTAACAAACCAACCAACTTTCGATCTCTTGTAGATCTGTTCTCTAAACGAACTTTAAAATCTGTGTGGCTGTCACTCGGCTGCATGCTTAGTGCACTCACGCAGTATAATTAATAACTAATTACTGTCGTTGACAGGACACGAGTAACTCGTCTATCTTCTGCAGGCTGCTTACGGTTTCGTCCGTGTTGCAGCCGATCATCAGCACATCTAGGTTTCGTCCGGGTGTG} + set rna2 {ATTAAAGGTTTATACCTTCCCAGGTAACAAACCAACCAACTTTCGATCTCTTGTAGATCTGTTCTCTAAACGAACTTTAAAATCTGTGTGGCTGTCACTCGGCTGCATGCTTAGTGCACTCACGCAGTATAATTAATAACTAATTACTGTCGTTGACAGGACACGAGTAACTCGTCTATCTTCTGCAGGCTGCTTACGGTTTCGTCCGTGTTGCAGCCGATCATCAGCACATCTAGGTTT} + set rnalcs {ACCTTCCCAGGTAACAAACCAACCAACTTTCGATCTCTTGTAGATCTGTTCTCTAAACGAACTTTAAAATCTGTGTGGCTGTCACTCGGCTGCATGCTTAGTGCACTCACGCAGTATAATTAATAACTAATTACTGTCGTTGACAGGACACGAGTAACTCGTCTATCTTCTGCAGGCTGCTTACGGTTTCGTCCGTGTTGCAGCCGATCATCAGCACATCTAGGTTT} + + test {LCS basic} { + r set virus1{t} $rna1 + r set virus2{t} $rna2 + r LCS virus1{t} virus2{t} + } $rnalcs + + test {LCS len} { + r set virus1{t} $rna1 + r set virus2{t} $rna2 + r LCS virus1{t} virus2{t} LEN + } [string length $rnalcs] + + test {LCS indexes} { + dict get [r LCS virus1{t} virus2{t} IDX] matches + } {{{238 238} {239 239}} {{236 236} {238 238}} {{229 230} {236 237}} {{224 224} {235 235}} {{1 222} {13 234}}} + + test {LCS indexes with match len} { + dict get [r LCS virus1{t} virus2{t} IDX WITHMATCHLEN] matches + } {{{238 238} {239 239} 1} {{236 236} {238 238} 1} {{229 230} {236 237} 2} {{224 224} {235 235} 1} {{1 222} {13 234} 222}} + + test {LCS indexes with match len and minimum match len} { + dict get [r LCS virus1{t} virus2{t} IDX WITHMATCHLEN MINMATCHLEN 5] matches + } {{{1 222} {13 234} 222}} + + test {SETRANGE with huge offset} { + foreach value {9223372036854775807 2147483647} { + catch {[r setrange K $value A]} res + # expecting a different error on 32 and 64 bit systems + if {![string match "*string exceeds maximum allowed size*" $res] && ![string match "*out of range*" $res]} { + assert_equal $res "expecting an error" + } + } + } +} diff --git a/tests/unit/type/zset.tcl b/tests/unit/type/zset.tcl new file mode 100644 index 0000000..88c0bcb --- /dev/null +++ b/tests/unit/type/zset.tcl @@ -0,0 +1,2468 @@ +start_server {tags {"zset"}} { + proc create_zset {key items} { + r del $key + foreach {score entry} $items { + r zadd $key $score $entry + } + } + + # A helper function to verify either ZPOP* or ZMPOP* response. + proc verify_pop_response {pop res zpop_expected_response zmpop_expected_response} { + if {[string match "*ZM*" $pop]} { + assert_equal $res $zmpop_expected_response + } else { + assert_equal $res $zpop_expected_response + } + } + + # A helper function to verify either ZPOP* or ZMPOP* response when given one input key. + proc verify_zpop_response {rd pop key count zpop_expected_response zmpop_expected_response} { + if {[string match "ZM*" $pop]} { + lassign [split $pop "_"] pop where + + if {$count == 0} { + set res [$rd $pop 1 $key $where] + } else { + set res [$rd $pop 1 $key $where COUNT $count] + } + } else { + if {$count == 0} { + set res [$rd $pop $key] + } else { + set res [$rd $pop $key $count] + } + } + verify_pop_response $pop $res $zpop_expected_response $zmpop_expected_response + } + + # A helper function to verify either BZPOP* or BZMPOP* response when given one input key. + proc verify_bzpop_response {rd pop key timeout count bzpop_expected_response bzmpop_expected_response} { + if {[string match "BZM*" $pop]} { + lassign [split $pop "_"] pop where + + if {$count == 0} { + $rd $pop $timeout 1 $key $where + } else { + $rd $pop $timeout 1 $key $where COUNT $count + } + } else { + $rd $pop $key $timeout + } + verify_pop_response $pop [$rd read] $bzpop_expected_response $bzmpop_expected_response + } + + # A helper function to verify either ZPOP* or ZMPOP* response when given two input keys. + proc verify_bzpop_two_key_response {rd pop key key2 timeout count bzpop_expected_response bzmpop_expected_response} { + if {[string match "BZM*" $pop]} { + lassign [split $pop "_"] pop where + + if {$count == 0} { + $rd $pop $timeout 2 $key $key2 $where + } else { + $rd $pop $timeout 2 $key $key2 $where COUNT $count + } + } else { + $rd $pop $key $key2 $timeout + } + verify_pop_response $pop [$rd read] $bzpop_expected_response $bzmpop_expected_response + } + + # A helper function to execute either BZPOP* or BZMPOP* with one input key. + proc bzpop_command {rd pop key timeout} { + if {[string match "BZM*" $pop]} { + lassign [split $pop "_"] pop where + $rd $pop $timeout 1 $key $where COUNT 1 + } else { + $rd $pop $key $timeout + } + } + + # A helper function to verify nil response in readraw base on RESP version. + proc verify_nil_response {resp nil_response} { + if {$resp == 2} { + assert_equal $nil_response {*-1} + } elseif {$resp == 3} { + assert_equal $nil_response {_} + } + } + + # A helper function to verify zset score response in readraw base on RESP version. + proc verify_score_response {rd resp score} { + if {$resp == 2} { + assert_equal [$rd read] {$1} + assert_equal [$rd read] $score + } elseif {$resp == 3} { + assert_equal [$rd read] ",$score" + } + } + + proc basics {encoding} { + set original_max_entries [lindex [r config get zset-max-ziplist-entries] 1] + set original_max_value [lindex [r config get zset-max-ziplist-value] 1] + if {$encoding == "listpack"} { + r config set zset-max-ziplist-entries 128 + r config set zset-max-ziplist-value 64 + } elseif {$encoding == "skiplist"} { + r config set zset-max-ziplist-entries 0 + r config set zset-max-ziplist-value 0 + } else { + puts "Unknown sorted set encoding" + exit + } + + test "Check encoding - $encoding" { + r del ztmp + r zadd ztmp 10 x + assert_encoding $encoding ztmp + } + + test "ZSET basic ZADD and score update - $encoding" { + r del ztmp + r zadd ztmp 10 x + r zadd ztmp 20 y + r zadd ztmp 30 z + assert_equal {x y z} [r zrange ztmp 0 -1] + + r zadd ztmp 1 y + assert_equal {y x z} [r zrange ztmp 0 -1] + } + + test "ZSET element can't be set to NaN with ZADD - $encoding" { + assert_error "*not*float*" {r zadd myzset nan abc} + } + + test "ZSET element can't be set to NaN with ZINCRBY - $encoding" { + assert_error "*not*float*" {r zadd myzset nan abc} + } + + test "ZADD with options syntax error with incomplete pair - $encoding" { + r del ztmp + catch {r zadd ztmp xx 10 x 20} err + set err + } {ERR*} + + test "ZADD XX option without key - $encoding" { + r del ztmp + assert {[r zadd ztmp xx 10 x] == 0} + assert {[r type ztmp] eq {none}} + } + + test "ZADD XX existing key - $encoding" { + r del ztmp + r zadd ztmp 10 x + assert {[r zadd ztmp xx 20 y] == 0} + assert {[r zcard ztmp] == 1} + } + + test "ZADD XX returns the number of elements actually added - $encoding" { + r del ztmp + r zadd ztmp 10 x + set retval [r zadd ztmp 10 x 20 y 30 z] + assert {$retval == 2} + } + + test "ZADD XX updates existing elements score - $encoding" { + r del ztmp + r zadd ztmp 10 x 20 y 30 z + r zadd ztmp xx 5 foo 11 x 21 y 40 zap + assert {[r zcard ztmp] == 3} + assert {[r zscore ztmp x] == 11} + assert {[r zscore ztmp y] == 21} + } + + test "ZADD GT updates existing elements when new scores are greater - $encoding" { + r del ztmp + r zadd ztmp 10 x 20 y 30 z + assert {[r zadd ztmp gt ch 5 foo 11 x 21 y 29 z] == 3} + assert {[r zcard ztmp] == 4} + assert {[r zscore ztmp x] == 11} + assert {[r zscore ztmp y] == 21} + assert {[r zscore ztmp z] == 30} + } + + test "ZADD LT updates existing elements when new scores are lower - $encoding" { + r del ztmp + r zadd ztmp 10 x 20 y 30 z + assert {[r zadd ztmp lt ch 5 foo 11 x 21 y 29 z] == 2} + assert {[r zcard ztmp] == 4} + assert {[r zscore ztmp x] == 10} + assert {[r zscore ztmp y] == 20} + assert {[r zscore ztmp z] == 29} + } + + test "ZADD GT XX updates existing elements when new scores are greater and skips new elements - $encoding" { + r del ztmp + r zadd ztmp 10 x 20 y 30 z + assert {[r zadd ztmp gt xx ch 5 foo 11 x 21 y 29 z] == 2} + assert {[r zcard ztmp] == 3} + assert {[r zscore ztmp x] == 11} + assert {[r zscore ztmp y] == 21} + assert {[r zscore ztmp z] == 30} + } + + test "ZADD LT XX updates existing elements when new scores are lower and skips new elements - $encoding" { + r del ztmp + r zadd ztmp 10 x 20 y 30 z + assert {[r zadd ztmp lt xx ch 5 foo 11 x 21 y 29 z] == 1} + assert {[r zcard ztmp] == 3} + assert {[r zscore ztmp x] == 10} + assert {[r zscore ztmp y] == 20} + assert {[r zscore ztmp z] == 29} + } + + test "ZADD XX and NX are not compatible - $encoding" { + r del ztmp + catch {r zadd ztmp xx nx 10 x} err + set err + } {ERR*} + + test "ZADD NX with non existing key - $encoding" { + r del ztmp + r zadd ztmp nx 10 x 20 y 30 z + assert {[r zcard ztmp] == 3} + } + + test "ZADD NX only add new elements without updating old ones - $encoding" { + r del ztmp + r zadd ztmp 10 x 20 y 30 z + assert {[r zadd ztmp nx 11 x 21 y 100 a 200 b] == 2} + assert {[r zscore ztmp x] == 10} + assert {[r zscore ztmp y] == 20} + assert {[r zscore ztmp a] == 100} + assert {[r zscore ztmp b] == 200} + } + + test "ZADD GT and NX are not compatible - $encoding" { + r del ztmp + catch {r zadd ztmp gt nx 10 x} err + set err + } {ERR*} + + test "ZADD LT and NX are not compatible - $encoding" { + r del ztmp + catch {r zadd ztmp lt nx 10 x} err + set err + } {ERR*} + + test "ZADD LT and GT are not compatible - $encoding" { + r del ztmp + catch {r zadd ztmp lt gt 10 x} err + set err + } {ERR*} + + test "ZADD INCR LT/GT replies with nill if score not updated - $encoding" { + r del ztmp + r zadd ztmp 28 x + assert {[r zadd ztmp lt incr 1 x] eq {}} + assert {[r zscore ztmp x] == 28} + assert {[r zadd ztmp gt incr -1 x] eq {}} + assert {[r zscore ztmp x] == 28} + } + + test "ZADD INCR LT/GT with inf - $encoding" { + r del ztmp + r zadd ztmp +inf x -inf y + + assert {[r zadd ztmp lt incr 1 x] eq {}} + assert {[r zscore ztmp x] == inf} + assert {[r zadd ztmp gt incr -1 x] eq {}} + assert {[r zscore ztmp x] == inf} + assert {[r zadd ztmp lt incr -1 x] eq {}} + assert {[r zscore ztmp x] == inf} + assert {[r zadd ztmp gt incr 1 x] eq {}} + assert {[r zscore ztmp x] == inf} + + assert {[r zadd ztmp lt incr 1 y] eq {}} + assert {[r zscore ztmp y] == -inf} + assert {[r zadd ztmp gt incr -1 y] eq {}} + assert {[r zscore ztmp y] == -inf} + assert {[r zadd ztmp lt incr -1 y] eq {}} + assert {[r zscore ztmp y] == -inf} + assert {[r zadd ztmp gt incr 1 y] eq {}} + assert {[r zscore ztmp y] == -inf} + } + + test "ZADD INCR works like ZINCRBY - $encoding" { + r del ztmp + r zadd ztmp 10 x 20 y 30 z + r zadd ztmp INCR 15 x + assert {[r zscore ztmp x] == 25} + } + + test "ZADD INCR works with a single score-elemenet pair - $encoding" { + r del ztmp + r zadd ztmp 10 x 20 y 30 z + catch {r zadd ztmp INCR 15 x 10 y} err + set err + } {ERR*} + + test "ZADD CH option changes return value to all changed elements - $encoding" { + r del ztmp + r zadd ztmp 10 x 20 y 30 z + assert {[r zadd ztmp 11 x 21 y 30 z] == 0} + assert {[r zadd ztmp ch 12 x 22 y 30 z] == 2} + } + + test "ZINCRBY calls leading to NaN result in error - $encoding" { + r zincrby myzset +inf abc + assert_error "*NaN*" {r zincrby myzset -inf abc} + } + + test {ZADD - Variadic version base case - $encoding} { + r del myzset + list [r zadd myzset 10 a 20 b 30 c] [r zrange myzset 0 -1 withscores] + } {3 {a 10 b 20 c 30}} + + test {ZADD - Return value is the number of actually added items - $encoding} { + list [r zadd myzset 5 x 20 b 30 c] [r zrange myzset 0 -1 withscores] + } {1 {x 5 a 10 b 20 c 30}} + + test {ZADD - Variadic version does not add nothing on single parsing err - $encoding} { + r del myzset + catch {r zadd myzset 10 a 20 b 30.badscore c} e + assert_match {*ERR*not*float*} $e + r exists myzset + } {0} + + test {ZADD - Variadic version will raise error on missing arg - $encoding} { + r del myzset + catch {r zadd myzset 10 a 20 b 30 c 40} e + assert_match {*ERR*syntax*} $e + } + + test {ZINCRBY does not work variadic even if shares ZADD implementation - $encoding} { + r del myzset + catch {r zincrby myzset 10 a 20 b 30 c} e + assert_match {*ERR*wrong*number*arg*} $e + } + + test "ZCARD basics - $encoding" { + r del ztmp + r zadd ztmp 10 a 20 b 30 c + assert_equal 3 [r zcard ztmp] + assert_equal 0 [r zcard zdoesntexist] + } + + test "ZREM removes key after last element is removed - $encoding" { + r del ztmp + r zadd ztmp 10 x + r zadd ztmp 20 y + + assert_equal 1 [r exists ztmp] + assert_equal 0 [r zrem ztmp z] + assert_equal 1 [r zrem ztmp y] + assert_equal 1 [r zrem ztmp x] + assert_equal 0 [r exists ztmp] + } + + test "ZREM variadic version - $encoding" { + r del ztmp + r zadd ztmp 10 a 20 b 30 c + assert_equal 2 [r zrem ztmp x y a b k] + assert_equal 0 [r zrem ztmp foo bar] + assert_equal 1 [r zrem ztmp c] + r exists ztmp + } {0} + + test "ZREM variadic version -- remove elements after key deletion - $encoding" { + r del ztmp + r zadd ztmp 10 a 20 b 30 c + r zrem ztmp a b c d e f g + } {3} + + test "ZRANGE basics - $encoding" { + r del ztmp + r zadd ztmp 1 a + r zadd ztmp 2 b + r zadd ztmp 3 c + r zadd ztmp 4 d + + assert_equal {a b c d} [r zrange ztmp 0 -1] + assert_equal {a b c} [r zrange ztmp 0 -2] + assert_equal {b c d} [r zrange ztmp 1 -1] + assert_equal {b c} [r zrange ztmp 1 -2] + assert_equal {c d} [r zrange ztmp -2 -1] + assert_equal {c} [r zrange ztmp -2 -2] + + # out of range start index + assert_equal {a b c} [r zrange ztmp -5 2] + assert_equal {a b} [r zrange ztmp -5 1] + assert_equal {} [r zrange ztmp 5 -1] + assert_equal {} [r zrange ztmp 5 -2] + + # out of range end index + assert_equal {a b c d} [r zrange ztmp 0 5] + assert_equal {b c d} [r zrange ztmp 1 5] + assert_equal {} [r zrange ztmp 0 -5] + assert_equal {} [r zrange ztmp 1 -5] + + # withscores + assert_equal {a 1 b 2 c 3 d 4} [r zrange ztmp 0 -1 withscores] + } + + test "ZREVRANGE basics - $encoding" { + r del ztmp + r zadd ztmp 1 a + r zadd ztmp 2 b + r zadd ztmp 3 c + r zadd ztmp 4 d + + assert_equal {d c b a} [r zrevrange ztmp 0 -1] + assert_equal {d c b} [r zrevrange ztmp 0 -2] + assert_equal {c b a} [r zrevrange ztmp 1 -1] + assert_equal {c b} [r zrevrange ztmp 1 -2] + assert_equal {b a} [r zrevrange ztmp -2 -1] + assert_equal {b} [r zrevrange ztmp -2 -2] + + # out of range start index + assert_equal {d c b} [r zrevrange ztmp -5 2] + assert_equal {d c} [r zrevrange ztmp -5 1] + assert_equal {} [r zrevrange ztmp 5 -1] + assert_equal {} [r zrevrange ztmp 5 -2] + + # out of range end index + assert_equal {d c b a} [r zrevrange ztmp 0 5] + assert_equal {c b a} [r zrevrange ztmp 1 5] + assert_equal {} [r zrevrange ztmp 0 -5] + assert_equal {} [r zrevrange ztmp 1 -5] + + # withscores + assert_equal {d 4 c 3 b 2 a 1} [r zrevrange ztmp 0 -1 withscores] + } + + test "ZRANK/ZREVRANK basics - $encoding" { + r del zranktmp + r zadd zranktmp 10 x + r zadd zranktmp 20 y + r zadd zranktmp 30 z + assert_equal 0 [r zrank zranktmp x] + assert_equal 1 [r zrank zranktmp y] + assert_equal 2 [r zrank zranktmp z] + assert_equal "" [r zrank zranktmp foo] + assert_equal 2 [r zrevrank zranktmp x] + assert_equal 1 [r zrevrank zranktmp y] + assert_equal 0 [r zrevrank zranktmp z] + assert_equal "" [r zrevrank zranktmp foo] + } + + test "ZRANK - after deletion - $encoding" { + r zrem zranktmp y + assert_equal 0 [r zrank zranktmp x] + assert_equal 1 [r zrank zranktmp z] + } + + test "ZINCRBY - can create a new sorted set - $encoding" { + r del zset + r zincrby zset 1 foo + assert_equal {foo} [r zrange zset 0 -1] + assert_equal 1 [r zscore zset foo] + } + + test "ZINCRBY - increment and decrement - $encoding" { + r zincrby zset 2 foo + r zincrby zset 1 bar + assert_equal {bar foo} [r zrange zset 0 -1] + + r zincrby zset 10 bar + r zincrby zset -5 foo + r zincrby zset -5 bar + assert_equal {foo bar} [r zrange zset 0 -1] + + assert_equal -2 [r zscore zset foo] + assert_equal 6 [r zscore zset bar] + } + + test "ZINCRBY return value - $encoding" { + r del ztmp + set retval [r zincrby ztmp 1.0 x] + assert {$retval == 1.0} + } + + proc create_default_zset {} { + create_zset zset {-inf a 1 b 2 c 3 d 4 e 5 f +inf g} + } + + test "ZRANGEBYSCORE/ZREVRANGEBYSCORE/ZCOUNT basics - $encoding" { + create_default_zset + + # inclusive range + assert_equal {a b c} [r zrangebyscore zset -inf 2] + assert_equal {b c d} [r zrangebyscore zset 0 3] + assert_equal {d e f} [r zrangebyscore zset 3 6] + assert_equal {e f g} [r zrangebyscore zset 4 +inf] + assert_equal {c b a} [r zrevrangebyscore zset 2 -inf] + assert_equal {d c b} [r zrevrangebyscore zset 3 0] + assert_equal {f e d} [r zrevrangebyscore zset 6 3] + assert_equal {g f e} [r zrevrangebyscore zset +inf 4] + assert_equal 3 [r zcount zset 0 3] + + # exclusive range + assert_equal {b} [r zrangebyscore zset (-inf (2] + assert_equal {b c} [r zrangebyscore zset (0 (3] + assert_equal {e f} [r zrangebyscore zset (3 (6] + assert_equal {f} [r zrangebyscore zset (4 (+inf] + assert_equal {b} [r zrevrangebyscore zset (2 (-inf] + assert_equal {c b} [r zrevrangebyscore zset (3 (0] + assert_equal {f e} [r zrevrangebyscore zset (6 (3] + assert_equal {f} [r zrevrangebyscore zset (+inf (4] + assert_equal 2 [r zcount zset (0 (3] + + # test empty ranges + r zrem zset a + r zrem zset g + + # inclusive + assert_equal {} [r zrangebyscore zset 4 2] + assert_equal {} [r zrangebyscore zset 6 +inf] + assert_equal {} [r zrangebyscore zset -inf -6] + assert_equal {} [r zrevrangebyscore zset +inf 6] + assert_equal {} [r zrevrangebyscore zset -6 -inf] + + # exclusive + assert_equal {} [r zrangebyscore zset (4 (2] + assert_equal {} [r zrangebyscore zset 2 (2] + assert_equal {} [r zrangebyscore zset (2 2] + assert_equal {} [r zrangebyscore zset (6 (+inf] + assert_equal {} [r zrangebyscore zset (-inf (-6] + assert_equal {} [r zrevrangebyscore zset (+inf (6] + assert_equal {} [r zrevrangebyscore zset (-6 (-inf] + + # empty inner range + assert_equal {} [r zrangebyscore zset 2.4 2.6] + assert_equal {} [r zrangebyscore zset (2.4 2.6] + assert_equal {} [r zrangebyscore zset 2.4 (2.6] + assert_equal {} [r zrangebyscore zset (2.4 (2.6] + } + + test "ZRANGEBYSCORE with WITHSCORES - $encoding" { + create_default_zset + assert_equal {b 1 c 2 d 3} [r zrangebyscore zset 0 3 withscores] + assert_equal {d 3 c 2 b 1} [r zrevrangebyscore zset 3 0 withscores] + } + + test "ZRANGEBYSCORE with LIMIT - $encoding" { + create_default_zset + assert_equal {b c} [r zrangebyscore zset 0 10 LIMIT 0 2] + assert_equal {d e f} [r zrangebyscore zset 0 10 LIMIT 2 3] + assert_equal {d e f} [r zrangebyscore zset 0 10 LIMIT 2 10] + assert_equal {} [r zrangebyscore zset 0 10 LIMIT 20 10] + assert_equal {f e} [r zrevrangebyscore zset 10 0 LIMIT 0 2] + assert_equal {d c b} [r zrevrangebyscore zset 10 0 LIMIT 2 3] + assert_equal {d c b} [r zrevrangebyscore zset 10 0 LIMIT 2 10] + assert_equal {} [r zrevrangebyscore zset 10 0 LIMIT 20 10] + } + + test "ZRANGEBYSCORE with LIMIT and WITHSCORES - $encoding" { + create_default_zset + assert_equal {e 4 f 5} [r zrangebyscore zset 2 5 LIMIT 2 3 WITHSCORES] + assert_equal {d 3 c 2} [r zrevrangebyscore zset 5 2 LIMIT 2 3 WITHSCORES] + assert_equal {} [r zrangebyscore zset 2 5 LIMIT 12 13 WITHSCORES] + } + + test "ZRANGEBYSCORE with non-value min or max - $encoding" { + assert_error "*not*float*" {r zrangebyscore fooz str 1} + assert_error "*not*float*" {r zrangebyscore fooz 1 str} + assert_error "*not*float*" {r zrangebyscore fooz 1 NaN} + } + + proc create_default_lex_zset {} { + create_zset zset {0 alpha 0 bar 0 cool 0 down + 0 elephant 0 foo 0 great 0 hill + 0 omega} + } + + test "ZRANGEBYLEX/ZREVRANGEBYLEX/ZLEXCOUNT basics - $encoding" { + create_default_lex_zset + + # inclusive range + assert_equal {alpha bar cool} [r zrangebylex zset - \[cool] + assert_equal {bar cool down} [r zrangebylex zset \[bar \[down] + assert_equal {great hill omega} [r zrangebylex zset \[g +] + assert_equal {cool bar alpha} [r zrevrangebylex zset \[cool -] + assert_equal {down cool bar} [r zrevrangebylex zset \[down \[bar] + assert_equal {omega hill great foo elephant down} [r zrevrangebylex zset + \[d] + assert_equal 3 [r zlexcount zset \[ele \[h] + + # exclusive range + assert_equal {alpha bar} [r zrangebylex zset - (cool] + assert_equal {cool} [r zrangebylex zset (bar (down] + assert_equal {hill omega} [r zrangebylex zset (great +] + assert_equal {bar alpha} [r zrevrangebylex zset (cool -] + assert_equal {cool} [r zrevrangebylex zset (down (bar] + assert_equal {omega hill} [r zrevrangebylex zset + (great] + assert_equal 2 [r zlexcount zset (ele (great] + + # inclusive and exclusive + assert_equal {} [r zrangebylex zset (az (b] + assert_equal {} [r zrangebylex zset (z +] + assert_equal {} [r zrangebylex zset - \[aaaa] + assert_equal {} [r zrevrangebylex zset \[elez \[elex] + assert_equal {} [r zrevrangebylex zset (hill (omega] + } + + test "ZLEXCOUNT advanced - $encoding" { + create_default_lex_zset + + assert_equal 9 [r zlexcount zset - +] + assert_equal 0 [r zlexcount zset + -] + assert_equal 0 [r zlexcount zset + \[c] + assert_equal 0 [r zlexcount zset \[c -] + assert_equal 8 [r zlexcount zset \[bar +] + assert_equal 5 [r zlexcount zset \[bar \[foo] + assert_equal 4 [r zlexcount zset \[bar (foo] + assert_equal 4 [r zlexcount zset (bar \[foo] + assert_equal 3 [r zlexcount zset (bar (foo] + assert_equal 5 [r zlexcount zset - (foo] + assert_equal 1 [r zlexcount zset (maxstring +] + } + + test "ZRANGEBYSLEX with LIMIT - $encoding" { + create_default_lex_zset + assert_equal {alpha bar} [r zrangebylex zset - \[cool LIMIT 0 2] + assert_equal {bar cool} [r zrangebylex zset - \[cool LIMIT 1 2] + assert_equal {} [r zrangebylex zset \[bar \[down LIMIT 0 0] + assert_equal {} [r zrangebylex zset \[bar \[down LIMIT 2 0] + assert_equal {bar} [r zrangebylex zset \[bar \[down LIMIT 0 1] + assert_equal {cool} [r zrangebylex zset \[bar \[down LIMIT 1 1] + assert_equal {bar cool down} [r zrangebylex zset \[bar \[down LIMIT 0 100] + assert_equal {omega hill great foo elephant} [r zrevrangebylex zset + \[d LIMIT 0 5] + assert_equal {omega hill great foo} [r zrevrangebylex zset + \[d LIMIT 0 4] + } + + test "ZRANGEBYLEX with invalid lex range specifiers - $encoding" { + assert_error "*not*string*" {r zrangebylex fooz foo bar} + assert_error "*not*string*" {r zrangebylex fooz \[foo bar} + assert_error "*not*string*" {r zrangebylex fooz foo \[bar} + assert_error "*not*string*" {r zrangebylex fooz +x \[bar} + assert_error "*not*string*" {r zrangebylex fooz -x \[bar} + } + + test "ZREMRANGEBYSCORE basics - $encoding" { + proc remrangebyscore {min max} { + create_zset zset {1 a 2 b 3 c 4 d 5 e} + assert_equal 1 [r exists zset] + r zremrangebyscore zset $min $max + } + + # inner range + assert_equal 3 [remrangebyscore 2 4] + assert_equal {a e} [r zrange zset 0 -1] + + # start underflow + assert_equal 1 [remrangebyscore -10 1] + assert_equal {b c d e} [r zrange zset 0 -1] + + # end overflow + assert_equal 1 [remrangebyscore 5 10] + assert_equal {a b c d} [r zrange zset 0 -1] + + # switch min and max + assert_equal 0 [remrangebyscore 4 2] + assert_equal {a b c d e} [r zrange zset 0 -1] + + # -inf to mid + assert_equal 3 [remrangebyscore -inf 3] + assert_equal {d e} [r zrange zset 0 -1] + + # mid to +inf + assert_equal 3 [remrangebyscore 3 +inf] + assert_equal {a b} [r zrange zset 0 -1] + + # -inf to +inf + assert_equal 5 [remrangebyscore -inf +inf] + assert_equal {} [r zrange zset 0 -1] + + # exclusive min + assert_equal 4 [remrangebyscore (1 5] + assert_equal {a} [r zrange zset 0 -1] + assert_equal 3 [remrangebyscore (2 5] + assert_equal {a b} [r zrange zset 0 -1] + + # exclusive max + assert_equal 4 [remrangebyscore 1 (5] + assert_equal {e} [r zrange zset 0 -1] + assert_equal 3 [remrangebyscore 1 (4] + assert_equal {d e} [r zrange zset 0 -1] + + # exclusive min and max + assert_equal 3 [remrangebyscore (1 (5] + assert_equal {a e} [r zrange zset 0 -1] + + # destroy when empty + assert_equal 5 [remrangebyscore 1 5] + assert_equal 0 [r exists zset] + } + + test "ZREMRANGEBYSCORE with non-value min or max - $encoding" { + assert_error "*not*float*" {r zremrangebyscore fooz str 1} + assert_error "*not*float*" {r zremrangebyscore fooz 1 str} + assert_error "*not*float*" {r zremrangebyscore fooz 1 NaN} + } + + test "ZREMRANGEBYRANK basics - $encoding" { + proc remrangebyrank {min max} { + create_zset zset {1 a 2 b 3 c 4 d 5 e} + assert_equal 1 [r exists zset] + r zremrangebyrank zset $min $max + } + + # inner range + assert_equal 3 [remrangebyrank 1 3] + assert_equal {a e} [r zrange zset 0 -1] + + # start underflow + assert_equal 1 [remrangebyrank -10 0] + assert_equal {b c d e} [r zrange zset 0 -1] + + # start overflow + assert_equal 0 [remrangebyrank 10 -1] + assert_equal {a b c d e} [r zrange zset 0 -1] + + # end underflow + assert_equal 0 [remrangebyrank 0 -10] + assert_equal {a b c d e} [r zrange zset 0 -1] + + # end overflow + assert_equal 5 [remrangebyrank 0 10] + assert_equal {} [r zrange zset 0 -1] + + # destroy when empty + assert_equal 5 [remrangebyrank 0 4] + assert_equal 0 [r exists zset] + } + + test "ZUNIONSTORE against non-existing key doesn't set destination - $encoding" { + r del zseta{t} + assert_equal 0 [r zunionstore dst_key{t} 1 zseta{t}] + assert_equal 0 [r exists dst_key{t}] + } + + test "ZUNION/ZINTER/ZINTERCARD/ZDIFF against non-existing key - $encoding" { + r del zseta + assert_equal {} [r zunion 1 zseta] + assert_equal {} [r zinter 1 zseta] + assert_equal 0 [r zintercard 1 zseta] + assert_equal 0 [r zintercard 1 zseta limit 0] + assert_equal {} [r zdiff 1 zseta] + } + + test "ZUNIONSTORE with empty set - $encoding" { + r del zseta{t} zsetb{t} + r zadd zseta{t} 1 a + r zadd zseta{t} 2 b + r zunionstore zsetc{t} 2 zseta{t} zsetb{t} + r zrange zsetc{t} 0 -1 withscores + } {a 1 b 2} + + test "ZUNION/ZINTER/ZINTERCARD/ZDIFF with empty set - $encoding" { + r del zseta{t} zsetb{t} + r zadd zseta{t} 1 a + r zadd zseta{t} 2 b + assert_equal {a 1 b 2} [r zunion 2 zseta{t} zsetb{t} withscores] + assert_equal {} [r zinter 2 zseta{t} zsetb{t} withscores] + assert_equal 0 [r zintercard 2 zseta{t} zsetb{t}] + assert_equal 0 [r zintercard 2 zseta{t} zsetb{t} limit 0] + assert_equal {a 1 b 2} [r zdiff 2 zseta{t} zsetb{t} withscores] + } + + test "ZUNIONSTORE basics - $encoding" { + r del zseta{t} zsetb{t} zsetc{t} + r zadd zseta{t} 1 a + r zadd zseta{t} 2 b + r zadd zseta{t} 3 c + r zadd zsetb{t} 1 b + r zadd zsetb{t} 2 c + r zadd zsetb{t} 3 d + + assert_equal 4 [r zunionstore zsetc{t} 2 zseta{t} zsetb{t}] + assert_equal {a 1 b 3 d 3 c 5} [r zrange zsetc{t} 0 -1 withscores] + } + + test "ZUNION/ZINTER/ZINTERCARD/ZDIFF with integer members - $encoding" { + r del zsetd{t} zsetf{t} + r zadd zsetd{t} 1 1 + r zadd zsetd{t} 2 2 + r zadd zsetd{t} 3 3 + r zadd zsetf{t} 1 1 + r zadd zsetf{t} 3 3 + r zadd zsetf{t} 4 4 + + assert_equal {1 2 2 2 4 4 3 6} [r zunion 2 zsetd{t} zsetf{t} withscores] + assert_equal {1 2 3 6} [r zinter 2 zsetd{t} zsetf{t} withscores] + assert_equal 2 [r zintercard 2 zsetd{t} zsetf{t}] + assert_equal 2 [r zintercard 2 zsetd{t} zsetf{t} limit 0] + assert_equal {2 2} [r zdiff 2 zsetd{t} zsetf{t} withscores] + } + + test "ZUNIONSTORE with weights - $encoding" { + assert_equal 4 [r zunionstore zsetc{t} 2 zseta{t} zsetb{t} weights 2 3] + assert_equal {a 2 b 7 d 9 c 12} [r zrange zsetc{t} 0 -1 withscores] + } + + test "ZUNION with weights - $encoding" { + assert_equal {a 2 b 7 d 9 c 12} [r zunion 2 zseta{t} zsetb{t} weights 2 3 withscores] + assert_equal {b 7 c 12} [r zinter 2 zseta{t} zsetb{t} weights 2 3 withscores] + } + + test "ZUNIONSTORE with a regular set and weights - $encoding" { + r del seta{t} + r sadd seta{t} a + r sadd seta{t} b + r sadd seta{t} c + + assert_equal 4 [r zunionstore zsetc{t} 2 seta{t} zsetb{t} weights 2 3] + assert_equal {a 2 b 5 c 8 d 9} [r zrange zsetc{t} 0 -1 withscores] + } + + test "ZUNIONSTORE with AGGREGATE MIN - $encoding" { + assert_equal 4 [r zunionstore zsetc{t} 2 zseta{t} zsetb{t} aggregate min] + assert_equal {a 1 b 1 c 2 d 3} [r zrange zsetc{t} 0 -1 withscores] + } + + test "ZUNION/ZINTER with AGGREGATE MIN - $encoding" { + assert_equal {a 1 b 1 c 2 d 3} [r zunion 2 zseta{t} zsetb{t} aggregate min withscores] + assert_equal {b 1 c 2} [r zinter 2 zseta{t} zsetb{t} aggregate min withscores] + } + + test "ZUNIONSTORE with AGGREGATE MAX - $encoding" { + assert_equal 4 [r zunionstore zsetc{t} 2 zseta{t} zsetb{t} aggregate max] + assert_equal {a 1 b 2 c 3 d 3} [r zrange zsetc{t} 0 -1 withscores] + } + + test "ZUNION/ZINTER with AGGREGATE MAX - $encoding" { + assert_equal {a 1 b 2 c 3 d 3} [r zunion 2 zseta{t} zsetb{t} aggregate max withscores] + assert_equal {b 2 c 3} [r zinter 2 zseta{t} zsetb{t} aggregate max withscores] + } + + test "ZINTERSTORE basics - $encoding" { + assert_equal 2 [r zinterstore zsetc{t} 2 zseta{t} zsetb{t}] + assert_equal {b 3 c 5} [r zrange zsetc{t} 0 -1 withscores] + } + + test "ZINTER basics - $encoding" { + assert_equal {b 3 c 5} [r zinter 2 zseta{t} zsetb{t} withscores] + } + + test "ZINTERCARD with illegal arguments" { + assert_error "ERR syntax error*" {r zintercard 1 zseta{t} zseta{t}} + assert_error "ERR syntax error*" {r zintercard 1 zseta{t} bar_arg} + assert_error "ERR syntax error*" {r zintercard 1 zseta{t} LIMIT} + + assert_error "ERR LIMIT*" {r zintercard 1 myset{t} LIMIT -1} + assert_error "ERR LIMIT*" {r zintercard 1 myset{t} LIMIT a} + } + + test "ZINTERCARD basics - $encoding" { + assert_equal 2 [r zintercard 2 zseta{t} zsetb{t}] + assert_equal 2 [r zintercard 2 zseta{t} zsetb{t} limit 0] + assert_equal 1 [r zintercard 2 zseta{t} zsetb{t} limit 1] + assert_equal 2 [r zintercard 2 zseta{t} zsetb{t} limit 10] + } + + test "ZINTER RESP3 - $encoding" { + r hello 3 + assert_equal {{b 3.0} {c 5.0}} [r zinter 2 zseta{t} zsetb{t} withscores] + r hello 2 + } + + test "ZINTERSTORE with weights - $encoding" { + assert_equal 2 [r zinterstore zsetc{t} 2 zseta{t} zsetb{t} weights 2 3] + assert_equal {b 7 c 12} [r zrange zsetc{t} 0 -1 withscores] + } + + test "ZINTER with weights - $encoding" { + assert_equal {b 7 c 12} [r zinter 2 zseta{t} zsetb{t} weights 2 3 withscores] + } + + test "ZINTERSTORE with a regular set and weights - $encoding" { + r del seta{t} + r sadd seta{t} a + r sadd seta{t} b + r sadd seta{t} c + assert_equal 2 [r zinterstore zsetc{t} 2 seta{t} zsetb{t} weights 2 3] + assert_equal {b 5 c 8} [r zrange zsetc{t} 0 -1 withscores] + } + + test "ZINTERSTORE with AGGREGATE MIN - $encoding" { + assert_equal 2 [r zinterstore zsetc{t} 2 zseta{t} zsetb{t} aggregate min] + assert_equal {b 1 c 2} [r zrange zsetc{t} 0 -1 withscores] + } + + test "ZINTERSTORE with AGGREGATE MAX - $encoding" { + assert_equal 2 [r zinterstore zsetc{t} 2 zseta{t} zsetb{t} aggregate max] + assert_equal {b 2 c 3} [r zrange zsetc{t} 0 -1 withscores] + } + + foreach cmd {ZUNIONSTORE ZINTERSTORE} { + test "$cmd with +inf/-inf scores - $encoding" { + r del zsetinf1{t} zsetinf2{t} + + r zadd zsetinf1{t} +inf key + r zadd zsetinf2{t} +inf key + r $cmd zsetinf3{t} 2 zsetinf1{t} zsetinf2{t} + assert_equal inf [r zscore zsetinf3{t} key] + + r zadd zsetinf1{t} -inf key + r zadd zsetinf2{t} +inf key + r $cmd zsetinf3{t} 2 zsetinf1{t} zsetinf2{t} + assert_equal 0 [r zscore zsetinf3{t} key] + + r zadd zsetinf1{t} +inf key + r zadd zsetinf2{t} -inf key + r $cmd zsetinf3{t} 2 zsetinf1{t} zsetinf2{t} + assert_equal 0 [r zscore zsetinf3{t} key] + + r zadd zsetinf1{t} -inf key + r zadd zsetinf2{t} -inf key + r $cmd zsetinf3{t} 2 zsetinf1{t} zsetinf2{t} + assert_equal -inf [r zscore zsetinf3{t} key] + } + + test "$cmd with NaN weights - $encoding" { + r del zsetinf1{t} zsetinf2{t} + + r zadd zsetinf1{t} 1.0 key + r zadd zsetinf2{t} 1.0 key + assert_error "*weight*not*float*" { + r $cmd zsetinf3{t} 2 zsetinf1{t} zsetinf2{t} weights nan nan + } + } + } + + test "ZDIFFSTORE basics - $encoding" { + assert_equal 1 [r zdiffstore zsetc{t} 2 zseta{t} zsetb{t}] + assert_equal {a 1} [r zrange zsetc{t} 0 -1 withscores] + } + + test "ZDIFF basics - $encoding" { + assert_equal {a 1} [r zdiff 2 zseta{t} zsetb{t} withscores] + } + + test "ZDIFFSTORE with a regular set - $encoding" { + r del seta{t} + r sadd seta{t} a + r sadd seta{t} b + r sadd seta{t} c + assert_equal 1 [r zdiffstore zsetc{t} 2 seta{t} zsetb{t}] + assert_equal {a 1} [r zrange zsetc{t} 0 -1 withscores] + } + + test "ZDIFF subtracting set from itself - $encoding" { + assert_equal 0 [r zdiffstore zsetc{t} 2 zseta{t} zseta{t}] + assert_equal {} [r zrange zsetc{t} 0 -1 withscores] + } + + test "ZDIFF algorithm 1 - $encoding" { + r del zseta{t} zsetb{t} zsetc{t} + r zadd zseta{t} 1 a + r zadd zseta{t} 2 b + r zadd zseta{t} 3 c + r zadd zsetb{t} 1 b + r zadd zsetb{t} 2 c + r zadd zsetb{t} 3 d + assert_equal 1 [r zdiffstore zsetc{t} 2 zseta{t} zsetb{t}] + assert_equal {a 1} [r zrange zsetc{t} 0 -1 withscores] + } + + test "ZDIFF algorithm 2 - $encoding" { + r del zseta{t} zsetb{t} zsetc{t} zsetd{t} zsete{t} + r zadd zseta{t} 1 a + r zadd zseta{t} 2 b + r zadd zseta{t} 3 c + r zadd zseta{t} 5 e + r zadd zsetb{t} 1 b + r zadd zsetc{t} 1 c + r zadd zsetd{t} 1 d + assert_equal 2 [r zdiffstore zsete{t} 4 zseta{t} zsetb{t} zsetc{t} zsetd{t}] + assert_equal {a 1 e 5} [r zrange zsete{t} 0 -1 withscores] + } + + test "ZDIFF fuzzing - $encoding" { + for {set j 0} {$j < 100} {incr j} { + unset -nocomplain s + array set s {} + set args {} + set num_sets [expr {[randomInt 10]+1}] + for {set i 0} {$i < $num_sets} {incr i} { + set num_elements [randomInt 100] + r del zset_$i{t} + lappend args zset_$i{t} + while {$num_elements} { + set ele [randomValue] + r zadd zset_$i{t} [randomInt 100] $ele + if {$i == 0} { + set s($ele) x + } else { + unset -nocomplain s($ele) + } + incr num_elements -1 + } + } + set result [lsort [r zdiff [llength $args] {*}$args]] + assert_equal $result [lsort [array names s]] + } + } + + foreach {pop} {ZPOPMIN ZPOPMAX} { + test "$pop with the count 0 returns an empty array" { + r del zset + r zadd zset 1 a 2 b 3 c + assert_equal {} [r $pop zset 0] + + # Make sure we can distinguish between an empty array and a null response + r readraw 1 + assert_equal {*0} [r $pop zset 0] + r readraw 0 + + assert_equal 3 [r zcard zset] + } + + test "$pop with negative count" { + r set zset foo + assert_error "ERR *must be positive" {r $pop zset -1} + + r del zset + assert_error "ERR *must be positive" {r $pop zset -2} + + r zadd zset 1 a 2 b 3 c + assert_error "ERR *must be positive" {r $pop zset -3} + } + } + + foreach {popmin popmax} {ZPOPMIN ZPOPMAX ZMPOP_MIN ZMPOP_MAX} { + test "Basic $popmin/$popmax with a single key - $encoding" { + r del zset + verify_zpop_response r $popmin zset 0 {} {} + + create_zset zset {-1 a 1 b 2 c 3 d 4 e} + verify_zpop_response r $popmin zset 0 {a -1} {zset {{a -1}}} + verify_zpop_response r $popmin zset 0 {b 1} {zset {{b 1}}} + verify_zpop_response r $popmax zset 0 {e 4} {zset {{e 4}}} + verify_zpop_response r $popmax zset 0 {d 3} {zset {{d 3}}} + verify_zpop_response r $popmin zset 0 {c 2} {zset {{c 2}}} + assert_equal 0 [r exists zset] + } + + test "$popmin/$popmax with count - $encoding" { + r del z1 + verify_zpop_response r $popmin z1 2 {} {} + + create_zset z1 {0 a 1 b 2 c 3 d} + verify_zpop_response r $popmin z1 2 {a 0 b 1} {z1 {{a 0} {b 1}}} + verify_zpop_response r $popmax z1 2 {d 3 c 2} {z1 {{d 3} {c 2}}} + } + } + + foreach {popmin popmax} {BZPOPMIN BZPOPMAX BZMPOP_MIN BZMPOP_MAX} { + test "$popmin/$popmax with a single existing sorted set - $encoding" { + set rd [redis_deferring_client] + create_zset zset {0 a 1 b 2 c 3 d} + + verify_bzpop_response $rd $popmin zset 5 0 {zset a 0} {zset {{a 0}}} + verify_bzpop_response $rd $popmax zset 5 0 {zset d 3} {zset {{d 3}}} + verify_bzpop_response $rd $popmin zset 5 0 {zset b 1} {zset {{b 1}}} + verify_bzpop_response $rd $popmax zset 5 0 {zset c 2} {zset {{c 2}}} + assert_equal 0 [r exists zset] + $rd close + } + + test "$popmin/$popmax with multiple existing sorted sets - $encoding" { + set rd [redis_deferring_client] + create_zset z1{t} {0 a 1 b 2 c} + create_zset z2{t} {3 d 4 e 5 f} + + verify_bzpop_two_key_response $rd $popmin z1{t} z2{t} 5 0 {z1{t} a 0} {z1{t} {{a 0}}} + verify_bzpop_two_key_response $rd $popmax z1{t} z2{t} 5 0 {z1{t} c 2} {z1{t} {{c 2}}} + assert_equal 1 [r zcard z1{t}] + assert_equal 3 [r zcard z2{t}] + + verify_bzpop_two_key_response $rd $popmax z2{t} z1{t} 5 0 {z2{t} f 5} {z2{t} {{f 5}}} + verify_bzpop_two_key_response $rd $popmin z2{t} z1{t} 5 0 {z2{t} d 3} {z2{t} {{d 3}}} + assert_equal 1 [r zcard z1{t}] + assert_equal 1 [r zcard z2{t}] + $rd close + } + + test "$popmin/$popmax second sorted set has members - $encoding" { + set rd [redis_deferring_client] + r del z1{t} + create_zset z2{t} {3 d 4 e 5 f} + + verify_bzpop_two_key_response $rd $popmax z1{t} z2{t} 5 0 {z2{t} f 5} {z2{t} {{f 5}}} + verify_bzpop_two_key_response $rd $popmin z1{t} z2{t} 5 0 {z2{t} d 3} {z2{t} {{d 3}}} + assert_equal 0 [r zcard z1{t}] + assert_equal 1 [r zcard z2{t}] + $rd close + } + } + + foreach {popmin popmax} {ZPOPMIN ZPOPMAX ZMPOP_MIN ZMPOP_MAX} { + test "Basic $popmin/$popmax - $encoding RESP3" { + r hello 3 + create_zset z1 {0 a 1 b 2 c 3 d} + verify_zpop_response r $popmin z1 0 {a 0.0} {z1 {{a 0.0}}} + verify_zpop_response r $popmax z1 0 {d 3.0} {z1 {{d 3.0}}} + r hello 2 + } + + test "$popmin/$popmax with count - $encoding RESP3" { + r hello 3 + create_zset z1 {0 a 1 b 2 c 3 d} + verify_zpop_response r $popmin z1 2 {{a 0.0} {b 1.0}} {z1 {{a 0.0} {b 1.0}}} + verify_zpop_response r $popmax z1 2 {{d 3.0} {c 2.0}} {z1 {{d 3.0} {c 2.0}}} + r hello 2 + } + } + + foreach {popmin popmax} {BZPOPMIN BZPOPMAX BZMPOP_MIN BZMPOP_MAX} { + test "$popmin/$popmax - $encoding RESP3" { + r hello 3 + set rd [redis_deferring_client] + create_zset zset {0 a 1 b 2 c 3 d} + + verify_bzpop_response $rd $popmin zset 5 0 {zset a 0} {zset {{a 0}}} + verify_bzpop_response $rd $popmax zset 5 0 {zset d 3} {zset {{d 3}}} + verify_bzpop_response $rd $popmin zset 5 0 {zset b 1} {zset {{b 1}}} + verify_bzpop_response $rd $popmax zset 5 0 {zset c 2} {zset {{c 2}}} + + assert_equal 0 [r exists zset] + r hello 2 + $rd close + } + } + + r config set zset-max-ziplist-entries $original_max_entries + r config set zset-max-ziplist-value $original_max_value + } + + basics listpack + basics skiplist + + test "ZPOP/ZMPOP against wrong type" { + r set foo{t} bar + assert_error "*WRONGTYPE*" {r zpopmin foo{t}} + assert_error "*WRONGTYPE*" {r zpopmin foo{t} 0} + assert_error "*WRONGTYPE*" {r zpopmax foo{t}} + assert_error "*WRONGTYPE*" {r zpopmax foo{t} 0} + assert_error "*WRONGTYPE*" {r zpopmin foo{t} 2} + + assert_error "*WRONGTYPE*" {r zmpop 1 foo{t} min} + assert_error "*WRONGTYPE*" {r zmpop 1 foo{t} max} + assert_error "*WRONGTYPE*" {r zmpop 1 foo{t} max count 200} + + r del foo{t} + r set foo2{t} bar + assert_error "*WRONGTYPE*" {r zmpop 2 foo{t} foo2{t} min} + assert_error "*WRONGTYPE*" {r zmpop 2 foo2{t} foo1{t} max count 1} + } + + test "ZMPOP with illegal argument" { + assert_error "ERR wrong number of arguments for 'zmpop' command" {r zmpop} + assert_error "ERR wrong number of arguments for 'zmpop' command" {r zmpop 1} + assert_error "ERR wrong number of arguments for 'zmpop' command" {r zmpop 1 myzset{t}} + + assert_error "ERR numkeys*" {r zmpop 0 myzset{t} MIN} + assert_error "ERR numkeys*" {r zmpop a myzset{t} MIN} + assert_error "ERR numkeys*" {r zmpop -1 myzset{t} MAX} + + assert_error "ERR syntax error*" {r zmpop 1 myzset{t} bad_where} + assert_error "ERR syntax error*" {r zmpop 1 myzset{t} MIN bar_arg} + assert_error "ERR syntax error*" {r zmpop 1 myzset{t} MAX MIN} + assert_error "ERR syntax error*" {r zmpop 1 myzset{t} COUNT} + assert_error "ERR syntax error*" {r zmpop 1 myzset{t} MAX COUNT 1 COUNT 2} + assert_error "ERR syntax error*" {r zmpop 2 myzset{t} myzset2{t} bad_arg} + + assert_error "ERR count*" {r zmpop 1 myzset{t} MIN COUNT 0} + assert_error "ERR count*" {r zmpop 1 myzset{t} MAX COUNT a} + assert_error "ERR count*" {r zmpop 1 myzset{t} MIN COUNT -1} + assert_error "ERR count*" {r zmpop 2 myzset{t} myzset2{t} MAX COUNT -1} + } + + test "ZMPOP propagate as pop with count command to replica" { + set repl [attach_to_replication_stream] + + # ZMPOP min/max propagate as ZPOPMIN/ZPOPMAX with count + r zadd myzset{t} 1 one 2 two 3 three + + # Pop elements from one zset. + r zmpop 1 myzset{t} min + r zmpop 1 myzset{t} max count 1 + + # Now the zset have only one element + r zmpop 2 myzset{t} myzset2{t} min count 10 + + # No elements so we don't propagate. + r zmpop 2 myzset{t} myzset2{t} max count 10 + + # Pop elements from the second zset. + r zadd myzset2{t} 1 one 2 two 3 three + r zmpop 2 myzset{t} myzset2{t} min count 2 + r zmpop 2 myzset{t} myzset2{t} max count 1 + + # Pop all elements. + r zadd myzset{t} 1 one 2 two 3 three + r zadd myzset2{t} 4 four 5 five 6 six + r zmpop 2 myzset{t} myzset2{t} min count 10 + r zmpop 2 myzset{t} myzset2{t} max count 10 + + assert_replication_stream $repl { + {select *} + {zadd myzset{t} 1 one 2 two 3 three} + {zpopmin myzset{t} 1} + {zpopmax myzset{t} 1} + {zpopmin myzset{t} 1} + {zadd myzset2{t} 1 one 2 two 3 three} + {zpopmin myzset2{t} 2} + {zpopmax myzset2{t} 1} + {zadd myzset{t} 1 one 2 two 3 three} + {zadd myzset2{t} 4 four 5 five 6 six} + {zpopmin myzset{t} 3} + {zpopmax myzset2{t} 3} + } + close_replication_stream $repl + } {} {needs:repl} + + foreach resp {3 2} { + set rd [redis_deferring_client] + + if {[lsearch $::denytags "resp3"] >= 0} { + if {$resp == 3} {continue} + } else { + r hello $resp + $rd hello $resp + $rd read + } + + test "ZPOPMIN/ZPOPMAX readraw in RESP$resp" { + r del zset{t} + create_zset zset2{t} {1 a 2 b 3 c 4 d 5 e} + + r readraw 1 + + # ZPOP against non existing key. + assert_equal {*0} [r zpopmin zset{t}] + assert_equal {*0} [r zpopmin zset{t} 1] + + # ZPOP without COUNT option. + assert_equal {*2} [r zpopmin zset2{t}] + assert_equal [r read] {$1} + assert_equal [r read] {a} + verify_score_response r $resp 1 + + # ZPOP with COUNT option. + if {$resp == 2} { + assert_equal {*2} [r zpopmax zset2{t} 1] + assert_equal [r read] {$1} + assert_equal [r read] {e} + } elseif {$resp == 3} { + assert_equal {*1} [r zpopmax zset2{t} 1] + assert_equal [r read] {*2} + assert_equal [r read] {$1} + assert_equal [r read] {e} + } + verify_score_response r $resp 5 + + r readraw 0 + } + + test "BZPOPMIN/BZPOPMAX readraw in RESP$resp" { + r del zset{t} + create_zset zset2{t} {1 a 2 b 3 c 4 d 5 e} + + $rd readraw 1 + + # BZPOP released on timeout. + $rd bzpopmin zset{t} 0.01 + verify_nil_response $resp [$rd read] + $rd bzpopmax zset{t} 0.01 + verify_nil_response $resp [$rd read] + + # BZPOP non-blocking path. + $rd bzpopmin zset1{t} zset2{t} 0.1 + assert_equal [$rd read] {*3} + assert_equal [$rd read] {$8} + assert_equal [$rd read] {zset2{t}} + assert_equal [$rd read] {$1} + assert_equal [$rd read] {a} + verify_score_response $rd $resp 1 + + # BZPOP blocking path. + $rd bzpopmin zset{t} 5 + wait_for_blocked_client + r zadd zset{t} 1 a + assert_equal [$rd read] {*3} + assert_equal [$rd read] {$7} + assert_equal [$rd read] {zset{t}} + assert_equal [$rd read] {$1} + assert_equal [$rd read] {a} + verify_score_response $rd $resp 1 + + $rd readraw 0 + } + + test "ZMPOP readraw in RESP$resp" { + r del zset{t} zset2{t} + create_zset zset3{t} {1 a} + create_zset zset4{t} {1 a 2 b 3 c 4 d 5 e} + + r readraw 1 + + # ZMPOP against non existing key. + verify_nil_response $resp [r zmpop 1 zset{t} min] + verify_nil_response $resp [r zmpop 1 zset{t} max count 1] + verify_nil_response $resp [r zmpop 2 zset{t} zset2{t} min] + verify_nil_response $resp [r zmpop 2 zset{t} zset2{t} max count 1] + + # ZMPOP with one input key. + assert_equal {*2} [r zmpop 1 zset3{t} max] + assert_equal [r read] {$8} + assert_equal [r read] {zset3{t}} + assert_equal [r read] {*1} + assert_equal [r read] {*2} + assert_equal [r read] {$1} + assert_equal [r read] {a} + verify_score_response r $resp 1 + + # ZMPOP with COUNT option. + assert_equal {*2} [r zmpop 2 zset3{t} zset4{t} min count 2] + assert_equal [r read] {$8} + assert_equal [r read] {zset4{t}} + assert_equal [r read] {*2} + assert_equal [r read] {*2} + assert_equal [r read] {$1} + assert_equal [r read] {a} + verify_score_response r $resp 1 + assert_equal [r read] {*2} + assert_equal [r read] {$1} + assert_equal [r read] {b} + verify_score_response r $resp 2 + + r readraw 0 + } + + test "BZMPOP readraw in RESP$resp" { + r del zset{t} zset2{t} + create_zset zset3{t} {1 a 2 b 3 c 4 d 5 e} + + $rd readraw 1 + + # BZMPOP released on timeout. + $rd bzmpop 0.01 1 zset{t} min + verify_nil_response $resp [$rd read] + $rd bzmpop 0.01 2 zset{t} zset2{t} max + verify_nil_response $resp [$rd read] + + # BZMPOP non-blocking path. + $rd bzmpop 0.1 2 zset3{t} zset4{t} min + + assert_equal [$rd read] {*2} + assert_equal [$rd read] {$8} + assert_equal [$rd read] {zset3{t}} + assert_equal [$rd read] {*1} + assert_equal [$rd read] {*2} + assert_equal [$rd read] {$1} + assert_equal [$rd read] {a} + verify_score_response $rd $resp 1 + + # BZMPOP blocking path with COUNT option. + $rd bzmpop 5 2 zset{t} zset2{t} max count 2 + wait_for_blocked_client + r zadd zset2{t} 1 a 2 b 3 c + + assert_equal [$rd read] {*2} + assert_equal [$rd read] {$8} + assert_equal [$rd read] {zset2{t}} + assert_equal [$rd read] {*2} + assert_equal [$rd read] {*2} + assert_equal [$rd read] {$1} + assert_equal [$rd read] {c} + verify_score_response $rd $resp 3 + assert_equal [$rd read] {*2} + assert_equal [$rd read] {$1} + assert_equal [$rd read] {b} + verify_score_response $rd $resp 2 + + } + + $rd close + } + + test {ZINTERSTORE regression with two sets, intset+hashtable} { + r del seta{t} setb{t} setc{t} + r sadd set1{t} a + r sadd set2{t} 10 + r zinterstore set3{t} 2 set1{t} set2{t} + } {0} + + test {ZUNIONSTORE regression, should not create NaN in scores} { + r zadd z{t} -inf neginf + r zunionstore out{t} 1 z{t} weights 0 + r zrange out{t} 0 -1 withscores + } {neginf 0} + + test {ZINTERSTORE #516 regression, mixed sets and ziplist zsets} { + r sadd one{t} 100 101 102 103 + r sadd two{t} 100 200 201 202 + r zadd three{t} 1 500 1 501 1 502 1 503 1 100 + r zinterstore to_here{t} 3 one{t} two{t} three{t} WEIGHTS 0 0 1 + r zrange to_here{t} 0 -1 + } {100} + + test {ZUNIONSTORE result is sorted} { + # Create two sets with common and not common elements, perform + # the UNION, check that elements are still sorted. + r del one{t} two{t} dest{t} + set cmd1 [list r zadd one{t}] + set cmd2 [list r zadd two{t}] + for {set j 0} {$j < 1000} {incr j} { + lappend cmd1 [expr rand()] [randomInt 1000] + lappend cmd2 [expr rand()] [randomInt 1000] + } + {*}$cmd1 + {*}$cmd2 + assert {[r zcard one{t}] > 100} + assert {[r zcard two{t}] > 100} + r zunionstore dest{t} 2 one{t} two{t} + set oldscore 0 + foreach {ele score} [r zrange dest{t} 0 -1 withscores] { + assert {$score >= $oldscore} + set oldscore $score + } + } + + test "ZUNIONSTORE/ZINTERSTORE/ZDIFFSTORE error if using WITHSCORES " { + assert_error "*ERR*syntax*" {r zunionstore foo{t} 2 zsetd{t} zsetf{t} withscores} + assert_error "*ERR*syntax*" {r zinterstore foo{t} 2 zsetd{t} zsetf{t} withscores} + assert_error "*ERR*syntax*" {r zdiffstore foo{t} 2 zsetd{t} zsetf{t} withscores} + } + + test {ZMSCORE retrieve} { + r del zmscoretest + r zadd zmscoretest 10 x + r zadd zmscoretest 20 y + + r zmscore zmscoretest x y + } {10 20} + + test {ZMSCORE retrieve from empty set} { + r del zmscoretest + + r zmscore zmscoretest x y + } {{} {}} + + test {ZMSCORE retrieve with missing member} { + r del zmscoretest + r zadd zmscoretest 10 x + + r zmscore zmscoretest x y + } {10 {}} + + test {ZMSCORE retrieve single member} { + r del zmscoretest + r zadd zmscoretest 10 x + r zadd zmscoretest 20 y + + r zmscore zmscoretest x + } {10} + + test {ZMSCORE retrieve requires one or more members} { + r del zmscoretest + r zadd zmscoretest 10 x + r zadd zmscoretest 20 y + + catch {r zmscore zmscoretest} e + assert_match {*ERR*wrong*number*arg*} $e + } + + test "ZSET commands don't accept the empty strings as valid score" { + assert_error "*not*float*" {r zadd myzset "" abc} + } + + test "zunionInterDiffGenericCommand at least 1 input key" { + assert_error {*at least 1 input key * 'zunion' command} {r zunion 0 key{t}} + assert_error {*at least 1 input key * 'zunionstore' command} {r zunionstore dst_key{t} 0 key{t}} + assert_error {*at least 1 input key * 'zinter' command} {r zinter 0 key{t}} + assert_error {*at least 1 input key * 'zinterstore' command} {r zinterstore dst_key{t} 0 key{t}} + assert_error {*at least 1 input key * 'zdiff' command} {r zdiff 0 key{t}} + assert_error {*at least 1 input key * 'zdiffstore' command} {r zdiffstore dst_key{t} 0 key{t}} + assert_error {*at least 1 input key * 'zintercard' command} {r zintercard 0 key{t}} + } + + proc stressers {encoding} { + set original_max_entries [lindex [r config get zset-max-ziplist-entries] 1] + set original_max_value [lindex [r config get zset-max-ziplist-value] 1] + if {$encoding == "listpack"} { + # Little extra to allow proper fuzzing in the sorting stresser + r config set zset-max-ziplist-entries 256 + r config set zset-max-ziplist-value 64 + set elements 128 + } elseif {$encoding == "skiplist"} { + r config set zset-max-ziplist-entries 0 + r config set zset-max-ziplist-value 0 + if {$::accurate} {set elements 1000} else {set elements 100} + } else { + puts "Unknown sorted set encoding" + exit + } + + test "ZSCORE - $encoding" { + r del zscoretest + set aux {} + for {set i 0} {$i < $elements} {incr i} { + set score [expr rand()] + lappend aux $score + r zadd zscoretest $score $i + } + + assert_encoding $encoding zscoretest + for {set i 0} {$i < $elements} {incr i} { + assert_equal [lindex $aux $i] [r zscore zscoretest $i] + } + } + + test "ZMSCORE - $encoding" { + r del zscoretest + set aux {} + for {set i 0} {$i < $elements} {incr i} { + set score [expr rand()] + lappend aux $score + r zadd zscoretest $score $i + } + + assert_encoding $encoding zscoretest + for {set i 0} {$i < $elements} {incr i} { + assert_equal [lindex $aux $i] [r zmscore zscoretest $i] + } + } + + test "ZSCORE after a DEBUG RELOAD - $encoding" { + r del zscoretest + set aux {} + for {set i 0} {$i < $elements} {incr i} { + set score [expr rand()] + lappend aux $score + r zadd zscoretest $score $i + } + + r debug reload + assert_encoding $encoding zscoretest + for {set i 0} {$i < $elements} {incr i} { + assert_equal [lindex $aux $i] [r zscore zscoretest $i] + } + } {} {needs:debug} + + test "ZSET sorting stresser - $encoding" { + set delta 0 + for {set test 0} {$test < 2} {incr test} { + unset -nocomplain auxarray + array set auxarray {} + set auxlist {} + r del myzset + for {set i 0} {$i < $elements} {incr i} { + if {$test == 0} { + set score [expr rand()] + } else { + set score [expr int(rand()*10)] + } + set auxarray($i) $score + r zadd myzset $score $i + # Random update + if {[expr rand()] < .2} { + set j [expr int(rand()*1000)] + if {$test == 0} { + set score [expr rand()] + } else { + set score [expr int(rand()*10)] + } + set auxarray($j) $score + r zadd myzset $score $j + } + } + foreach {item score} [array get auxarray] { + lappend auxlist [list $score $item] + } + set sorted [lsort -command zlistAlikeSort $auxlist] + set auxlist {} + foreach x $sorted { + lappend auxlist [lindex $x 1] + } + + assert_encoding $encoding myzset + set fromredis [r zrange myzset 0 -1] + set delta 0 + for {set i 0} {$i < [llength $fromredis]} {incr i} { + if {[lindex $fromredis $i] != [lindex $auxlist $i]} { + incr delta + } + } + } + assert_equal 0 $delta + } + + test "ZRANGEBYSCORE fuzzy test, 100 ranges in $elements element sorted set - $encoding" { + set err {} + r del zset + for {set i 0} {$i < $elements} {incr i} { + r zadd zset [expr rand()] $i + } + + assert_encoding $encoding zset + for {set i 0} {$i < 100} {incr i} { + set min [expr rand()] + set max [expr rand()] + if {$min > $max} { + set aux $min + set min $max + set max $aux + } + set low [r zrangebyscore zset -inf $min] + set ok [r zrangebyscore zset $min $max] + set high [r zrangebyscore zset $max +inf] + set lowx [r zrangebyscore zset -inf ($min] + set okx [r zrangebyscore zset ($min ($max] + set highx [r zrangebyscore zset ($max +inf] + + if {[r zcount zset -inf $min] != [llength $low]} { + append err "Error, len does not match zcount\n" + } + if {[r zcount zset $min $max] != [llength $ok]} { + append err "Error, len does not match zcount\n" + } + if {[r zcount zset $max +inf] != [llength $high]} { + append err "Error, len does not match zcount\n" + } + if {[r zcount zset -inf ($min] != [llength $lowx]} { + append err "Error, len does not match zcount\n" + } + if {[r zcount zset ($min ($max] != [llength $okx]} { + append err "Error, len does not match zcount\n" + } + if {[r zcount zset ($max +inf] != [llength $highx]} { + append err "Error, len does not match zcount\n" + } + + foreach x $low { + set score [r zscore zset $x] + if {$score > $min} { + append err "Error, score for $x is $score > $min\n" + } + } + foreach x $lowx { + set score [r zscore zset $x] + if {$score >= $min} { + append err "Error, score for $x is $score >= $min\n" + } + } + foreach x $ok { + set score [r zscore zset $x] + if {$score < $min || $score > $max} { + append err "Error, score for $x is $score outside $min-$max range\n" + } + } + foreach x $okx { + set score [r zscore zset $x] + if {$score <= $min || $score >= $max} { + append err "Error, score for $x is $score outside $min-$max open range\n" + } + } + foreach x $high { + set score [r zscore zset $x] + if {$score < $max} { + append err "Error, score for $x is $score < $max\n" + } + } + foreach x $highx { + set score [r zscore zset $x] + if {$score <= $max} { + append err "Error, score for $x is $score <= $max\n" + } + } + } + assert_equal {} $err + } + + test "ZRANGEBYLEX fuzzy test, 100 ranges in $elements element sorted set - $encoding" { + set lexset {} + r del zset + for {set j 0} {$j < $elements} {incr j} { + set e [randstring 0 30 alpha] + lappend lexset $e + r zadd zset 0 $e + } + set lexset [lsort -unique $lexset] + for {set j 0} {$j < 100} {incr j} { + set min [randstring 0 30 alpha] + set max [randstring 0 30 alpha] + set mininc [randomInt 2] + set maxinc [randomInt 2] + if {$mininc} {set cmin "\[$min"} else {set cmin "($min"} + if {$maxinc} {set cmax "\[$max"} else {set cmax "($max"} + set rev [randomInt 2] + if {$rev} { + set cmd zrevrangebylex + } else { + set cmd zrangebylex + } + + # Make sure data is the same in both sides + assert {[r zrange zset 0 -1] eq $lexset} + + # Get the Redis output + set output [r $cmd zset $cmin $cmax] + if {$rev} { + set outlen [r zlexcount zset $cmax $cmin] + } else { + set outlen [r zlexcount zset $cmin $cmax] + } + + # Compute the same output via Tcl + set o {} + set copy $lexset + if {(!$rev && [string compare $min $max] > 0) || + ($rev && [string compare $max $min] > 0)} { + # Empty output when ranges are inverted. + } else { + if {$rev} { + # Invert the Tcl array using Redis itself. + set copy [r zrevrange zset 0 -1] + # Invert min / max as well + lassign [list $min $max $mininc $maxinc] \ + max min maxinc mininc + } + foreach e $copy { + set mincmp [string compare $e $min] + set maxcmp [string compare $e $max] + if { + ($mininc && $mincmp >= 0 || !$mininc && $mincmp > 0) + && + ($maxinc && $maxcmp <= 0 || !$maxinc && $maxcmp < 0) + } { + lappend o $e + } + } + } + assert {$o eq $output} + assert {$outlen eq [llength $output]} + } + } + + test "ZREMRANGEBYLEX fuzzy test, 100 ranges in $elements element sorted set - $encoding" { + set lexset {} + r del zset{t} zsetcopy{t} + for {set j 0} {$j < $elements} {incr j} { + set e [randstring 0 30 alpha] + lappend lexset $e + r zadd zset{t} 0 $e + } + set lexset [lsort -unique $lexset] + for {set j 0} {$j < 100} {incr j} { + # Copy... + r zunionstore zsetcopy{t} 1 zset{t} + set lexsetcopy $lexset + + set min [randstring 0 30 alpha] + set max [randstring 0 30 alpha] + set mininc [randomInt 2] + set maxinc [randomInt 2] + if {$mininc} {set cmin "\[$min"} else {set cmin "($min"} + if {$maxinc} {set cmax "\[$max"} else {set cmax "($max"} + + # Make sure data is the same in both sides + assert {[r zrange zset{t} 0 -1] eq $lexset} + + # Get the range we are going to remove + set torem [r zrangebylex zset{t} $cmin $cmax] + set toremlen [r zlexcount zset{t} $cmin $cmax] + r zremrangebylex zsetcopy{t} $cmin $cmax + set output [r zrange zsetcopy{t} 0 -1] + + # Remove the range with Tcl from the original list + if {$toremlen} { + set first [lsearch -exact $lexsetcopy [lindex $torem 0]] + set last [expr {$first+$toremlen-1}] + set lexsetcopy [lreplace $lexsetcopy $first $last] + } + assert {$lexsetcopy eq $output} + } + } + + test "ZSETs skiplist implementation backlink consistency test - $encoding" { + set diff 0 + for {set j 0} {$j < $elements} {incr j} { + r zadd myzset [expr rand()] "Element-$j" + r zrem myzset "Element-[expr int(rand()*$elements)]" + } + + assert_encoding $encoding myzset + set l1 [r zrange myzset 0 -1] + set l2 [r zrevrange myzset 0 -1] + for {set j 0} {$j < [llength $l1]} {incr j} { + if {[lindex $l1 $j] ne [lindex $l2 end-$j]} { + incr diff + } + } + assert_equal 0 $diff + } + + test "ZSETs ZRANK augmented skip list stress testing - $encoding" { + set err {} + r del myzset + for {set k 0} {$k < 2000} {incr k} { + set i [expr {$k % $elements}] + if {[expr rand()] < .2} { + r zrem myzset $i + } else { + set score [expr rand()] + r zadd myzset $score $i + assert_encoding $encoding myzset + } + + set card [r zcard myzset] + if {$card > 0} { + set index [randomInt $card] + set ele [lindex [r zrange myzset $index $index] 0] + set rank [r zrank myzset $ele] + if {$rank != $index} { + set err "$ele RANK is wrong! ($rank != $index)" + break + } + } + } + assert_equal {} $err + } + + foreach {pop} {BZPOPMIN BZMPOP_MIN} { + test "$pop, ZADD + DEL should not awake blocked client" { + set rd [redis_deferring_client] + r del zset + + bzpop_command $rd $pop zset 0 + wait_for_blocked_client + + r multi + r zadd zset 0 foo + r del zset + r exec + r del zset + r zadd zset 1 bar + + verify_pop_response $pop [$rd read] {zset bar 1} {zset {{bar 1}}} + $rd close + } + + test "$pop, ZADD + DEL + SET should not awake blocked client" { + set rd [redis_deferring_client] + r del zset + + bzpop_command $rd $pop zset 0 + wait_for_blocked_client + + r multi + r zadd zset 0 foo + r del zset + r set zset foo + r exec + r del zset + r zadd zset 1 bar + + verify_pop_response $pop [$rd read] {zset bar 1} {zset {{bar 1}}} + $rd close + } + } + + test "BZPOPMIN with same key multiple times should work" { + set rd [redis_deferring_client] + r del z1{t} z2{t} + + # Data arriving after the BZPOPMIN. + $rd bzpopmin z1{t} z2{t} z2{t} z1{t} 0 + wait_for_blocked_client + r zadd z1{t} 0 a + assert_equal [$rd read] {z1{t} a 0} + $rd bzpopmin z1{t} z2{t} z2{t} z1{t} 0 + wait_for_blocked_client + r zadd z2{t} 1 b + assert_equal [$rd read] {z2{t} b 1} + + # Data already there. + r zadd z1{t} 0 a + r zadd z2{t} 1 b + $rd bzpopmin z1{t} z2{t} z2{t} z1{t} 0 + assert_equal [$rd read] {z1{t} a 0} + $rd bzpopmin z1{t} z2{t} z2{t} z1{t} 0 + assert_equal [$rd read] {z2{t} b 1} + $rd close + } + + foreach {pop} {BZPOPMIN BZMPOP_MIN} { + test "MULTI/EXEC is isolated from the point of view of $pop" { + set rd [redis_deferring_client] + r del zset + + bzpop_command $rd $pop zset 0 + wait_for_blocked_client + + r multi + r zadd zset 0 a + r zadd zset 1 b + r zadd zset 2 c + r exec + + verify_pop_response $pop [$rd read] {zset a 0} {zset {{a 0}}} + $rd close + } + + test "$pop with variadic ZADD" { + set rd [redis_deferring_client] + r del zset + if {$::valgrind} {after 100} + bzpop_command $rd $pop zset 0 + wait_for_blocked_client + if {$::valgrind} {after 100} + assert_equal 2 [r zadd zset -1 foo 1 bar] + if {$::valgrind} {after 100} + verify_pop_response $pop [$rd read] {zset foo -1} {zset {{foo -1}}} + assert_equal {bar} [r zrange zset 0 -1] + $rd close + } + + test "$pop with zero timeout should block indefinitely" { + set rd [redis_deferring_client] + r del zset + bzpop_command $rd $pop zset 0 + wait_for_blocked_client + after 1000 + r zadd zset 0 foo + verify_pop_response $pop [$rd read] {zset foo 0} {zset {{foo 0}}} + $rd close + } + } + + r config set zset-max-ziplist-entries $original_max_entries + r config set zset-max-ziplist-value $original_max_value + } + + tags {"slow"} { + stressers listpack + stressers skiplist + } + + test "BZPOP/BZMPOP against wrong type" { + r set foo{t} bar + assert_error "*WRONGTYPE*" {r bzpopmin foo{t} 1} + assert_error "*WRONGTYPE*" {r bzpopmax foo{t} 1} + + assert_error "*WRONGTYPE*" {r bzmpop 1 1 foo{t} min} + assert_error "*WRONGTYPE*" {r bzmpop 1 1 foo{t} max} + assert_error "*WRONGTYPE*" {r bzmpop 1 1 foo{t} min count 10} + + r del foo{t} + r set foo2{t} bar + assert_error "*WRONGTYPE*" {r bzmpop 1 2 foo{t} foo2{t} min} + assert_error "*WRONGTYPE*" {r bzmpop 1 2 foo2{t} foo{t} max count 1} + } + + test "BZMPOP with illegal argument" { + assert_error "ERR wrong number of arguments for 'bzmpop' command" {r bzmpop} + assert_error "ERR wrong number of arguments for 'bzmpop' command" {r bzmpop 0 1} + assert_error "ERR wrong number of arguments for 'bzmpop' command" {r bzmpop 0 1 myzset{t}} + + assert_error "ERR numkeys*" {r bzmpop 1 0 myzset{t} MIN} + assert_error "ERR numkeys*" {r bzmpop 1 a myzset{t} MIN} + assert_error "ERR numkeys*" {r bzmpop 1 -1 myzset{t} MAX} + + assert_error "ERR syntax error*" {r bzmpop 1 1 myzset{t} bad_where} + assert_error "ERR syntax error*" {r bzmpop 1 1 myzset{t} MIN bar_arg} + assert_error "ERR syntax error*" {r bzmpop 1 1 myzset{t} MAX MIN} + assert_error "ERR syntax error*" {r bzmpop 1 1 myzset{t} COUNT} + assert_error "ERR syntax error*" {r bzmpop 1 1 myzset{t} MIN COUNT 1 COUNT 2} + assert_error "ERR syntax error*" {r bzmpop 1 2 myzset{t} myzset2{t} bad_arg} + + assert_error "ERR count*" {r bzmpop 1 1 myzset{t} MIN COUNT 0} + assert_error "ERR count*" {r bzmpop 1 1 myzset{t} MAX COUNT a} + assert_error "ERR count*" {r bzmpop 1 1 myzset{t} MIN COUNT -1} + assert_error "ERR count*" {r bzmpop 1 2 myzset{t} myzset2{t} MAX COUNT -1} + } + + test "BZMPOP with multiple blocked clients" { + set rd1 [redis_deferring_client] + set rd2 [redis_deferring_client] + set rd3 [redis_deferring_client] + set rd4 [redis_deferring_client] + r del myzset{t} myzset2{t} + + $rd1 bzmpop 0 2 myzset{t} myzset2{t} min count 1 + wait_for_blocked_clients_count 1 + $rd2 bzmpop 0 2 myzset{t} myzset2{t} max count 10 + wait_for_blocked_clients_count 2 + $rd3 bzmpop 0 2 myzset{t} myzset2{t} min count 10 + wait_for_blocked_clients_count 3 + $rd4 bzmpop 0 2 myzset{t} myzset2{t} max count 1 + wait_for_blocked_clients_count 4 + + r multi + r zadd myzset{t} 1 a 2 b 3 c 4 d 5 e + r zadd myzset2{t} 1 a 2 b 3 c 4 d 5 e + r exec + + assert_equal {myzset{t} {{a 1}}} [$rd1 read] + assert_equal {myzset{t} {{e 5} {d 4} {c 3} {b 2}}} [$rd2 read] + assert_equal {myzset2{t} {{a 1} {b 2} {c 3} {d 4} {e 5}}} [$rd3 read] + + r zadd myzset2{t} 1 a 2 b 3 c + assert_equal {myzset2{t} {{c 3}}} [$rd4 read] + + r del myzset{t} myzset2{t} + $rd1 close + $rd2 close + $rd3 close + $rd4 close + } + + test "BZMPOP propagate as pop with count command to replica" { + set rd [redis_deferring_client] + set repl [attach_to_replication_stream] + + # BZMPOP without being blocked. + r zadd myzset{t} 1 one 2 two 3 three + r zadd myzset2{t} 4 four 5 five 6 six + r bzmpop 0 1 myzset{t} min + r bzmpop 0 2 myzset{t} myzset2{t} max count 10 + r bzmpop 0 2 myzset{t} myzset2{t} max count 10 + + # BZMPOP that gets blocked. + $rd bzmpop 0 1 myzset{t} min count 1 + wait_for_blocked_client + r zadd myzset{t} 1 one + $rd bzmpop 0 2 myzset{t} myzset2{t} min count 5 + wait_for_blocked_client + r zadd myzset{t} 1 one 2 two 3 three + $rd bzmpop 0 2 myzset{t} myzset2{t} max count 10 + wait_for_blocked_client + r zadd myzset2{t} 4 four 5 five 6 six + + # Released on timeout. + assert_equal {} [r bzmpop 0.01 1 myzset{t} max count 10] + r set foo{t} bar ;# something else to propagate after, so we can make sure the above pop didn't. + + $rd close + + assert_replication_stream $repl { + {select *} + {zadd myzset{t} 1 one 2 two 3 three} + {zadd myzset2{t} 4 four 5 five 6 six} + {zpopmin myzset{t} 1} + {zpopmax myzset{t} 2} + {zpopmax myzset2{t} 3} + {zadd myzset{t} 1 one} + {zpopmin myzset{t} 1} + {zadd myzset{t} 1 one 2 two 3 three} + {zpopmin myzset{t} 3} + {zadd myzset2{t} 4 four 5 five 6 six} + {zpopmax myzset2{t} 3} + {set foo{t} bar} + } + close_replication_stream $repl + } {} {needs:repl} + + test "BZMPOP should not blocks on non key arguments - #10762" { + set rd1 [redis_deferring_client] + set rd2 [redis_deferring_client] + r del myzset myzset2 myzset3 + + $rd1 bzmpop 0 1 myzset min count 10 + wait_for_blocked_clients_count 1 + $rd2 bzmpop 0 2 myzset2 myzset3 max count 10 + wait_for_blocked_clients_count 2 + + # These non-key keys will not unblock the clients. + r zadd 0 100 timeout_value + r zadd 1 200 numkeys_value + r zadd min 300 min_token + r zadd max 400 max_token + r zadd count 500 count_token + r zadd 10 600 count_value + + r zadd myzset 1 zset + r zadd myzset3 1 zset3 + assert_equal {myzset {{zset 1}}} [$rd1 read] + assert_equal {myzset3 {{zset3 1}}} [$rd2 read] + + $rd1 close + $rd2 close + } {0} {cluster:skip} + + test {ZSET skiplist order consistency when elements are moved} { + set original_max [lindex [r config get zset-max-ziplist-entries] 1] + r config set zset-max-ziplist-entries 0 + for {set times 0} {$times < 10} {incr times} { + r del zset + for {set j 0} {$j < 1000} {incr j} { + r zadd zset [randomInt 50] ele-[randomInt 10] + } + + # Make sure that element ordering is correct + set prev_element {} + set prev_score -1 + foreach {element score} [r zrange zset 0 -1 WITHSCORES] { + # Assert that elements are in increasing ordering + assert { + $prev_score < $score || + ($prev_score == $score && + [string compare $prev_element $element] == -1) + } + set prev_element $element + set prev_score $score + } + } + r config set zset-max-ziplist-entries $original_max + } + + test {ZRANGESTORE basic} { + r flushall + r zadd z1{t} 1 a 2 b 3 c 4 d + set res [r zrangestore z2{t} z1{t} 0 -1] + assert_equal $res 4 + r zrange z2{t} 0 -1 withscores + } {a 1 b 2 c 3 d 4} + + test {ZRANGESTORE RESP3} { + r hello 3 + assert_equal [r zrange z2{t} 0 -1 withscores] {{a 1.0} {b 2.0} {c 3.0} {d 4.0}} + r hello 2 + } + + test {ZRANGESTORE range} { + set res [r zrangestore z2{t} z1{t} 1 2] + assert_equal $res 2 + r zrange z2{t} 0 -1 withscores + } {b 2 c 3} + + test {ZRANGESTORE BYLEX} { + set res [r zrangestore z2{t} z1{t} \[b \[c BYLEX] + assert_equal $res 2 + r zrange z2{t} 0 -1 withscores + } {b 2 c 3} + + test {ZRANGESTORE BYSCORE} { + set res [r zrangestore z2{t} z1{t} 1 2 BYSCORE] + assert_equal $res 2 + r zrange z2{t} 0 -1 withscores + } {a 1 b 2} + + test {ZRANGESTORE BYSCORE LIMIT} { + set res [r zrangestore z2{t} z1{t} 0 5 BYSCORE LIMIT 0 2] + assert_equal $res 2 + r zrange z2{t} 0 -1 withscores + } {a 1 b 2} + + test {ZRANGESTORE BYSCORE REV LIMIT} { + set res [r zrangestore z2{t} z1{t} 5 0 BYSCORE REV LIMIT 0 2] + assert_equal $res 2 + r zrange z2{t} 0 -1 withscores + } {c 3 d 4} + + test {ZRANGE BYSCORE REV LIMIT} { + r zrange z1{t} 5 0 BYSCORE REV LIMIT 0 2 WITHSCORES + } {d 4 c 3} + + test {ZRANGESTORE - src key missing} { + set res [r zrangestore z2{t} missing{t} 0 -1] + assert_equal $res 0 + r exists z2{t} + } {0} + + test {ZRANGESTORE - src key wrong type} { + r zadd z2{t} 1 a + r set foo{t} bar + assert_error "*WRONGTYPE*" {r zrangestore z2{t} foo{t} 0 -1} + r zrange z2{t} 0 -1 + } {a} + + test {ZRANGESTORE - empty range} { + set res [r zrangestore z2{t} z1{t} 5 6] + assert_equal $res 0 + r exists z2{t} + } {0} + + test {ZRANGESTORE BYLEX - empty range} { + set res [r zrangestore z2{t} z1{t} \[f \[g BYLEX] + assert_equal $res 0 + r exists z2{t} + } {0} + + test {ZRANGESTORE BYSCORE - empty range} { + set res [r zrangestore z2{t} z1{t} 5 6 BYSCORE] + assert_equal $res 0 + r exists z2{t} + } {0} + + test {ZRANGE BYLEX} { + r zrange z1{t} \[b \[c BYLEX + } {b c} + + test {ZRANGESTORE invalid syntax} { + catch {r zrangestore z2{t} z1{t} 0 -1 limit 1 2} err + assert_match "*syntax*" $err + catch {r zrangestore z2{t} z1{t} 0 -1 WITHSCORES} err + assert_match "*syntax*" $err + } + + test {ZRANGESTORE with zset-max-listpack-entries 0 #10767 case} { + set original_max [lindex [r config get zset-max-listpack-entries] 1] + r config set zset-max-listpack-entries 0 + r del z1{t} z2{t} + r zadd z1{t} 1 a + assert_equal 1 [r zrangestore z2{t} z1{t} 0 -1] + r config set zset-max-listpack-entries $original_max + } + + test {ZRANGESTORE with zset-max-listpack-entries 1 dst key should use skiplist encoding} { + set original_max [lindex [r config get zset-max-listpack-entries] 1] + r config set zset-max-listpack-entries 1 + r del z1{t} z2{t} z3{t} + r zadd z1{t} 1 a 2 b + assert_equal 1 [r zrangestore z2{t} z1{t} 0 0] + assert_encoding listpack z2{t} + assert_equal 2 [r zrangestore z3{t} z1{t} 0 1] + assert_encoding skiplist z3{t} + r config set zset-max-listpack-entries $original_max + } + + test {ZRANGE invalid syntax} { + catch {r zrange z1{t} 0 -1 limit 1 2} err + assert_match "*syntax*" $err + catch {r zrange z1{t} 0 -1 BYLEX WITHSCORES} err + assert_match "*syntax*" $err + catch {r zrevrange z1{t} 0 -1 BYSCORE} err + assert_match "*syntax*" $err + catch {r zrangebyscore z1{t} 0 -1 REV} err + assert_match "*syntax*" $err + } + + proc get_keys {l} { + set res {} + foreach {score key} $l { + lappend res $key + } + return $res + } + + # Check whether the zset members belong to the zset + proc check_member {mydict res} { + foreach ele $res { + assert {[dict exists $mydict $ele]} + } + } + + # Check whether the zset members and score belong to the zset + proc check_member_and_score {mydict res} { + foreach {key val} $res { + assert_equal $val [dict get $mydict $key] + } + } + + foreach {type contents} "listpack {1 a 2 b 3 c} skiplist {1 a 2 b 3 [randstring 70 90 alpha]}" { + set original_max_value [lindex [r config get zset-max-ziplist-value] 1] + r config set zset-max-ziplist-value 10 + create_zset myzset $contents + assert_encoding $type myzset + + test "ZRANDMEMBER - $type" { + unset -nocomplain myzset + array set myzset {} + for {set i 0} {$i < 100} {incr i} { + set key [r zrandmember myzset] + set myzset($key) 1 + } + assert_equal [lsort [get_keys $contents]] [lsort [array names myzset]] + } + r config set zset-max-ziplist-value $original_max_value + } + + test "ZRANDMEMBER with RESP3" { + r hello 3 + set res [r zrandmember myzset 3 withscores] + assert_equal [llength $res] 3 + assert_equal [llength [lindex $res 1]] 2 + + set res [r zrandmember myzset 3] + assert_equal [llength $res] 3 + assert_equal [llength [lindex $res 1]] 1 + r hello 2 + } + + test "ZRANDMEMBER count of 0 is handled correctly" { + r zrandmember myzset 0 + } {} + + test "ZRANDMEMBER with <count> against non existing key" { + r zrandmember nonexisting_key 100 + } {} + + test "ZRANDMEMBER count overflow" { + r zadd myzset 0 a + assert_error {*value is out of range*} {r zrandmember myzset -9223372036854770000 withscores} + assert_error {*value is out of range*} {r zrandmember myzset -9223372036854775808 withscores} + assert_error {*value is out of range*} {r zrandmember myzset -9223372036854775808} + } {} + + # Make sure we can distinguish between an empty array and a null response + r readraw 1 + + test "ZRANDMEMBER count of 0 is handled correctly - emptyarray" { + r zrandmember myzset 0 + } {*0} + + test "ZRANDMEMBER with <count> against non existing key - emptyarray" { + r zrandmember nonexisting_key 100 + } {*0} + + r readraw 0 + + foreach {type contents} " + skiplist {1 a 2 b 3 c 4 d 5 e 6 f 7 g 7 h 9 i 10 [randstring 70 90 alpha]} + listpack {1 a 2 b 3 c 4 d 5 e 6 f 7 g 7 h 9 i 10 j} " { + test "ZRANDMEMBER with <count> - $type" { + set original_max_value [lindex [r config get zset-max-ziplist-value] 1] + r config set zset-max-ziplist-value 10 + create_zset myzset $contents + assert_encoding $type myzset + + # create a dict for easy lookup + set mydict [dict create {*}[r zrange myzset 0 -1 withscores]] + + # We'll stress different parts of the code, see the implementation + # of ZRANDMEMBER for more information, but basically there are + # four different code paths. + + # PATH 1: Use negative count. + + # 1) Check that it returns repeated elements with and without values. + # 2) Check that all the elements actually belong to the original zset. + set res [r zrandmember myzset -20] + assert_equal [llength $res] 20 + check_member $mydict $res + + set res [r zrandmember myzset -1001] + assert_equal [llength $res] 1001 + check_member $mydict $res + + # again with WITHSCORES + set res [r zrandmember myzset -20 withscores] + assert_equal [llength $res] 40 + check_member_and_score $mydict $res + + set res [r zrandmember myzset -1001 withscores] + assert_equal [llength $res] 2002 + check_member_and_score $mydict $res + + # Test random uniform distribution + # df = 9, 40 means 0.00001 probability + set res [r zrandmember myzset -1000] + assert_lessthan [chi_square_value $res] 40 + check_member $mydict $res + + # 3) Check that eventually all the elements are returned. + # Use both WITHSCORES and without + unset -nocomplain auxset + set iterations 1000 + while {$iterations != 0} { + incr iterations -1 + if {[expr {$iterations % 2}] == 0} { + set res [r zrandmember myzset -3 withscores] + foreach {key val} $res { + dict append auxset $key $val + } + } else { + set res [r zrandmember myzset -3] + foreach key $res { + dict append auxset $key + } + } + if {[lsort [dict keys $mydict]] eq + [lsort [dict keys $auxset]]} { + break; + } + } + assert {$iterations != 0} + + # PATH 2: positive count (unique behavior) with requested size + # equal or greater than set size. + foreach size {10 20} { + set res [r zrandmember myzset $size] + assert_equal [llength $res] 10 + assert_equal [lsort $res] [lsort [dict keys $mydict]] + check_member $mydict $res + + # again with WITHSCORES + set res [r zrandmember myzset $size withscores] + assert_equal [llength $res] 20 + assert_equal [lsort $res] [lsort $mydict] + check_member_and_score $mydict $res + } + + # PATH 3: Ask almost as elements as there are in the set. + # In this case the implementation will duplicate the original + # set and will remove random elements up to the requested size. + # + # PATH 4: Ask a number of elements definitely smaller than + # the set size. + # + # We can test both the code paths just changing the size but + # using the same code. + foreach size {1 2 8} { + # 1) Check that all the elements actually belong to the + # original set. + set res [r zrandmember myzset $size] + assert_equal [llength $res] $size + check_member $mydict $res + + # again with WITHSCORES + set res [r zrandmember myzset $size withscores] + assert_equal [llength $res] [expr {$size * 2}] + check_member_and_score $mydict $res + + # 2) Check that eventually all the elements are returned. + # Use both WITHSCORES and without + unset -nocomplain auxset + unset -nocomplain allkey + set iterations [expr {1000 / $size}] + set all_ele_return false + while {$iterations != 0} { + incr iterations -1 + if {[expr {$iterations % 2}] == 0} { + set res [r zrandmember myzset $size withscores] + foreach {key value} $res { + dict append auxset $key $value + lappend allkey $key + } + } else { + set res [r zrandmember myzset $size] + foreach key $res { + dict append auxset $key + lappend allkey $key + } + } + if {[lsort [dict keys $mydict]] eq + [lsort [dict keys $auxset]]} { + set all_ele_return true + } + } + assert_equal $all_ele_return true + # df = 9, 40 means 0.00001 probability + assert_lessthan [chi_square_value $allkey] 40 + } + } + r config set zset-max-ziplist-value $original_max_value + } + + test {zset score double range} { + set dblmax 179769313486231570814527423731704356798070567525844996598917476803157260780028538760589558632766878171540458953514382464234321326889464182768467546703537516986049910576551282076245490090389328944075868508455133942304583236903222948165808559332123348274797826204144723168738177180919299881250404026184124858368.00000000000000000 + r del zz + r zadd zz $dblmax dblmax + assert_encoding listpack zz + r zscore zz dblmax + } {1.7976931348623157e+308} + +} diff --git a/tests/unit/violations.tcl b/tests/unit/violations.tcl new file mode 100644 index 0000000..783f306 --- /dev/null +++ b/tests/unit/violations.tcl @@ -0,0 +1,103 @@ +# One XADD with one huge 5GB field +# Expected to fail resulting in an empty stream +run_solo {violations} { +start_server [list overrides [list save ""] ] { + test {XADD one huge field} { + r config set proto-max-bulk-len 10000000000 ;#10gb + r config set client-query-buffer-limit 10000000000 ;#10gb + r write "*5\r\n\$4\r\nXADD\r\n\$2\r\nS1\r\n\$1\r\n*\r\n" + r write "\$1\r\nA\r\n" + catch { + write_big_bulk 5000000000 ;#5gb + } err + assert_match {*too large*} $err + r xlen S1 + } {0} {large-memory} +} + +# One XADD with one huge (exactly nearly) 4GB field +# This uncovers the overflow in lpEncodeGetType +# Expected to fail resulting in an empty stream +start_server [list overrides [list save ""] ] { + test {XADD one huge field - 1} { + r config set proto-max-bulk-len 10000000000 ;#10gb + r config set client-query-buffer-limit 10000000000 ;#10gb + r write "*5\r\n\$4\r\nXADD\r\n\$2\r\nS1\r\n\$1\r\n*\r\n" + r write "\$1\r\nA\r\n" + catch { + write_big_bulk 4294967295 ;#4gb-1 + } err + assert_match {*too large*} $err + r xlen S1 + } {0} {large-memory} +} + +# Gradually add big stream fields using repeated XADD calls +start_server [list overrides [list save ""] ] { + test {several XADD big fields} { + r config set stream-node-max-bytes 0 + for {set j 0} {$j<10} {incr j} { + r xadd stream * 1 $::str500 2 $::str500 + } + r ping + r xlen stream + } {10} {large-memory} +} + +# Add over 4GB to a single stream listpack (one XADD command) +# Expected to fail resulting in an empty stream +start_server [list overrides [list save ""] ] { + test {single XADD big fields} { + r write "*23\r\n\$4\r\nXADD\r\n\$1\r\nS\r\n\$1\r\n*\r\n" + for {set j 0} {$j<10} {incr j} { + r write "\$1\r\n$j\r\n" + write_big_bulk 500000000 "" yes ;#500mb + } + r flush + catch {r read} err + assert_match {*too large*} $err + r xlen S + } {0} {large-memory} +} + +# Gradually add big hash fields using repeated HSET calls +# This reproduces the overflow in the call to ziplistResize +# Object will be converted to hashtable encoding +start_server [list overrides [list save ""] ] { + r config set hash-max-ziplist-value 1000000000 ;#1gb + test {hash with many big fields} { + for {set j 0} {$j<10} {incr j} { + r hset h $j $::str500 + } + r object encoding h + } {hashtable} {large-memory} +} + +# Add over 4GB to a single hash field (one HSET command) +# Object will be converted to hashtable encoding +start_server [list overrides [list save ""] ] { + test {hash with one huge field} { + catch {r config set hash-max-ziplist-value 10000000000} ;#10gb + r config set proto-max-bulk-len 10000000000 ;#10gb + r config set client-query-buffer-limit 10000000000 ;#10gb + r write "*4\r\n\$4\r\nHSET\r\n\$2\r\nH1\r\n" + r write "\$1\r\nA\r\n" + write_big_bulk 5000000000 ;#5gb + r object encoding H1 + } {hashtable} {large-memory} +} +} ;# run_solo + +# SORT which stores an integer encoded element into a list. +# Just for coverage, no news here. +start_server [list overrides [list save ""] ] { + test {SORT adds integer field to list} { + r set S1 asdf + r set S2 123 ;# integer encoded + assert_encoding "int" S2 + r sadd myset 1 2 + r mset D1 1 D2 2 + r sort myset by D* get S* store mylist + r llen mylist + } {2} {cluster:skip} +} diff --git a/tests/unit/wait.tcl b/tests/unit/wait.tcl new file mode 100644 index 0000000..0f52ee1 --- /dev/null +++ b/tests/unit/wait.tcl @@ -0,0 +1,58 @@ +source tests/support/cli.tcl + +start_server {tags {"wait network external:skip"}} { +start_server {} { + set slave [srv 0 client] + set slave_host [srv 0 host] + set slave_port [srv 0 port] + set slave_pid [srv 0 pid] + set master [srv -1 client] + set master_host [srv -1 host] + set master_port [srv -1 port] + + test {Setup slave} { + $slave slaveof $master_host $master_port + wait_for_condition 50 100 { + [s 0 master_link_status] eq {up} + } else { + fail "Replication not started." + } + } + + test {WAIT should acknowledge 1 additional copy of the data} { + $master set foo 0 + $master incr foo + $master incr foo + $master incr foo + assert {[$master wait 1 5000] == 1} + assert {[$slave get foo] == 3} + } + + test {WAIT should not acknowledge 2 additional copies of the data} { + $master incr foo + assert {[$master wait 2 1000] <= 1} + } + + test {WAIT should not acknowledge 1 additional copy if slave is blocked} { + exec kill -SIGSTOP $slave_pid + $master set foo 0 + $master incr foo + $master incr foo + $master incr foo + assert {[$master wait 1 1000] == 0} + exec kill -SIGCONT $slave_pid + assert {[$master wait 1 1000] == 1} + } + + test {WAIT implicitly blocks on client pause since ACKs aren't sent} { + exec kill -SIGSTOP $slave_pid + $master multi + $master incr foo + $master client pause 10000 write + $master exec + assert {[$master wait 1 1000] == 0} + $master client unpause + exec kill -SIGCONT $slave_pid + assert {[$master wait 1 1000] == 1} + } +}} |