diff options
author | Daniel Baumann <daniel.baumann@progress-linux.org> | 2024-04-14 13:40:54 +0000 |
---|---|---|
committer | Daniel Baumann <daniel.baumann@progress-linux.org> | 2024-04-14 13:40:54 +0000 |
commit | 317c0644ccf108aa23ef3fd8358bd66c2840bfc0 (patch) | |
tree | c417b3d25c86b775989cb5ac042f37611b626c8a /tests/unit/type | |
parent | Initial commit. (diff) | |
download | redis-317c0644ccf108aa23ef3fd8358bd66c2840bfc0.tar.xz redis-317c0644ccf108aa23ef3fd8358bd66c2840bfc0.zip |
Adding upstream version 5:7.2.4.upstream/5%7.2.4upstream
Signed-off-by: Daniel Baumann <daniel.baumann@progress-linux.org>
Diffstat (limited to 'tests/unit/type')
-rw-r--r-- | tests/unit/type/hash.tcl | 846 | ||||
-rw-r--r-- | tests/unit/type/incr.tcl | 214 | ||||
-rw-r--r-- | tests/unit/type/list-2.tcl | 47 | ||||
-rw-r--r-- | tests/unit/type/list-3.tcl | 232 | ||||
-rw-r--r-- | tests/unit/type/list-common.tcl | 4 | ||||
-rw-r--r-- | tests/unit/type/list.tcl | 2363 | ||||
-rw-r--r-- | tests/unit/type/set.tcl | 1305 | ||||
-rw-r--r-- | tests/unit/type/stream-cgroups.tcl | 1297 | ||||
-rw-r--r-- | tests/unit/type/stream.tcl | 940 | ||||
-rw-r--r-- | tests/unit/type/string.tcl | 674 | ||||
-rw-r--r-- | tests/unit/type/zset.tcl | 2654 |
11 files changed, 10576 insertions, 0 deletions
diff --git a/tests/unit/type/hash.tcl b/tests/unit/type/hash.tcl new file mode 100644 index 0000000..2a26f44 --- /dev/null +++ b/tests/unit/type/hash.tcl @@ -0,0 +1,846 @@ +start_server {tags {"hash"}} { + test {HSET/HLEN - Small hash creation} { + array set smallhash {} + for {set i 0} {$i < 8} {incr i} { + set key __avoid_collisions__[randstring 0 8 alpha] + set val __avoid_collisions__[randstring 0 8 alpha] + if {[info exists smallhash($key)]} { + incr i -1 + continue + } + r hset smallhash $key $val + set smallhash($key) $val + } + list [r hlen smallhash] + } {8} + + test {Is the small hash encoded with a listpack?} { + assert_encoding listpack smallhash + } + + proc create_hash {key entries} { + r del $key + foreach entry $entries { + r hset $key [lindex $entry 0] [lindex $entry 1] + } + } + + proc get_keys {l} { + set res {} + foreach entry $l { + set key [lindex $entry 0] + lappend res $key + } + return $res + } + + foreach {type contents} "listpack {{a 1} {b 2} {c 3}} hashtable {{a 1} {b 2} {[randstring 70 90 alpha] 3}}" { + set original_max_value [lindex [r config get hash-max-ziplist-value] 1] + r config set hash-max-ziplist-value 10 + create_hash myhash $contents + assert_encoding $type myhash + + # coverage for objectComputeSize + assert_morethan [memory_usage myhash] 0 + + test "HRANDFIELD - $type" { + unset -nocomplain myhash + array set myhash {} + for {set i 0} {$i < 100} {incr i} { + set key [r hrandfield myhash] + set myhash($key) 1 + } + assert_equal [lsort [get_keys $contents]] [lsort [array names myhash]] + } + r config set hash-max-ziplist-value $original_max_value + } + + test "HRANDFIELD with RESP3" { + r hello 3 + set res [r hrandfield myhash 3 withvalues] + assert_equal [llength $res] 3 + assert_equal [llength [lindex $res 1]] 2 + + set res [r hrandfield myhash 3] + assert_equal [llength $res] 3 + assert_equal [llength [lindex $res 1]] 1 + r hello 2 + } + + test "HRANDFIELD count of 0 is handled correctly" { + r hrandfield myhash 0 + } {} + + test "HRANDFIELD count overflow" { + r hmset myhash a 1 + assert_error {*value is out of range*} {r hrandfield myhash -9223372036854770000 withvalues} + assert_error {*value is out of range*} {r hrandfield myhash -9223372036854775808 withvalues} + assert_error {*value is out of range*} {r hrandfield myhash -9223372036854775808} + } {} + + test "HRANDFIELD with <count> against non existing key" { + r hrandfield nonexisting_key 100 + } {} + + # Make sure we can distinguish between an empty array and a null response + r readraw 1 + + test "HRANDFIELD count of 0 is handled correctly - emptyarray" { + r hrandfield myhash 0 + } {*0} + + test "HRANDFIELD with <count> against non existing key - emptyarray" { + r hrandfield nonexisting_key 100 + } {*0} + + r readraw 0 + + foreach {type contents} " + hashtable {{a 1} {b 2} {c 3} {d 4} {e 5} {6 f} {7 g} {8 h} {9 i} {[randstring 70 90 alpha] 10}} + listpack {{a 1} {b 2} {c 3} {d 4} {e 5} {6 f} {7 g} {8 h} {9 i} {10 j}} " { + test "HRANDFIELD with <count> - $type" { + set original_max_value [lindex [r config get hash-max-ziplist-value] 1] + r config set hash-max-ziplist-value 10 + create_hash myhash $contents + assert_encoding $type myhash + + # create a dict for easy lookup + set mydict [dict create {*}[r hgetall myhash]] + + # We'll stress different parts of the code, see the implementation + # of HRANDFIELD for more information, but basically there are + # four different code paths. + + # PATH 1: Use negative count. + + # 1) Check that it returns repeated elements with and without values. + set res [r hrandfield myhash -20] + assert_equal [llength $res] 20 + set res [r hrandfield myhash -1001] + assert_equal [llength $res] 1001 + # again with WITHVALUES + set res [r hrandfield myhash -20 withvalues] + assert_equal [llength $res] 40 + set res [r hrandfield myhash -1001 withvalues] + assert_equal [llength $res] 2002 + + # Test random uniform distribution + # df = 9, 40 means 0.00001 probability + set res [r hrandfield myhash -1000] + assert_lessthan [chi_square_value $res] 40 + + # 2) Check that all the elements actually belong to the original hash. + foreach {key val} $res { + assert {[dict exists $mydict $key]} + } + + # 3) Check that eventually all the elements are returned. + # Use both WITHVALUES and without + unset -nocomplain auxset + set iterations 1000 + while {$iterations != 0} { + incr iterations -1 + if {[expr {$iterations % 2}] == 0} { + set res [r hrandfield myhash -3 withvalues] + foreach {key val} $res { + dict append auxset $key $val + } + } else { + set res [r hrandfield myhash -3] + foreach key $res { + dict append auxset $key $val + } + } + if {[lsort [dict keys $mydict]] eq + [lsort [dict keys $auxset]]} { + break; + } + } + assert {$iterations != 0} + + # PATH 2: positive count (unique behavior) with requested size + # equal or greater than set size. + foreach size {10 20} { + set res [r hrandfield myhash $size] + assert_equal [llength $res] 10 + assert_equal [lsort $res] [lsort [dict keys $mydict]] + + # again with WITHVALUES + set res [r hrandfield myhash $size withvalues] + assert_equal [llength $res] 20 + assert_equal [lsort $res] [lsort $mydict] + } + + # PATH 3: Ask almost as elements as there are in the set. + # In this case the implementation will duplicate the original + # set and will remove random elements up to the requested size. + # + # PATH 4: Ask a number of elements definitely smaller than + # the set size. + # + # We can test both the code paths just changing the size but + # using the same code. + foreach size {8 2} { + set res [r hrandfield myhash $size] + assert_equal [llength $res] $size + # again with WITHVALUES + set res [r hrandfield myhash $size withvalues] + assert_equal [llength $res] [expr {$size * 2}] + + # 1) Check that all the elements actually belong to the + # original set. + foreach ele [dict keys $res] { + assert {[dict exists $mydict $ele]} + } + + # 2) Check that eventually all the elements are returned. + # Use both WITHVALUES and without + unset -nocomplain auxset + unset -nocomplain allkey + set iterations [expr {1000 / $size}] + set all_ele_return false + while {$iterations != 0} { + incr iterations -1 + if {[expr {$iterations % 2}] == 0} { + set res [r hrandfield myhash $size withvalues] + foreach {key value} $res { + dict append auxset $key $value + lappend allkey $key + } + } else { + set res [r hrandfield myhash $size] + foreach key $res { + dict append auxset $key + lappend allkey $key + } + } + if {[lsort [dict keys $mydict]] eq + [lsort [dict keys $auxset]]} { + set all_ele_return true + } + } + assert_equal $all_ele_return true + # df = 9, 40 means 0.00001 probability + assert_lessthan [chi_square_value $allkey] 40 + } + } + r config set hash-max-ziplist-value $original_max_value + } + + + test {HSET/HLEN - Big hash creation} { + array set bighash {} + for {set i 0} {$i < 1024} {incr i} { + set key __avoid_collisions__[randstring 0 8 alpha] + set val __avoid_collisions__[randstring 0 8 alpha] + if {[info exists bighash($key)]} { + incr i -1 + continue + } + r hset bighash $key $val + set bighash($key) $val + } + list [r hlen bighash] + } {1024} + + test {Is the big hash encoded with an hash table?} { + assert_encoding hashtable bighash + } + + test {HGET against the small hash} { + set err {} + foreach k [array names smallhash *] { + if {$smallhash($k) ne [r hget smallhash $k]} { + set err "$smallhash($k) != [r hget smallhash $k]" + break + } + } + set _ $err + } {} + + test {HGET against the big hash} { + set err {} + foreach k [array names bighash *] { + if {$bighash($k) ne [r hget bighash $k]} { + set err "$bighash($k) != [r hget bighash $k]" + break + } + } + set _ $err + } {} + + test {HGET against non existing key} { + set rv {} + lappend rv [r hget smallhash __123123123__] + lappend rv [r hget bighash __123123123__] + set _ $rv + } {{} {}} + + test {HSET in update and insert mode} { + set rv {} + set k [lindex [array names smallhash *] 0] + lappend rv [r hset smallhash $k newval1] + set smallhash($k) newval1 + lappend rv [r hget smallhash $k] + lappend rv [r hset smallhash __foobar123__ newval] + set k [lindex [array names bighash *] 0] + lappend rv [r hset bighash $k newval2] + set bighash($k) newval2 + lappend rv [r hget bighash $k] + lappend rv [r hset bighash __foobar123__ newval] + lappend rv [r hdel smallhash __foobar123__] + lappend rv [r hdel bighash __foobar123__] + set _ $rv + } {0 newval1 1 0 newval2 1 1 1} + + test {HSETNX target key missing - small hash} { + r hsetnx smallhash __123123123__ foo + r hget smallhash __123123123__ + } {foo} + + test {HSETNX target key exists - small hash} { + r hsetnx smallhash __123123123__ bar + set result [r hget smallhash __123123123__] + r hdel smallhash __123123123__ + set _ $result + } {foo} + + test {HSETNX target key missing - big hash} { + r hsetnx bighash __123123123__ foo + r hget bighash __123123123__ + } {foo} + + test {HSETNX target key exists - big hash} { + r hsetnx bighash __123123123__ bar + set result [r hget bighash __123123123__] + r hdel bighash __123123123__ + set _ $result + } {foo} + + test {HSET/HMSET wrong number of args} { + assert_error {*wrong number of arguments for 'hset' command} {r hset smallhash key1 val1 key2} + assert_error {*wrong number of arguments for 'hmset' command} {r hmset smallhash key1 val1 key2} + } + + test {HMSET - small hash} { + set args {} + foreach {k v} [array get smallhash] { + set newval [randstring 0 8 alpha] + set smallhash($k) $newval + lappend args $k $newval + } + r hmset smallhash {*}$args + } {OK} + + test {HMSET - big hash} { + set args {} + foreach {k v} [array get bighash] { + set newval [randstring 0 8 alpha] + set bighash($k) $newval + lappend args $k $newval + } + r hmset bighash {*}$args + } {OK} + + test {HMGET against non existing key and fields} { + set rv {} + lappend rv [r hmget doesntexist __123123123__ __456456456__] + lappend rv [r hmget smallhash __123123123__ __456456456__] + lappend rv [r hmget bighash __123123123__ __456456456__] + set _ $rv + } {{{} {}} {{} {}} {{} {}}} + + test {Hash commands against wrong type} { + r set wrongtype somevalue + assert_error "WRONGTYPE Operation against a key*" {r hmget wrongtype field1 field2} + assert_error "WRONGTYPE Operation against a key*" {r hrandfield wrongtype} + assert_error "WRONGTYPE Operation against a key*" {r hget wrongtype field1} + assert_error "WRONGTYPE Operation against a key*" {r hgetall wrongtype} + assert_error "WRONGTYPE Operation against a key*" {r hdel wrongtype field1} + assert_error "WRONGTYPE Operation against a key*" {r hincrby wrongtype field1 2} + assert_error "WRONGTYPE Operation against a key*" {r hincrbyfloat wrongtype field1 2.5} + assert_error "WRONGTYPE Operation against a key*" {r hstrlen wrongtype field1} + assert_error "WRONGTYPE Operation against a key*" {r hvals wrongtype} + assert_error "WRONGTYPE Operation against a key*" {r hkeys wrongtype} + assert_error "WRONGTYPE Operation against a key*" {r hexists wrongtype field1} + } + + test {HMGET - small hash} { + set keys {} + set vals {} + foreach {k v} [array get smallhash] { + lappend keys $k + lappend vals $v + } + set err {} + set result [r hmget smallhash {*}$keys] + if {$vals ne $result} { + set err "$vals != $result" + break + } + set _ $err + } {} + + test {HMGET - big hash} { + set keys {} + set vals {} + foreach {k v} [array get bighash] { + lappend keys $k + lappend vals $v + } + set err {} + set result [r hmget bighash {*}$keys] + if {$vals ne $result} { + set err "$vals != $result" + break + } + set _ $err + } {} + + test {HKEYS - small hash} { + lsort [r hkeys smallhash] + } [lsort [array names smallhash *]] + + test {HKEYS - big hash} { + lsort [r hkeys bighash] + } [lsort [array names bighash *]] + + test {HVALS - small hash} { + set vals {} + foreach {k v} [array get smallhash] { + lappend vals $v + } + set _ [lsort $vals] + } [lsort [r hvals smallhash]] + + test {HVALS - big hash} { + set vals {} + foreach {k v} [array get bighash] { + lappend vals $v + } + set _ [lsort $vals] + } [lsort [r hvals bighash]] + + test {HGETALL - small hash} { + lsort [r hgetall smallhash] + } [lsort [array get smallhash]] + + test {HGETALL - big hash} { + lsort [r hgetall bighash] + } [lsort [array get bighash]] + + test {HDEL and return value} { + set rv {} + lappend rv [r hdel smallhash nokey] + lappend rv [r hdel bighash nokey] + set k [lindex [array names smallhash *] 0] + lappend rv [r hdel smallhash $k] + lappend rv [r hdel smallhash $k] + lappend rv [r hget smallhash $k] + unset smallhash($k) + set k [lindex [array names bighash *] 0] + lappend rv [r hdel bighash $k] + lappend rv [r hdel bighash $k] + lappend rv [r hget bighash $k] + unset bighash($k) + set _ $rv + } {0 0 1 0 {} 1 0 {}} + + test {HDEL - more than a single value} { + set rv {} + r del myhash + r hmset myhash a 1 b 2 c 3 + assert_equal 0 [r hdel myhash x y] + assert_equal 2 [r hdel myhash a c f] + r hgetall myhash + } {b 2} + + test {HDEL - hash becomes empty before deleting all specified fields} { + r del myhash + r hmset myhash a 1 b 2 c 3 + assert_equal 3 [r hdel myhash a b c d e] + assert_equal 0 [r exists myhash] + } + + test {HEXISTS} { + set rv {} + set k [lindex [array names smallhash *] 0] + lappend rv [r hexists smallhash $k] + lappend rv [r hexists smallhash nokey] + set k [lindex [array names bighash *] 0] + lappend rv [r hexists bighash $k] + lappend rv [r hexists bighash nokey] + } {1 0 1 0} + + test {Is a ziplist encoded Hash promoted on big payload?} { + r hset smallhash foo [string repeat a 1024] + r debug object smallhash + } {*hashtable*} {needs:debug} + + test {HINCRBY against non existing database key} { + r del htest + list [r hincrby htest foo 2] + } {2} + + test {HINCRBY against non existing hash key} { + set rv {} + r hdel smallhash tmp + r hdel bighash tmp + lappend rv [r hincrby smallhash tmp 2] + lappend rv [r hget smallhash tmp] + lappend rv [r hincrby bighash tmp 2] + lappend rv [r hget bighash tmp] + } {2 2 2 2} + + test {HINCRBY against hash key created by hincrby itself} { + set rv {} + lappend rv [r hincrby smallhash tmp 3] + lappend rv [r hget smallhash tmp] + lappend rv [r hincrby bighash tmp 3] + lappend rv [r hget bighash tmp] + } {5 5 5 5} + + test {HINCRBY against hash key originally set with HSET} { + r hset smallhash tmp 100 + r hset bighash tmp 100 + list [r hincrby smallhash tmp 2] [r hincrby bighash tmp 2] + } {102 102} + + test {HINCRBY over 32bit value} { + r hset smallhash tmp 17179869184 + r hset bighash tmp 17179869184 + list [r hincrby smallhash tmp 1] [r hincrby bighash tmp 1] + } {17179869185 17179869185} + + test {HINCRBY over 32bit value with over 32bit increment} { + r hset smallhash tmp 17179869184 + r hset bighash tmp 17179869184 + list [r hincrby smallhash tmp 17179869184] [r hincrby bighash tmp 17179869184] + } {34359738368 34359738368} + + test {HINCRBY fails against hash value with spaces (left)} { + r hset smallhash str " 11" + r hset bighash str " 11" + catch {r hincrby smallhash str 1} smallerr + catch {r hincrby bighash str 1} bigerr + set rv {} + lappend rv [string match "ERR *not an integer*" $smallerr] + lappend rv [string match "ERR *not an integer*" $bigerr] + } {1 1} + + test {HINCRBY fails against hash value with spaces (right)} { + r hset smallhash str "11 " + r hset bighash str "11 " + catch {r hincrby smallhash str 1} smallerr + catch {r hincrby bighash str 1} bigerr + set rv {} + lappend rv [string match "ERR *not an integer*" $smallerr] + lappend rv [string match "ERR *not an integer*" $bigerr] + } {1 1} + + test {HINCRBY can detect overflows} { + set e {} + r hset hash n -9223372036854775484 + assert {[r hincrby hash n -1] == -9223372036854775485} + catch {r hincrby hash n -10000} e + set e + } {*overflow*} + + test {HINCRBYFLOAT against non existing database key} { + r del htest + list [r hincrbyfloat htest foo 2.5] + } {2.5} + + test {HINCRBYFLOAT against non existing hash key} { + set rv {} + r hdel smallhash tmp + r hdel bighash tmp + lappend rv [roundFloat [r hincrbyfloat smallhash tmp 2.5]] + lappend rv [roundFloat [r hget smallhash tmp]] + lappend rv [roundFloat [r hincrbyfloat bighash tmp 2.5]] + lappend rv [roundFloat [r hget bighash tmp]] + } {2.5 2.5 2.5 2.5} + + test {HINCRBYFLOAT against hash key created by hincrby itself} { + set rv {} + lappend rv [roundFloat [r hincrbyfloat smallhash tmp 3.5]] + lappend rv [roundFloat [r hget smallhash tmp]] + lappend rv [roundFloat [r hincrbyfloat bighash tmp 3.5]] + lappend rv [roundFloat [r hget bighash tmp]] + } {6 6 6 6} + + test {HINCRBYFLOAT against hash key originally set with HSET} { + r hset smallhash tmp 100 + r hset bighash tmp 100 + list [roundFloat [r hincrbyfloat smallhash tmp 2.5]] \ + [roundFloat [r hincrbyfloat bighash tmp 2.5]] + } {102.5 102.5} + + test {HINCRBYFLOAT over 32bit value} { + r hset smallhash tmp 17179869184 + r hset bighash tmp 17179869184 + list [r hincrbyfloat smallhash tmp 1] \ + [r hincrbyfloat bighash tmp 1] + } {17179869185 17179869185} + + test {HINCRBYFLOAT over 32bit value with over 32bit increment} { + r hset smallhash tmp 17179869184 + r hset bighash tmp 17179869184 + list [r hincrbyfloat smallhash tmp 17179869184] \ + [r hincrbyfloat bighash tmp 17179869184] + } {34359738368 34359738368} + + test {HINCRBYFLOAT fails against hash value with spaces (left)} { + r hset smallhash str " 11" + r hset bighash str " 11" + catch {r hincrbyfloat smallhash str 1} smallerr + catch {r hincrbyfloat bighash str 1} bigerr + set rv {} + lappend rv [string match "ERR *not*float*" $smallerr] + lappend rv [string match "ERR *not*float*" $bigerr] + } {1 1} + + test {HINCRBYFLOAT fails against hash value with spaces (right)} { + r hset smallhash str "11 " + r hset bighash str "11 " + catch {r hincrbyfloat smallhash str 1} smallerr + catch {r hincrbyfloat bighash str 1} bigerr + set rv {} + lappend rv [string match "ERR *not*float*" $smallerr] + lappend rv [string match "ERR *not*float*" $bigerr] + } {1 1} + + test {HINCRBYFLOAT fails against hash value that contains a null-terminator in the middle} { + r hset h f "1\x002" + catch {r hincrbyfloat h f 1} err + set rv {} + lappend rv [string match "ERR *not*float*" $err] + } {1} + + test {HSTRLEN against the small hash} { + set err {} + foreach k [array names smallhash *] { + if {[string length $smallhash($k)] ne [r hstrlen smallhash $k]} { + set err "[string length $smallhash($k)] != [r hstrlen smallhash $k]" + break + } + } + set _ $err + } {} + + test {HSTRLEN against the big hash} { + set err {} + foreach k [array names bighash *] { + if {[string length $bighash($k)] ne [r hstrlen bighash $k]} { + set err "[string length $bighash($k)] != [r hstrlen bighash $k]" + puts "HSTRLEN and logical length mismatch:" + puts "key: $k" + puts "Logical content: $bighash($k)" + puts "Server content: [r hget bighash $k]" + } + } + set _ $err + } {} + + test {HSTRLEN against non existing field} { + set rv {} + lappend rv [r hstrlen smallhash __123123123__] + lappend rv [r hstrlen bighash __123123123__] + set _ $rv + } {0 0} + + test {HSTRLEN corner cases} { + set vals { + -9223372036854775808 9223372036854775807 9223372036854775808 + {} 0 -1 x + } + foreach v $vals { + r hmset smallhash field $v + r hmset bighash field $v + set len1 [string length $v] + set len2 [r hstrlen smallhash field] + set len3 [r hstrlen bighash field] + assert {$len1 == $len2} + assert {$len2 == $len3} + } + } + + test {HINCRBYFLOAT over hash-max-listpack-value encoded with a listpack} { + set original_max_value [lindex [r config get hash-max-ziplist-value] 1] + r config set hash-max-listpack-value 8 + + # hash's value exceeds hash-max-listpack-value + r del smallhash + r del bighash + r hset smallhash tmp 0 + r hset bighash tmp 0 + r hincrbyfloat smallhash tmp 0.000005 + r hincrbyfloat bighash tmp 0.0000005 + assert_encoding listpack smallhash + assert_encoding hashtable bighash + + # hash's field exceeds hash-max-listpack-value + r del smallhash + r del bighash + r hincrbyfloat smallhash abcdefgh 1 + r hincrbyfloat bighash abcdefghi 1 + assert_encoding listpack smallhash + assert_encoding hashtable bighash + + r config set hash-max-listpack-value $original_max_value + } + + test {Hash ziplist regression test for large keys} { + r hset hash kkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkk a + r hset hash kkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkk b + r hget hash kkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkk + } {b} + + foreach size {10 512} { + test "Hash fuzzing #1 - $size fields" { + for {set times 0} {$times < 10} {incr times} { + catch {unset hash} + array set hash {} + r del hash + + # Create + for {set j 0} {$j < $size} {incr j} { + set field [randomValue] + set value [randomValue] + r hset hash $field $value + set hash($field) $value + } + + # Verify + foreach {k v} [array get hash] { + assert_equal $v [r hget hash $k] + } + assert_equal [array size hash] [r hlen hash] + } + } + + test "Hash fuzzing #2 - $size fields" { + for {set times 0} {$times < 10} {incr times} { + catch {unset hash} + array set hash {} + r del hash + + # Create + for {set j 0} {$j < $size} {incr j} { + randpath { + set field [randomValue] + set value [randomValue] + r hset hash $field $value + set hash($field) $value + } { + set field [randomSignedInt 512] + set value [randomSignedInt 512] + r hset hash $field $value + set hash($field) $value + } { + randpath { + set field [randomValue] + } { + set field [randomSignedInt 512] + } + r hdel hash $field + unset -nocomplain hash($field) + } + } + + # Verify + foreach {k v} [array get hash] { + assert_equal $v [r hget hash $k] + } + assert_equal [array size hash] [r hlen hash] + } + } + } + + test {Stress test the hash ziplist -> hashtable encoding conversion} { + r config set hash-max-ziplist-entries 32 + for {set j 0} {$j < 100} {incr j} { + r del myhash + for {set i 0} {$i < 64} {incr i} { + r hset myhash [randomValue] [randomValue] + } + assert_encoding hashtable myhash + } + } + + # The following test can only be executed if we don't use Valgrind, and if + # we are using x86_64 architecture, because: + # + # 1) Valgrind has floating point limitations, no support for 80 bits math. + # 2) Other archs may have the same limits. + # + # 1.23 cannot be represented correctly with 64 bit doubles, so we skip + # the test, since we are only testing pretty printing here and is not + # a bug if the program outputs things like 1.299999... + if {!$::valgrind && [string match *x86_64* [exec uname -a]]} { + test {Test HINCRBYFLOAT for correct float representation (issue #2846)} { + r del myhash + assert {[r hincrbyfloat myhash float 1.23] eq {1.23}} + assert {[r hincrbyfloat myhash float 0.77] eq {2}} + assert {[r hincrbyfloat myhash float -0.1] eq {1.9}} + } + } + + test {Hash ziplist of various encodings} { + r del k + config_set hash-max-ziplist-entries 1000000000 + config_set hash-max-ziplist-value 1000000000 + r hset k ZIP_INT_8B 127 + r hset k ZIP_INT_16B 32767 + r hset k ZIP_INT_32B 2147483647 + r hset k ZIP_INT_64B 9223372036854775808 + r hset k ZIP_INT_IMM_MIN 0 + r hset k ZIP_INT_IMM_MAX 12 + r hset k ZIP_STR_06B [string repeat x 31] + r hset k ZIP_STR_14B [string repeat x 8191] + r hset k ZIP_STR_32B [string repeat x 65535] + set k [r hgetall k] + set dump [r dump k] + + # will be converted to dict at RESTORE + config_set hash-max-ziplist-entries 2 + config_set sanitize-dump-payload no mayfail + r restore kk 0 $dump + set kk [r hgetall kk] + + # make sure the values are right + assert_equal [lsort $k] [lsort $kk] + assert_equal [dict get $k ZIP_STR_06B] [string repeat x 31] + set k [dict remove $k ZIP_STR_06B] + assert_equal [dict get $k ZIP_STR_14B] [string repeat x 8191] + set k [dict remove $k ZIP_STR_14B] + assert_equal [dict get $k ZIP_STR_32B] [string repeat x 65535] + set k [dict remove $k ZIP_STR_32B] + set _ $k + } {ZIP_INT_8B 127 ZIP_INT_16B 32767 ZIP_INT_32B 2147483647 ZIP_INT_64B 9223372036854775808 ZIP_INT_IMM_MIN 0 ZIP_INT_IMM_MAX 12} + + test {Hash ziplist of various encodings - sanitize dump} { + config_set sanitize-dump-payload yes mayfail + r restore kk 0 $dump replace + set k [r hgetall k] + set kk [r hgetall kk] + + # make sure the values are right + assert_equal [lsort $k] [lsort $kk] + assert_equal [dict get $k ZIP_STR_06B] [string repeat x 31] + set k [dict remove $k ZIP_STR_06B] + assert_equal [dict get $k ZIP_STR_14B] [string repeat x 8191] + set k [dict remove $k ZIP_STR_14B] + assert_equal [dict get $k ZIP_STR_32B] [string repeat x 65535] + set k [dict remove $k ZIP_STR_32B] + set _ $k + } {ZIP_INT_8B 127 ZIP_INT_16B 32767 ZIP_INT_32B 2147483647 ZIP_INT_64B 9223372036854775808 ZIP_INT_IMM_MIN 0 ZIP_INT_IMM_MAX 12} + + # On some platforms strtold("+inf") with valgrind returns a non-inf result + if {!$::valgrind} { + test {HINCRBYFLOAT does not allow NaN or Infinity} { + assert_error "*value is NaN or Infinity*" {r hincrbyfloat hfoo field +inf} + assert_equal 0 [r exists hfoo] + } + } +} diff --git a/tests/unit/type/incr.tcl b/tests/unit/type/incr.tcl new file mode 100644 index 0000000..2319b2c --- /dev/null +++ b/tests/unit/type/incr.tcl @@ -0,0 +1,214 @@ +start_server {tags {"incr"}} { + test {INCR against non existing key} { + set res {} + append res [r incr novar] + append res [r get novar] + } {11} + + test {INCR against key created by incr itself} { + r incr novar + } {2} + + test {DECR against key created by incr} { + r decr novar + } {1} + + test {DECR against key is not exist and incr} { + r del novar_not_exist + assert_equal {-1} [r decr novar_not_exist] + assert_equal {0} [r incr novar_not_exist] + } + + test {INCR against key originally set with SET} { + r set novar 100 + r incr novar + } {101} + + test {INCR over 32bit value} { + r set novar 17179869184 + r incr novar + } {17179869185} + + test {INCRBY over 32bit value with over 32bit increment} { + r set novar 17179869184 + r incrby novar 17179869184 + } {34359738368} + + test {INCR fails against key with spaces (left)} { + r set novar " 11" + catch {r incr novar} err + format $err + } {ERR*} + + test {INCR fails against key with spaces (right)} { + r set novar "11 " + catch {r incr novar} err + format $err + } {ERR*} + + test {INCR fails against key with spaces (both)} { + r set novar " 11 " + catch {r incr novar} err + format $err + } {ERR*} + + test {DECRBY negation overflow} { + r set x 0 + catch {r decrby x -9223372036854775808} err + format $err + } {ERR*} + + test {INCR fails against a key holding a list} { + r rpush mylist 1 + catch {r incr mylist} err + r rpop mylist + format $err + } {WRONGTYPE*} + + test {DECRBY over 32bit value with over 32bit increment, negative res} { + r set novar 17179869184 + r decrby novar 17179869185 + } {-1} + + test {DECRBY against key is not exist} { + r del key_not_exist + assert_equal {-1} [r decrby key_not_exist 1] + } + + test {INCR uses shared objects in the 0-9999 range} { + r set foo -1 + r incr foo + assert_refcount_morethan foo 1 + r set foo 9998 + r incr foo + assert_refcount_morethan foo 1 + r incr foo + assert_refcount 1 foo + } + + test {INCR can modify objects in-place} { + r set foo 20000 + r incr foo + assert_refcount 1 foo + set old [lindex [split [r debug object foo]] 1] + r incr foo + set new [lindex [split [r debug object foo]] 1] + assert {[string range $old 0 2] eq "at:"} + assert {[string range $new 0 2] eq "at:"} + assert {$old eq $new} + } {} {needs:debug} + + test {INCRBYFLOAT against non existing key} { + r del novar + list [roundFloat [r incrbyfloat novar 1]] \ + [roundFloat [r get novar]] \ + [roundFloat [r incrbyfloat novar 0.25]] \ + [roundFloat [r get novar]] + } {1 1 1.25 1.25} + + test {INCRBYFLOAT against key originally set with SET} { + r set novar 1.5 + roundFloat [r incrbyfloat novar 1.5] + } {3} + + test {INCRBYFLOAT over 32bit value} { + r set novar 17179869184 + r incrbyfloat novar 1.5 + } {17179869185.5} + + test {INCRBYFLOAT over 32bit value with over 32bit increment} { + r set novar 17179869184 + r incrbyfloat novar 17179869184 + } {34359738368} + + test {INCRBYFLOAT fails against key with spaces (left)} { + set err {} + r set novar " 11" + catch {r incrbyfloat novar 1.0} err + format $err + } {ERR *valid*} + + test {INCRBYFLOAT fails against key with spaces (right)} { + set err {} + r set novar "11 " + catch {r incrbyfloat novar 1.0} err + format $err + } {ERR *valid*} + + test {INCRBYFLOAT fails against key with spaces (both)} { + set err {} + r set novar " 11 " + catch {r incrbyfloat novar 1.0} err + format $err + } {ERR *valid*} + + test {INCRBYFLOAT fails against a key holding a list} { + r del mylist + set err {} + r rpush mylist 1 + catch {r incrbyfloat mylist 1.0} err + r del mylist + format $err + } {WRONGTYPE*} + + # On some platforms strtold("+inf") with valgrind returns a non-inf result + if {!$::valgrind} { + test {INCRBYFLOAT does not allow NaN or Infinity} { + r set foo 0 + set err {} + catch {r incrbyfloat foo +inf} err + set err + # p.s. no way I can force NaN to test it from the API because + # there is no way to increment / decrement by infinity nor to + # perform divisions. + } {ERR *would produce*} + } + + test {INCRBYFLOAT decrement} { + r set foo 1 + roundFloat [r incrbyfloat foo -1.1] + } {-0.1} + + test {string to double with null terminator} { + r set foo 1 + r setrange foo 2 2 + catch {r incrbyfloat foo 1} err + format $err + } {ERR *valid*} + + test {No negative zero} { + r del foo + r incrbyfloat foo [expr double(1)/41] + r incrbyfloat foo [expr double(-1)/41] + r get foo + } {0} + + foreach cmd {"incr" "decr" "incrby" "decrby"} { + test "$cmd operation should update encoding from raw to int" { + set res {} + set expected {1 12} + if {[string match {*incr*} $cmd]} { + lappend expected 13 + } else { + lappend expected 11 + } + + r set foo 1 + assert_encoding "int" foo + lappend res [r get foo] + + r append foo 2 + assert_encoding "raw" foo + lappend res [r get foo] + + if {[string match {*by*} $cmd]} { + r $cmd foo 1 + } else { + r $cmd foo + } + assert_encoding "int" foo + lappend res [r get foo] + assert_equal $res $expected + } + } +} diff --git a/tests/unit/type/list-2.tcl b/tests/unit/type/list-2.tcl new file mode 100644 index 0000000..5874a90 --- /dev/null +++ b/tests/unit/type/list-2.tcl @@ -0,0 +1,47 @@ +start_server { + tags {"list"} + overrides { + "list-max-ziplist-size" 4 + } +} { + source "tests/unit/type/list-common.tcl" + + foreach {type large} [array get largevalue] { + tags {"slow"} { + test "LTRIM stress testing - $type" { + set mylist {} + set startlen 32 + r del mylist + + # Start with the large value to ensure the + # right encoding is used. + r rpush mylist $large + lappend mylist $large + + for {set i 0} {$i < $startlen} {incr i} { + set str [randomInt 9223372036854775807] + r rpush mylist $str + lappend mylist $str + } + + for {set i 0} {$i < 1000} {incr i} { + set min [expr {int(rand()*$startlen)}] + set max [expr {$min+int(rand()*$startlen)}] + set before_len [llength $mylist] + set before_len_r [r llen mylist] + assert_equal $before_len $before_len_r + set mylist [lrange $mylist $min $max] + r ltrim mylist $min $max + assert_equal $mylist [r lrange mylist 0 -1] "failed trim" + + for {set j [r llen mylist]} {$j < $startlen} {incr j} { + set str [randomInt 9223372036854775807] + r rpush mylist $str + lappend mylist $str + assert_equal $mylist [r lrange mylist 0 -1] "failed append match" + } + } + } + } + } +} diff --git a/tests/unit/type/list-3.tcl b/tests/unit/type/list-3.tcl new file mode 100644 index 0000000..45df593 --- /dev/null +++ b/tests/unit/type/list-3.tcl @@ -0,0 +1,232 @@ +proc generate_cmd_on_list_key {key} { + set op [randomInt 7] + set small_signed_count [expr 5-[randomInt 10]] + if {[randomInt 2] == 0} { + set ele [randomInt 1000] + } else { + set ele [string repeat x [randomInt 10000]][randomInt 1000] + } + switch $op { + 0 {return "lpush $key $ele"} + 1 {return "rpush $key $ele"} + 2 {return "lpop $key"} + 3 {return "rpop $key"} + 4 { + return "lset $key $small_signed_count $ele" + } + 5 { + set otherele [randomInt 1000] + if {[randomInt 2] == 0} { + set where before + } else { + set where after + } + return "linsert $key $where $otherele $ele" + } + 6 { + set otherele "" + catch { + set index [randomInt [r llen $key]] + set otherele [r lindex $key $index] + } + return "lrem $key 1 $otherele" + } + } +} + +start_server { + tags {"list ziplist"} + overrides { + "list-max-ziplist-size" 16 + } +} { + test {Explicit regression for a list bug} { + set mylist {49376042582 {BkG2o\pIC]4YYJa9cJ4GWZalG[4tin;1D2whSkCOW`mX;SFXGyS8sedcff3fQI^tgPCC@^Nu1J6o]meM@Lko]t_jRyo<xSJ1oObDYd`ppZuW6P@fS278YaOx=s6lvdFlMbP0[SbkI^Kr\HBXtuFaA^mDx:yzS4a[skiiPWhT<nNfAf=aQVfclcuwDrfe;iVuKdNvB9kbfq>tK?tH[\EvWqS]b`o2OCtjg:?nUTwdjpcUm]y:pg5q24q7LlCOwQE^}} + r del l + r rpush l [lindex $mylist 0] + r rpush l [lindex $mylist 1] + assert_equal [r lindex l 0] [lindex $mylist 0] + assert_equal [r lindex l 1] [lindex $mylist 1] + } + + test {Regression for quicklist #3343 bug} { + r del mylist + r lpush mylist 401 + r lpush mylist 392 + r rpush mylist [string repeat x 5105]"799" + r lset mylist -1 [string repeat x 1014]"702" + r lpop mylist + r lset mylist -1 [string repeat x 4149]"852" + r linsert mylist before 401 [string repeat x 9927]"12" + r lrange mylist 0 -1 + r ping ; # It's enough if the server is still alive + } {PONG} + + test {Check compression with recompress} { + r del key + config_set list-compress-depth 1 + config_set list-max-ziplist-size 16 + r rpush key a + r rpush key [string repeat b 50000] + r rpush key c + r lset key 1 d + r rpop key + r rpush key [string repeat e 5000] + r linsert key before f 1 + r rpush key g + r ping + } + + test {Crash due to wrongly recompress after lrem} { + r del key + config_set list-compress-depth 2 + r lpush key a + r lpush key [string repeat a 5000] + r lpush key [string repeat b 5000] + r lpush key [string repeat c 5000] + r rpush key [string repeat x 10000]"969" + r rpush key b + r lrem key 1 a + r rpop key + r lrem key 1 [string repeat x 10000]"969" + r rpush key crash + r ping + } + + test {LINSERT correctly recompress full quicklistNode after inserting a element before it} { + r del key + config_set list-compress-depth 1 + r rpush key b + r rpush key c + r lset key -1 [string repeat x 8192]"969" + r lpush key a + r rpush key d + r linsert key before b f + r rpop key + r ping + } + + test {LINSERT correctly recompress full quicklistNode after inserting a element after it} { + r del key + config_set list-compress-depth 1 + r rpush key b + r rpush key c + r lset key 0 [string repeat x 8192]"969" + r lpush key a + r rpush key d + r linsert key after c f + r lpop key + r ping + } + +foreach comp {2 1 0} { + set cycles 1000 + if {$::accurate} { set cycles 10000 } + config_set list-compress-depth $comp + + test "Stress tester for #3343-alike bugs comp: $comp" { + r del key + set sent {} + for {set j 0} {$j < $cycles} {incr j} { + catch { + set cmd [generate_cmd_on_list_key key] + lappend sent $cmd + + # execute the command, we expect commands to fail on syntax errors + r {*}$cmd + } + } + + set print_commands false + set crash false + if {[catch {r ping}]} { + puts "Server crashed" + set print_commands true + set crash true + } + + if {!$::external} { + # check valgrind and asan report for invalid reads after execute + # command so that we have a report that is easier to reproduce + set valgrind_errors [find_valgrind_errors [srv 0 stderr] false] + set asan_errors [sanitizer_errors_from_file [srv 0 stderr]] + if {$valgrind_errors != "" || $asan_errors != ""} { + puts "valgrind or asan found an issue" + set print_commands true + } + } + + if {$print_commands} { + puts "violating commands:" + foreach cmd $sent { + puts $cmd + } + } + + assert_equal $crash false + } +} ;# foreach comp + + tags {slow} { + test {ziplist implementation: value encoding and backlink} { + if {$::accurate} {set iterations 100} else {set iterations 10} + for {set j 0} {$j < $iterations} {incr j} { + r del l + set l {} + for {set i 0} {$i < 200} {incr i} { + randpath { + set data [string repeat x [randomInt 100000]] + } { + set data [randomInt 65536] + } { + set data [randomInt 4294967296] + } { + set data [randomInt 18446744073709551616] + } { + set data -[randomInt 65536] + if {$data eq {-0}} {set data 0} + } { + set data -[randomInt 4294967296] + if {$data eq {-0}} {set data 0} + } { + set data -[randomInt 18446744073709551616] + if {$data eq {-0}} {set data 0} + } + lappend l $data + r rpush l $data + } + assert_equal [llength $l] [r llen l] + # Traverse backward + for {set i 199} {$i >= 0} {incr i -1} { + if {[lindex $l $i] ne [r lindex l $i]} { + assert_equal [lindex $l $i] [r lindex l $i] + } + } + } + } + + test {ziplist implementation: encoding stress testing} { + for {set j 0} {$j < 200} {incr j} { + r del l + set l {} + set len [randomInt 400] + for {set i 0} {$i < $len} {incr i} { + set rv [randomValue] + randpath { + lappend l $rv + r rpush l $rv + } { + set l [concat [list $rv] $l] + r lpush l $rv + } + } + assert_equal [llength $l] [r llen l] + for {set i 0} {$i < $len} {incr i} { + if {[lindex $l $i] ne [r lindex l $i]} { + assert_equal [lindex $l $i] [r lindex l $i] + } + } + } + } + } +} diff --git a/tests/unit/type/list-common.tcl b/tests/unit/type/list-common.tcl new file mode 100644 index 0000000..b393737 --- /dev/null +++ b/tests/unit/type/list-common.tcl @@ -0,0 +1,4 @@ +# We need a value to make sure the list has the right encoding when it is inserted. +array set largevalue {} +set largevalue(listpack) "hello" +set largevalue(quicklist) [string repeat "x" 8192] diff --git a/tests/unit/type/list.tcl b/tests/unit/type/list.tcl new file mode 100644 index 0000000..993b6d1 --- /dev/null +++ b/tests/unit/type/list.tcl @@ -0,0 +1,2363 @@ +# check functionality compression of plain and zipped nodes +start_server [list overrides [list save ""] ] { + r config set list-compress-depth 2 + r config set list-max-ziplist-size 1 + + # 3 test to check compression with regular ziplist nodes + # 1. using push + insert + # 2. using push + insert + trim + # 3. using push + insert + set + + test {reg node check compression with insert and pop} { + r lpush list1 [string repeat a 500] + r lpush list1 [string repeat b 500] + r lpush list1 [string repeat c 500] + r lpush list1 [string repeat d 500] + r linsert list1 after [string repeat d 500] [string repeat e 500] + r linsert list1 after [string repeat d 500] [string repeat f 500] + r linsert list1 after [string repeat d 500] [string repeat g 500] + r linsert list1 after [string repeat d 500] [string repeat j 500] + assert_equal [r lpop list1] [string repeat d 500] + assert_equal [r lpop list1] [string repeat j 500] + assert_equal [r lpop list1] [string repeat g 500] + assert_equal [r lpop list1] [string repeat f 500] + assert_equal [r lpop list1] [string repeat e 500] + assert_equal [r lpop list1] [string repeat c 500] + assert_equal [r lpop list1] [string repeat b 500] + assert_equal [r lpop list1] [string repeat a 500] + }; + + test {reg node check compression combined with trim} { + r lpush list2 [string repeat a 500] + r linsert list2 after [string repeat a 500] [string repeat b 500] + r rpush list2 [string repeat c 500] + assert_equal [string repeat b 500] [r lindex list2 1] + r LTRIM list2 1 -1 + r llen list2 + } {2} + + test {reg node check compression with lset} { + r lpush list3 [string repeat a 500] + r LSET list3 0 [string repeat b 500] + assert_equal [string repeat b 500] [r lindex list3 0] + r lpush list3 [string repeat c 500] + r LSET list3 0 [string repeat d 500] + assert_equal [string repeat d 500] [r lindex list3 0] + } + + # repeating the 3 tests with plain nodes + # (by adjusting quicklist-packed-threshold) + + test {plain node check compression} { + r debug quicklist-packed-threshold 1b + r lpush list4 [string repeat a 500] + r lpush list4 [string repeat b 500] + r lpush list4 [string repeat c 500] + r lpush list4 [string repeat d 500] + r linsert list4 after [string repeat d 500] [string repeat e 500] + r linsert list4 after [string repeat d 500] [string repeat f 500] + r linsert list4 after [string repeat d 500] [string repeat g 500] + r linsert list4 after [string repeat d 500] [string repeat j 500] + assert_equal [r lpop list4] [string repeat d 500] + assert_equal [r lpop list4] [string repeat j 500] + assert_equal [r lpop list4] [string repeat g 500] + assert_equal [r lpop list4] [string repeat f 500] + assert_equal [r lpop list4] [string repeat e 500] + assert_equal [r lpop list4] [string repeat c 500] + assert_equal [r lpop list4] [string repeat b 500] + assert_equal [r lpop list4] [string repeat a 500] + r debug quicklist-packed-threshold 0 + } {OK} {needs:debug} + + test {plain node check compression with ltrim} { + r debug quicklist-packed-threshold 1b + r lpush list5 [string repeat a 500] + r linsert list5 after [string repeat a 500] [string repeat b 500] + r rpush list5 [string repeat c 500] + assert_equal [string repeat b 500] [r lindex list5 1] + r LTRIM list5 1 -1 + assert_equal [r llen list5] 2 + r debug quicklist-packed-threshold 0 + } {OK} {needs:debug} + + test {plain node check compression using lset} { + r debug quicklist-packed-threshold 1b + r lpush list6 [string repeat a 500] + r LSET list6 0 [string repeat b 500] + assert_equal [string repeat b 500] [r lindex list6 0] + r lpush list6 [string repeat c 500] + r LSET list6 0 [string repeat d 500] + assert_equal [string repeat d 500] [r lindex list6 0] + r debug quicklist-packed-threshold 0 + } {OK} {needs:debug} + + # revert config for external mode tests. + r config set list-compress-depth 0 +} + +# check functionality of plain nodes using low packed-threshold +start_server [list overrides [list save ""] ] { + # basic command check for plain nodes - "LPUSH & LPOP" + test {Test LPUSH and LPOP on plain nodes} { + r flushdb + r debug quicklist-packed-threshold 1b + r lpush lst 9 + r lpush lst xxxxxxxxxx + r lpush lst xxxxxxxxxx + set s0 [s used_memory] + assert {$s0 > 10} + assert {[r llen lst] == 3} + set s0 [r rpop lst] + set s1 [r rpop lst] + assert {$s0 eq "9"} + assert {[r llen lst] == 1} + r lpop lst + assert {[string length $s1] == 10} + # check rdb + r lpush lst xxxxxxxxxx + r lpush lst bb + r debug reload + assert_equal [r rpop lst] "xxxxxxxxxx" + r debug quicklist-packed-threshold 0 + } {OK} {needs:debug} + + # basic command check for plain nodes - "LINDEX & LINSERT" + test {Test LINDEX and LINSERT on plain nodes} { + r flushdb + r debug quicklist-packed-threshold 1b + r lpush lst xxxxxxxxxxx + r lpush lst 9 + r lpush lst xxxxxxxxxxx + r linsert lst before "9" "8" + assert {[r lindex lst 1] eq "8"} + r linsert lst BEFORE "9" "7" + r linsert lst BEFORE "9" "xxxxxxxxxxx" + assert {[r lindex lst 3] eq "xxxxxxxxxxx"} + r debug quicklist-packed-threshold 0 + } {OK} {needs:debug} + + # basic command check for plain nodes - "LTRIM" + test {Test LTRIM on plain nodes} { + r flushdb + r debug quicklist-packed-threshold 1b + r lpush lst1 9 + r lpush lst1 xxxxxxxxxxx + r lpush lst1 9 + r LTRIM lst1 1 -1 + assert_equal [r llen lst1] 2 + r debug quicklist-packed-threshold 0 + } {OK} {needs:debug} + + # basic command check for plain nodes - "LREM" + test {Test LREM on plain nodes} { + r flushdb + r debug quicklist-packed-threshold 1b + r lpush lst one + r lpush lst xxxxxxxxxxx + set s0 [s used_memory] + assert {$s0 > 10} + r lpush lst 9 + r LREM lst -2 "one" + assert_equal [r llen lst] 2 + r debug quicklist-packed-threshold 0 + } {OK} {needs:debug} + + # basic command check for plain nodes - "LPOS" + test {Test LPOS on plain nodes} { + r flushdb + r debug quicklist-packed-threshold 1b + r RPUSH lst "aa" + r RPUSH lst "bb" + r RPUSH lst "cc" + r LSET lst 0 "xxxxxxxxxxx" + assert_equal [r LPOS lst "xxxxxxxxxxx"] 0 + r debug quicklist-packed-threshold 0 + } {OK} {needs:debug} + + # basic command check for plain nodes - "LMOVE" + test {Test LMOVE on plain nodes} { + r flushdb + r debug quicklist-packed-threshold 1b + r RPUSH lst2{t} "aa" + r RPUSH lst2{t} "bb" + r LSET lst2{t} 0 xxxxxxxxxxx + r RPUSH lst2{t} "cc" + r RPUSH lst2{t} "dd" + r LMOVE lst2{t} lst{t} RIGHT LEFT + r LMOVE lst2{t} lst{t} LEFT RIGHT + assert_equal [r llen lst{t}] 2 + assert_equal [r llen lst2{t}] 2 + assert_equal [r lpop lst2{t}] "bb" + assert_equal [r lpop lst2{t}] "cc" + assert_equal [r lpop lst{t}] "dd" + assert_equal [r lpop lst{t}] "xxxxxxxxxxx" + r debug quicklist-packed-threshold 0 + } {OK} {needs:debug} + + # testing LSET with combinations of node types + # plain->packed , packed->plain, plain->plain, packed->packed + test {Test LSET with packed / plain combinations} { + r debug quicklist-packed-threshold 5b + r RPUSH lst "aa" + r RPUSH lst "bb" + r lset lst 0 [string repeat d 50001] + set s1 [r lpop lst] + assert_equal $s1 [string repeat d 50001] + r RPUSH lst [string repeat f 50001] + r lset lst 0 [string repeat e 50001] + set s1 [r lpop lst] + assert_equal $s1 [string repeat e 50001] + r RPUSH lst [string repeat m 50001] + r lset lst 0 "bb" + set s1 [r lpop lst] + assert_equal $s1 "bb" + r RPUSH lst "bb" + r lset lst 0 "cc" + set s1 [r lpop lst] + assert_equal $s1 "cc" + r debug quicklist-packed-threshold 0 + } {OK} {needs:debug} + + # checking LSET in case ziplist needs to be split + test {Test LSET with packed is split in the middle} { + r flushdb + r debug quicklist-packed-threshold 5b + r RPUSH lst "aa" + r RPUSH lst "bb" + r RPUSH lst "cc" + r RPUSH lst "dd" + r RPUSH lst "ee" + r lset lst 2 [string repeat e 10] + assert_equal [r lpop lst] "aa" + assert_equal [r lpop lst] "bb" + assert_equal [r lpop lst] [string repeat e 10] + assert_equal [r lpop lst] "dd" + assert_equal [r lpop lst] "ee" + r debug quicklist-packed-threshold 0 + } {OK} {needs:debug} + + + # repeating "plain check LSET with combinations" + # but now with single item in each ziplist + test {Test LSET with packed consist only one item} { + r flushdb + set original_config [config_get_set list-max-ziplist-size 1] + r debug quicklist-packed-threshold 1b + r RPUSH lst "aa" + r RPUSH lst "bb" + r lset lst 0 [string repeat d 50001] + set s1 [r lpop lst] + assert_equal $s1 [string repeat d 50001] + r RPUSH lst [string repeat f 50001] + r lset lst 0 [string repeat e 50001] + set s1 [r lpop lst] + assert_equal $s1 [string repeat e 50001] + r RPUSH lst [string repeat m 50001] + r lset lst 0 "bb" + set s1 [r lpop lst] + assert_equal $s1 "bb" + r RPUSH lst "bb" + r lset lst 0 "cc" + set s1 [r lpop lst] + assert_equal $s1 "cc" + r debug quicklist-packed-threshold 0 + r config set list-max-ziplist-size $original_config + } {OK} {needs:debug} + + test {Crash due to delete entry from a compress quicklist node} { + r flushdb + r debug quicklist-packed-threshold 100b + set original_config [config_get_set list-compress-depth 1] + + set small_ele [string repeat x 32] + set large_ele [string repeat x 100] + + # Push a large element + r RPUSH lst $large_ele + + # Insert two elements and keep them in the same node + r RPUSH lst $small_ele + r RPUSH lst $small_ele + + # When setting the position of -1 to a large element, we first insert + # a large element at the end and then delete its previous element. + r LSET lst -1 $large_ele + assert_equal "$large_ele $small_ele $large_ele" [r LRANGE lst 0 -1] + + r debug quicklist-packed-threshold 0 + r config set list-compress-depth $original_config + } {OK} {needs:debug} + + test {Crash due to split quicklist node wrongly} { + r flushdb + r debug quicklist-packed-threshold 10b + + r LPUSH lst "aa" + r LPUSH lst "bb" + r LSET lst -2 [string repeat x 10] + r RPOP lst + assert_equal [string repeat x 10] [r LRANGE lst 0 -1] + + r debug quicklist-packed-threshold 0 + } {OK} {needs:debug} +} + +run_solo {list-large-memory} { +start_server [list overrides [list save ""] ] { + +# test if the server supports such large configs (avoid 32 bit builds) +catch { + r config set proto-max-bulk-len 10000000000 ;#10gb + r config set client-query-buffer-limit 10000000000 ;#10gb +} +if {[lindex [r config get proto-max-bulk-len] 1] == 10000000000} { + + set str_length 5000000000 + + # repeating all the plain nodes basic checks with 5gb values + test {Test LPUSH and LPOP on plain nodes over 4GB} { + r flushdb + r lpush lst 9 + r write "*3\r\n\$5\r\nLPUSH\r\n\$3\r\nlst\r\n" + write_big_bulk $str_length; + r write "*3\r\n\$5\r\nLPUSH\r\n\$3\r\nlst\r\n" + write_big_bulk $str_length; + set s0 [s used_memory] + assert {$s0 > $str_length} + assert {[r llen lst] == 3} + assert_equal [r rpop lst] "9" + assert_equal [read_big_bulk {r rpop lst}] $str_length + assert {[r llen lst] == 1} + assert_equal [read_big_bulk {r rpop lst}] $str_length + } {} {large-memory} + + test {Test LINDEX and LINSERT on plain nodes over 4GB} { + r flushdb + r write "*3\r\n\$5\r\nLPUSH\r\n\$3\r\nlst\r\n" + write_big_bulk $str_length; + r lpush lst 9 + r write "*3\r\n\$5\r\nLPUSH\r\n\$3\r\nlst\r\n" + write_big_bulk $str_length; + r linsert lst before "9" "8" + assert_equal [r lindex lst 1] "8" + r LINSERT lst BEFORE "9" "7" + r write "*5\r\n\$7\r\nLINSERT\r\n\$3\r\nlst\r\n\$6\r\nBEFORE\r\n\$3\r\n\"9\"\r\n" + write_big_bulk 10; + assert_equal [read_big_bulk {r rpop lst}] $str_length + } {} {large-memory} + + test {Test LTRIM on plain nodes over 4GB} { + r flushdb + r lpush lst 9 + r write "*3\r\n\$5\r\nLPUSH\r\n\$3\r\nlst\r\n" + write_big_bulk $str_length; + r lpush lst 9 + r LTRIM lst 1 -1 + assert_equal [r llen lst] 2 + assert_equal [r rpop lst] 9 + assert_equal [read_big_bulk {r rpop lst}] $str_length + } {} {large-memory} + + test {Test LREM on plain nodes over 4GB} { + r flushdb + r lpush lst one + r write "*3\r\n\$5\r\nLPUSH\r\n\$3\r\nlst\r\n" + write_big_bulk $str_length; + r lpush lst 9 + r LREM lst -2 "one" + assert_equal [read_big_bulk {r rpop lst}] $str_length + r llen lst + } {1} {large-memory} + + test {Test LSET on plain nodes over 4GB} { + r flushdb + r RPUSH lst "aa" + r RPUSH lst "bb" + r RPUSH lst "cc" + r write "*4\r\n\$4\r\nLSET\r\n\$3\r\nlst\r\n\$1\r\n0\r\n" + write_big_bulk $str_length; + assert_equal [r rpop lst] "cc" + assert_equal [r rpop lst] "bb" + assert_equal [read_big_bulk {r rpop lst}] $str_length + } {} {large-memory} + + test {Test LMOVE on plain nodes over 4GB} { + r flushdb + r RPUSH lst2{t} "aa" + r RPUSH lst2{t} "bb" + r write "*4\r\n\$4\r\nLSET\r\n\$7\r\nlst2{t}\r\n\$1\r\n0\r\n" + write_big_bulk $str_length; + r RPUSH lst2{t} "cc" + r RPUSH lst2{t} "dd" + r LMOVE lst2{t} lst{t} RIGHT LEFT + assert_equal [read_big_bulk {r LMOVE lst2{t} lst{t} LEFT RIGHT}] $str_length + assert_equal [r llen lst{t}] 2 + assert_equal [r llen lst2{t}] 2 + assert_equal [r lpop lst2{t}] "bb" + assert_equal [r lpop lst2{t}] "cc" + assert_equal [r lpop lst{t}] "dd" + assert_equal [read_big_bulk {r rpop lst{t}}] $str_length + } {} {large-memory} + + # restore defaults + r config set proto-max-bulk-len 536870912 + r config set client-query-buffer-limit 1073741824 + +} ;# skip 32bit builds +} +} ;# run_solo + +start_server { + tags {"list"} + overrides { + "list-max-ziplist-size" -1 + } +} { + source "tests/unit/type/list-common.tcl" + + # A helper function to execute either B*POP or BLMPOP* with one input key. + proc bpop_command {rd pop key timeout} { + if {$pop == "BLMPOP_LEFT"} { + $rd blmpop $timeout 1 $key left count 1 + } elseif {$pop == "BLMPOP_RIGHT"} { + $rd blmpop $timeout 1 $key right count 1 + } else { + $rd $pop $key $timeout + } + } + + # A helper function to execute either B*POP or BLMPOP* with two input keys. + proc bpop_command_two_key {rd pop key key2 timeout} { + if {$pop == "BLMPOP_LEFT"} { + $rd blmpop $timeout 2 $key $key2 left count 1 + } elseif {$pop == "BLMPOP_RIGHT"} { + $rd blmpop $timeout 2 $key $key2 right count 1 + } else { + $rd $pop $key $key2 $timeout + } + } + + proc create_listpack {key entries} { + r del $key + foreach entry $entries { r rpush $key $entry } + assert_encoding listpack $key + } + + proc create_quicklist {key entries} { + r del $key + foreach entry $entries { r rpush $key $entry } + assert_encoding quicklist $key + } + +foreach {type large} [array get largevalue] { + test "LPOS basic usage - $type" { + r DEL mylist + r RPUSH mylist a b c $large 2 3 c c + assert {[r LPOS mylist a] == 0} + assert {[r LPOS mylist c] == 2} + } + + test {LPOS RANK (positive, negative and zero rank) option} { + assert {[r LPOS mylist c RANK 1] == 2} + assert {[r LPOS mylist c RANK 2] == 6} + assert {[r LPOS mylist c RANK 4] eq ""} + assert {[r LPOS mylist c RANK -1] == 7} + assert {[r LPOS mylist c RANK -2] == 6} + assert_error "*RANK can't be zero: use 1 to start from the first match, 2 from the second ... or use negative to start*" {r LPOS mylist c RANK 0} + assert_error "*value is out of range*" {r LPOS mylist c RANK -9223372036854775808} + } + + test {LPOS COUNT option} { + assert {[r LPOS mylist c COUNT 0] == {2 6 7}} + assert {[r LPOS mylist c COUNT 1] == {2}} + assert {[r LPOS mylist c COUNT 2] == {2 6}} + assert {[r LPOS mylist c COUNT 100] == {2 6 7}} + } + + test {LPOS COUNT + RANK option} { + assert {[r LPOS mylist c COUNT 0 RANK 2] == {6 7}} + assert {[r LPOS mylist c COUNT 2 RANK -1] == {7 6}} + } + + test {LPOS non existing key} { + assert {[r LPOS mylistxxx c COUNT 0 RANK 2] eq {}} + } + + test {LPOS no match} { + assert {[r LPOS mylist x COUNT 2 RANK -1] eq {}} + assert {[r LPOS mylist x RANK -1] eq {}} + } + + test {LPOS MAXLEN} { + assert {[r LPOS mylist a COUNT 0 MAXLEN 1] == {0}} + assert {[r LPOS mylist c COUNT 0 MAXLEN 1] == {}} + assert {[r LPOS mylist c COUNT 0 MAXLEN 3] == {2}} + assert {[r LPOS mylist c COUNT 0 MAXLEN 3 RANK -1] == {7 6}} + assert {[r LPOS mylist c COUNT 0 MAXLEN 7 RANK 2] == {6}} + } + + test {LPOS when RANK is greater than matches} { + r DEL mylist + r LPUSH mylist a + assert {[r LPOS mylist b COUNT 10 RANK 5] eq {}} + } + + test "LPUSH, RPUSH, LLENGTH, LINDEX, LPOP - $type" { + # first lpush then rpush + r del mylist1 + assert_equal 1 [r lpush mylist1 $large] + assert_encoding $type mylist1 + assert_equal 2 [r rpush mylist1 b] + assert_equal 3 [r rpush mylist1 c] + assert_equal 3 [r llen mylist1] + assert_equal $large [r lindex mylist1 0] + assert_equal b [r lindex mylist1 1] + assert_equal c [r lindex mylist1 2] + assert_equal {} [r lindex mylist1 3] + assert_equal c [r rpop mylist1] + assert_equal $large [r lpop mylist1] + + # first rpush then lpush + r del mylist2 + assert_equal 1 [r rpush mylist2 $large] + assert_equal 2 [r lpush mylist2 b] + assert_equal 3 [r lpush mylist2 c] + assert_encoding $type mylist2 + assert_equal 3 [r llen mylist2] + assert_equal c [r lindex mylist2 0] + assert_equal b [r lindex mylist2 1] + assert_equal $large [r lindex mylist2 2] + assert_equal {} [r lindex mylist2 3] + assert_equal $large [r rpop mylist2] + assert_equal c [r lpop mylist2] + } + + test "LPOP/RPOP with wrong number of arguments" { + assert_error {*wrong number of arguments for 'lpop' command} {r lpop key 1 1} + assert_error {*wrong number of arguments for 'rpop' command} {r rpop key 2 2} + } + + test "RPOP/LPOP with the optional count argument - $type" { + assert_equal 7 [r lpush listcount aa $large cc dd ee ff gg] + assert_equal {gg} [r lpop listcount 1] + assert_equal {ff ee} [r lpop listcount 2] + assert_equal "aa $large" [r rpop listcount 2] + assert_equal {cc} [r rpop listcount 1] + assert_equal {dd} [r rpop listcount 123] + assert_error "*ERR*range*" {r lpop forbarqaz -123} + } +} + + proc verify_resp_response {resp response resp2_response resp3_response} { + if {$resp == 2} { + assert_equal $response $resp2_response + } elseif {$resp == 3} { + assert_equal $response $resp3_response + } + } + + foreach resp {3 2} { + if {[lsearch $::denytags "resp3"] >= 0} { + if {$resp == 3} {continue} + } elseif {$::force_resp3} { + if {$resp == 2} {continue} + } + r hello $resp + + # Make sure we can distinguish between an empty array and a null response + r readraw 1 + + test "LPOP/RPOP with the count 0 returns an empty array in RESP$resp" { + r lpush listcount zero + assert_equal {*0} [r lpop listcount 0] + assert_equal {*0} [r rpop listcount 0] + } + + test "LPOP/RPOP against non existing key in RESP$resp" { + r del non_existing_key + + verify_resp_response $resp [r lpop non_existing_key] {$-1} {_} + verify_resp_response $resp [r rpop non_existing_key] {$-1} {_} + } + + test "LPOP/RPOP with <count> against non existing key in RESP$resp" { + r del non_existing_key + + verify_resp_response $resp [r lpop non_existing_key 0] {*-1} {_} + verify_resp_response $resp [r lpop non_existing_key 1] {*-1} {_} + + verify_resp_response $resp [r rpop non_existing_key 0] {*-1} {_} + verify_resp_response $resp [r rpop non_existing_key 1] {*-1} {_} + } + + r readraw 0 + r hello 2 + } + + test {Variadic RPUSH/LPUSH} { + r del mylist + assert_equal 4 [r lpush mylist a b c d] + assert_equal 8 [r rpush mylist 0 1 2 3] + assert_equal {d c b a 0 1 2 3} [r lrange mylist 0 -1] + } + + test {DEL a list} { + assert_equal 1 [r del mylist2] + assert_equal 0 [r exists mylist2] + assert_equal 0 [r llen mylist2] + } + + foreach {type large} [array get largevalue] { + foreach {pop} {BLPOP BLMPOP_LEFT} { + test "$pop: single existing list - $type" { + set rd [redis_deferring_client] + create_$type blist "a b $large c d" + + bpop_command $rd $pop blist 1 + assert_equal {blist a} [$rd read] + if {$pop == "BLPOP"} { + bpop_command $rd BRPOP blist 1 + } else { + bpop_command $rd BLMPOP_RIGHT blist 1 + } + assert_equal {blist d} [$rd read] + + bpop_command $rd $pop blist 1 + assert_equal {blist b} [$rd read] + if {$pop == "BLPOP"} { + bpop_command $rd BRPOP blist 1 + } else { + bpop_command $rd BLMPOP_RIGHT blist 1 + } + assert_equal {blist c} [$rd read] + + assert_equal 1 [r llen blist] + $rd close + } + + test "$pop: multiple existing lists - $type" { + set rd [redis_deferring_client] + create_$type blist1{t} "a $large c" + create_$type blist2{t} "d $large f" + + bpop_command_two_key $rd $pop blist1{t} blist2{t} 1 + assert_equal {blist1{t} a} [$rd read] + if {$pop == "BLPOP"} { + bpop_command_two_key $rd BRPOP blist1{t} blist2{t} 1 + } else { + bpop_command_two_key $rd BLMPOP_RIGHT blist1{t} blist2{t} 1 + } + assert_equal {blist1{t} c} [$rd read] + assert_equal 1 [r llen blist1{t}] + assert_equal 3 [r llen blist2{t}] + + bpop_command_two_key $rd $pop blist2{t} blist1{t} 1 + assert_equal {blist2{t} d} [$rd read] + if {$pop == "BLPOP"} { + bpop_command_two_key $rd BRPOP blist2{t} blist1{t} 1 + } else { + bpop_command_two_key $rd BLMPOP_RIGHT blist2{t} blist1{t} 1 + } + assert_equal {blist2{t} f} [$rd read] + assert_equal 1 [r llen blist1{t}] + assert_equal 1 [r llen blist2{t}] + $rd close + } + + test "$pop: second list has an entry - $type" { + set rd [redis_deferring_client] + r del blist1{t} + create_$type blist2{t} "d $large f" + + bpop_command_two_key $rd $pop blist1{t} blist2{t} 1 + assert_equal {blist2{t} d} [$rd read] + if {$pop == "BLPOP"} { + bpop_command_two_key $rd BRPOP blist1{t} blist2{t} 1 + } else { + bpop_command_two_key $rd BLMPOP_RIGHT blist1{t} blist2{t} 1 + } + assert_equal {blist2{t} f} [$rd read] + assert_equal 0 [r llen blist1{t}] + assert_equal 1 [r llen blist2{t}] + $rd close + } + } + + test "BRPOPLPUSH - $type" { + r del target{t} + r rpush target{t} bar + + set rd [redis_deferring_client] + create_$type blist{t} "a b $large c d" + + $rd brpoplpush blist{t} target{t} 1 + assert_equal d [$rd read] + + assert_equal d [r lpop target{t}] + assert_equal "a b $large c" [r lrange blist{t} 0 -1] + $rd close + } + + foreach wherefrom {left right} { + foreach whereto {left right} { + test "BLMOVE $wherefrom $whereto - $type" { + r del target{t} + r rpush target{t} bar + + set rd [redis_deferring_client] + create_$type blist{t} "a b $large c d" + + $rd blmove blist{t} target{t} $wherefrom $whereto 1 + set poppedelement [$rd read] + + if {$wherefrom eq "right"} { + assert_equal d $poppedelement + assert_equal "a b $large c" [r lrange blist{t} 0 -1] + } else { + assert_equal a $poppedelement + assert_equal "b $large c d" [r lrange blist{t} 0 -1] + } + + if {$whereto eq "right"} { + assert_equal $poppedelement [r rpop target{t}] + } else { + assert_equal $poppedelement [r lpop target{t}] + } + $rd close + } + } + } + } + +foreach {pop} {BLPOP BLMPOP_LEFT} { + test "$pop, LPUSH + DEL should not awake blocked client" { + set rd [redis_deferring_client] + r del list + + bpop_command $rd $pop list 0 + wait_for_blocked_client + + r multi + r lpush list a + r del list + r exec + r del list + r lpush list b + assert_equal {list b} [$rd read] + $rd close + } + + test "$pop, LPUSH + DEL + SET should not awake blocked client" { + set rd [redis_deferring_client] + r del list + + bpop_command $rd $pop list 0 + wait_for_blocked_client + + r multi + r lpush list a + r del list + r set list foo + r exec + r del list + r lpush list b + assert_equal {list b} [$rd read] + $rd close + } +} + + test "BLPOP with same key multiple times should work (issue #801)" { + set rd [redis_deferring_client] + r del list1{t} list2{t} + + # Data arriving after the BLPOP. + $rd blpop list1{t} list2{t} list2{t} list1{t} 0 + wait_for_blocked_client + r lpush list1{t} a + assert_equal [$rd read] {list1{t} a} + $rd blpop list1{t} list2{t} list2{t} list1{t} 0 + wait_for_blocked_client + r lpush list2{t} b + assert_equal [$rd read] {list2{t} b} + + # Data already there. + r lpush list1{t} a + r lpush list2{t} b + $rd blpop list1{t} list2{t} list2{t} list1{t} 0 + assert_equal [$rd read] {list1{t} a} + $rd blpop list1{t} list2{t} list2{t} list1{t} 0 + assert_equal [$rd read] {list2{t} b} + $rd close + } + +foreach {pop} {BLPOP BLMPOP_LEFT} { + test "MULTI/EXEC is isolated from the point of view of $pop" { + set rd [redis_deferring_client] + r del list + + bpop_command $rd $pop list 0 + wait_for_blocked_client + + r multi + r lpush list a + r lpush list b + r lpush list c + r exec + assert_equal {list c} [$rd read] + $rd close + } + + test "$pop with variadic LPUSH" { + set rd [redis_deferring_client] + r del blist + bpop_command $rd $pop blist 0 + wait_for_blocked_client + assert_equal 2 [r lpush blist foo bar] + assert_equal {blist bar} [$rd read] + assert_equal foo [lindex [r lrange blist 0 -1] 0] + $rd close + } +} + + test "BRPOPLPUSH with zero timeout should block indefinitely" { + set rd [redis_deferring_client] + r del blist{t} target{t} + r rpush target{t} bar + $rd brpoplpush blist{t} target{t} 0 + wait_for_blocked_clients_count 1 + r rpush blist{t} foo + assert_equal foo [$rd read] + assert_equal {foo bar} [r lrange target{t} 0 -1] + $rd close + } + + foreach wherefrom {left right} { + foreach whereto {left right} { + test "BLMOVE $wherefrom $whereto with zero timeout should block indefinitely" { + set rd [redis_deferring_client] + r del blist{t} target{t} + r rpush target{t} bar + $rd blmove blist{t} target{t} $wherefrom $whereto 0 + wait_for_blocked_clients_count 1 + r rpush blist{t} foo + assert_equal foo [$rd read] + if {$whereto eq "right"} { + assert_equal {bar foo} [r lrange target{t} 0 -1] + } else { + assert_equal {foo bar} [r lrange target{t} 0 -1] + } + $rd close + } + } + } + + foreach wherefrom {left right} { + foreach whereto {left right} { + test "BLMOVE ($wherefrom, $whereto) with a client BLPOPing the target list" { + set rd [redis_deferring_client] + set rd2 [redis_deferring_client] + r del blist{t} target{t} + $rd2 blpop target{t} 0 + wait_for_blocked_clients_count 1 + $rd blmove blist{t} target{t} $wherefrom $whereto 0 + wait_for_blocked_clients_count 2 + r rpush blist{t} foo + assert_equal foo [$rd read] + assert_equal {target{t} foo} [$rd2 read] + assert_equal 0 [r exists target{t}] + $rd close + $rd2 close + } + } + } + + test "BRPOPLPUSH with wrong source type" { + set rd [redis_deferring_client] + r del blist{t} target{t} + r set blist{t} nolist + $rd brpoplpush blist{t} target{t} 1 + assert_error "WRONGTYPE*" {$rd read} + $rd close + } + + test "BRPOPLPUSH with wrong destination type" { + set rd [redis_deferring_client] + r del blist{t} target{t} + r set target{t} nolist + r lpush blist{t} foo + $rd brpoplpush blist{t} target{t} 1 + assert_error "WRONGTYPE*" {$rd read} + $rd close + + set rd [redis_deferring_client] + r del blist{t} target{t} + r set target{t} nolist + $rd brpoplpush blist{t} target{t} 0 + wait_for_blocked_clients_count 1 + r rpush blist{t} foo + assert_error "WRONGTYPE*" {$rd read} + assert_equal {foo} [r lrange blist{t} 0 -1] + $rd close + } + + test "BRPOPLPUSH maintains order of elements after failure" { + set rd [redis_deferring_client] + r del blist{t} target{t} + r set target{t} nolist + $rd brpoplpush blist{t} target{t} 0 + wait_for_blocked_client + r rpush blist{t} a b c + assert_error "WRONGTYPE*" {$rd read} + $rd close + r lrange blist{t} 0 -1 + } {a b c} + + test "BRPOPLPUSH with multiple blocked clients" { + set rd1 [redis_deferring_client] + set rd2 [redis_deferring_client] + r del blist{t} target1{t} target2{t} + r set target1{t} nolist + $rd1 brpoplpush blist{t} target1{t} 0 + wait_for_blocked_clients_count 1 + $rd2 brpoplpush blist{t} target2{t} 0 + wait_for_blocked_clients_count 2 + r lpush blist{t} foo + + assert_error "WRONGTYPE*" {$rd1 read} + assert_equal {foo} [$rd2 read] + assert_equal {foo} [r lrange target2{t} 0 -1] + $rd1 close + $rd2 close + } + + test "BLMPOP with multiple blocked clients" { + set rd1 [redis_deferring_client] + set rd2 [redis_deferring_client] + set rd3 [redis_deferring_client] + set rd4 [redis_deferring_client] + r del blist{t} blist2{t} + + $rd1 blmpop 0 2 blist{t} blist2{t} left count 1 + wait_for_blocked_clients_count 1 + $rd2 blmpop 0 2 blist{t} blist2{t} right count 10 + wait_for_blocked_clients_count 2 + $rd3 blmpop 0 2 blist{t} blist2{t} left count 10 + wait_for_blocked_clients_count 3 + $rd4 blmpop 0 2 blist{t} blist2{t} right count 1 + wait_for_blocked_clients_count 4 + + r multi + r lpush blist{t} a b c d e + r lpush blist2{t} 1 2 3 4 5 + r exec + + assert_equal {blist{t} e} [$rd1 read] + assert_equal {blist{t} {a b c d}} [$rd2 read] + assert_equal {blist2{t} {5 4 3 2 1}} [$rd3 read] + + r lpush blist2{t} 1 2 3 + assert_equal {blist2{t} 1} [$rd4 read] + $rd1 close + $rd2 close + $rd3 close + $rd4 close + } + + test "Linked LMOVEs" { + set rd1 [redis_deferring_client] + set rd2 [redis_deferring_client] + + r del list1{t} list2{t} list3{t} + + $rd1 blmove list1{t} list2{t} right left 0 + wait_for_blocked_clients_count 1 + $rd2 blmove list2{t} list3{t} left right 0 + wait_for_blocked_clients_count 2 + + r rpush list1{t} foo + + assert_equal {} [r lrange list1{t} 0 -1] + assert_equal {} [r lrange list2{t} 0 -1] + assert_equal {foo} [r lrange list3{t} 0 -1] + $rd1 close + $rd2 close + } + + test "Circular BRPOPLPUSH" { + set rd1 [redis_deferring_client] + set rd2 [redis_deferring_client] + + r del list1{t} list2{t} + + $rd1 brpoplpush list1{t} list2{t} 0 + wait_for_blocked_clients_count 1 + $rd2 brpoplpush list2{t} list1{t} 0 + wait_for_blocked_clients_count 2 + + r rpush list1{t} foo + + assert_equal {foo} [r lrange list1{t} 0 -1] + assert_equal {} [r lrange list2{t} 0 -1] + $rd1 close + $rd2 close + } + + test "Self-referential BRPOPLPUSH" { + set rd [redis_deferring_client] + + r del blist{t} + + $rd brpoplpush blist{t} blist{t} 0 + wait_for_blocked_client + + r rpush blist{t} foo + + assert_equal {foo} [r lrange blist{t} 0 -1] + $rd close + } + + test "BRPOPLPUSH inside a transaction" { + r del xlist{t} target{t} + r lpush xlist{t} foo + r lpush xlist{t} bar + + r multi + r brpoplpush xlist{t} target{t} 0 + r brpoplpush xlist{t} target{t} 0 + r brpoplpush xlist{t} target{t} 0 + r lrange xlist{t} 0 -1 + r lrange target{t} 0 -1 + r exec + } {foo bar {} {} {bar foo}} + + test "PUSH resulting from BRPOPLPUSH affect WATCH" { + set blocked_client [redis_deferring_client] + set watching_client [redis_deferring_client] + r del srclist{t} dstlist{t} somekey{t} + r set somekey{t} somevalue + $blocked_client brpoplpush srclist{t} dstlist{t} 0 + wait_for_blocked_client + $watching_client watch dstlist{t} + $watching_client read + $watching_client multi + $watching_client read + $watching_client get somekey{t} + $watching_client read + r lpush srclist{t} element + $watching_client exec + set res [$watching_client read] + $blocked_client close + $watching_client close + set _ $res + } {} + + test "BRPOPLPUSH does not affect WATCH while still blocked" { + set blocked_client [redis_deferring_client] + set watching_client [redis_deferring_client] + r del srclist{t} dstlist{t} somekey{t} + r set somekey{t} somevalue + $blocked_client brpoplpush srclist{t} dstlist{t} 0 + wait_for_blocked_client + $watching_client watch dstlist{t} + $watching_client read + $watching_client multi + $watching_client read + $watching_client get somekey{t} + $watching_client read + $watching_client exec + # Blocked BLPOPLPUSH may create problems, unblock it. + r lpush srclist{t} element + set res [$watching_client read] + $blocked_client close + $watching_client close + set _ $res + } {somevalue} + + test {BRPOPLPUSH timeout} { + set rd [redis_deferring_client] + + $rd brpoplpush foo_list{t} bar_list{t} 1 + wait_for_blocked_clients_count 1 + wait_for_blocked_clients_count 0 500 10 + set res [$rd read] + $rd close + set _ $res + } {} + + test {SWAPDB awakes blocked client} { + r flushall + r select 1 + r rpush k hello + r select 9 + set rd [redis_deferring_client] + $rd brpop k 5 + wait_for_blocked_clients_count 1 + r swapdb 1 9 + $rd read + } {k hello} {singledb:skip} + + test {SWAPDB wants to wake blocked client, but the key already expired} { + set repl [attach_to_replication_stream] + r flushall + r debug set-active-expire 0 + r select 1 + r rpush k hello + r pexpire k 100 + set rd [redis_deferring_client] + $rd deferred 0 + $rd select 9 + set id [$rd client id] + $rd deferred 1 + $rd brpop k 1 + wait_for_blocked_clients_count 1 + after 101 + r swapdb 1 9 + # The SWAPDB command tries to awake the blocked client, but it remains + # blocked because the key is expired. Check that the deferred client is + # still blocked. Then unblock it. + assert_match "*flags=b*" [r client list id $id] + r client unblock $id + assert_equal {} [$rd read] + $rd deferred 0 + # We want to force key deletion to be propagated to the replica + # in order to verify it was expiered on the replication stream. + $rd set somekey1 someval1 + $rd exists k + r set somekey2 someval2 + + assert_replication_stream $repl { + {select *} + {flushall} + {select 1} + {rpush k hello} + {pexpireat k *} + {swapdb 1 9} + {select 9} + {set somekey1 someval1} + {del k} + {select 1} + {set somekey2 someval2} + } + close_replication_stream $repl + r debug set-active-expire 1 + # Restore server and client state + r select 9 + } {OK} {singledb:skip needs:debug} + + test {MULTI + LPUSH + EXPIRE + DEBUG SLEEP on blocked client, key already expired} { + set repl [attach_to_replication_stream] + r flushall + r debug set-active-expire 0 + + set rd [redis_deferring_client] + $rd client id + set id [$rd read] + $rd brpop k 0 + wait_for_blocked_clients_count 1 + + r multi + r rpush k hello + r pexpire k 100 + r debug sleep 0.2 + r exec + + # The EXEC command tries to awake the blocked client, but it remains + # blocked because the key is expired. Check that the deferred client is + # still blocked. Then unblock it. + assert_match "*flags=b*" [r client list id $id] + r client unblock $id + assert_equal {} [$rd read] + # We want to force key deletion to be propagated to the replica + # in order to verify it was expiered on the replication stream. + $rd exists k + assert_equal {0} [$rd read] + assert_replication_stream $repl { + {select *} + {flushall} + {multi} + {rpush k hello} + {pexpireat k *} + {exec} + {del k} + } + close_replication_stream $repl + # Restore server and client state + r debug set-active-expire 1 + r select 9 + } {OK} {singledb:skip needs:debug} + +foreach {pop} {BLPOP BLMPOP_LEFT} { + test "$pop when new key is moved into place" { + set rd [redis_deferring_client] + r del foo{t} + + bpop_command $rd $pop foo{t} 0 + wait_for_blocked_client + r lpush bob{t} abc def hij + r rename bob{t} foo{t} + set res [$rd read] + $rd close + set _ $res + } {foo{t} hij} + + test "$pop when result key is created by SORT..STORE" { + set rd [redis_deferring_client] + + # zero out list from previous test without explicit delete + r lpop foo{t} + r lpop foo{t} + r lpop foo{t} + + bpop_command $rd $pop foo{t} 5 + wait_for_blocked_client + r lpush notfoo{t} hello hola aguacate konichiwa zanzibar + r sort notfoo{t} ALPHA store foo{t} + set res [$rd read] + $rd close + set _ $res + } {foo{t} aguacate} +} + + test "BLPOP: timeout value out of range" { + # Timeout is parsed as float and multiplied by 1000, added mstime() + # and stored in long-long which might lead to out-of-range value. + # (Even though given timeout is smaller than LLONG_MAX, the result + # will be bigger) + assert_error "ERR *is out of range*" {r BLPOP blist1 0x7FFFFFFFFFFFFF} + } + + foreach {pop} {BLPOP BRPOP BLMPOP_LEFT BLMPOP_RIGHT} { + test "$pop: with single empty list argument" { + set rd [redis_deferring_client] + r del blist1 + bpop_command $rd $pop blist1 1 + wait_for_blocked_client + r rpush blist1 foo + assert_equal {blist1 foo} [$rd read] + assert_equal 0 [r exists blist1] + $rd close + } + + test "$pop: with negative timeout" { + set rd [redis_deferring_client] + bpop_command $rd $pop blist1 -1 + assert_error "ERR *is negative*" {$rd read} + $rd close + } + + test "$pop: with non-integer timeout" { + set rd [redis_deferring_client] + r del blist1 + bpop_command $rd $pop blist1 0.1 + r rpush blist1 foo + assert_equal {blist1 foo} [$rd read] + assert_equal 0 [r exists blist1] + $rd close + } + + test "$pop: with zero timeout should block indefinitely" { + # To test this, use a timeout of 0 and wait a second. + # The blocking pop should still be waiting for a push. + set rd [redis_deferring_client] + bpop_command $rd $pop blist1 0 + wait_for_blocked_client + r rpush blist1 foo + assert_equal {blist1 foo} [$rd read] + $rd close + } + + test "$pop: with 0.001 timeout should not block indefinitely" { + # Use a timeout of 0.001 and wait for the number of blocked clients to equal 0. + # Validate the empty read from the deferring client. + set rd [redis_deferring_client] + bpop_command $rd $pop blist1 0.001 + wait_for_blocked_clients_count 0 + assert_equal {} [$rd read] + $rd close + } + + test "$pop: second argument is not a list" { + set rd [redis_deferring_client] + r del blist1{t} blist2{t} + r set blist2{t} nolist{t} + bpop_command_two_key $rd $pop blist1{t} blist2{t} 1 + assert_error "WRONGTYPE*" {$rd read} + $rd close + } + + test "$pop: timeout" { + set rd [redis_deferring_client] + r del blist1{t} blist2{t} + bpop_command_two_key $rd $pop blist1{t} blist2{t} 1 + wait_for_blocked_client + assert_equal {} [$rd read] + $rd close + } + + test "$pop: arguments are empty" { + set rd [redis_deferring_client] + r del blist1{t} blist2{t} + + bpop_command_two_key $rd $pop blist1{t} blist2{t} 1 + wait_for_blocked_client + r rpush blist1{t} foo + assert_equal {blist1{t} foo} [$rd read] + assert_equal 0 [r exists blist1{t}] + assert_equal 0 [r exists blist2{t}] + + bpop_command_two_key $rd $pop blist1{t} blist2{t} 1 + wait_for_blocked_client + r rpush blist2{t} foo + assert_equal {blist2{t} foo} [$rd read] + assert_equal 0 [r exists blist1{t}] + assert_equal 0 [r exists blist2{t}] + $rd close + } + } + +foreach {pop} {BLPOP BLMPOP_LEFT} { + test "$pop inside a transaction" { + r del xlist + r lpush xlist foo + r lpush xlist bar + r multi + + bpop_command r $pop xlist 0 + bpop_command r $pop xlist 0 + bpop_command r $pop xlist 0 + r exec + } {{xlist bar} {xlist foo} {}} +} + + test {BLMPOP propagate as pop with count command to replica} { + set rd [redis_deferring_client] + set repl [attach_to_replication_stream] + + # BLMPOP without being blocked. + r lpush mylist{t} a b c + r rpush mylist2{t} 1 2 3 + r blmpop 0 1 mylist{t} left count 1 + r blmpop 0 2 mylist{t} mylist2{t} right count 10 + r blmpop 0 2 mylist{t} mylist2{t} right count 10 + + # BLMPOP that gets blocked. + $rd blmpop 0 1 mylist{t} left count 1 + wait_for_blocked_client + r lpush mylist{t} a + $rd blmpop 0 2 mylist{t} mylist2{t} left count 5 + wait_for_blocked_client + r lpush mylist{t} a b c + $rd blmpop 0 2 mylist{t} mylist2{t} right count 10 + wait_for_blocked_client + r rpush mylist2{t} a b c + + # Released on timeout. + assert_equal {} [r blmpop 0.01 1 mylist{t} left count 10] + r set foo{t} bar ;# something else to propagate after, so we can make sure the above pop didn't. + + $rd close + + assert_replication_stream $repl { + {select *} + {lpush mylist{t} a b c} + {rpush mylist2{t} 1 2 3} + {lpop mylist{t} 1} + {rpop mylist{t} 2} + {rpop mylist2{t} 3} + {lpush mylist{t} a} + {lpop mylist{t} 1} + {lpush mylist{t} a b c} + {lpop mylist{t} 3} + {rpush mylist2{t} a b c} + {rpop mylist2{t} 3} + {set foo{t} bar} + } + close_replication_stream $repl + } {} {needs:repl} + + test {LPUSHX, RPUSHX - generic} { + r del xlist + assert_equal 0 [r lpushx xlist a] + assert_equal 0 [r llen xlist] + assert_equal 0 [r rpushx xlist a] + assert_equal 0 [r llen xlist] + } + + foreach {type large} [array get largevalue] { + test "LPUSHX, RPUSHX - $type" { + create_$type xlist "$large c" + assert_equal 3 [r rpushx xlist d] + assert_equal 4 [r lpushx xlist a] + assert_equal 6 [r rpushx xlist 42 x] + assert_equal 9 [r lpushx xlist y3 y2 y1] + assert_equal "y1 y2 y3 a $large c d 42 x" [r lrange xlist 0 -1] + } + + test "LINSERT - $type" { + create_$type xlist "a $large c d" + assert_equal 5 [r linsert xlist before c zz] "before c" + assert_equal "a $large zz c d" [r lrange xlist 0 10] "lrangeA" + assert_equal 6 [r linsert xlist after c yy] "after c" + assert_equal "a $large zz c yy d" [r lrange xlist 0 10] "lrangeB" + assert_equal 7 [r linsert xlist after d dd] "after d" + assert_equal -1 [r linsert xlist after bad ddd] "after bad" + assert_equal "a $large zz c yy d dd" [r lrange xlist 0 10] "lrangeC" + assert_equal 8 [r linsert xlist before a aa] "before a" + assert_equal -1 [r linsert xlist before bad aaa] "before bad" + assert_equal "aa a $large zz c yy d dd" [r lrange xlist 0 10] "lrangeD" + + # check inserting integer encoded value + assert_equal 9 [r linsert xlist before aa 42] "before aa" + assert_equal 42 [r lrange xlist 0 0] "lrangeE" + } + } + + test {LINSERT raise error on bad syntax} { + catch {[r linsert xlist aft3r aa 42]} e + set e + } {*ERR*syntax*error*} + + test {LINSERT against non-list value error} { + r set k1 v1 + assert_error {WRONGTYPE Operation against a key holding the wrong kind of value*} {r linsert k1 after 0 0} + } + + test {LINSERT against non existing key} { + assert_equal 0 [r linsert not-a-key before 0 0] + } + +foreach type {listpack quicklist} { + foreach {num} {250 500} { + if {$type == "quicklist"} { + set origin_config [config_get_set list-max-listpack-size 5] + } else { + set origin_config [config_get_set list-max-listpack-size -1] + } + + proc check_numbered_list_consistency {key} { + set len [r llen $key] + for {set i 0} {$i < $len} {incr i} { + assert_equal $i [r lindex $key $i] + assert_equal [expr $len-1-$i] [r lindex $key [expr (-$i)-1]] + } + } + + proc check_random_access_consistency {key} { + set len [r llen $key] + for {set i 0} {$i < $len} {incr i} { + set rint [expr int(rand()*$len)] + assert_equal $rint [r lindex $key $rint] + assert_equal [expr $len-1-$rint] [r lindex $key [expr (-$rint)-1]] + } + } + + test "LINDEX consistency test - $type" { + r del mylist + for {set i 0} {$i < $num} {incr i} { + r rpush mylist $i + } + assert_encoding $type mylist + check_numbered_list_consistency mylist + } + + test "LINDEX random access - $type" { + assert_encoding $type mylist + check_random_access_consistency mylist + } + + test "Check if list is still ok after a DEBUG RELOAD - $type" { + r debug reload + assert_encoding $type mylist + check_numbered_list_consistency mylist + check_random_access_consistency mylist + } {} {needs:debug} + + config_set list-max-listpack-size $origin_config + } +} + + test {LLEN against non-list value error} { + r del mylist + r set mylist foobar + assert_error WRONGTYPE* {r llen mylist} + } + + test {LLEN against non existing key} { + assert_equal 0 [r llen not-a-key] + } + + test {LINDEX against non-list value error} { + assert_error WRONGTYPE* {r lindex mylist 0} + } + + test {LINDEX against non existing key} { + assert_equal "" [r lindex not-a-key 10] + } + + test {LPUSH against non-list value error} { + assert_error WRONGTYPE* {r lpush mylist 0} + } + + test {RPUSH against non-list value error} { + assert_error WRONGTYPE* {r rpush mylist 0} + } + + foreach {type large} [array get largevalue] { + test "RPOPLPUSH base case - $type" { + r del mylist1{t} mylist2{t} + create_$type mylist1{t} "a $large c d" + assert_equal d [r rpoplpush mylist1{t} mylist2{t}] + assert_equal c [r rpoplpush mylist1{t} mylist2{t}] + assert_equal $large [r rpoplpush mylist1{t} mylist2{t}] + assert_equal "a" [r lrange mylist1{t} 0 -1] + assert_equal "$large c d" [r lrange mylist2{t} 0 -1] + assert_encoding listpack mylist1{t} ;# converted to listpack after shrinking + assert_encoding $type mylist2{t} + } + + foreach wherefrom {left right} { + foreach whereto {left right} { + test "LMOVE $wherefrom $whereto base case - $type" { + r del mylist1{t} mylist2{t} + + if {$wherefrom eq "right"} { + create_$type mylist1{t} "c d $large a" + } else { + create_$type mylist1{t} "a $large c d" + } + assert_equal a [r lmove mylist1{t} mylist2{t} $wherefrom $whereto] + assert_equal $large [r lmove mylist1{t} mylist2{t} $wherefrom $whereto] + assert_equal "c d" [r lrange mylist1{t} 0 -1] + if {$whereto eq "right"} { + assert_equal "a $large" [r lrange mylist2{t} 0 -1] + } else { + assert_equal "$large a" [r lrange mylist2{t} 0 -1] + } + assert_encoding $type mylist2{t} + } + } + } + + test "RPOPLPUSH with the same list as src and dst - $type" { + create_$type mylist{t} "a $large c" + assert_equal "a $large c" [r lrange mylist{t} 0 -1] + assert_equal c [r rpoplpush mylist{t} mylist{t}] + assert_equal "c a $large" [r lrange mylist{t} 0 -1] + } + + foreach wherefrom {left right} { + foreach whereto {left right} { + test "LMOVE $wherefrom $whereto with the same list as src and dst - $type" { + if {$wherefrom eq "right"} { + create_$type mylist{t} "a $large c" + assert_equal "a $large c" [r lrange mylist{t} 0 -1] + } else { + create_$type mylist{t} "c a $large" + assert_equal "c a $large" [r lrange mylist{t} 0 -1] + } + assert_equal c [r lmove mylist{t} mylist{t} $wherefrom $whereto] + if {$whereto eq "right"} { + assert_equal "a $large c" [r lrange mylist{t} 0 -1] + } else { + assert_equal "c a $large" [r lrange mylist{t} 0 -1] + } + } + } + } + + foreach {othertype otherlarge} [array get largevalue] { + test "RPOPLPUSH with $type source and existing target $othertype" { + create_$type srclist{t} "a b c $large" + create_$othertype dstlist{t} "$otherlarge" + assert_equal $large [r rpoplpush srclist{t} dstlist{t}] + assert_equal c [r rpoplpush srclist{t} dstlist{t}] + assert_equal "a b" [r lrange srclist{t} 0 -1] + assert_equal "c $large $otherlarge" [r lrange dstlist{t} 0 -1] + + # When we rpoplpush'ed a large value, dstlist should be + # converted to the same encoding as srclist. + if {$type eq "quicklist"} { + assert_encoding quicklist dstlist{t} + } + } + + foreach wherefrom {left right} { + foreach whereto {left right} { + test "LMOVE $wherefrom $whereto with $type source and existing target $othertype" { + create_$othertype dstlist{t} "$otherlarge" + + if {$wherefrom eq "right"} { + create_$type srclist{t} "a b c $large" + } else { + create_$type srclist{t} "$large c a b" + } + assert_equal $large [r lmove srclist{t} dstlist{t} $wherefrom $whereto] + assert_equal c [r lmove srclist{t} dstlist{t} $wherefrom $whereto] + assert_equal "a b" [r lrange srclist{t} 0 -1] + + if {$whereto eq "right"} { + assert_equal "$otherlarge $large c" [r lrange dstlist{t} 0 -1] + } else { + assert_equal "c $large $otherlarge" [r lrange dstlist{t} 0 -1] + } + + # When we lmoved a large value, dstlist should be + # converted to the same encoding as srclist. + if {$type eq "quicklist"} { + assert_encoding quicklist dstlist{t} + } + } + } + } + } + } + + test {RPOPLPUSH against non existing key} { + r del srclist{t} dstlist{t} + assert_equal {} [r rpoplpush srclist{t} dstlist{t}] + assert_equal 0 [r exists srclist{t}] + assert_equal 0 [r exists dstlist{t}] + } + + test {RPOPLPUSH against non list src key} { + r del srclist{t} dstlist{t} + r set srclist{t} x + assert_error WRONGTYPE* {r rpoplpush srclist{t} dstlist{t}} + assert_type string srclist{t} + assert_equal 0 [r exists newlist{t}] + } + +foreach {type large} [array get largevalue] { + test "RPOPLPUSH against non list dst key - $type" { + create_$type srclist{t} "a $large c d" + r set dstlist{t} x + assert_error WRONGTYPE* {r rpoplpush srclist{t} dstlist{t}} + assert_type string dstlist{t} + assert_equal "a $large c d" [r lrange srclist{t} 0 -1] + } +} + + test {RPOPLPUSH against non existing src key} { + r del srclist{t} dstlist{t} + assert_equal {} [r rpoplpush srclist{t} dstlist{t}] + } {} + + foreach {type large} [array get largevalue] { + test "Basic LPOP/RPOP/LMPOP - $type" { + create_$type mylist "$large 1 2" + assert_equal $large [r lpop mylist] + assert_equal 2 [r rpop mylist] + assert_equal 1 [r lpop mylist] + assert_equal 0 [r llen mylist] + + create_$type mylist "$large 1 2" + assert_equal "mylist $large" [r lmpop 1 mylist left count 1] + assert_equal {mylist {2 1}} [r lmpop 2 mylist mylist right count 2] + } + } + + test {LPOP/RPOP/LMPOP against empty list} { + r del non-existing-list{t} non-existing-list2{t} + + assert_equal {} [r lpop non-existing-list{t}] + assert_equal {} [r rpop non-existing-list2{t}] + + assert_equal {} [r lmpop 1 non-existing-list{t} left count 1] + assert_equal {} [r lmpop 1 non-existing-list{t} left count 10] + assert_equal {} [r lmpop 2 non-existing-list{t} non-existing-list2{t} right count 1] + assert_equal {} [r lmpop 2 non-existing-list{t} non-existing-list2{t} right count 10] + } + + test {LPOP/RPOP/LMPOP NON-BLOCK or BLOCK against non list value} { + r set notalist{t} foo + assert_error WRONGTYPE* {r lpop notalist{t}} + assert_error WRONGTYPE* {r blpop notalist{t} 0} + assert_error WRONGTYPE* {r rpop notalist{t}} + assert_error WRONGTYPE* {r brpop notalist{t} 0} + + r del notalist2{t} + assert_error "WRONGTYPE*" {r lmpop 2 notalist{t} notalist2{t} left count 1} + assert_error "WRONGTYPE*" {r blmpop 0 2 notalist{t} notalist2{t} left count 1} + + r del notalist{t} + r set notalist2{t} nolist + assert_error "WRONGTYPE*" {r lmpop 2 notalist{t} notalist2{t} right count 10} + assert_error "WRONGTYPE*" {r blmpop 0 2 notalist{t} notalist2{t} left count 1} + } + + foreach {num} {250 500} { + test "Mass RPOP/LPOP - $type" { + r del mylist + set sum1 0 + for {set i 0} {$i < $num} {incr i} { + if {$i == [expr $num/2]} { + r lpush mylist $large + } + r lpush mylist $i + incr sum1 $i + } + assert_encoding $type mylist + set sum2 0 + for {set i 0} {$i < [expr $num/2]} {incr i} { + incr sum2 [r lpop mylist] + incr sum2 [r rpop mylist] + } + assert_equal $sum1 $sum2 + } + } + + test {LMPOP with illegal argument} { + assert_error "ERR wrong number of arguments for 'lmpop' command" {r lmpop} + assert_error "ERR wrong number of arguments for 'lmpop' command" {r lmpop 1} + assert_error "ERR wrong number of arguments for 'lmpop' command" {r lmpop 1 mylist{t}} + + assert_error "ERR numkeys*" {r lmpop 0 mylist{t} LEFT} + assert_error "ERR numkeys*" {r lmpop a mylist{t} LEFT} + assert_error "ERR numkeys*" {r lmpop -1 mylist{t} RIGHT} + + assert_error "ERR syntax error*" {r lmpop 1 mylist{t} bad_where} + assert_error "ERR syntax error*" {r lmpop 1 mylist{t} LEFT bar_arg} + assert_error "ERR syntax error*" {r lmpop 1 mylist{t} RIGHT LEFT} + assert_error "ERR syntax error*" {r lmpop 1 mylist{t} COUNT} + assert_error "ERR syntax error*" {r lmpop 1 mylist{t} LEFT COUNT 1 COUNT 2} + assert_error "ERR syntax error*" {r lmpop 2 mylist{t} mylist2{t} bad_arg} + + assert_error "ERR count*" {r lmpop 1 mylist{t} LEFT COUNT 0} + assert_error "ERR count*" {r lmpop 1 mylist{t} RIGHT COUNT a} + assert_error "ERR count*" {r lmpop 1 mylist{t} LEFT COUNT -1} + assert_error "ERR count*" {r lmpop 2 mylist{t} mylist2{t} RIGHT COUNT -1} + } + +foreach {type large} [array get largevalue] { + test "LMPOP single existing list - $type" { + # Same key multiple times. + create_$type mylist{t} "a b $large d e f" + assert_equal {mylist{t} {a b}} [r lmpop 2 mylist{t} mylist{t} left count 2] + assert_equal {mylist{t} {f e}} [r lmpop 2 mylist{t} mylist{t} right count 2] + assert_equal 2 [r llen mylist{t}] + + # First one exists, second one does not exist. + create_$type mylist{t} "a b $large d e" + r del mylist2{t} + assert_equal {mylist{t} a} [r lmpop 2 mylist{t} mylist2{t} left count 1] + assert_equal 4 [r llen mylist{t}] + assert_equal "mylist{t} {e d $large b}" [r lmpop 2 mylist{t} mylist2{t} right count 10] + assert_equal {} [r lmpop 2 mylist{t} mylist2{t} right count 1] + + # First one does not exist, second one exists. + r del mylist{t} + create_$type mylist2{t} "1 2 $large 4 5" + assert_equal {mylist2{t} 5} [r lmpop 2 mylist{t} mylist2{t} right count 1] + assert_equal 4 [r llen mylist2{t}] + assert_equal "mylist2{t} {1 2 $large 4}" [r lmpop 2 mylist{t} mylist2{t} left count 10] + + assert_equal 0 [r exists mylist{t} mylist2{t}] + } + + test "LMPOP multiple existing lists - $type" { + create_$type mylist{t} "a b $large d e" + create_$type mylist2{t} "1 2 $large 4 5" + + # Pop up from the first key. + assert_equal {mylist{t} {a b}} [r lmpop 2 mylist{t} mylist2{t} left count 2] + assert_equal 3 [r llen mylist{t}] + assert_equal "mylist{t} {e d $large}" [r lmpop 2 mylist{t} mylist2{t} right count 3] + assert_equal 0 [r exists mylist{t}] + + # Pop up from the second key. + assert_equal "mylist2{t} {1 2 $large}" [r lmpop 2 mylist{t} mylist2{t} left count 3] + assert_equal 2 [r llen mylist2{t}] + assert_equal {mylist2{t} {5 4}} [r lmpop 2 mylist{t} mylist2{t} right count 2] + assert_equal 0 [r exists mylist{t}] + + # Pop up all elements. + create_$type mylist{t} "a $large c" + create_$type mylist2{t} "1 $large 3" + assert_equal "mylist{t} {a $large c}" [r lmpop 2 mylist{t} mylist2{t} left count 10] + assert_equal 0 [r llen mylist{t}] + assert_equal "mylist2{t} {3 $large 1}" [r lmpop 2 mylist{t} mylist2{t} right count 10] + assert_equal 0 [r llen mylist2{t}] + assert_equal 0 [r exists mylist{t} mylist2{t}] + } +} + + test {LMPOP propagate as pop with count command to replica} { + set repl [attach_to_replication_stream] + + # left/right propagate as lpop/rpop with count + r lpush mylist{t} a b c + + # Pop elements from one list. + r lmpop 1 mylist{t} left count 1 + r lmpop 1 mylist{t} right count 1 + + # Now the list have only one element + r lmpop 2 mylist{t} mylist2{t} left count 10 + + # No elements so we don't propagate. + r lmpop 2 mylist{t} mylist2{t} left count 10 + + # Pop elements from the second list. + r rpush mylist2{t} 1 2 3 + r lmpop 2 mylist{t} mylist2{t} left count 2 + r lmpop 2 mylist{t} mylist2{t} right count 1 + + # Pop all elements. + r rpush mylist{t} a b c + r rpush mylist2{t} 1 2 3 + r lmpop 2 mylist{t} mylist2{t} left count 10 + r lmpop 2 mylist{t} mylist2{t} right count 10 + + assert_replication_stream $repl { + {select *} + {lpush mylist{t} a b c} + {lpop mylist{t} 1} + {rpop mylist{t} 1} + {lpop mylist{t} 1} + {rpush mylist2{t} 1 2 3} + {lpop mylist2{t} 2} + {rpop mylist2{t} 1} + {rpush mylist{t} a b c} + {rpush mylist2{t} 1 2 3} + {lpop mylist{t} 3} + {rpop mylist2{t} 3} + } + close_replication_stream $repl + } {} {needs:repl} + + foreach {type large} [array get largevalue] { + test "LRANGE basics - $type" { + create_$type mylist "$large 1 2 3 4 5 6 7 8 9" + assert_equal {1 2 3 4 5 6 7 8} [r lrange mylist 1 -2] + assert_equal {7 8 9} [r lrange mylist -3 -1] + assert_equal {4} [r lrange mylist 4 4] + } + + test "LRANGE inverted indexes - $type" { + create_$type mylist "$large 1 2 3 4 5 6 7 8 9" + assert_equal {} [r lrange mylist 6 2] + } + + test "LRANGE out of range indexes including the full list - $type" { + create_$type mylist "$large 1 2 3" + assert_equal "$large 1 2 3" [r lrange mylist -1000 1000] + } + + test "LRANGE out of range negative end index - $type" { + create_$type mylist "$large 1 2 3" + assert_equal $large [r lrange mylist 0 -4] + assert_equal {} [r lrange mylist 0 -5] + } + } + + test {LRANGE against non existing key} { + assert_equal {} [r lrange nosuchkey 0 1] + } + + test {LRANGE with start > end yields an empty array for backward compatibility} { + create_$type mylist "1 $large 3" + assert_equal {} [r lrange mylist 1 0] + assert_equal {} [r lrange mylist -1 -2] + } + + foreach {type large} [array get largevalue] { + proc trim_list {type min max} { + upvar 1 large large + r del mylist + create_$type mylist "1 2 3 4 $large" + r ltrim mylist $min $max + r lrange mylist 0 -1 + } + + test "LTRIM basics - $type" { + assert_equal "1" [trim_list $type 0 0] + assert_equal "1 2" [trim_list $type 0 1] + assert_equal "1 2 3" [trim_list $type 0 2] + assert_equal "2 3" [trim_list $type 1 2] + assert_equal "2 3 4 $large" [trim_list $type 1 -1] + assert_equal "2 3 4" [trim_list $type 1 -2] + assert_equal "4 $large" [trim_list $type -2 -1] + assert_equal "$large" [trim_list $type -1 -1] + assert_equal "1 2 3 4 $large" [trim_list $type -5 -1] + assert_equal "1 2 3 4 $large" [trim_list $type -10 10] + assert_equal "1 2 3 4 $large" [trim_list $type 0 5] + assert_equal "1 2 3 4 $large" [trim_list $type 0 10] + } + + test "LTRIM out of range negative end index - $type" { + assert_equal {1} [trim_list $type 0 -5] + assert_equal {} [trim_list $type 0 -6] + } + + test "LSET - $type" { + create_$type mylist "99 98 $large 96 95" + r lset mylist 1 foo + r lset mylist -1 bar + assert_equal "99 foo $large 96 bar" [r lrange mylist 0 -1] + } + + test "LSET out of range index - $type" { + assert_error ERR*range* {r lset mylist 10 foo} + } + } + + test {LSET against non existing key} { + assert_error ERR*key* {r lset nosuchkey 10 foo} + } + + test {LSET against non list value} { + r set nolist foobar + assert_error WRONGTYPE* {r lset nolist 0 foo} + } + + foreach {type e} [array get largevalue] { + test "LREM remove all the occurrences - $type" { + create_$type mylist "$e foo bar foobar foobared zap bar test foo" + assert_equal 2 [r lrem mylist 0 bar] + assert_equal "$e foo foobar foobared zap test foo" [r lrange mylist 0 -1] + } + + test "LREM remove the first occurrence - $type" { + assert_equal 1 [r lrem mylist 1 foo] + assert_equal "$e foobar foobared zap test foo" [r lrange mylist 0 -1] + } + + test "LREM remove non existing element - $type" { + assert_equal 0 [r lrem mylist 1 nosuchelement] + assert_equal "$e foobar foobared zap test foo" [r lrange mylist 0 -1] + } + + test "LREM starting from tail with negative count - $type" { + create_$type mylist "$e foo bar foobar foobared zap bar test foo foo" + assert_equal 1 [r lrem mylist -1 bar] + assert_equal "$e foo bar foobar foobared zap test foo foo" [r lrange mylist 0 -1] + } + + test "LREM starting from tail with negative count (2) - $type" { + assert_equal 2 [r lrem mylist -2 foo] + assert_equal "$e foo bar foobar foobared zap test" [r lrange mylist 0 -1] + } + + test "LREM deleting objects that may be int encoded - $type" { + create_$type myotherlist "$e 1 2 3" + assert_equal 1 [r lrem myotherlist 1 2] + assert_equal 3 [r llen myotherlist] + } + } + + test "Regression for bug 593 - chaining BRPOPLPUSH with other blocking cmds" { + set rd1 [redis_deferring_client] + set rd2 [redis_deferring_client] + + $rd1 brpoplpush a{t} b{t} 0 + $rd1 brpoplpush a{t} b{t} 0 + wait_for_blocked_clients_count 1 + $rd2 brpoplpush b{t} c{t} 0 + wait_for_blocked_clients_count 2 + r lpush a{t} data + $rd1 close + $rd2 close + r ping + } {PONG} + + test "BLPOP/BLMOVE should increase dirty" { + r del lst{t} lst1{t} + set rd [redis_deferring_client] + + set dirty [s rdb_changes_since_last_save] + $rd blpop lst{t} 0 + wait_for_blocked_client + r lpush lst{t} a + assert_equal {lst{t} a} [$rd read] + set dirty2 [s rdb_changes_since_last_save] + assert {$dirty2 == $dirty + 2} + + set dirty [s rdb_changes_since_last_save] + $rd blmove lst{t} lst1{t} left left 0 + wait_for_blocked_client + r lpush lst{t} a + assert_equal {a} [$rd read] + set dirty2 [s rdb_changes_since_last_save] + assert {$dirty2 == $dirty + 2} + + $rd close + } + +foreach {pop} {BLPOP BLMPOP_RIGHT} { + test "client unblock tests" { + r del l + set rd [redis_deferring_client] + $rd client id + set id [$rd read] + + # test default args + bpop_command $rd $pop l 0 + wait_for_blocked_client + r client unblock $id + assert_equal {} [$rd read] + + # test with timeout + bpop_command $rd $pop l 0 + wait_for_blocked_client + r client unblock $id TIMEOUT + assert_equal {} [$rd read] + + # test with error + bpop_command $rd $pop l 0 + wait_for_blocked_client + r client unblock $id ERROR + catch {[$rd read]} e + assert_equal $e "UNBLOCKED client unblocked via CLIENT UNBLOCK" + + # test with invalid client id + catch {[r client unblock asd]} e + assert_equal $e "ERR value is not an integer or out of range" + + # test with non blocked client + set myid [r client id] + catch {[r client unblock $myid]} e + assert_equal $e {invalid command name "0"} + + # finally, see the this client and list are still functional + bpop_command $rd $pop l 0 + wait_for_blocked_client + r lpush l foo + assert_equal {l foo} [$rd read] + $rd close + } +} + + foreach {max_lp_size large} "3 $largevalue(listpack) -1 $largevalue(quicklist)" { + test "List listpack -> quicklist encoding conversion" { + set origin_conf [config_get_set list-max-listpack-size $max_lp_size] + + # RPUSH + create_listpack lst "a b c" + r RPUSH lst $large + assert_encoding quicklist lst + + # LINSERT + create_listpack lst "a b c" + r LINSERT lst after b $large + assert_encoding quicklist lst + + # LSET + create_listpack lst "a b c" + r LSET lst 0 $large + assert_encoding quicklist lst + + # LMOVE + create_quicklist lsrc{t} "a b c $large" + create_listpack ldes{t} "d e f" + r LMOVE lsrc{t} ldes{t} right right + assert_encoding quicklist ldes{t} + + r config set list-max-listpack-size $origin_conf + } + } + + test "List quicklist -> listpack encoding conversion" { + set origin_conf [config_get_set list-max-listpack-size 3] + + # RPOP + create_quicklist lst "a b c d" + r RPOP lst 3 + assert_encoding listpack lst + + # LREM + create_quicklist lst "a a a d" + r LREM lst 3 a + assert_encoding listpack lst + + # LTRIM + create_quicklist lst "a b c d" + r LTRIM lst 1 1 + assert_encoding listpack lst + + r config set list-max-listpack-size -1 + + # RPOP + create_quicklist lst "a b c $largevalue(quicklist)" + r RPOP lst 1 + assert_encoding listpack lst + + # LREM + create_quicklist lst "a $largevalue(quicklist)" + r LREM lst 1 $largevalue(quicklist) + assert_encoding listpack lst + + # LTRIM + create_quicklist lst "a b $largevalue(quicklist)" + r LTRIM lst 0 1 + assert_encoding listpack lst + + # LSET + create_quicklist lst "$largevalue(quicklist) a b" + r RPOP lst 2 + assert_encoding quicklist lst + r LSET lst -1 c + assert_encoding listpack lst + + r config set list-max-listpack-size $origin_conf + } + + test "List encoding conversion when RDB loading" { + set origin_conf [config_get_set list-max-listpack-size 3] + create_listpack lst "a b c" + + # list is still a listpack after DEBUG RELOAD + r DEBUG RELOAD + assert_encoding listpack lst + + # list is still a quicklist after DEBUG RELOAD + r RPUSH lst d + r DEBUG RELOAD + assert_encoding quicklist lst + + # when a quicklist has only one packed node, it will be + # converted to listpack during rdb loading + r RPOP lst + assert_encoding quicklist lst + r DEBUG RELOAD + assert_encoding listpack lst + + r config set list-max-listpack-size $origin_conf + } {OK} {needs:debug} + + test "List invalid list-max-listpack-size config" { + # ​When list-max-listpack-size is 0 we treat it as 1 and it'll + # still be listpack if there's a single element in the list. + r config set list-max-listpack-size 0 + r DEL lst + r RPUSH lst a + assert_encoding listpack lst + r RPUSH lst b + assert_encoding quicklist lst + + # When list-max-listpack-size < -5 we treat it as -5. + r config set list-max-listpack-size -6 + r DEL lst + r RPUSH lst [string repeat "x" 60000] + assert_encoding listpack lst + # Converted to quicklist when the size of listpack exceed 65536 + r RPUSH lst [string repeat "x" 5536] + assert_encoding quicklist lst + } + + test "List of various encodings" { + r del k + r lpush k 127 ;# ZIP_INT_8B + r lpush k 32767 ;# ZIP_INT_16B + r lpush k 2147483647 ;# ZIP_INT_32B + r lpush k 9223372036854775808 ;# ZIP_INT_64B + r lpush k 0 ;# ZIP_INT_IMM_MIN + r lpush k 12 ;# ZIP_INT_IMM_MAX + r lpush k [string repeat x 31] ;# ZIP_STR_06B + r lpush k [string repeat x 8191] ;# ZIP_STR_14B + r lpush k [string repeat x 65535] ;# ZIP_STR_32B + assert_encoding quicklist k ;# exceeds the size limit of quicklist node + set k [r lrange k 0 -1] + set dump [r dump k] + + # coverage for objectComputeSize + assert_morethan [memory_usage k] 0 + + config_set sanitize-dump-payload no mayfail + r restore kk 0 $dump replace + assert_encoding quicklist kk + set kk [r lrange kk 0 -1] + + # try some forward and backward searches to make sure all encodings + # can be traversed + assert_equal [r lindex kk 5] {9223372036854775808} + assert_equal [r lindex kk -5] {0} + assert_equal [r lpos kk foo rank 1] {} + assert_equal [r lpos kk foo rank -1] {} + + # make sure the values are right + assert_equal $k $kk + assert_equal [lpop k] [string repeat x 65535] + assert_equal [lpop k] [string repeat x 8191] + assert_equal [lpop k] [string repeat x 31] + set _ $k + } {12 0 9223372036854775808 2147483647 32767 127} + + test "List of various encodings - sanitize dump" { + config_set sanitize-dump-payload yes mayfail + r restore kk 0 $dump replace + assert_encoding quicklist kk + set k [r lrange k 0 -1] + set kk [r lrange kk 0 -1] + + # make sure the values are right + assert_equal $k $kk + assert_equal [lpop k] [string repeat x 65535] + assert_equal [lpop k] [string repeat x 8191] + assert_equal [lpop k] [string repeat x 31] + set _ $k + } {12 0 9223372036854775808 2147483647 32767 127} + + test "Unblock fairness is kept while pipelining" { + set rd1 [redis_deferring_client] + set rd2 [redis_deferring_client] + + # delete the list in case already exists + r del mylist + + # block a client on the list + $rd1 BLPOP mylist 0 + wait_for_blocked_clients_count 1 + + # pipeline on other client a list push and a blocking pop + # we should expect the fairness to be kept and have $rd1 + # being unblocked + set buf "" + append buf "LPUSH mylist 1\r\n" + append buf "BLPOP mylist 0\r\n" + $rd2 write $buf + $rd2 flush + + # we check that we still have 1 blocked client + # and that the first blocked client has been served + assert_equal [$rd1 read] {mylist 1} + assert_equal [$rd2 read] {1} + wait_for_blocked_clients_count 1 + + # We no unblock the last client and verify it was served last + r LPUSH mylist 2 + wait_for_blocked_clients_count 0 + assert_equal [$rd2 read] {mylist 2} + + $rd1 close + $rd2 close + } + + test "Unblock fairness is kept during nested unblock" { + set rd1 [redis_deferring_client] + set rd2 [redis_deferring_client] + set rd3 [redis_deferring_client] + + # delete the list in case already exists + r del l1{t} l2{t} l3{t} + + # block a client on the list + $rd1 BRPOPLPUSH l1{t} l3{t} 0 + wait_for_blocked_clients_count 1 + + $rd2 BLPOP l2{t} 0 + wait_for_blocked_clients_count 2 + + $rd3 BLMPOP 0 2 l2{t} l3{t} LEFT COUNT 1 + wait_for_blocked_clients_count 3 + + r multi + r lpush l1{t} 1 + r lpush l2{t} 2 + r exec + + wait_for_blocked_clients_count 0 + + assert_equal [$rd1 read] {1} + assert_equal [$rd2 read] {l2{t} 2} + assert_equal [$rd3 read] {l3{t} 1} + + $rd1 close + $rd2 close + $rd3 close + } + + test "Blocking command accounted only once in commandstats" { + # cleanup first + r del mylist + + # create a test client + set rd [redis_deferring_client] + + # reset the server stats + r config resetstat + + # block a client on the list + $rd BLPOP mylist 0 + wait_for_blocked_clients_count 1 + + # unblock the list + r LPUSH mylist 1 + wait_for_blocked_clients_count 0 + + assert_match {*calls=1,*,rejected_calls=0,failed_calls=0} [cmdrstat blpop r] + + $rd close + } + + test "Blocking command accounted only once in commandstats after timeout" { + # cleanup first + r del mylist + + # create a test client + set rd [redis_deferring_client] + $rd client id + set id [$rd read] + + # reset the server stats + r config resetstat + + # block a client on the list + $rd BLPOP mylist 0 + wait_for_blocked_clients_count 1 + + # unblock the client on timeout + r client unblock $id timeout + + assert_match {*calls=1,*,rejected_calls=0,failed_calls=0} [cmdrstat blpop r] + + $rd close + } + + test {Command being unblocked cause another command to get unblocked execution order test} { + r del src{t} dst{t} key1{t} key2{t} key3{t} + set repl [attach_to_replication_stream] + + set rd1 [redis_deferring_client] + set rd2 [redis_deferring_client] + set rd3 [redis_deferring_client] + + $rd1 blmove src{t} dst{t} left right 0 + wait_for_blocked_clients_count 1 + + $rd2 blmove dst{t} src{t} right left 0 + wait_for_blocked_clients_count 2 + + # Create a pipeline of commands that will be processed in one socket read. + # Insert two set commands before and after lpush to observe the execution order. + set buf "" + append buf "set key1{t} value1\r\n" + append buf "lpush src{t} dummy\r\n" + append buf "set key2{t} value2\r\n" + $rd3 write $buf + $rd3 flush + + wait_for_blocked_clients_count 0 + + r set key3{t} value3 + + # If a command being unblocked causes another command to get unblocked, like a BLMOVE would do, + # then the new unblocked command will get processed right away rather than wait for later. + # If the set command occurs between two lmove commands, the results are not as expected. + assert_replication_stream $repl { + {select *} + {set key1{t} value1} + {lpush src{t} dummy} + {lmove src{t} dst{t} left right} + {lmove dst{t} src{t} right left} + {set key2{t} value2} + {set key3{t} value3} + } + + $rd1 close + $rd2 close + $rd3 close + + close_replication_stream $repl + } {} {needs:repl} + +} ;# stop servers diff --git a/tests/unit/type/set.tcl b/tests/unit/type/set.tcl new file mode 100644 index 0000000..2927562 --- /dev/null +++ b/tests/unit/type/set.tcl @@ -0,0 +1,1305 @@ +start_server { + tags {"set"} + overrides { + "set-max-intset-entries" 512 + "set-max-listpack-entries" 128 + "set-max-listpack-value" 32 + } +} { + proc create_set {key entries} { + r del $key + foreach entry $entries { r sadd $key $entry } + } + + # Values for initialing sets, per encoding. + array set initelems {listpack {foo} hashtable {foo}} + for {set i 0} {$i < 130} {incr i} { + lappend initelems(hashtable) [format "i%03d" $i] + } + + foreach type {listpack hashtable} { + test "SADD, SCARD, SISMEMBER, SMISMEMBER, SMEMBERS basics - $type" { + create_set myset $initelems($type) + assert_encoding $type myset + assert_equal 1 [r sadd myset bar] + assert_equal 0 [r sadd myset bar] + assert_equal [expr [llength $initelems($type)] + 1] [r scard myset] + assert_equal 1 [r sismember myset foo] + assert_equal 1 [r sismember myset bar] + assert_equal 0 [r sismember myset bla] + assert_equal {1} [r smismember myset foo] + assert_equal {1 1} [r smismember myset foo bar] + assert_equal {1 0} [r smismember myset foo bla] + assert_equal {0 1} [r smismember myset bla foo] + assert_equal {0} [r smismember myset bla] + assert_equal "bar $initelems($type)" [lsort [r smembers myset]] + } + } + + test {SADD, SCARD, SISMEMBER, SMISMEMBER, SMEMBERS basics - intset} { + create_set myset {17} + assert_encoding intset myset + assert_equal 1 [r sadd myset 16] + assert_equal 0 [r sadd myset 16] + assert_equal 2 [r scard myset] + assert_equal 1 [r sismember myset 16] + assert_equal 1 [r sismember myset 17] + assert_equal 0 [r sismember myset 18] + assert_equal {1} [r smismember myset 16] + assert_equal {1 1} [r smismember myset 16 17] + assert_equal {1 0} [r smismember myset 16 18] + assert_equal {0 1} [r smismember myset 18 16] + assert_equal {0} [r smismember myset 18] + assert_equal {16 17} [lsort [r smembers myset]] + } + + test {SMISMEMBER SMEMBERS SCARD against non set} { + r lpush mylist foo + assert_error WRONGTYPE* {r smismember mylist bar} + assert_error WRONGTYPE* {r smembers mylist} + assert_error WRONGTYPE* {r scard mylist} + } + + test {SMISMEMBER SMEMBERS SCARD against non existing key} { + assert_equal {0} [r smismember myset1 foo] + assert_equal {0 0} [r smismember myset1 foo bar] + assert_equal {} [r smembers myset1] + assert_equal {0} [r scard myset1] + } + + test {SMISMEMBER requires one or more members} { + r del zmscoretest + r zadd zmscoretest 10 x + r zadd zmscoretest 20 y + + catch {r smismember zmscoretest} e + assert_match {*ERR*wrong*number*arg*} $e + } + + test {SADD against non set} { + r lpush mylist foo + assert_error WRONGTYPE* {r sadd mylist bar} + } + + test "SADD a non-integer against a small intset" { + create_set myset {1 2 3} + assert_encoding intset myset + assert_equal 1 [r sadd myset a] + assert_encoding listpack myset + } + + test "SADD a non-integer against a large intset" { + create_set myset {0} + for {set i 1} {$i < 130} {incr i} {r sadd myset $i} + assert_encoding intset myset + assert_equal 1 [r sadd myset a] + assert_encoding hashtable myset + } + + test "SADD an integer larger than 64 bits" { + create_set myset {213244124402402314402033402} + assert_encoding listpack myset + assert_equal 1 [r sismember myset 213244124402402314402033402] + assert_equal {1} [r smismember myset 213244124402402314402033402] + } + + test "SADD an integer larger than 64 bits to a large intset" { + create_set myset {0} + for {set i 1} {$i < 130} {incr i} {r sadd myset $i} + assert_encoding intset myset + r sadd myset 213244124402402314402033402 + assert_encoding hashtable myset + assert_equal 1 [r sismember myset 213244124402402314402033402] + assert_equal {1} [r smismember myset 213244124402402314402033402] + } + +foreach type {single multiple single_multiple} { + test "SADD overflows the maximum allowed integers in an intset - $type" { + r del myset + + if {$type == "single"} { + # All are single sadd commands. + for {set i 0} {$i < 512} {incr i} { r sadd myset $i } + } elseif {$type == "multiple"} { + # One sadd command to add all elements. + set args {} + for {set i 0} {$i < 512} {incr i} { lappend args $i } + r sadd myset {*}$args + } elseif {$type == "single_multiple"} { + # First one sadd adds an element (creates a key) and then one sadd adds all elements. + r sadd myset 1 + set args {} + for {set i 0} {$i < 512} {incr i} { lappend args $i } + r sadd myset {*}$args + } + + assert_encoding intset myset + assert_equal 512 [r scard myset] + assert_equal 1 [r sadd myset 512] + assert_encoding hashtable myset + } + + test "SADD overflows the maximum allowed elements in a listpack - $type" { + r del myset + + if {$type == "single"} { + # All are single sadd commands. + r sadd myset a + for {set i 0} {$i < 127} {incr i} { r sadd myset $i } + } elseif {$type == "multiple"} { + # One sadd command to add all elements. + set args {} + lappend args a + for {set i 0} {$i < 127} {incr i} { lappend args $i } + r sadd myset {*}$args + } elseif {$type == "single_multiple"} { + # First one sadd adds an element (creates a key) and then one sadd adds all elements. + r sadd myset a + set args {} + lappend args a + for {set i 0} {$i < 127} {incr i} { lappend args $i } + r sadd myset {*}$args + } + + assert_encoding listpack myset + assert_equal 128 [r scard myset] + assert_equal 1 [r sadd myset b] + assert_encoding hashtable myset + } +} + + test {Variadic SADD} { + r del myset + assert_equal 3 [r sadd myset a b c] + assert_equal 2 [r sadd myset A a b c B] + assert_equal [lsort {A a b c B}] [lsort [r smembers myset]] + } + + test "Set encoding after DEBUG RELOAD" { + r del myintset + r del myhashset + r del mylargeintset + r del mysmallset + for {set i 0} {$i < 100} {incr i} { r sadd myintset $i } + for {set i 0} {$i < 1280} {incr i} { r sadd mylargeintset $i } + for {set i 0} {$i < 50} {incr i} { r sadd mysmallset [format "i%03d" $i] } + for {set i 0} {$i < 256} {incr i} { r sadd myhashset [format "i%03d" $i] } + assert_encoding intset myintset + assert_encoding hashtable mylargeintset + assert_encoding listpack mysmallset + assert_encoding hashtable myhashset + + r debug reload + assert_encoding intset myintset + assert_encoding hashtable mylargeintset + assert_encoding listpack mysmallset + assert_encoding hashtable myhashset + } {} {needs:debug} + + foreach type {listpack hashtable} { + test {SREM basics - $type} { + create_set myset $initelems($type) + r sadd myset ciao + assert_encoding $type myset + assert_equal 0 [r srem myset qux] + assert_equal 1 [r srem myset ciao] + assert_equal $initelems($type) [lsort [r smembers myset]] + } + } + + test {SREM basics - intset} { + create_set myset {3 4 5} + assert_encoding intset myset + assert_equal 0 [r srem myset 6] + assert_equal 1 [r srem myset 4] + assert_equal {3 5} [lsort [r smembers myset]] + } + + test {SREM with multiple arguments} { + r del myset + r sadd myset a b c d + assert_equal 0 [r srem myset k k k] + assert_equal 2 [r srem myset b d x y] + lsort [r smembers myset] + } {a c} + + test {SREM variadic version with more args needed to destroy the key} { + r del myset + r sadd myset 1 2 3 + r srem myset 1 2 3 4 5 6 7 8 + } {3} + + test "SINTERCARD with illegal arguments" { + assert_error "ERR wrong number of arguments for 'sintercard' command" {r sintercard} + assert_error "ERR wrong number of arguments for 'sintercard' command" {r sintercard 1} + + assert_error "ERR numkeys*" {r sintercard 0 myset{t}} + assert_error "ERR numkeys*" {r sintercard a myset{t}} + + assert_error "ERR Number of keys*" {r sintercard 2 myset{t}} + assert_error "ERR Number of keys*" {r sintercard 3 myset{t} myset2{t}} + + assert_error "ERR syntax error*" {r sintercard 1 myset{t} myset2{t}} + assert_error "ERR syntax error*" {r sintercard 1 myset{t} bar_arg} + assert_error "ERR syntax error*" {r sintercard 1 myset{t} LIMIT} + + assert_error "ERR LIMIT*" {r sintercard 1 myset{t} LIMIT -1} + assert_error "ERR LIMIT*" {r sintercard 1 myset{t} LIMIT a} + } + + test "SINTERCARD against non-set should throw error" { + r del set{t} + r sadd set{t} a b c + r set key1{t} x + + assert_error "WRONGTYPE*" {r sintercard 1 key1{t}} + assert_error "WRONGTYPE*" {r sintercard 2 set{t} key1{t}} + assert_error "WRONGTYPE*" {r sintercard 2 key1{t} noset{t}} + } + + test "SINTERCARD against non-existing key" { + assert_equal 0 [r sintercard 1 non-existing-key] + assert_equal 0 [r sintercard 1 non-existing-key limit 0] + assert_equal 0 [r sintercard 1 non-existing-key limit 10] + } + + foreach {type} {regular intset} { + # Create sets setN{t} where N = 1..5 + if {$type eq "regular"} { + set smallenc listpack + set bigenc hashtable + } else { + set smallenc intset + set bigenc intset + } + # Sets 1, 2 and 4 are big; sets 3 and 5 are small. + array set encoding "1 $bigenc 2 $bigenc 3 $smallenc 4 $bigenc 5 $smallenc" + + for {set i 1} {$i <= 5} {incr i} { + r del [format "set%d{t}" $i] + } + for {set i 0} {$i < 200} {incr i} { + r sadd set1{t} $i + r sadd set2{t} [expr $i+195] + } + foreach i {199 195 1000 2000} { + r sadd set3{t} $i + } + for {set i 5} {$i < 200} {incr i} { + r sadd set4{t} $i + } + r sadd set5{t} 0 + + # To make sure the sets are encoded as the type we are testing -- also + # when the VM is enabled and the values may be swapped in and out + # while the tests are running -- an extra element is added to every + # set that determines its encoding. + set large 200 + if {$type eq "regular"} { + set large foo + } + + for {set i 1} {$i <= 5} {incr i} { + r sadd [format "set%d{t}" $i] $large + } + + test "Generated sets must be encoded correctly - $type" { + for {set i 1} {$i <= 5} {incr i} { + assert_encoding $encoding($i) [format "set%d{t}" $i] + } + } + + test "SINTER with two sets - $type" { + assert_equal [list 195 196 197 198 199 $large] [lsort [r sinter set1{t} set2{t}]] + } + + test "SINTERCARD with two sets - $type" { + assert_equal 6 [r sintercard 2 set1{t} set2{t}] + assert_equal 6 [r sintercard 2 set1{t} set2{t} limit 0] + assert_equal 3 [r sintercard 2 set1{t} set2{t} limit 3] + assert_equal 6 [r sintercard 2 set1{t} set2{t} limit 10] + } + + test "SINTERSTORE with two sets - $type" { + r sinterstore setres{t} set1{t} set2{t} + assert_encoding $smallenc setres{t} + assert_equal [list 195 196 197 198 199 $large] [lsort [r smembers setres{t}]] + } + + test "SINTERSTORE with two sets, after a DEBUG RELOAD - $type" { + r debug reload + r sinterstore setres{t} set1{t} set2{t} + assert_encoding $smallenc setres{t} + assert_equal [list 195 196 197 198 199 $large] [lsort [r smembers setres{t}]] + } {} {needs:debug} + + test "SUNION with two sets - $type" { + set expected [lsort -uniq "[r smembers set1{t}] [r smembers set2{t}]"] + assert_equal $expected [lsort [r sunion set1{t} set2{t}]] + } + + test "SUNIONSTORE with two sets - $type" { + r sunionstore setres{t} set1{t} set2{t} + assert_encoding $bigenc setres{t} + set expected [lsort -uniq "[r smembers set1{t}] [r smembers set2{t}]"] + assert_equal $expected [lsort [r smembers setres{t}]] + } + + test "SINTER against three sets - $type" { + assert_equal [list 195 199 $large] [lsort [r sinter set1{t} set2{t} set3{t}]] + } + + test "SINTERCARD against three sets - $type" { + assert_equal 3 [r sintercard 3 set1{t} set2{t} set3{t}] + assert_equal 3 [r sintercard 3 set1{t} set2{t} set3{t} limit 0] + assert_equal 2 [r sintercard 3 set1{t} set2{t} set3{t} limit 2] + assert_equal 3 [r sintercard 3 set1{t} set2{t} set3{t} limit 10] + } + + test "SINTERSTORE with three sets - $type" { + r sinterstore setres{t} set1{t} set2{t} set3{t} + assert_equal [list 195 199 $large] [lsort [r smembers setres{t}]] + } + + test "SUNION with non existing keys - $type" { + set expected [lsort -uniq "[r smembers set1{t}] [r smembers set2{t}]"] + assert_equal $expected [lsort [r sunion nokey1{t} set1{t} set2{t} nokey2{t}]] + } + + test "SDIFF with two sets - $type" { + assert_equal {0 1 2 3 4} [lsort [r sdiff set1{t} set4{t}]] + } + + test "SDIFF with three sets - $type" { + assert_equal {1 2 3 4} [lsort [r sdiff set1{t} set4{t} set5{t}]] + } + + test "SDIFFSTORE with three sets - $type" { + r sdiffstore setres{t} set1{t} set4{t} set5{t} + # When we start with intsets, we should always end with intsets. + if {$type eq {intset}} { + assert_encoding intset setres{t} + } + assert_equal {1 2 3 4} [lsort [r smembers setres{t}]] + } + + test "SINTER/SUNION/SDIFF with three same sets - $type" { + set expected [lsort "[r smembers set1{t}]"] + assert_equal $expected [lsort [r sinter set1{t} set1{t} set1{t}]] + assert_equal $expected [lsort [r sunion set1{t} set1{t} set1{t}]] + assert_equal {} [lsort [r sdiff set1{t} set1{t} set1{t}]] + } + } + + test "SINTERSTORE with two listpack sets where result is intset" { + r del setres{t} set1{t} set2{t} + r sadd set1{t} a b c 1 3 6 x y z + r sadd set2{t} e f g 1 2 3 u v w + assert_encoding listpack set1{t} + assert_encoding listpack set2{t} + r sinterstore setres{t} set1{t} set2{t} + assert_equal [list 1 3] [lsort [r smembers setres{t}]] + assert_encoding intset setres{t} + } + + test "SINTERSTORE with two hashtable sets where result is intset" { + r del setres{t} set1{t} set2{t} + r sadd set1{t} a b c 444 555 666 + r sadd set2{t} e f g 111 222 333 + set expected {} + for {set i 1} {$i < 130} {incr i} { + r sadd set1{t} $i + r sadd set2{t} $i + lappend expected $i + } + assert_encoding hashtable set1{t} + assert_encoding hashtable set2{t} + r sinterstore setres{t} set1{t} set2{t} + assert_equal [lsort $expected] [lsort [r smembers setres{t}]] + assert_encoding intset setres{t} + } + + test "SUNION hashtable and listpack" { + # This adds code coverage for adding a non-sds string to a hashtable set + # which already contains the string. + r del set1{t} set2{t} + set union {abcdefghijklmnopqrstuvwxyz1234567890 a b c 1 2 3} + create_set set1{t} $union + create_set set2{t} {a b c} + assert_encoding hashtable set1{t} + assert_encoding listpack set2{t} + assert_equal [lsort $union] [lsort [r sunion set1{t} set2{t}]] + } + + test "SDIFF with first set empty" { + r del set1{t} set2{t} set3{t} + r sadd set2{t} 1 2 3 4 + r sadd set3{t} a b c d + r sdiff set1{t} set2{t} set3{t} + } {} + + test "SDIFF with same set two times" { + r del set1 + r sadd set1 a b c 1 2 3 4 5 6 + r sdiff set1 set1 + } {} + + test "SDIFF fuzzing" { + for {set j 0} {$j < 100} {incr j} { + unset -nocomplain s + array set s {} + set args {} + set num_sets [expr {[randomInt 10]+1}] + for {set i 0} {$i < $num_sets} {incr i} { + set num_elements [randomInt 100] + r del set_$i{t} + lappend args set_$i{t} + while {$num_elements} { + set ele [randomValue] + r sadd set_$i{t} $ele + if {$i == 0} { + set s($ele) x + } else { + unset -nocomplain s($ele) + } + incr num_elements -1 + } + } + set result [lsort [r sdiff {*}$args]] + assert_equal $result [lsort [array names s]] + } + } + + test "SDIFF against non-set should throw error" { + # with an empty set + r set key1{t} x + assert_error "WRONGTYPE*" {r sdiff key1{t} noset{t}} + # different order + assert_error "WRONGTYPE*" {r sdiff noset{t} key1{t}} + + # with a legal set + r del set1{t} + r sadd set1{t} a b c + assert_error "WRONGTYPE*" {r sdiff key1{t} set1{t}} + # different order + assert_error "WRONGTYPE*" {r sdiff set1{t} key1{t}} + } + + test "SDIFF should handle non existing key as empty" { + r del set1{t} set2{t} set3{t} + + r sadd set1{t} a b c + r sadd set2{t} b c d + assert_equal {a} [lsort [r sdiff set1{t} set2{t} set3{t}]] + assert_equal {} [lsort [r sdiff set3{t} set2{t} set1{t}]] + } + + test "SDIFFSTORE against non-set should throw error" { + r del set1{t} set2{t} set3{t} key1{t} + r set key1{t} x + + # with en empty dstkey + assert_error "WRONGTYPE*" {r SDIFFSTORE set3{t} key1{t} noset{t}} + assert_equal 0 [r exists set3{t}] + assert_error "WRONGTYPE*" {r SDIFFSTORE set3{t} noset{t} key1{t}} + assert_equal 0 [r exists set3{t}] + + # with a legal dstkey + r sadd set1{t} a b c + r sadd set2{t} b c d + r sadd set3{t} e + assert_error "WRONGTYPE*" {r SDIFFSTORE set3{t} key1{t} set1{t} noset{t}} + assert_equal 1 [r exists set3{t}] + assert_equal {e} [lsort [r smembers set3{t}]] + + assert_error "WRONGTYPE*" {r SDIFFSTORE set3{t} set1{t} key1{t} set2{t}} + assert_equal 1 [r exists set3{t}] + assert_equal {e} [lsort [r smembers set3{t}]] + } + + test "SDIFFSTORE should handle non existing key as empty" { + r del set1{t} set2{t} set3{t} + + r set setres{t} xxx + assert_equal 0 [r sdiffstore setres{t} foo111{t} bar222{t}] + assert_equal 0 [r exists setres{t}] + + # with a legal dstkey, should delete dstkey + r sadd set3{t} a b c + assert_equal 0 [r sdiffstore set3{t} set1{t} set2{t}] + assert_equal 0 [r exists set3{t}] + + r sadd set1{t} a b c + assert_equal 3 [r sdiffstore set3{t} set1{t} set2{t}] + assert_equal 1 [r exists set3{t}] + assert_equal {a b c} [lsort [r smembers set3{t}]] + + # with a legal dstkey and empty set2, should delete the dstkey + r sadd set3{t} a b c + assert_equal 0 [r sdiffstore set3{t} set2{t} set1{t}] + assert_equal 0 [r exists set3{t}] + } + + test "SINTER against non-set should throw error" { + r set key1{t} x + assert_error "WRONGTYPE*" {r sinter key1{t} noset{t}} + # different order + assert_error "WRONGTYPE*" {r sinter noset{t} key1{t}} + + r sadd set1{t} a b c + assert_error "WRONGTYPE*" {r sinter key1{t} set1{t}} + # different order + assert_error "WRONGTYPE*" {r sinter set1{t} key1{t}} + } + + test "SINTER should handle non existing key as empty" { + r del set1{t} set2{t} set3{t} + r sadd set1{t} a b c + r sadd set2{t} b c d + r sinter set1{t} set2{t} set3{t} + } {} + + test "SINTER with same integer elements but different encoding" { + r del set1{t} set2{t} + r sadd set1{t} 1 2 3 + r sadd set2{t} 1 2 3 a + r srem set2{t} a + assert_encoding intset set1{t} + assert_encoding listpack set2{t} + lsort [r sinter set1{t} set2{t}] + } {1 2 3} + + test "SINTERSTORE against non-set should throw error" { + r del set1{t} set2{t} set3{t} key1{t} + r set key1{t} x + + # with en empty dstkey + assert_error "WRONGTYPE*" {r sinterstore set3{t} key1{t} noset{t}} + assert_equal 0 [r exists set3{t}] + assert_error "WRONGTYPE*" {r sinterstore set3{t} noset{t} key1{t}} + assert_equal 0 [r exists set3{t}] + + # with a legal dstkey + r sadd set1{t} a b c + r sadd set2{t} b c d + r sadd set3{t} e + assert_error "WRONGTYPE*" {r sinterstore set3{t} key1{t} set2{t} noset{t}} + assert_equal 1 [r exists set3{t}] + assert_equal {e} [lsort [r smembers set3{t}]] + + assert_error "WRONGTYPE*" {r sinterstore set3{t} noset{t} key1{t} set2{t}} + assert_equal 1 [r exists set3{t}] + assert_equal {e} [lsort [r smembers set3{t}]] + } + + test "SINTERSTORE against non existing keys should delete dstkey" { + r del set1{t} set2{t} set3{t} + + r set setres{t} xxx + assert_equal 0 [r sinterstore setres{t} foo111{t} bar222{t}] + assert_equal 0 [r exists setres{t}] + + # with a legal dstkey + r sadd set3{t} a b c + assert_equal 0 [r sinterstore set3{t} set1{t} set2{t}] + assert_equal 0 [r exists set3{t}] + + r sadd set1{t} a b c + assert_equal 0 [r sinterstore set3{t} set1{t} set2{t}] + assert_equal 0 [r exists set3{t}] + + assert_equal 0 [r sinterstore set3{t} set2{t} set1{t}] + assert_equal 0 [r exists set3{t}] + } + + test "SUNION against non-set should throw error" { + r set key1{t} x + assert_error "WRONGTYPE*" {r sunion key1{t} noset{t}} + # different order + assert_error "WRONGTYPE*" {r sunion noset{t} key1{t}} + + r del set1{t} + r sadd set1{t} a b c + assert_error "WRONGTYPE*" {r sunion key1{t} set1{t}} + # different order + assert_error "WRONGTYPE*" {r sunion set1{t} key1{t}} + } + + test "SUNION should handle non existing key as empty" { + r del set1{t} set2{t} set3{t} + + r sadd set1{t} a b c + r sadd set2{t} b c d + assert_equal {a b c d} [lsort [r sunion set1{t} set2{t} set3{t}]] + } + + test "SUNIONSTORE against non-set should throw error" { + r del set1{t} set2{t} set3{t} key1{t} + r set key1{t} x + + # with en empty dstkey + assert_error "WRONGTYPE*" {r sunionstore set3{t} key1{t} noset{t}} + assert_equal 0 [r exists set3{t}] + assert_error "WRONGTYPE*" {r sunionstore set3{t} noset{t} key1{t}} + assert_equal 0 [r exists set3{t}] + + # with a legal dstkey + r sadd set1{t} a b c + r sadd set2{t} b c d + r sadd set3{t} e + assert_error "WRONGTYPE*" {r sunionstore set3{t} key1{t} key2{t} noset{t}} + assert_equal 1 [r exists set3{t}] + assert_equal {e} [lsort [r smembers set3{t}]] + + assert_error "WRONGTYPE*" {r sunionstore set3{t} noset{t} key1{t} key2{t}} + assert_equal 1 [r exists set3{t}] + assert_equal {e} [lsort [r smembers set3{t}]] + } + + test "SUNIONSTORE should handle non existing key as empty" { + r del set1{t} set2{t} set3{t} + + r set setres{t} xxx + assert_equal 0 [r sunionstore setres{t} foo111{t} bar222{t}] + assert_equal 0 [r exists setres{t}] + + # set1 set2 both empty, should delete the dstkey + r sadd set3{t} a b c + assert_equal 0 [r sunionstore set3{t} set1{t} set2{t}] + assert_equal 0 [r exists set3{t}] + + r sadd set1{t} a b c + r sadd set3{t} e f + assert_equal 3 [r sunionstore set3{t} set1{t} set2{t}] + assert_equal 1 [r exists set3{t}] + assert_equal {a b c} [lsort [r smembers set3{t}]] + + r sadd set3{t} d + assert_equal 3 [r sunionstore set3{t} set2{t} set1{t}] + assert_equal 1 [r exists set3{t}] + assert_equal {a b c} [lsort [r smembers set3{t}]] + } + + test "SUNIONSTORE against non existing keys should delete dstkey" { + r set setres{t} xxx + assert_equal 0 [r sunionstore setres{t} foo111{t} bar222{t}] + assert_equal 0 [r exists setres{t}] + } + + foreach {type contents} {listpack {a b c} intset {1 2 3}} { + test "SPOP basics - $type" { + create_set myset $contents + assert_encoding $type myset + assert_equal $contents [lsort [list [r spop myset] [r spop myset] [r spop myset]]] + assert_equal 0 [r scard myset] + } + + test "SPOP with <count>=1 - $type" { + create_set myset $contents + assert_encoding $type myset + assert_equal $contents [lsort [list [r spop myset 1] [r spop myset 1] [r spop myset 1]]] + assert_equal 0 [r scard myset] + } + + test "SRANDMEMBER - $type" { + create_set myset $contents + unset -nocomplain myset + array set myset {} + for {set i 0} {$i < 100} {incr i} { + set myset([r srandmember myset]) 1 + } + assert_equal $contents [lsort [array names myset]] + } + } + + test "SPOP integer from listpack set" { + create_set myset {a 1 2 3 4 5 6 7} + assert_encoding listpack myset + set a [r spop myset] + set b [r spop myset] + assert {[string is digit $a] || [string is digit $b]} + } + + foreach {type contents} { + listpack {a b c d e f g h i j k l m n o p q r s t u v w x y z} + intset {1 10 11 12 13 14 15 16 17 18 19 2 20 21 22 23 24 25 26 3 4 5 6 7 8 9} + hashtable {ABCDEFGHIJKLMNOPQRSTUVWXYZ0123456789 b c d e f g h i j k l m n o p q r s t u v w x y z} + } { + test "SPOP with <count> - $type" { + create_set myset $contents + assert_encoding $type myset + assert_equal $contents [lsort [concat [r spop myset 11] [r spop myset 9] [r spop myset 0] [r spop myset 4] [r spop myset 1] [r spop myset 0] [r spop myset 1] [r spop myset 0]]] + assert_equal 0 [r scard myset] + } + } + + # As seen in intsetRandomMembers + test "SPOP using integers, testing Knuth's and Floyd's algorithm" { + create_set myset {1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20} + assert_encoding intset myset + assert_equal 20 [r scard myset] + r spop myset 1 + assert_equal 19 [r scard myset] + r spop myset 2 + assert_equal 17 [r scard myset] + r spop myset 3 + assert_equal 14 [r scard myset] + r spop myset 10 + assert_equal 4 [r scard myset] + r spop myset 10 + assert_equal 0 [r scard myset] + r spop myset 1 + assert_equal 0 [r scard myset] + } {} + + test "SPOP using integers with Knuth's algorithm" { + r spop nonexisting_key 100 + } {} + + foreach {type content} { + intset {1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20} + listpack {a 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20} + } { + test "SPOP new implementation: code path #1 $type" { + create_set myset $content + assert_encoding $type myset + set res [r spop myset 30] + assert {[lsort $content] eq [lsort $res]} + assert_equal {0} [r exists myset] + } + + test "SPOP new implementation: code path #2 $type" { + create_set myset $content + assert_encoding $type myset + set res [r spop myset 2] + assert {[llength $res] == 2} + assert {[r scard myset] == 18} + set union [concat [r smembers myset] $res] + assert {[lsort $union] eq [lsort $content]} + } + + test "SPOP new implementation: code path #3 $type" { + create_set myset $content + assert_encoding $type myset + set res [r spop myset 18] + assert {[llength $res] == 18} + assert {[r scard myset] == 2} + set union [concat [r smembers myset] $res] + assert {[lsort $union] eq [lsort $content]} + } + } + + test "SPOP new implementation: code path #1 propagate as DEL or UNLINK" { + r del myset1{t} myset2{t} + r sadd myset1{t} 1 2 3 4 5 + r sadd myset2{t} 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 + + set repl [attach_to_replication_stream] + + r config set lazyfree-lazy-server-del no + r spop myset1{t} [r scard myset1{t}] + r config set lazyfree-lazy-server-del yes + r spop myset2{t} [r scard myset2{t}] + assert_equal {0} [r exists myset1{t} myset2{t}] + + # Verify the propagate of DEL and UNLINK. + assert_replication_stream $repl { + {select *} + {del myset1{t}} + {unlink myset2{t}} + } + + close_replication_stream $repl + } {} {needs:repl} + + test "SRANDMEMBER count of 0 is handled correctly" { + r srandmember myset 0 + } {} + + test "SRANDMEMBER with <count> against non existing key" { + r srandmember nonexisting_key 100 + } {} + + test "SRANDMEMBER count overflow" { + r sadd myset a + assert_error {*value is out of range*} {r srandmember myset -9223372036854775808} + } {} + + # Make sure we can distinguish between an empty array and a null response + r readraw 1 + + test "SRANDMEMBER count of 0 is handled correctly - emptyarray" { + r srandmember myset 0 + } {*0} + + test "SRANDMEMBER with <count> against non existing key - emptyarray" { + r srandmember nonexisting_key 100 + } {*0} + + r readraw 0 + + foreach {type contents} { + listpack { + 1 5 10 50 125 50000 33959417 4775547 65434162 + 12098459 427716 483706 2726473884 72615637475 + MARY PATRICIA LINDA BARBARA ELIZABETH JENNIFER MARIA + SUSAN MARGARET DOROTHY LISA NANCY KAREN BETTY HELEN + SANDRA DONNA CAROL RUTH SHARON MICHELLE LAURA SARAH + KIMBERLY DEBORAH JESSICA SHIRLEY CYNTHIA ANGELA MELISSA + BRENDA AMY ANNA REBECCA VIRGINIA KATHLEEN + } + intset { + 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 + 20 21 22 23 24 25 26 27 28 29 + 30 31 32 33 34 35 36 37 38 39 + 40 41 42 43 44 45 46 47 48 49 + } + hashtable { + ABCDEFGHIJKLMNOPQRSTUVWXYZ0123456789 + 1 5 10 50 125 50000 33959417 4775547 65434162 + 12098459 427716 483706 2726473884 72615637475 + MARY PATRICIA LINDA BARBARA ELIZABETH JENNIFER MARIA + SUSAN MARGARET DOROTHY LISA NANCY KAREN BETTY HELEN + SANDRA DONNA CAROL RUTH SHARON MICHELLE LAURA SARAH + KIMBERLY DEBORAH JESSICA SHIRLEY CYNTHIA ANGELA MELISSA + BRENDA AMY ANNA REBECCA VIRGINIA + } + } { + test "SRANDMEMBER with <count> - $type" { + create_set myset $contents + assert_encoding $type myset + unset -nocomplain myset + array set myset {} + foreach ele [r smembers myset] { + set myset($ele) 1 + } + assert_equal [lsort $contents] [lsort [array names myset]] + + # Make sure that a count of 0 is handled correctly. + assert_equal [r srandmember myset 0] {} + + # We'll stress different parts of the code, see the implementation + # of SRANDMEMBER for more information, but basically there are + # four different code paths. + # + # PATH 1: Use negative count. + # + # 1) Check that it returns repeated elements. + set res [r srandmember myset -100] + assert_equal [llength $res] 100 + + # 2) Check that all the elements actually belong to the + # original set. + foreach ele $res { + assert {[info exists myset($ele)]} + } + + # 3) Check that eventually all the elements are returned. + unset -nocomplain auxset + set iterations 1000 + while {$iterations != 0} { + incr iterations -1 + set res [r srandmember myset -10] + foreach ele $res { + set auxset($ele) 1 + } + if {[lsort [array names myset]] eq + [lsort [array names auxset]]} { + break; + } + } + assert {$iterations != 0} + + # PATH 2: positive count (unique behavior) with requested size + # equal or greater than set size. + foreach size {50 100} { + set res [r srandmember myset $size] + assert_equal [llength $res] 50 + assert_equal [lsort $res] [lsort [array names myset]] + } + + # PATH 3: Ask almost as elements as there are in the set. + # In this case the implementation will duplicate the original + # set and will remove random elements up to the requested size. + # + # PATH 4: Ask a number of elements definitely smaller than + # the set size. + # + # We can test both the code paths just changing the size but + # using the same code. + + foreach size {45 5} { + set res [r srandmember myset $size] + assert_equal [llength $res] $size + + # 1) Check that all the elements actually belong to the + # original set. + foreach ele $res { + assert {[info exists myset($ele)]} + } + + # 2) Check that eventually all the elements are returned. + unset -nocomplain auxset + set iterations 1000 + while {$iterations != 0} { + incr iterations -1 + set res [r srandmember myset $size] + foreach ele $res { + set auxset($ele) 1 + } + if {[lsort [array names myset]] eq + [lsort [array names auxset]]} { + break; + } + } + assert {$iterations != 0} + } + } + } + + foreach {type contents} { + listpack { + 1 5 10 50 125 + MARY PATRICIA LINDA BARBARA ELIZABETH + } + intset { + 0 1 2 3 4 5 6 7 8 9 + } + hashtable { + ABCDEFGHIJKLMNOPQRSTUVWXYZ0123456789 + 1 5 10 50 125 + MARY PATRICIA LINDA BARBARA + } + } { + test "SRANDMEMBER histogram distribution - $type" { + create_set myset $contents + assert_encoding $type myset + unset -nocomplain myset + array set myset {} + foreach ele [r smembers myset] { + set myset($ele) 1 + } + + # Use negative count (PATH 1). + # df = 9, 40 means 0.00001 probability + set res [r srandmember myset -1000] + assert_lessthan [chi_square_value $res] 40 + + # Use positive count (both PATH 3 and PATH 4). + foreach size {8 2} { + unset -nocomplain allkey + set iterations [expr {1000 / $size}] + while {$iterations != 0} { + incr iterations -1 + set res [r srandmember myset $size] + foreach ele $res { + lappend allkey $ele + } + } + # df = 9, 40 means 0.00001 probability + assert_lessthan [chi_square_value $allkey] 40 + } + } + } + + proc is_rehashing {myset} { + set htstats [r debug HTSTATS-KEY $myset] + return [string match {*rehashing target*} $htstats] + } + + proc rem_hash_set_top_N {myset n} { + set cursor 0 + set members {} + set enough 0 + while 1 { + set res [r sscan $myset $cursor] + set cursor [lindex $res 0] + set k [lindex $res 1] + foreach m $k { + lappend members $m + if {[llength $members] >= $n} { + set enough 1 + break + } + } + if {$enough || $cursor == 0} { + break + } + } + r srem $myset {*}$members + } + + test "SRANDMEMBER with a dict containing long chain" { + set origin_save [config_get_set save ""] + set origin_max_lp [config_get_set set-max-listpack-entries 0] + set origin_save_delay [config_get_set rdb-key-save-delay 2147483647] + + # 1) Create a hash set with 100000 members. + set members {} + for {set i 0} {$i < 100000} {incr i} { + lappend members [format "m:%d" $i] + } + create_set myset $members + + # 2) Wait for the hash set rehashing to finish. + while {[is_rehashing myset]} { + r srandmember myset 100 + } + + # 3) Turn off the rehashing of this set, and remove the members to 500. + r bgsave + rem_hash_set_top_N myset [expr {[r scard myset] - 500}] + assert_equal [r scard myset] 500 + + # 4) Kill RDB child process to restart rehashing. + set pid1 [get_child_pid 0] + catch {exec kill -9 $pid1} + waitForBgsave r + + # 5) Let the set hash to start rehashing + r spop myset 1 + assert [is_rehashing myset] + + # 6) Verify that when rdb saving is in progress, rehashing will still be performed (because + # the ratio is extreme) by waiting for it to finish during an active bgsave. + r bgsave + + while {[is_rehashing myset]} { + r srandmember myset 1 + } + if {$::verbose} { + puts [r debug HTSTATS-KEY myset full] + } + + set pid1 [get_child_pid 0] + catch {exec kill -9 $pid1} + waitForBgsave r + + # 7) Check that eventually, SRANDMEMBER returns all elements. + array set allmyset {} + foreach ele [r smembers myset] { + set allmyset($ele) 1 + } + unset -nocomplain auxset + set iterations 1000 + while {$iterations != 0} { + incr iterations -1 + set res [r srandmember myset -10] + foreach ele $res { + set auxset($ele) 1 + } + if {[lsort [array names allmyset]] eq + [lsort [array names auxset]]} { + break; + } + } + assert {$iterations != 0} + + # 8) Remove the members to 30 in order to calculate the value of Chi-Square Distribution, + # otherwise we would need more iterations. + rem_hash_set_top_N myset [expr {[r scard myset] - 30}] + assert_equal [r scard myset] 30 + assert {[is_rehashing myset]} + + # Now that we have a hash set with only one long chain bucket. + set htstats [r debug HTSTATS-KEY myset full] + assert {[regexp {different slots: ([0-9]+)} $htstats - different_slots]} + assert {[regexp {max chain length: ([0-9]+)} $htstats - max_chain_length]} + assert {$different_slots == 1 && $max_chain_length == 30} + + # 9) Use positive count (PATH 4) to get 10 elements (out of 30) each time. + unset -nocomplain allkey + set iterations 1000 + while {$iterations != 0} { + incr iterations -1 + set res [r srandmember myset 10] + foreach ele $res { + lappend allkey $ele + } + } + # validate even distribution of random sampling (df = 29, 73 means 0.00001 probability) + assert_lessthan [chi_square_value $allkey] 73 + + r config set save $origin_save + r config set set-max-listpack-entries $origin_max_lp + r config set rdb-key-save-delay $origin_save_delay + } {OK} {needs:debug slow} + + proc setup_move {} { + r del myset3{t} myset4{t} + create_set myset1{t} {1 a b} + create_set myset2{t} {2 3 4} + assert_encoding listpack myset1{t} + assert_encoding intset myset2{t} + } + + test "SMOVE basics - from regular set to intset" { + # move a non-integer element to an intset should convert encoding + setup_move + assert_equal 1 [r smove myset1{t} myset2{t} a] + assert_equal {1 b} [lsort [r smembers myset1{t}]] + assert_equal {2 3 4 a} [lsort [r smembers myset2{t}]] + assert_encoding listpack myset2{t} + + # move an integer element should not convert the encoding + setup_move + assert_equal 1 [r smove myset1{t} myset2{t} 1] + assert_equal {a b} [lsort [r smembers myset1{t}]] + assert_equal {1 2 3 4} [lsort [r smembers myset2{t}]] + assert_encoding intset myset2{t} + } + + test "SMOVE basics - from intset to regular set" { + setup_move + assert_equal 1 [r smove myset2{t} myset1{t} 2] + assert_equal {1 2 a b} [lsort [r smembers myset1{t}]] + assert_equal {3 4} [lsort [r smembers myset2{t}]] + } + + test "SMOVE non existing key" { + setup_move + assert_equal 0 [r smove myset1{t} myset2{t} foo] + assert_equal 0 [r smove myset1{t} myset1{t} foo] + assert_equal {1 a b} [lsort [r smembers myset1{t}]] + assert_equal {2 3 4} [lsort [r smembers myset2{t}]] + } + + test "SMOVE non existing src set" { + setup_move + assert_equal 0 [r smove noset{t} myset2{t} foo] + assert_equal {2 3 4} [lsort [r smembers myset2{t}]] + } + + test "SMOVE from regular set to non existing destination set" { + setup_move + assert_equal 1 [r smove myset1{t} myset3{t} a] + assert_equal {1 b} [lsort [r smembers myset1{t}]] + assert_equal {a} [lsort [r smembers myset3{t}]] + assert_encoding listpack myset3{t} + } + + test "SMOVE from intset to non existing destination set" { + setup_move + assert_equal 1 [r smove myset2{t} myset3{t} 2] + assert_equal {3 4} [lsort [r smembers myset2{t}]] + assert_equal {2} [lsort [r smembers myset3{t}]] + assert_encoding intset myset3{t} + } + + test "SMOVE wrong src key type" { + r set x{t} 10 + assert_error "WRONGTYPE*" {r smove x{t} myset2{t} foo} + } + + test "SMOVE wrong dst key type" { + r set x{t} 10 + assert_error "WRONGTYPE*" {r smove myset2{t} x{t} foo} + } + + test "SMOVE with identical source and destination" { + r del set{t} + r sadd set{t} a b c + r smove set{t} set{t} b + lsort [r smembers set{t}] + } {a b c} + + test "SMOVE only notify dstset when the addition is successful" { + r del srcset{t} + r del dstset{t} + + r sadd srcset{t} a b + r sadd dstset{t} a + + r watch dstset{t} + + r multi + r sadd dstset{t} c + + set r2 [redis_client] + $r2 smove srcset{t} dstset{t} a + + # The dstset is actually unchanged, multi should success + r exec + set res [r scard dstset{t}] + assert_equal $res 2 + $r2 close + } + + tags {slow} { + test {intsets implementation stress testing} { + for {set j 0} {$j < 20} {incr j} { + unset -nocomplain s + array set s {} + r del s + set len [randomInt 1024] + for {set i 0} {$i < $len} {incr i} { + randpath { + set data [randomInt 65536] + } { + set data [randomInt 4294967296] + } { + set data [randomInt 18446744073709551616] + } + set s($data) {} + r sadd s $data + } + assert_equal [lsort [r smembers s]] [lsort [array names s]] + set len [array size s] + for {set i 0} {$i < $len} {incr i} { + set e [r spop s] + if {![info exists s($e)]} { + puts "Can't find '$e' on local array" + puts "Local array: [lsort [r smembers s]]" + puts "Remote array: [lsort [array names s]]" + error "exception" + } + array unset s $e + } + assert_equal [r scard s] 0 + assert_equal [array size s] 0 + } + } + } +} + +run_solo {set-large-memory} { +start_server [list overrides [list save ""] ] { + +# test if the server supports such large configs (avoid 32 bit builds) +catch { + r config set proto-max-bulk-len 10000000000 ;#10gb + r config set client-query-buffer-limit 10000000000 ;#10gb +} +if {[lindex [r config get proto-max-bulk-len] 1] == 10000000000} { + + set str_length 4400000000 ;#~4.4GB + + test {SADD, SCARD, SISMEMBER - large data} { + r flushdb + r write "*3\r\n\$4\r\nSADD\r\n\$5\r\nmyset\r\n" + assert_equal 1 [write_big_bulk $str_length "aaa"] + r write "*3\r\n\$4\r\nSADD\r\n\$5\r\nmyset\r\n" + assert_equal 1 [write_big_bulk $str_length "bbb"] + r write "*3\r\n\$4\r\nSADD\r\n\$5\r\nmyset\r\n" + assert_equal 0 [write_big_bulk $str_length "aaa"] + assert_encoding hashtable myset + set s0 [s used_memory] + assert {$s0 > [expr $str_length * 2]} + assert_equal 2 [r scard myset] + + r write "*3\r\n\$9\r\nSISMEMBER\r\n\$5\r\nmyset\r\n" + assert_equal 1 [write_big_bulk $str_length "aaa"] + r write "*3\r\n\$9\r\nSISMEMBER\r\n\$5\r\nmyset\r\n" + assert_equal 0 [write_big_bulk $str_length "ccc"] + r write "*3\r\n\$4\r\nSREM\r\n\$5\r\nmyset\r\n" + assert_equal 1 [write_big_bulk $str_length "bbb"] + assert_equal [read_big_bulk {r spop myset} yes "aaa"] $str_length + } {} {large-memory} + + # restore defaults + r config set proto-max-bulk-len 536870912 + r config set client-query-buffer-limit 1073741824 + +} ;# skip 32bit builds +} +} ;# run_solo diff --git a/tests/unit/type/stream-cgroups.tcl b/tests/unit/type/stream-cgroups.tcl new file mode 100644 index 0000000..a6cc5da --- /dev/null +++ b/tests/unit/type/stream-cgroups.tcl @@ -0,0 +1,1297 @@ +start_server { + tags {"stream"} +} { + test {XGROUP CREATE: creation and duplicate group name detection} { + r DEL mystream + r XADD mystream * foo bar + r XGROUP CREATE mystream mygroup $ + catch {r XGROUP CREATE mystream mygroup $} err + set err + } {BUSYGROUP*} + + test {XGROUP CREATE: with ENTRIESREAD parameter} { + r DEL mystream + r XADD mystream 1-1 a 1 + r XADD mystream 1-2 b 2 + r XADD mystream 1-3 c 3 + r XADD mystream 1-4 d 4 + assert_error "*value for ENTRIESREAD must be positive or -1*" {r XGROUP CREATE mystream mygroup $ ENTRIESREAD -3} + + r XGROUP CREATE mystream mygroup1 $ ENTRIESREAD 0 + r XGROUP CREATE mystream mygroup2 $ ENTRIESREAD 3 + + set reply [r xinfo groups mystream] + foreach group_info $reply { + set group_name [dict get $group_info name] + set entries_read [dict get $group_info entries-read] + if {$group_name == "mygroup1"} { + assert_equal $entries_read 0 + } else { + assert_equal $entries_read 3 + } + } + } + + test {XGROUP CREATE: automatic stream creation fails without MKSTREAM} { + r DEL mystream + catch {r XGROUP CREATE mystream mygroup $} err + set err + } {ERR*} + + test {XGROUP CREATE: automatic stream creation works with MKSTREAM} { + r DEL mystream + r XGROUP CREATE mystream mygroup $ MKSTREAM + } {OK} + + test {XREADGROUP will return only new elements} { + r XADD mystream * a 1 + r XADD mystream * b 2 + # XREADGROUP should return only the new elements "a 1" "b 1" + # and not the element "foo bar" which was pre existing in the + # stream (see previous test) + set reply [ + r XREADGROUP GROUP mygroup consumer-1 STREAMS mystream ">" + ] + assert {[llength [lindex $reply 0 1]] == 2} + lindex $reply 0 1 0 1 + } {a 1} + + test {XREADGROUP can read the history of the elements we own} { + # Add a few more elements + r XADD mystream * c 3 + r XADD mystream * d 4 + # Read a few elements using a different consumer name + set reply [ + r XREADGROUP GROUP mygroup consumer-2 STREAMS mystream ">" + ] + assert {[llength [lindex $reply 0 1]] == 2} + assert {[lindex $reply 0 1 0 1] eq {c 3}} + + set r1 [r XREADGROUP GROUP mygroup consumer-1 COUNT 10 STREAMS mystream 0] + set r2 [r XREADGROUP GROUP mygroup consumer-2 COUNT 10 STREAMS mystream 0] + assert {[lindex $r1 0 1 0 1] eq {a 1}} + assert {[lindex $r2 0 1 0 1] eq {c 3}} + } + + test {XPENDING is able to return pending items} { + set pending [r XPENDING mystream mygroup - + 10] + assert {[llength $pending] == 4} + for {set j 0} {$j < 4} {incr j} { + set item [lindex $pending $j] + if {$j < 2} { + set owner consumer-1 + } else { + set owner consumer-2 + } + assert {[lindex $item 1] eq $owner} + assert {[lindex $item 1] eq $owner} + } + } + + test {XPENDING can return single consumer items} { + set pending [r XPENDING mystream mygroup - + 10 consumer-1] + assert {[llength $pending] == 2} + } + + test {XPENDING only group} { + set pending [r XPENDING mystream mygroup] + assert {[llength $pending] == 4} + } + + test {XPENDING with IDLE} { + after 20 + set pending [r XPENDING mystream mygroup IDLE 99999999 - + 10 consumer-1] + assert {[llength $pending] == 0} + set pending [r XPENDING mystream mygroup IDLE 1 - + 10 consumer-1] + assert {[llength $pending] == 2} + set pending [r XPENDING mystream mygroup IDLE 99999999 - + 10] + assert {[llength $pending] == 0} + set pending [r XPENDING mystream mygroup IDLE 1 - + 10] + assert {[llength $pending] == 4} + } + + test {XPENDING with exclusive range intervals works as expected} { + set pending [r XPENDING mystream mygroup - + 10] + assert {[llength $pending] == 4} + set startid [lindex [lindex $pending 0] 0] + set endid [lindex [lindex $pending 3] 0] + set expending [r XPENDING mystream mygroup ($startid ($endid 10] + assert {[llength $expending] == 2} + for {set j 0} {$j < 2} {incr j} { + set itemid [lindex [lindex $expending $j] 0] + assert {$itemid ne $startid} + assert {$itemid ne $endid} + } + } + + test {XACK is able to remove items from the consumer/group PEL} { + set pending [r XPENDING mystream mygroup - + 10 consumer-1] + set id1 [lindex $pending 0 0] + set id2 [lindex $pending 1 0] + assert {[r XACK mystream mygroup $id1] eq 1} + set pending [r XPENDING mystream mygroup - + 10 consumer-1] + assert {[llength $pending] == 1} + set id [lindex $pending 0 0] + assert {$id eq $id2} + set global_pel [r XPENDING mystream mygroup - + 10] + assert {[llength $global_pel] == 3} + } + + test {XACK can't remove the same item multiple times} { + assert {[r XACK mystream mygroup $id1] eq 0} + } + + test {XACK is able to accept multiple arguments} { + # One of the IDs was already removed, so it should ack + # just ID2. + assert {[r XACK mystream mygroup $id1 $id2] eq 1} + } + + test {XACK should fail if got at least one invalid ID} { + r del mystream + r xgroup create s g $ MKSTREAM + r xadd s * f1 v1 + set c [llength [lindex [r xreadgroup group g c streams s >] 0 1]] + assert {$c == 1} + set pending [r xpending s g - + 10 c] + set id1 [lindex $pending 0 0] + assert_error "*Invalid stream ID specified*" {r xack s g $id1 invalid-id} + assert {[r xack s g $id1] eq 1} + } + + test {PEL NACK reassignment after XGROUP SETID event} { + r del events + r xadd events * f1 v1 + r xadd events * f1 v1 + r xadd events * f1 v1 + r xadd events * f1 v1 + r xgroup create events g1 $ + r xadd events * f1 v1 + set c [llength [lindex [r xreadgroup group g1 c1 streams events >] 0 1]] + assert {$c == 1} + r xgroup setid events g1 - + set c [llength [lindex [r xreadgroup group g1 c2 streams events >] 0 1]] + assert {$c == 5} + } + + test {XREADGROUP will not report data on empty history. Bug #5577} { + r del events + r xadd events * a 1 + r xadd events * b 2 + r xadd events * c 3 + r xgroup create events mygroup 0 + + # Current local PEL should be empty + set res [r xpending events mygroup - + 10] + assert {[llength $res] == 0} + + # So XREADGROUP should read an empty history as well + set res [r xreadgroup group mygroup myconsumer count 3 streams events 0] + assert {[llength [lindex $res 0 1]] == 0} + + # We should fetch all the elements in the stream asking for > + set res [r xreadgroup group mygroup myconsumer count 3 streams events >] + assert {[llength [lindex $res 0 1]] == 3} + + # Now the history is populated with three not acked entries + set res [r xreadgroup group mygroup myconsumer count 3 streams events 0] + assert {[llength [lindex $res 0 1]] == 3} + } + + test {XREADGROUP history reporting of deleted entries. Bug #5570} { + r del mystream + r XGROUP CREATE mystream mygroup $ MKSTREAM + r XADD mystream 1 field1 A + r XREADGROUP GROUP mygroup myconsumer STREAMS mystream > + r XADD mystream MAXLEN 1 2 field1 B + r XREADGROUP GROUP mygroup myconsumer STREAMS mystream > + + # Now we have two pending entries, however one should be deleted + # and one should be ok (we should only see "B") + set res [r XREADGROUP GROUP mygroup myconsumer STREAMS mystream 0-1] + assert {[lindex $res 0 1 0] == {1-0 {}}} + assert {[lindex $res 0 1 1] == {2-0 {field1 B}}} + } + + test {Blocking XREADGROUP will not reply with an empty array} { + r del mystream + r XGROUP CREATE mystream mygroup $ MKSTREAM + r XADD mystream 666 f v + set res [r XREADGROUP GROUP mygroup Alice BLOCK 10 STREAMS mystream ">"] + assert {[lindex $res 0 1 0] == {666-0 {f v}}} + r XADD mystream 667 f2 v2 + r XDEL mystream 667 + set rd [redis_deferring_client] + $rd XREADGROUP GROUP mygroup Alice BLOCK 10 STREAMS mystream ">" + wait_for_blocked_clients_count 0 + assert {[$rd read] == {}} ;# before the fix, client didn't even block, but was served synchronously with {mystream {}} + $rd close + } + + test {Blocking XREADGROUP: key deleted} { + r DEL mystream + r XADD mystream 666 f v + r XGROUP CREATE mystream mygroup $ + set rd [redis_deferring_client] + $rd XREADGROUP GROUP mygroup Alice BLOCK 0 STREAMS mystream ">" + wait_for_blocked_clients_count 1 + r DEL mystream + assert_error "NOGROUP*" {$rd read} + $rd close + } + + test {Blocking XREADGROUP: key type changed with SET} { + r DEL mystream + r XADD mystream 666 f v + r XGROUP CREATE mystream mygroup $ + set rd [redis_deferring_client] + $rd XREADGROUP GROUP mygroup Alice BLOCK 0 STREAMS mystream ">" + wait_for_blocked_clients_count 1 + r SET mystream val1 + assert_error "*WRONGTYPE*" {$rd read} + $rd close + } + + test {Blocking XREADGROUP: key type changed with transaction} { + r DEL mystream + r XADD mystream 666 f v + r XGROUP CREATE mystream mygroup $ + set rd [redis_deferring_client] + $rd XREADGROUP GROUP mygroup Alice BLOCK 0 STREAMS mystream ">" + wait_for_blocked_clients_count 1 + r MULTI + r DEL mystream + r SADD mystream e1 + r EXEC + assert_error "*WRONGTYPE*" {$rd read} + $rd close + } + + test {Blocking XREADGROUP: flushed DB} { + r DEL mystream + r XADD mystream 666 f v + r XGROUP CREATE mystream mygroup $ + set rd [redis_deferring_client] + $rd XREADGROUP GROUP mygroup Alice BLOCK 0 STREAMS mystream ">" + wait_for_blocked_clients_count 1 + r FLUSHALL + assert_error "*NOGROUP*" {$rd read} + $rd close + } + + test {Blocking XREADGROUP: swapped DB, key doesn't exist} { + r SELECT 4 + r FLUSHDB + r SELECT 9 + r DEL mystream + r XADD mystream 666 f v + r XGROUP CREATE mystream mygroup $ + set rd [redis_deferring_client] + $rd SELECT 9 + $rd read + $rd XREADGROUP GROUP mygroup Alice BLOCK 0 STREAMS mystream ">" + wait_for_blocked_clients_count 1 + r SWAPDB 4 9 + assert_error "*NOGROUP*" {$rd read} + $rd close + } {0} {external:skip} + + test {Blocking XREADGROUP: swapped DB, key is not a stream} { + r SELECT 4 + r FLUSHDB + r LPUSH mystream e1 + r SELECT 9 + r DEL mystream + r XADD mystream 666 f v + r XGROUP CREATE mystream mygroup $ + set rd [redis_deferring_client] + $rd SELECT 9 + $rd read + $rd XREADGROUP GROUP mygroup Alice BLOCK 0 STREAMS mystream ">" + wait_for_blocked_clients_count 1 + r SWAPDB 4 9 + assert_error "*WRONGTYPE*" {$rd read} + $rd close + } {0} {external:skip} + + test {XREAD and XREADGROUP against wrong parameter} { + r DEL mystream + r XADD mystream 666 f v + r XGROUP CREATE mystream mygroup $ + assert_error "ERR Unbalanced 'xreadgroup' list of streams: for each stream key an ID or '>' must be specified." {r XREADGROUP GROUP mygroup Alice COUNT 1 STREAMS mystream } + assert_error "ERR Unbalanced 'xread' list of streams: for each stream key an ID or '$' must be specified." {r XREAD COUNT 1 STREAMS mystream } + } + + test {Blocking XREAD: key deleted} { + r DEL mystream + r XADD mystream 666 f v + set rd [redis_deferring_client] + $rd XREAD BLOCK 0 STREAMS mystream "$" + wait_for_blocked_clients_count 1 + r DEL mystream + + r XADD mystream 667 f v + set res [$rd read] + assert_equal [lindex $res 0 1 0] {667-0 {f v}} + $rd close + } + + test {Blocking XREAD: key type changed with SET} { + r DEL mystream + r XADD mystream 666 f v + set rd [redis_deferring_client] + $rd XREAD BLOCK 0 STREAMS mystream "$" + wait_for_blocked_clients_count 1 + r SET mystream val1 + + r DEL mystream + r XADD mystream 667 f v + set res [$rd read] + assert_equal [lindex $res 0 1 0] {667-0 {f v}} + $rd close + } + + test {Blocking XREADGROUP for stream that ran dry (issue #5299)} { + set rd [redis_deferring_client] + + # Add a entry then delete it, now stream's last_id is 666. + r DEL mystream + r XGROUP CREATE mystream mygroup $ MKSTREAM + r XADD mystream 666 key value + r XDEL mystream 666 + + # Pass a special `>` ID but without new entry, released on timeout. + $rd XREADGROUP GROUP mygroup myconsumer BLOCK 10 STREAMS mystream > + assert_equal [$rd read] {} + + # Throw an error if the ID equal or smaller than the last_id. + assert_error ERR*equal*smaller* {r XADD mystream 665 key value} + assert_error ERR*equal*smaller* {r XADD mystream 666 key value} + + # Entered blocking state and then release because of the new entry. + $rd XREADGROUP GROUP mygroup myconsumer BLOCK 0 STREAMS mystream > + wait_for_blocked_clients_count 1 + r XADD mystream 667 key value + assert_equal [$rd read] {{mystream {{667-0 {key value}}}}} + + $rd close + } + + test "Blocking XREADGROUP will ignore BLOCK if ID is not >" { + set rd [redis_deferring_client] + + # Add a entry then delete it, now stream's last_id is 666. + r DEL mystream + r XGROUP CREATE mystream mygroup $ MKSTREAM + r XADD mystream 666 key value + r XDEL mystream 666 + + # Return right away instead of blocking, return the stream with an + # empty list instead of NIL if the ID specified is not the special `>` ID. + foreach id {0 600 666 700} { + $rd XREADGROUP GROUP mygroup myconsumer BLOCK 0 STREAMS mystream $id + assert_equal [$rd read] {{mystream {}}} + } + + # After adding a new entry, `XREADGROUP BLOCK` still return the stream + # with an empty list because the pending list is empty. + r XADD mystream 667 key value + foreach id {0 600 666 667 700} { + $rd XREADGROUP GROUP mygroup myconsumer BLOCK 0 STREAMS mystream $id + assert_equal [$rd read] {{mystream {}}} + } + + # After we read it once, the pending list is not empty at this time, + # pass any ID smaller than 667 will return one of the pending entry. + set res [r XREADGROUP GROUP mygroup myconsumer BLOCK 0 STREAMS mystream >] + assert_equal $res {{mystream {{667-0 {key value}}}}} + foreach id {0 600 666} { + $rd XREADGROUP GROUP mygroup myconsumer BLOCK 0 STREAMS mystream $id + assert_equal [$rd read] {{mystream {{667-0 {key value}}}}} + } + + # Pass ID equal or greater than 667 will return the stream with an empty list. + foreach id {667 700} { + $rd XREADGROUP GROUP mygroup myconsumer BLOCK 0 STREAMS mystream $id + assert_equal [$rd read] {{mystream {}}} + } + + # After we ACK the pending entry, return the stream with an empty list. + r XACK mystream mygroup 667 + foreach id {0 600 666 667 700} { + $rd XREADGROUP GROUP mygroup myconsumer BLOCK 0 STREAMS mystream $id + assert_equal [$rd read] {{mystream {}}} + } + + $rd close + } + + test {Blocking XREADGROUP for stream key that has clients blocked on list} { + set rd [redis_deferring_client] + set rd2 [redis_deferring_client] + + # First delete the stream + r DEL mystream + + # now place a client blocked on non-existing key as list + $rd2 BLPOP mystream 0 + + # wait until we verify the client is blocked + wait_for_blocked_clients_count 1 + + # verify we only have 1 regular blocking key + assert_equal 1 [getInfoProperty [r info clients] total_blocking_keys] + assert_equal 0 [getInfoProperty [r info clients] total_blocking_keys_on_nokey] + + # now write mystream as stream + r XADD mystream 666 key value + r XGROUP CREATE mystream mygroup $ MKSTREAM + + # block another client on xreadgroup + $rd XREADGROUP GROUP mygroup myconsumer BLOCK 0 STREAMS mystream ">" + + # wait until we verify we have 2 blocked clients (one for the list and one for the stream) + wait_for_blocked_clients_count 2 + + # verify we have 1 blocking key which also have clients blocked on nokey condition + assert_equal 1 [getInfoProperty [r info clients] total_blocking_keys] + assert_equal 1 [getInfoProperty [r info clients] total_blocking_keys_on_nokey] + + # now delete the key and verify we have no clients blocked on nokey condition + r DEL mystream + assert_error "NOGROUP*" {$rd read} + assert_equal 1 [getInfoProperty [r info clients] total_blocking_keys] + assert_equal 0 [getInfoProperty [r info clients] total_blocking_keys_on_nokey] + + # close the only left client and make sure we have no more blocking keys + $rd2 close + + # wait until we verify we have no more blocked clients + wait_for_blocked_clients_count 0 + + assert_equal 0 [getInfoProperty [r info clients] total_blocking_keys] + assert_equal 0 [getInfoProperty [r info clients] total_blocking_keys_on_nokey] + + $rd close + } + + test {Blocking XREADGROUP for stream key that has clients blocked on list - avoid endless loop} { + r DEL mystream + r XGROUP CREATE mystream mygroup $ MKSTREAM + + set rd1 [redis_deferring_client] + set rd2 [redis_deferring_client] + set rd3 [redis_deferring_client] + + $rd1 xreadgroup GROUP mygroup myuser COUNT 10 BLOCK 10000 STREAMS mystream > + $rd2 xreadgroup GROUP mygroup myuser COUNT 10 BLOCK 10000 STREAMS mystream > + $rd3 xreadgroup GROUP mygroup myuser COUNT 10 BLOCK 10000 STREAMS mystream > + + wait_for_blocked_clients_count 3 + + r xadd mystream MAXLEN 5000 * field1 value1 field2 value2 field3 value3 + + $rd1 close + $rd2 close + $rd3 close + + assert_equal [r ping] {PONG} + } + + test {XGROUP DESTROY should unblock XREADGROUP with -NOGROUP} { + r config resetstat + r del mystream + r XGROUP CREATE mystream mygroup $ MKSTREAM + set rd [redis_deferring_client] + $rd XREADGROUP GROUP mygroup Alice BLOCK 0 STREAMS mystream ">" + wait_for_blocked_clients_count 1 + r XGROUP DESTROY mystream mygroup + assert_error "NOGROUP*" {$rd read} + $rd close + + # verify command stats, error stats and error counter work on failed blocked command + assert_match {*count=1*} [errorrstat NOGROUP r] + assert_match {*calls=1,*,rejected_calls=0,failed_calls=1} [cmdrstat xreadgroup r] + assert_equal [s total_error_replies] 1 + } + + test {RENAME can unblock XREADGROUP with data} { + r del mystream{t} + r XGROUP CREATE mystream{t} mygroup $ MKSTREAM + set rd [redis_deferring_client] + $rd XREADGROUP GROUP mygroup Alice BLOCK 0 STREAMS mystream{t} ">" + wait_for_blocked_clients_count 1 + r XGROUP CREATE mystream2{t} mygroup $ MKSTREAM + r XADD mystream2{t} 100 f1 v1 + r RENAME mystream2{t} mystream{t} + assert_equal "{mystream{t} {{100-0 {f1 v1}}}}" [$rd read] ;# mystream2{t} had mygroup before RENAME + $rd close + } + + test {RENAME can unblock XREADGROUP with -NOGROUP} { + r del mystream{t} + r XGROUP CREATE mystream{t} mygroup $ MKSTREAM + set rd [redis_deferring_client] + $rd XREADGROUP GROUP mygroup Alice BLOCK 0 STREAMS mystream{t} ">" + wait_for_blocked_clients_count 1 + r XADD mystream2{t} 100 f1 v1 + r RENAME mystream2{t} mystream{t} + assert_error "*NOGROUP*" {$rd read} ;# mystream2{t} didn't have mygroup before RENAME + $rd close + } + + test {XCLAIM can claim PEL items from another consumer} { + # Add 3 items into the stream, and create a consumer group + r del mystream + set id1 [r XADD mystream * a 1] + set id2 [r XADD mystream * b 2] + set id3 [r XADD mystream * c 3] + r XGROUP CREATE mystream mygroup 0 + + # Consumer 1 reads item 1 from the stream without acknowledgements. + # Consumer 2 then claims pending item 1 from the PEL of consumer 1 + set reply [ + r XREADGROUP GROUP mygroup consumer1 count 1 STREAMS mystream > + ] + assert {[llength [lindex $reply 0 1 0 1]] == 2} + assert {[lindex $reply 0 1 0 1] eq {a 1}} + + # make sure the entry is present in both the group, and the right consumer + assert {[llength [r XPENDING mystream mygroup - + 10]] == 1} + assert {[llength [r XPENDING mystream mygroup - + 10 consumer1]] == 1} + assert {[llength [r XPENDING mystream mygroup - + 10 consumer2]] == 0} + + after 200 + set reply [ + r XCLAIM mystream mygroup consumer2 10 $id1 + ] + assert {[llength [lindex $reply 0 1]] == 2} + assert {[lindex $reply 0 1] eq {a 1}} + + # make sure the entry is present in both the group, and the right consumer + assert {[llength [r XPENDING mystream mygroup - + 10]] == 1} + assert {[llength [r XPENDING mystream mygroup - + 10 consumer1]] == 0} + assert {[llength [r XPENDING mystream mygroup - + 10 consumer2]] == 1} + + # Consumer 1 reads another 2 items from stream + r XREADGROUP GROUP mygroup consumer1 count 2 STREAMS mystream > + after 200 + + # Delete item 2 from the stream. Now consumer 1 has PEL that contains + # only item 3. Try to use consumer 2 to claim the deleted item 2 + # from the PEL of consumer 1, this should be NOP + r XDEL mystream $id2 + set reply [ + r XCLAIM mystream mygroup consumer2 10 $id2 + ] + assert {[llength $reply] == 0} + + # Delete item 3 from the stream. Now consumer 1 has PEL that is empty. + # Try to use consumer 2 to claim the deleted item 3 from the PEL + # of consumer 1, this should be NOP + after 200 + r XDEL mystream $id3 + set reply [ + r XCLAIM mystream mygroup consumer2 10 $id3 + ] + assert {[llength $reply] == 0} + } + + test {XCLAIM without JUSTID increments delivery count} { + # Add 3 items into the stream, and create a consumer group + r del mystream + set id1 [r XADD mystream * a 1] + set id2 [r XADD mystream * b 2] + set id3 [r XADD mystream * c 3] + r XGROUP CREATE mystream mygroup 0 + + # Consumer 1 reads item 1 from the stream without acknowledgements. + # Consumer 2 then claims pending item 1 from the PEL of consumer 1 + set reply [ + r XREADGROUP GROUP mygroup consumer1 count 1 STREAMS mystream > + ] + assert {[llength [lindex $reply 0 1 0 1]] == 2} + assert {[lindex $reply 0 1 0 1] eq {a 1}} + after 200 + set reply [ + r XCLAIM mystream mygroup consumer2 10 $id1 + ] + assert {[llength [lindex $reply 0 1]] == 2} + assert {[lindex $reply 0 1] eq {a 1}} + + set reply [ + r XPENDING mystream mygroup - + 10 + ] + assert {[llength [lindex $reply 0]] == 4} + assert {[lindex $reply 0 3] == 2} + + # Consumer 3 then claims pending item 1 from the PEL of consumer 2 using JUSTID + after 200 + set reply [ + r XCLAIM mystream mygroup consumer3 10 $id1 JUSTID + ] + assert {[llength $reply] == 1} + assert {[lindex $reply 0] eq $id1} + + set reply [ + r XPENDING mystream mygroup - + 10 + ] + assert {[llength [lindex $reply 0]] == 4} + assert {[lindex $reply 0 3] == 2} + } + + test {XCLAIM same consumer} { + # Add 3 items into the stream, and create a consumer group + r del mystream + set id1 [r XADD mystream * a 1] + set id2 [r XADD mystream * b 2] + set id3 [r XADD mystream * c 3] + r XGROUP CREATE mystream mygroup 0 + + set reply [r XREADGROUP GROUP mygroup consumer1 count 1 STREAMS mystream >] + assert {[llength [lindex $reply 0 1 0 1]] == 2} + assert {[lindex $reply 0 1 0 1] eq {a 1}} + after 200 + # re-claim with the same consumer that already has it + assert {[llength [r XCLAIM mystream mygroup consumer1 10 $id1]] == 1} + + # make sure the entry is still in the PEL + set reply [r XPENDING mystream mygroup - + 10] + assert {[llength $reply] == 1} + assert {[lindex $reply 0 1] eq {consumer1}} + } + + test {XAUTOCLAIM can claim PEL items from another consumer} { + # Add 3 items into the stream, and create a consumer group + r del mystream + set id1 [r XADD mystream * a 1] + set id2 [r XADD mystream * b 2] + set id3 [r XADD mystream * c 3] + set id4 [r XADD mystream * d 4] + r XGROUP CREATE mystream mygroup 0 + + # Consumer 1 reads item 1 from the stream without acknowledgements. + # Consumer 2 then claims pending item 1 from the PEL of consumer 1 + set reply [r XREADGROUP GROUP mygroup consumer1 count 1 STREAMS mystream >] + assert_equal [llength [lindex $reply 0 1 0 1]] 2 + assert_equal [lindex $reply 0 1 0 1] {a 1} + after 200 + set reply [r XAUTOCLAIM mystream mygroup consumer2 10 - COUNT 1] + assert_equal [llength $reply] 3 + assert_equal [lindex $reply 0] "0-0" + assert_equal [llength [lindex $reply 1]] 1 + assert_equal [llength [lindex $reply 1 0]] 2 + assert_equal [llength [lindex $reply 1 0 1]] 2 + assert_equal [lindex $reply 1 0 1] {a 1} + + # Consumer 1 reads another 2 items from stream + r XREADGROUP GROUP mygroup consumer1 count 3 STREAMS mystream > + + # For min-idle-time + after 200 + + # Delete item 2 from the stream. Now consumer 1 has PEL that contains + # only item 3. Try to use consumer 2 to claim the deleted item 2 + # from the PEL of consumer 1, this should return nil + r XDEL mystream $id2 + + # id1 and id3 are self-claimed here but not id2 ('count' was set to 3) + # we make sure id2 is indeed skipped (the cursor points to id4) + set reply [r XAUTOCLAIM mystream mygroup consumer2 10 - COUNT 3] + + assert_equal [llength $reply] 3 + assert_equal [lindex $reply 0] $id4 + assert_equal [llength [lindex $reply 1]] 2 + assert_equal [llength [lindex $reply 1 0]] 2 + assert_equal [llength [lindex $reply 1 0 1]] 2 + assert_equal [lindex $reply 1 0 1] {a 1} + assert_equal [lindex $reply 1 1 1] {c 3} + assert_equal [llength [lindex $reply 2]] 1 + assert_equal [llength [lindex $reply 2 0]] 1 + + # Delete item 3 from the stream. Now consumer 1 has PEL that is empty. + # Try to use consumer 2 to claim the deleted item 3 from the PEL + # of consumer 1, this should return nil + after 200 + + r XDEL mystream $id4 + + # id1 and id3 are self-claimed here but not id2 and id4 ('count' is default 100) + set reply [r XAUTOCLAIM mystream mygroup consumer2 10 - JUSTID] + + # we also test the JUSTID modifier here. note that, when using JUSTID, + # deleted entries are returned in reply (consistent with XCLAIM). + + assert_equal [llength $reply] 3 + assert_equal [lindex $reply 0] {0-0} + assert_equal [llength [lindex $reply 1]] 2 + assert_equal [lindex $reply 1 0] $id1 + assert_equal [lindex $reply 1 1] $id3 + } + + test {XAUTOCLAIM as an iterator} { + # Add 5 items into the stream, and create a consumer group + r del mystream + set id1 [r XADD mystream * a 1] + set id2 [r XADD mystream * b 2] + set id3 [r XADD mystream * c 3] + set id4 [r XADD mystream * d 4] + set id5 [r XADD mystream * e 5] + r XGROUP CREATE mystream mygroup 0 + + # Read 5 messages into consumer1 + r XREADGROUP GROUP mygroup consumer1 count 90 STREAMS mystream > + + # For min-idle-time + after 200 + + # Claim 2 entries + set reply [r XAUTOCLAIM mystream mygroup consumer2 10 - COUNT 2] + assert_equal [llength $reply] 3 + set cursor [lindex $reply 0] + assert_equal $cursor $id3 + assert_equal [llength [lindex $reply 1]] 2 + assert_equal [llength [lindex $reply 1 0 1]] 2 + assert_equal [lindex $reply 1 0 1] {a 1} + + # Claim 2 more entries + set reply [r XAUTOCLAIM mystream mygroup consumer2 10 $cursor COUNT 2] + assert_equal [llength $reply] 3 + set cursor [lindex $reply 0] + assert_equal $cursor $id5 + assert_equal [llength [lindex $reply 1]] 2 + assert_equal [llength [lindex $reply 1 0 1]] 2 + assert_equal [lindex $reply 1 0 1] {c 3} + + # Claim last entry + set reply [r XAUTOCLAIM mystream mygroup consumer2 10 $cursor COUNT 1] + assert_equal [llength $reply] 3 + set cursor [lindex $reply 0] + assert_equal $cursor {0-0} + assert_equal [llength [lindex $reply 1]] 1 + assert_equal [llength [lindex $reply 1 0 1]] 2 + assert_equal [lindex $reply 1 0 1] {e 5} + } + + test {XAUTOCLAIM COUNT must be > 0} { + assert_error "ERR COUNT must be > 0" {r XAUTOCLAIM key group consumer 1 1 COUNT 0} + } + + test {XCLAIM with XDEL} { + r DEL x + r XADD x 1-0 f v + r XADD x 2-0 f v + r XADD x 3-0 f v + r XGROUP CREATE x grp 0 + assert_equal [r XREADGROUP GROUP grp Alice STREAMS x >] {{x {{1-0 {f v}} {2-0 {f v}} {3-0 {f v}}}}} + r XDEL x 2-0 + assert_equal [r XCLAIM x grp Bob 0 1-0 2-0 3-0] {{1-0 {f v}} {3-0 {f v}}} + assert_equal [r XPENDING x grp - + 10 Alice] {} + } + + test {XCLAIM with trimming} { + r DEL x + r config set stream-node-max-entries 2 + r XADD x 1-0 f v + r XADD x 2-0 f v + r XADD x 3-0 f v + r XGROUP CREATE x grp 0 + assert_equal [r XREADGROUP GROUP grp Alice STREAMS x >] {{x {{1-0 {f v}} {2-0 {f v}} {3-0 {f v}}}}} + r XTRIM x MAXLEN 1 + assert_equal [r XCLAIM x grp Bob 0 1-0 2-0 3-0] {{3-0 {f v}}} + assert_equal [r XPENDING x grp - + 10 Alice] {} + } + + test {XAUTOCLAIM with XDEL} { + r DEL x + r XADD x 1-0 f v + r XADD x 2-0 f v + r XADD x 3-0 f v + r XGROUP CREATE x grp 0 + assert_equal [r XREADGROUP GROUP grp Alice STREAMS x >] {{x {{1-0 {f v}} {2-0 {f v}} {3-0 {f v}}}}} + r XDEL x 2-0 + assert_equal [r XAUTOCLAIM x grp Bob 0 0-0] {0-0 {{1-0 {f v}} {3-0 {f v}}} 2-0} + assert_equal [r XPENDING x grp - + 10 Alice] {} + } + + test {XAUTOCLAIM with XDEL and count} { + r DEL x + r XADD x 1-0 f v + r XADD x 2-0 f v + r XADD x 3-0 f v + r XGROUP CREATE x grp 0 + assert_equal [r XREADGROUP GROUP grp Alice STREAMS x >] {{x {{1-0 {f v}} {2-0 {f v}} {3-0 {f v}}}}} + r XDEL x 1-0 + r XDEL x 2-0 + assert_equal [r XAUTOCLAIM x grp Bob 0 0-0 COUNT 1] {2-0 {} 1-0} + assert_equal [r XAUTOCLAIM x grp Bob 0 2-0 COUNT 1] {3-0 {} 2-0} + assert_equal [r XAUTOCLAIM x grp Bob 0 3-0 COUNT 1] {0-0 {{3-0 {f v}}} {}} + assert_equal [r XPENDING x grp - + 10 Alice] {} + } + + test {XAUTOCLAIM with out of range count} { + assert_error {ERR COUNT*} {r XAUTOCLAIM x grp Bob 0 3-0 COUNT 8070450532247928833} + } + + test {XCLAIM with trimming} { + r DEL x + r config set stream-node-max-entries 2 + r XADD x 1-0 f v + r XADD x 2-0 f v + r XADD x 3-0 f v + r XGROUP CREATE x grp 0 + assert_equal [r XREADGROUP GROUP grp Alice STREAMS x >] {{x {{1-0 {f v}} {2-0 {f v}} {3-0 {f v}}}}} + r XTRIM x MAXLEN 1 + assert_equal [r XAUTOCLAIM x grp Bob 0 0-0] {0-0 {{3-0 {f v}}} {1-0 2-0}} + assert_equal [r XPENDING x grp - + 10 Alice] {} + } + + test {XINFO FULL output} { + r del x + r XADD x 100 a 1 + r XADD x 101 b 1 + r XADD x 102 c 1 + r XADD x 103 e 1 + r XADD x 104 f 1 + r XGROUP CREATE x g1 0 + r XGROUP CREATE x g2 0 + r XREADGROUP GROUP g1 Alice COUNT 1 STREAMS x > + r XREADGROUP GROUP g1 Bob COUNT 1 STREAMS x > + r XREADGROUP GROUP g1 Bob NOACK COUNT 1 STREAMS x > + r XREADGROUP GROUP g2 Charlie COUNT 4 STREAMS x > + r XDEL x 103 + + set reply [r XINFO STREAM x FULL] + assert_equal [llength $reply] 18 + assert_equal [dict get $reply length] 4 + assert_equal [dict get $reply entries] "{100-0 {a 1}} {101-0 {b 1}} {102-0 {c 1}} {104-0 {f 1}}" + + # First consumer group + set group [lindex [dict get $reply groups] 0] + assert_equal [dict get $group name] "g1" + assert_equal [lindex [dict get $group pending] 0 0] "100-0" + set consumer [lindex [dict get $group consumers] 0] + assert_equal [dict get $consumer name] "Alice" + assert_equal [lindex [dict get $consumer pending] 0 0] "100-0" ;# first entry in first consumer's PEL + + # Second consumer group + set group [lindex [dict get $reply groups] 1] + assert_equal [dict get $group name] "g2" + set consumer [lindex [dict get $group consumers] 0] + assert_equal [dict get $consumer name] "Charlie" + assert_equal [lindex [dict get $consumer pending] 0 0] "100-0" ;# first entry in first consumer's PEL + assert_equal [lindex [dict get $consumer pending] 1 0] "101-0" ;# second entry in first consumer's PEL + + set reply [r XINFO STREAM x FULL COUNT 1] + assert_equal [llength $reply] 18 + assert_equal [dict get $reply length] 4 + assert_equal [dict get $reply entries] "{100-0 {a 1}}" + } + + test {Consumer seen-time and active-time} { + r DEL mystream + r XGROUP CREATE mystream mygroup $ MKSTREAM + r XREADGROUP GROUP mygroup Alice COUNT 1 STREAMS mystream > + after 100 + set reply [r xinfo consumers mystream mygroup] + set consumer_info [lindex $reply 0] + assert {[dict get $consumer_info idle] >= 100} ;# consumer idle (seen-time) + assert_equal [dict get $consumer_info inactive] "-1" ;# consumer inactive (active-time) + + r XADD mystream * f v + r XREADGROUP GROUP mygroup Alice COUNT 1 STREAMS mystream > + set reply [r xinfo consumers mystream mygroup] + set consumer_info [lindex $reply 0] + assert_equal [lindex $consumer_info 1] "Alice" ;# consumer name + assert {[dict get $consumer_info idle] < 80} ;# consumer idle (seen-time) + assert {[dict get $consumer_info inactive] < 80} ;# consumer inactive (active-time) + + after 100 + r XREADGROUP GROUP mygroup Alice COUNT 1 STREAMS mystream > + set reply [r xinfo consumers mystream mygroup] + set consumer_info [lindex $reply 0] + assert {[dict get $consumer_info idle] < 80} ;# consumer idle (seen-time) + assert {[dict get $consumer_info inactive] >= 100} ;# consumer inactive (active-time) + + + # Simulate loading from RDB + + set reply [r XINFO STREAM x FULL] + set group [lindex [dict get $reply groups] 0] + set consumer [lindex [dict get $group consumers] 0] + set prev_seen [dict get $consumer seen-time] + set prev_active [dict get $consumer active-time] + + set dump [r DUMP mystream] + r DEL mystream + r RESTORE mystream 0 $dump + + set reply [r XINFO STREAM x FULL] + set group [lindex [dict get $reply groups] 0] + set consumer [lindex [dict get $group consumers] 0] + assert_equal $prev_seen [dict get $consumer seen-time] + assert_equal $prev_active [dict get $consumer active-time] + } + + test {XGROUP CREATECONSUMER: create consumer if does not exist} { + r del mystream + r XGROUP CREATE mystream mygroup $ MKSTREAM + r XADD mystream * f v + + set reply [r xinfo groups mystream] + set group_info [lindex $reply 0] + set n_consumers [lindex $group_info 3] + assert_equal $n_consumers 0 ;# consumers number in cg + + # create consumer using XREADGROUP + r XREADGROUP GROUP mygroup Alice COUNT 1 STREAMS mystream > + + set reply [r xinfo groups mystream] + set group_info [lindex $reply 0] + set n_consumers [lindex $group_info 3] + assert_equal $n_consumers 1 ;# consumers number in cg + + set reply [r xinfo consumers mystream mygroup] + set consumer_info [lindex $reply 0] + assert_equal [lindex $consumer_info 1] "Alice" ;# consumer name + + # create group using XGROUP CREATECONSUMER when Alice already exists + set created [r XGROUP CREATECONSUMER mystream mygroup Alice] + assert_equal $created 0 + + # create group using XGROUP CREATECONSUMER when Bob does not exist + set created [r XGROUP CREATECONSUMER mystream mygroup Bob] + assert_equal $created 1 + + set reply [r xinfo groups mystream] + set group_info [lindex $reply 0] + set n_consumers [lindex $group_info 3] + assert_equal $n_consumers 2 ;# consumers number in cg + + set reply [r xinfo consumers mystream mygroup] + set consumer_info [lindex $reply 0] + assert_equal [lindex $consumer_info 1] "Alice" ;# consumer name + set consumer_info [lindex $reply 1] + assert_equal [lindex $consumer_info 1] "Bob" ;# consumer name + } + + test {XGROUP CREATECONSUMER: group must exist} { + r del mystream + r XADD mystream * f v + assert_error "*NOGROUP*" {r XGROUP CREATECONSUMER mystream mygroup consumer} + } + + start_server {tags {"stream needs:debug"} overrides {appendonly yes aof-use-rdb-preamble no appendfsync always}} { + test {XREADGROUP with NOACK creates consumer} { + r del mystream + r XGROUP CREATE mystream mygroup $ MKSTREAM + r XADD mystream * f1 v1 + r XREADGROUP GROUP mygroup Alice NOACK STREAMS mystream ">" + set rd [redis_deferring_client] + $rd XREADGROUP GROUP mygroup Bob BLOCK 0 NOACK STREAMS mystream ">" + wait_for_blocked_clients_count 1 + r XADD mystream * f2 v2 + set grpinfo [r xinfo groups mystream] + + r debug loadaof + assert_equal [r xinfo groups mystream] $grpinfo + set reply [r xinfo consumers mystream mygroup] + set consumer_info [lindex $reply 0] + assert_equal [lindex $consumer_info 1] "Alice" ;# consumer name + set consumer_info [lindex $reply 1] + assert_equal [lindex $consumer_info 1] "Bob" ;# consumer name + $rd close + } + + test {Consumer without PEL is present in AOF after AOFRW} { + r del mystream + r XGROUP CREATE mystream mygroup $ MKSTREAM + r XADD mystream * f v + r XREADGROUP GROUP mygroup Alice NOACK STREAMS mystream ">" + set rd [redis_deferring_client] + $rd XREADGROUP GROUP mygroup Bob BLOCK 0 NOACK STREAMS mystream ">" + wait_for_blocked_clients_count 1 + r XGROUP CREATECONSUMER mystream mygroup Charlie + set grpinfo [lindex [r xinfo groups mystream] 0] + + r bgrewriteaof + waitForBgrewriteaof r + r debug loadaof + + set curr_grpinfo [lindex [r xinfo groups mystream] 0] + assert {$curr_grpinfo == $grpinfo} + set n_consumers [lindex $grpinfo 3] + + # All consumers are created via XREADGROUP, regardless of whether they managed + # to read any entries ot not + assert_equal $n_consumers 3 + $rd close + } + } + + test {Consumer group read counter and lag in empty streams} { + r DEL x + r XGROUP CREATE x g1 0 MKSTREAM + + set reply [r XINFO STREAM x FULL] + set group [lindex [dict get $reply groups] 0] + assert_equal [dict get $reply max-deleted-entry-id] "0-0" + assert_equal [dict get $reply entries-added] 0 + assert_equal [dict get $group entries-read] {} + assert_equal [dict get $group lag] 0 + + r XADD x 1-0 data a + r XDEL x 1-0 + + set reply [r XINFO STREAM x FULL] + set group [lindex [dict get $reply groups] 0] + assert_equal [dict get $reply max-deleted-entry-id] "1-0" + assert_equal [dict get $reply entries-added] 1 + assert_equal [dict get $group entries-read] {} + assert_equal [dict get $group lag] 0 + } + + test {Consumer group read counter and lag sanity} { + r DEL x + r XADD x 1-0 data a + r XADD x 2-0 data b + r XADD x 3-0 data c + r XADD x 4-0 data d + r XADD x 5-0 data e + r XGROUP CREATE x g1 0 + + set reply [r XINFO STREAM x FULL] + set group [lindex [dict get $reply groups] 0] + assert_equal [dict get $group entries-read] {} + assert_equal [dict get $group lag] 5 + + r XREADGROUP GROUP g1 c11 COUNT 1 STREAMS x > + set reply [r XINFO STREAM x FULL] + set group [lindex [dict get $reply groups] 0] + assert_equal [dict get $group entries-read] 1 + assert_equal [dict get $group lag] 4 + + r XREADGROUP GROUP g1 c12 COUNT 10 STREAMS x > + set reply [r XINFO STREAM x FULL] + set group [lindex [dict get $reply groups] 0] + assert_equal [dict get $group entries-read] 5 + assert_equal [dict get $group lag] 0 + + r XADD x 6-0 data f + set reply [r XINFO STREAM x FULL] + set group [lindex [dict get $reply groups] 0] + assert_equal [dict get $group entries-read] 5 + assert_equal [dict get $group lag] 1 + } + + test {Consumer group lag with XDELs} { + r DEL x + r XADD x 1-0 data a + r XADD x 2-0 data b + r XADD x 3-0 data c + r XADD x 4-0 data d + r XADD x 5-0 data e + r XDEL x 3-0 + r XGROUP CREATE x g1 0 + r XGROUP CREATE x g2 0 + + set reply [r XINFO STREAM x FULL] + set group [lindex [dict get $reply groups] 0] + assert_equal [dict get $group entries-read] {} + assert_equal [dict get $group lag] {} + + r XREADGROUP GROUP g1 c11 COUNT 1 STREAMS x > + set reply [r XINFO STREAM x FULL] + set group [lindex [dict get $reply groups] 0] + assert_equal [dict get $group entries-read] {} + assert_equal [dict get $group lag] {} + + r XREADGROUP GROUP g1 c11 COUNT 1 STREAMS x > + set reply [r XINFO STREAM x FULL] + set group [lindex [dict get $reply groups] 0] + assert_equal [dict get $group entries-read] {} + assert_equal [dict get $group lag] {} + + r XREADGROUP GROUP g1 c11 COUNT 1 STREAMS x > + set reply [r XINFO STREAM x FULL] + set group [lindex [dict get $reply groups] 0] + assert_equal [dict get $group entries-read] {} + assert_equal [dict get $group lag] {} + + r XREADGROUP GROUP g1 c11 COUNT 1 STREAMS x > + set reply [r XINFO STREAM x FULL] + set group [lindex [dict get $reply groups] 0] + assert_equal [dict get $group entries-read] 5 + assert_equal [dict get $group lag] 0 + + r XADD x 6-0 data f + set reply [r XINFO STREAM x FULL] + set group [lindex [dict get $reply groups] 0] + assert_equal [dict get $group entries-read] 5 + assert_equal [dict get $group lag] 1 + + r XTRIM x MINID = 3-0 + set reply [r XINFO STREAM x FULL] + set group [lindex [dict get $reply groups] 0] + assert_equal [dict get $group entries-read] 5 + assert_equal [dict get $group lag] 1 + set group [lindex [dict get $reply groups] 1] + assert_equal [dict get $group entries-read] {} + assert_equal [dict get $group lag] 3 + + r XTRIM x MINID = 5-0 + set reply [r XINFO STREAM x FULL] + set group [lindex [dict get $reply groups] 0] + assert_equal [dict get $group entries-read] 5 + assert_equal [dict get $group lag] 1 + set group [lindex [dict get $reply groups] 1] + assert_equal [dict get $group entries-read] {} + assert_equal [dict get $group lag] 2 + } + + test {Loading from legacy (Redis <= v6.2.x, rdb_ver < 10) persistence} { + # The payload was DUMPed from a v5 instance after: + # XADD x 1-0 data a + # XADD x 2-0 data b + # XADD x 3-0 data c + # XADD x 4-0 data d + # XADD x 5-0 data e + # XADD x 6-0 data f + # XDEL x 3-0 + # XGROUP CREATE x g1 0 + # XGROUP CREATE x g2 0 + # XREADGROUP GROUP g1 c11 COUNT 4 STREAMS x > + # XTRIM x MAXLEN = 2 + + r DEL x + r RESTORE x 0 "\x0F\x01\x10\x00\x00\x00\x00\x00\x00\x00\x01\x00\x00\x00\x00\x00\x00\x00\x00\xC3\x40\x4A\x40\x57\x16\x57\x00\x00\x00\x23\x00\x02\x01\x04\x01\x01\x01\x84\x64\x61\x74\x61\x05\x00\x01\x03\x01\x00\x20\x01\x03\x81\x61\x02\x04\x20\x0A\x00\x01\x40\x0A\x00\x62\x60\x0A\x00\x02\x40\x0A\x00\x63\x60\x0A\x40\x22\x01\x81\x64\x20\x0A\x40\x39\x20\x0A\x00\x65\x60\x0A\x00\x05\x40\x0A\x00\x66\x20\x0A\x00\xFF\x02\x06\x00\x02\x02\x67\x31\x05\x00\x04\x00\x00\x00\x00\x00\x00\x00\x01\x00\x00\x00\x00\x00\x00\x00\x00\x3E\xF7\x83\x43\x7A\x01\x00\x00\x01\x00\x00\x00\x00\x00\x00\x00\x02\x00\x00\x00\x00\x00\x00\x00\x00\x3E\xF7\x83\x43\x7A\x01\x00\x00\x01\x00\x00\x00\x00\x00\x00\x00\x04\x00\x00\x00\x00\x00\x00\x00\x00\x3E\xF7\x83\x43\x7A\x01\x00\x00\x01\x00\x00\x00\x00\x00\x00\x00\x05\x00\x00\x00\x00\x00\x00\x00\x00\x3E\xF7\x83\x43\x7A\x01\x00\x00\x01\x01\x03\x63\x31\x31\x3E\xF7\x83\x43\x7A\x01\x00\x00\x04\x00\x00\x00\x00\x00\x00\x00\x01\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x02\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x04\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x05\x00\x00\x00\x00\x00\x00\x00\x00\x02\x67\x32\x00\x00\x00\x00\x09\x00\x3D\x52\xEF\x68\x67\x52\x1D\xFA" + + set reply [r XINFO STREAM x FULL] + assert_equal [dict get $reply max-deleted-entry-id] "0-0" + assert_equal [dict get $reply entries-added] 2 + set group [lindex [dict get $reply groups] 0] + assert_equal [dict get $group entries-read] 1 + assert_equal [dict get $group lag] 1 + set group [lindex [dict get $reply groups] 1] + assert_equal [dict get $group entries-read] 0 + assert_equal [dict get $group lag] 2 + } + + test {Loading from legacy (Redis <= v7.0.x, rdb_ver < 11) persistence} { + # The payload was DUMPed from a v7 instance after: + # XGROUP CREATE x g $ MKSTREAM + # XADD x 1-1 f v + # XREADGROUP GROUP g Alice STREAMS x > + + r DEL x + r RESTORE x 0 "\x13\x01\x10\x00\x00\x00\x00\x00\x00\x00\x01\x00\x00\x00\x00\x00\x00\x00\x01\x1D\x1D\x00\x00\x00\x0A\x00\x01\x01\x00\x01\x01\x01\x81\x66\x02\x00\x01\x02\x01\x00\x01\x00\x01\x81\x76\x02\x04\x01\xFF\x01\x01\x01\x01\x01\x00\x00\x01\x01\x01\x67\x01\x01\x01\x01\x00\x00\x00\x00\x00\x00\x00\x01\x00\x00\x00\x00\x00\x00\x00\x01\xF5\x5A\x71\xC7\x84\x01\x00\x00\x01\x01\x05\x41\x6C\x69\x63\x65\xF5\x5A\x71\xC7\x84\x01\x00\x00\x01\x00\x00\x00\x00\x00\x00\x00\x01\x00\x00\x00\x00\x00\x00\x00\x01\x0B\x00\xA7\xA9\x14\xA5\x27\xFF\x9B\x9B" + set reply [r XINFO STREAM x FULL] + set group [lindex [dict get $reply groups] 0] + set consumer [lindex [dict get $group consumers] 0] + assert_equal [dict get $consumer seen-time] [dict get $consumer active-time] + } + + start_server {tags {"external:skip"}} { + set master [srv -1 client] + set master_host [srv -1 host] + set master_port [srv -1 port] + set slave [srv 0 client] + + foreach noack {0 1} { + test "Consumer group last ID propagation to slave (NOACK=$noack)" { + $slave slaveof $master_host $master_port + wait_for_condition 50 100 { + [s 0 master_link_status] eq {up} + } else { + fail "Replication not started." + } + + $master del stream + $master xadd stream * a 1 + $master xadd stream * a 2 + $master xadd stream * a 3 + $master xgroup create stream mygroup 0 + + # Consume the first two items on the master + for {set j 0} {$j < 2} {incr j} { + if {$noack} { + set item [$master xreadgroup group mygroup \ + myconsumer COUNT 1 NOACK STREAMS stream >] + } else { + set item [$master xreadgroup group mygroup \ + myconsumer COUNT 1 STREAMS stream >] + } + set id [lindex $item 0 1 0 0] + if {$noack == 0} { + assert {[$master xack stream mygroup $id] eq "1"} + } + } + + wait_for_ofs_sync $master $slave + + # Turn slave into master + $slave slaveof no one + + set item [$slave xreadgroup group mygroup myconsumer \ + COUNT 1 STREAMS stream >] + + # The consumed entry should be the third + set myentry [lindex $item 0 1 0 1] + assert {$myentry eq {a 3}} + } + } + } + + start_server {tags {"external:skip"}} { + set master [srv -1 client] + set master_host [srv -1 host] + set master_port [srv -1 port] + set replica [srv 0 client] + + foreach autoclaim {0 1} { + test "Replication tests of XCLAIM with deleted entries (autclaim=$autoclaim)" { + $replica replicaof $master_host $master_port + wait_for_condition 50 100 { + [s 0 master_link_status] eq {up} + } else { + fail "Replication not started." + } + + $master DEL x + $master XADD x 1-0 f v + $master XADD x 2-0 f v + $master XADD x 3-0 f v + $master XADD x 4-0 f v + $master XADD x 5-0 f v + $master XGROUP CREATE x grp 0 + assert_equal [$master XREADGROUP GROUP grp Alice STREAMS x >] {{x {{1-0 {f v}} {2-0 {f v}} {3-0 {f v}} {4-0 {f v}} {5-0 {f v}}}}} + wait_for_ofs_sync $master $replica + assert_equal [llength [$replica XPENDING x grp - + 10 Alice]] 5 + $master XDEL x 2-0 + $master XDEL x 4-0 + if {$autoclaim} { + assert_equal [$master XAUTOCLAIM x grp Bob 0 0-0] {0-0 {{1-0 {f v}} {3-0 {f v}} {5-0 {f v}}} {2-0 4-0}} + wait_for_ofs_sync $master $replica + assert_equal [llength [$replica XPENDING x grp - + 10 Alice]] 0 + } else { + assert_equal [$master XCLAIM x grp Bob 0 1-0 2-0 3-0 4-0] {{1-0 {f v}} {3-0 {f v}}} + wait_for_ofs_sync $master $replica + assert_equal [llength [$replica XPENDING x grp - + 10 Alice]] 1 + } + } + } + } + + start_server {tags {"stream needs:debug"} overrides {appendonly yes aof-use-rdb-preamble no}} { + test {Empty stream with no lastid can be rewrite into AOF correctly} { + r XGROUP CREATE mystream group-name $ MKSTREAM + assert {[dict get [r xinfo stream mystream] length] == 0} + set grpinfo [r xinfo groups mystream] + r bgrewriteaof + waitForBgrewriteaof r + r debug loadaof + assert {[dict get [r xinfo stream mystream] length] == 0} + assert_equal [r xinfo groups mystream] $grpinfo + } + } +} diff --git a/tests/unit/type/stream.tcl b/tests/unit/type/stream.tcl new file mode 100644 index 0000000..3081c40 --- /dev/null +++ b/tests/unit/type/stream.tcl @@ -0,0 +1,940 @@ +# return value is like strcmp() and similar. +proc streamCompareID {a b} { + if {$a eq $b} {return 0} + lassign [split $a -] a_ms a_seq + lassign [split $b -] b_ms b_seq + if {$a_ms > $b_ms} {return 1} + if {$a_ms < $b_ms} {return -1} + # Same ms case, compare seq. + if {$a_seq > $b_seq} {return 1} + if {$a_seq < $b_seq} {return -1} +} + +# return the ID immediately greater than the specified one. +# Note that this function does not care to handle 'seq' overflow +# since it's a 64 bit value. +proc streamNextID {id} { + lassign [split $id -] ms seq + incr seq + join [list $ms $seq] - +} + +# Generate a random stream entry ID with the ms part between min and max +# and a low sequence number (0 - 999 range), in order to stress test +# XRANGE against a Tcl implementation implementing the same concept +# with Tcl-only code in a linear array. +proc streamRandomID {min_id max_id} { + lassign [split $min_id -] min_ms min_seq + lassign [split $max_id -] max_ms max_seq + set delta [expr {$max_ms-$min_ms+1}] + set ms [expr {$min_ms+[randomInt $delta]}] + set seq [randomInt 1000] + return $ms-$seq +} + +# Tcl-side implementation of XRANGE to perform fuzz testing in the Redis +# XRANGE implementation. +proc streamSimulateXRANGE {items start end} { + set res {} + foreach i $items { + set this_id [lindex $i 0] + if {[streamCompareID $this_id $start] >= 0} { + if {[streamCompareID $this_id $end] <= 0} { + lappend res $i + } + } + } + return $res +} + +set content {} ;# Will be populated with Tcl side copy of the stream content. + +start_server { + tags {"stream"} +} { + test "XADD wrong number of args" { + assert_error {*wrong number of arguments for 'xadd' command} {r XADD mystream} + assert_error {*wrong number of arguments for 'xadd' command} {r XADD mystream *} + assert_error {*wrong number of arguments for 'xadd' command} {r XADD mystream * field} + } + + test {XADD can add entries into a stream that XRANGE can fetch} { + r XADD mystream * item 1 value a + r XADD mystream * item 2 value b + assert_equal 2 [r XLEN mystream] + set items [r XRANGE mystream - +] + assert_equal [lindex $items 0 1] {item 1 value a} + assert_equal [lindex $items 1 1] {item 2 value b} + } + + test {XADD IDs are incremental} { + set id1 [r XADD mystream * item 1 value a] + set id2 [r XADD mystream * item 2 value b] + set id3 [r XADD mystream * item 3 value c] + assert {[streamCompareID $id1 $id2] == -1} + assert {[streamCompareID $id2 $id3] == -1} + } + + test {XADD IDs are incremental when ms is the same as well} { + r multi + r XADD mystream * item 1 value a + r XADD mystream * item 2 value b + r XADD mystream * item 3 value c + lassign [r exec] id1 id2 id3 + assert {[streamCompareID $id1 $id2] == -1} + assert {[streamCompareID $id2 $id3] == -1} + } + + test {XADD IDs correctly report an error when overflowing} { + r DEL mystream + r xadd mystream 18446744073709551615-18446744073709551615 a b + assert_error ERR* {r xadd mystream * c d} + } + + test {XADD auto-generated sequence is incremented for last ID} { + r DEL mystream + set id1 [r XADD mystream 123-456 item 1 value a] + set id2 [r XADD mystream 123-* item 2 value b] + lassign [split $id2 -] _ seq + assert {$seq == 457} + assert {[streamCompareID $id1 $id2] == -1} + } + + test {XADD auto-generated sequence is zero for future timestamp ID} { + r DEL mystream + set id1 [r XADD mystream 123-456 item 1 value a] + set id2 [r XADD mystream 789-* item 2 value b] + lassign [split $id2 -] _ seq + assert {$seq == 0} + assert {[streamCompareID $id1 $id2] == -1} + } + + test {XADD auto-generated sequence can't be smaller than last ID} { + r DEL mystream + r XADD mystream 123-456 item 1 value a + assert_error ERR* {r XADD mystream 42-* item 2 value b} + } + + test {XADD auto-generated sequence can't overflow} { + r DEL mystream + r xadd mystream 1-18446744073709551615 a b + assert_error ERR* {r xadd mystream 1-* c d} + } + + test {XADD 0-* should succeed} { + r DEL mystream + set id [r xadd mystream 0-* a b] + lassign [split $id -] _ seq + assert {$seq == 1} + } + + test {XADD with MAXLEN option} { + r DEL mystream + for {set j 0} {$j < 1000} {incr j} { + if {rand() < 0.9} { + r XADD mystream MAXLEN 5 * xitem $j + } else { + r XADD mystream MAXLEN 5 * yitem $j + } + } + assert {[r xlen mystream] == 5} + set res [r xrange mystream - +] + set expected 995 + foreach r $res { + assert {[lindex $r 1 1] == $expected} + incr expected + } + } + + test {XADD with MAXLEN option and the '=' argument} { + r DEL mystream + for {set j 0} {$j < 1000} {incr j} { + if {rand() < 0.9} { + r XADD mystream MAXLEN = 5 * xitem $j + } else { + r XADD mystream MAXLEN = 5 * yitem $j + } + } + assert {[r XLEN mystream] == 5} + } + + test {XADD with MAXLEN option and the '~' argument} { + r DEL mystream + r config set stream-node-max-entries 100 + for {set j 0} {$j < 1000} {incr j} { + if {rand() < 0.9} { + r XADD mystream MAXLEN ~ 555 * xitem $j + } else { + r XADD mystream MAXLEN ~ 555 * yitem $j + } + } + assert {[r XLEN mystream] == 600} + } + + test {XADD with NOMKSTREAM option} { + r DEL mystream + assert_equal "" [r XADD mystream NOMKSTREAM * item 1 value a] + assert_equal 0 [r EXISTS mystream] + r XADD mystream * item 1 value a + r XADD mystream NOMKSTREAM * item 2 value b + assert_equal 2 [r XLEN mystream] + set items [r XRANGE mystream - +] + assert_equal [lindex $items 0 1] {item 1 value a} + assert_equal [lindex $items 1 1] {item 2 value b} + } + + test {XADD with MINID option} { + r DEL mystream + for {set j 1} {$j < 1001} {incr j} { + set minid 1000 + if {$j >= 5} { + set minid [expr {$j-5}] + } + if {rand() < 0.9} { + r XADD mystream MINID $minid $j xitem $j + } else { + r XADD mystream MINID $minid $j yitem $j + } + } + assert {[r xlen mystream] == 6} + set res [r xrange mystream - +] + set expected 995 + foreach r $res { + assert {[lindex $r 1 1] == $expected} + incr expected + } + } + + test {XTRIM with MINID option} { + r DEL mystream + r XADD mystream 1-0 f v + r XADD mystream 2-0 f v + r XADD mystream 3-0 f v + r XADD mystream 4-0 f v + r XADD mystream 5-0 f v + r XTRIM mystream MINID = 3-0 + assert_equal [r XRANGE mystream - +] {{3-0 {f v}} {4-0 {f v}} {5-0 {f v}}} + } + + test {XTRIM with MINID option, big delta from master record} { + r DEL mystream + r XADD mystream 1-0 f v + r XADD mystream 1641544570597-0 f v + r XADD mystream 1641544570597-1 f v + r XTRIM mystream MINID 1641544570597-0 + assert_equal [r XRANGE mystream - +] {{1641544570597-0 {f v}} {1641544570597-1 {f v}}} + } + + proc insert_into_stream_key {key {count 10000}} { + r multi + for {set j 0} {$j < $count} {incr j} { + # From time to time insert a field with a different set + # of fields in order to stress the stream compression code. + if {rand() < 0.9} { + r XADD $key * item $j + } else { + r XADD $key * item $j otherfield foo + } + } + r exec + } + + test {XADD mass insertion and XLEN} { + r DEL mystream + insert_into_stream_key mystream + + set items [r XRANGE mystream - +] + for {set j 0} {$j < 10000} {incr j} { + assert {[lrange [lindex $items $j 1] 0 1] eq [list item $j]} + } + assert {[r xlen mystream] == $j} + } + + test {XADD with ID 0-0} { + r DEL otherstream + catch {r XADD otherstream 0-0 k v} err + assert {[r EXISTS otherstream] == 0} + } + + test {XADD with LIMIT delete entries no more than limit} { + r del yourstream + for {set j 0} {$j < 3} {incr j} { + r XADD yourstream * xitem v + } + r XADD yourstream MAXLEN ~ 0 limit 1 * xitem v + assert {[r XLEN yourstream] == 4} + } + + test {XRANGE COUNT works as expected} { + assert {[llength [r xrange mystream - + COUNT 10]] == 10} + } + + test {XREVRANGE COUNT works as expected} { + assert {[llength [r xrevrange mystream + - COUNT 10]] == 10} + } + + test {XRANGE can be used to iterate the whole stream} { + set last_id "-" + set j 0 + while 1 { + set elements [r xrange mystream $last_id + COUNT 100] + if {[llength $elements] == 0} break + foreach e $elements { + assert {[lrange [lindex $e 1] 0 1] eq [list item $j]} + incr j; + } + set last_id [streamNextID [lindex $elements end 0]] + } + assert {$j == 10000} + } + + test {XREVRANGE returns the reverse of XRANGE} { + assert {[r xrange mystream - +] == [lreverse [r xrevrange mystream + -]]} + } + + test {XRANGE exclusive ranges} { + set ids {0-1 0-18446744073709551615 1-0 42-0 42-42 + 18446744073709551615-18446744073709551614 + 18446744073709551615-18446744073709551615} + set total [llength $ids] + r multi + r DEL vipstream + foreach id $ids { + r XADD vipstream $id foo bar + } + r exec + assert {[llength [r xrange vipstream - +]] == $total} + assert {[llength [r xrange vipstream ([lindex $ids 0] +]] == $total-1} + assert {[llength [r xrange vipstream - ([lindex $ids $total-1]]] == $total-1} + assert {[llength [r xrange vipstream (0-1 (1-0]] == 1} + assert {[llength [r xrange vipstream (1-0 (42-42]] == 1} + catch {r xrange vipstream (- +} e + assert_match {ERR*} $e + catch {r xrange vipstream - (+} e + assert_match {ERR*} $e + catch {r xrange vipstream (18446744073709551615-18446744073709551615 +} e + assert_match {ERR*} $e + catch {r xrange vipstream - (0-0} e + assert_match {ERR*} $e + } + + test {XREAD with non empty stream} { + set res [r XREAD COUNT 1 STREAMS mystream 0-0] + assert {[lrange [lindex $res 0 1 0 1] 0 1] eq {item 0}} + } + + test {Non blocking XREAD with empty streams} { + set res [r XREAD STREAMS s1{t} s2{t} 0-0 0-0] + assert {$res eq {}} + } + + test {XREAD with non empty second stream} { + insert_into_stream_key mystream{t} + set res [r XREAD COUNT 1 STREAMS nostream{t} mystream{t} 0-0 0-0] + assert {[lindex $res 0 0] eq {mystream{t}}} + assert {[lrange [lindex $res 0 1 0 1] 0 1] eq {item 0}} + } + + test {Blocking XREAD waiting new data} { + r XADD s2{t} * old abcd1234 + set rd [redis_deferring_client] + $rd XREAD BLOCK 20000 STREAMS s1{t} s2{t} s3{t} $ $ $ + wait_for_blocked_client + r XADD s2{t} * new abcd1234 + set res [$rd read] + assert {[lindex $res 0 0] eq {s2{t}}} + assert {[lindex $res 0 1 0 1] eq {new abcd1234}} + $rd close + } + + test {Blocking XREAD waiting old data} { + set rd [redis_deferring_client] + $rd XREAD BLOCK 20000 STREAMS s1{t} s2{t} s3{t} $ 0-0 $ + r XADD s2{t} * foo abcd1234 + set res [$rd read] + assert {[lindex $res 0 0] eq {s2{t}}} + assert {[lindex $res 0 1 0 1] eq {old abcd1234}} + $rd close + } + + test {Blocking XREAD will not reply with an empty array} { + r del s1 + r XADD s1 666 f v + r XADD s1 667 f2 v2 + r XDEL s1 667 + set rd [redis_deferring_client] + $rd XREAD BLOCK 10 STREAMS s1 666 + after 20 + assert {[$rd read] == {}} ;# before the fix, client didn't even block, but was served synchronously with {s1 {}} + $rd close + } + + test "Blocking XREAD for stream that ran dry (issue #5299)" { + set rd [redis_deferring_client] + + # Add a entry then delete it, now stream's last_id is 666. + r DEL mystream + r XADD mystream 666 key value + r XDEL mystream 666 + + # Pass a ID smaller than stream's last_id, released on timeout. + $rd XREAD BLOCK 10 STREAMS mystream 665 + assert_equal [$rd read] {} + + # Throw an error if the ID equal or smaller than the last_id. + assert_error ERR*equal*smaller* {r XADD mystream 665 key value} + assert_error ERR*equal*smaller* {r XADD mystream 666 key value} + + # Entered blocking state and then release because of the new entry. + $rd XREAD BLOCK 0 STREAMS mystream 665 + wait_for_blocked_clients_count 1 + r XADD mystream 667 key value + assert_equal [$rd read] {{mystream {{667-0 {key value}}}}} + + $rd close + } + + test "XREAD: XADD + DEL should not awake client" { + set rd [redis_deferring_client] + r del s1 + $rd XREAD BLOCK 20000 STREAMS s1 $ + wait_for_blocked_clients_count 1 + r multi + r XADD s1 * old abcd1234 + r DEL s1 + r exec + r XADD s1 * new abcd1234 + set res [$rd read] + assert {[lindex $res 0 0] eq {s1}} + assert {[lindex $res 0 1 0 1] eq {new abcd1234}} + $rd close + } + + test "XREAD: XADD + DEL + LPUSH should not awake client" { + set rd [redis_deferring_client] + r del s1 + $rd XREAD BLOCK 20000 STREAMS s1 $ + wait_for_blocked_clients_count 1 + r multi + r XADD s1 * old abcd1234 + r DEL s1 + r LPUSH s1 foo bar + r exec + r DEL s1 + r XADD s1 * new abcd1234 + set res [$rd read] + assert {[lindex $res 0 0] eq {s1}} + assert {[lindex $res 0 1 0 1] eq {new abcd1234}} + $rd close + } + + test {XREAD with same stream name multiple times should work} { + r XADD s2 * old abcd1234 + set rd [redis_deferring_client] + $rd XREAD BLOCK 20000 STREAMS s2 s2 s2 $ $ $ + wait_for_blocked_clients_count 1 + r XADD s2 * new abcd1234 + set res [$rd read] + assert {[lindex $res 0 0] eq {s2}} + assert {[lindex $res 0 1 0 1] eq {new abcd1234}} + $rd close + } + + test {XREAD + multiple XADD inside transaction} { + r XADD s2 * old abcd1234 + set rd [redis_deferring_client] + $rd XREAD BLOCK 20000 STREAMS s2 s2 s2 $ $ $ + wait_for_blocked_clients_count 1 + r MULTI + r XADD s2 * field one + r XADD s2 * field two + r XADD s2 * field three + r EXEC + set res [$rd read] + assert {[lindex $res 0 0] eq {s2}} + assert {[lindex $res 0 1 0 1] eq {field one}} + assert {[lindex $res 0 1 1 1] eq {field two}} + $rd close + } + + test {XDEL basic test} { + r del somestream + r xadd somestream * foo value0 + set id [r xadd somestream * foo value1] + r xadd somestream * foo value2 + r xdel somestream $id + assert {[r xlen somestream] == 2} + set result [r xrange somestream - +] + assert {[lindex $result 0 1 1] eq {value0}} + assert {[lindex $result 1 1 1] eq {value2}} + } + + test {XDEL multiply id test} { + r del somestream + r xadd somestream 1-1 a 1 + r xadd somestream 1-2 b 2 + r xadd somestream 1-3 c 3 + r xadd somestream 1-4 d 4 + r xadd somestream 1-5 e 5 + assert {[r xlen somestream] == 5} + assert {[r xdel somestream 1-1 1-4 1-5 2-1] == 3} + assert {[r xlen somestream] == 2} + set result [r xrange somestream - +] + assert {[dict get [lindex $result 0 1] b] eq {2}} + assert {[dict get [lindex $result 1 1] c] eq {3}} + } + # Here the idea is to check the consistency of the stream data structure + # as we remove all the elements down to zero elements. + test {XDEL fuzz test} { + r del somestream + set ids {} + set x 0; # Length of the stream + while 1 { + lappend ids [r xadd somestream * item $x] + incr x + # Add enough elements to have a few radix tree nodes inside the stream. + if {[dict get [r xinfo stream somestream] radix-tree-keys] > 20} break + } + + # Now remove all the elements till we reach an empty stream + # and after every deletion, check that the stream is sane enough + # to report the right number of elements with XRANGE: this will also + # force accessing the whole data structure to check sanity. + assert {[r xlen somestream] == $x} + + # We want to remove elements in random order to really test the + # implementation in a better way. + set ids [lshuffle $ids] + foreach id $ids { + assert {[r xdel somestream $id] == 1} + incr x -1 + assert {[r xlen somestream] == $x} + # The test would be too slow calling XRANGE for every iteration. + # Do it every 100 removal. + if {$x % 100 == 0} { + set res [r xrange somestream - +] + assert {[llength $res] == $x} + } + } + } + + test {XRANGE fuzzing} { + set items [r XRANGE mystream{t} - +] + set low_id [lindex $items 0 0] + set high_id [lindex $items end 0] + for {set j 0} {$j < 100} {incr j} { + set start [streamRandomID $low_id $high_id] + set end [streamRandomID $low_id $high_id] + set range [r xrange mystream{t} $start $end] + set tcl_range [streamSimulateXRANGE $items $start $end] + if {$range ne $tcl_range} { + puts "*** WARNING *** - XRANGE fuzzing mismatch: $start - $end" + puts "---" + puts "XRANGE: '$range'" + puts "---" + puts "TCL: '$tcl_range'" + puts "---" + fail "XRANGE fuzzing failed, check logs for details" + } + } + } + + test {XREVRANGE regression test for issue #5006} { + # Add non compressed entries + r xadd teststream 1234567891230 key1 value1 + r xadd teststream 1234567891240 key2 value2 + r xadd teststream 1234567891250 key3 value3 + + # Add SAMEFIELD compressed entries + r xadd teststream2 1234567891230 key1 value1 + r xadd teststream2 1234567891240 key1 value2 + r xadd teststream2 1234567891250 key1 value3 + + assert_equal [r xrevrange teststream 1234567891245 -] {{1234567891240-0 {key2 value2}} {1234567891230-0 {key1 value1}}} + + assert_equal [r xrevrange teststream2 1234567891245 -] {{1234567891240-0 {key1 value2}} {1234567891230-0 {key1 value1}}} + } + + test {XREAD streamID edge (no-blocking)} { + r del x + r XADD x 1-1 f v + r XADD x 1-18446744073709551615 f v + r XADD x 2-1 f v + set res [r XREAD BLOCK 0 STREAMS x 1-18446744073709551615] + assert {[lindex $res 0 1 0] == {2-1 {f v}}} + } + + test {XREAD streamID edge (blocking)} { + r del x + set rd [redis_deferring_client] + $rd XREAD BLOCK 0 STREAMS x 1-18446744073709551615 + wait_for_blocked_clients_count 1 + r XADD x 1-1 f v + r XADD x 1-18446744073709551615 f v + r XADD x 2-1 f v + set res [$rd read] + assert {[lindex $res 0 1 0] == {2-1 {f v}}} + $rd close + } + + test {XADD streamID edge} { + r del x + r XADD x 2577343934890-18446744073709551615 f v ;# we need the timestamp to be in the future + r XADD x * f2 v2 + assert_equal [r XRANGE x - +] {{2577343934890-18446744073709551615 {f v}} {2577343934891-0 {f2 v2}}} + } + + test {XTRIM with MAXLEN option basic test} { + r DEL mystream + for {set j 0} {$j < 1000} {incr j} { + if {rand() < 0.9} { + r XADD mystream * xitem $j + } else { + r XADD mystream * yitem $j + } + } + r XTRIM mystream MAXLEN 666 + assert {[r XLEN mystream] == 666} + r XTRIM mystream MAXLEN = 555 + assert {[r XLEN mystream] == 555} + r XTRIM mystream MAXLEN ~ 444 + assert {[r XLEN mystream] == 500} + r XTRIM mystream MAXLEN ~ 400 + assert {[r XLEN mystream] == 400} + } + + test {XADD with LIMIT consecutive calls} { + r del mystream + r config set stream-node-max-entries 10 + for {set j 0} {$j < 100} {incr j} { + r XADD mystream * xitem v + } + r XADD mystream MAXLEN ~ 55 LIMIT 30 * xitem v + assert {[r xlen mystream] == 71} + r XADD mystream MAXLEN ~ 55 LIMIT 30 * xitem v + assert {[r xlen mystream] == 62} + r config set stream-node-max-entries 100 + } + + test {XTRIM with ~ is limited} { + r del mystream + r config set stream-node-max-entries 1 + for {set j 0} {$j < 102} {incr j} { + r XADD mystream * xitem v + } + r XTRIM mystream MAXLEN ~ 1 + assert {[r xlen mystream] == 2} + r config set stream-node-max-entries 100 + } + + test {XTRIM without ~ is not limited} { + r del mystream + r config set stream-node-max-entries 1 + for {set j 0} {$j < 102} {incr j} { + r XADD mystream * xitem v + } + r XTRIM mystream MAXLEN 1 + assert {[r xlen mystream] == 1} + r config set stream-node-max-entries 100 + } + + test {XTRIM without ~ and with LIMIT} { + r del mystream + r config set stream-node-max-entries 1 + for {set j 0} {$j < 102} {incr j} { + r XADD mystream * xitem v + } + assert_error ERR* {r XTRIM mystream MAXLEN 1 LIMIT 30} + } + + test {XTRIM with LIMIT delete entries no more than limit} { + r del mystream + r config set stream-node-max-entries 2 + for {set j 0} {$j < 3} {incr j} { + r XADD mystream * xitem v + } + assert {[r XTRIM mystream MAXLEN ~ 0 LIMIT 1] == 0} + assert {[r XTRIM mystream MAXLEN ~ 0 LIMIT 2] == 2} + } +} + +start_server {tags {"stream needs:debug"} overrides {appendonly yes}} { + test {XADD with MAXLEN > xlen can propagate correctly} { + for {set j 0} {$j < 100} {incr j} { + r XADD mystream * xitem v + } + r XADD mystream MAXLEN 200 * xitem v + incr j + assert {[r xlen mystream] == $j} + r debug loadaof + r XADD mystream * xitem v + incr j + assert {[r xlen mystream] == $j} + } +} + +start_server {tags {"stream needs:debug"} overrides {appendonly yes}} { + test {XADD with MINID > lastid can propagate correctly} { + for {set j 0} {$j < 100} {incr j} { + set id [expr {$j+1}] + r XADD mystream $id xitem v + } + r XADD mystream MINID 1 * xitem v + incr j + assert {[r xlen mystream] == $j} + r debug loadaof + r XADD mystream * xitem v + incr j + assert {[r xlen mystream] == $j} + } +} + +start_server {tags {"stream needs:debug"} overrides {appendonly yes stream-node-max-entries 100}} { + test {XADD with ~ MAXLEN can propagate correctly} { + for {set j 0} {$j < 100} {incr j} { + r XADD mystream * xitem v + } + r XADD mystream MAXLEN ~ $j * xitem v + incr j + assert {[r xlen mystream] == $j} + r config set stream-node-max-entries 1 + r debug loadaof + r XADD mystream * xitem v + incr j + assert {[r xlen mystream] == $j} + } +} + +start_server {tags {"stream needs:debug"} overrides {appendonly yes stream-node-max-entries 10}} { + test {XADD with ~ MAXLEN and LIMIT can propagate correctly} { + for {set j 0} {$j < 100} {incr j} { + r XADD mystream * xitem v + } + r XADD mystream MAXLEN ~ 55 LIMIT 30 * xitem v + assert {[r xlen mystream] == 71} + r config set stream-node-max-entries 1 + r debug loadaof + r XADD mystream * xitem v + assert {[r xlen mystream] == 72} + } +} + +start_server {tags {"stream needs:debug"} overrides {appendonly yes stream-node-max-entries 100}} { + test {XADD with ~ MINID can propagate correctly} { + for {set j 0} {$j < 100} {incr j} { + set id [expr {$j+1}] + r XADD mystream $id xitem v + } + r XADD mystream MINID ~ $j * xitem v + incr j + assert {[r xlen mystream] == $j} + r config set stream-node-max-entries 1 + r debug loadaof + r XADD mystream * xitem v + incr j + assert {[r xlen mystream] == $j} + } +} + +start_server {tags {"stream needs:debug"} overrides {appendonly yes stream-node-max-entries 10}} { + test {XADD with ~ MINID and LIMIT can propagate correctly} { + for {set j 0} {$j < 100} {incr j} { + set id [expr {$j+1}] + r XADD mystream $id xitem v + } + r XADD mystream MINID ~ 55 LIMIT 30 * xitem v + assert {[r xlen mystream] == 71} + r config set stream-node-max-entries 1 + r debug loadaof + r XADD mystream * xitem v + assert {[r xlen mystream] == 72} + } +} + +start_server {tags {"stream needs:debug"} overrides {appendonly yes stream-node-max-entries 10}} { + test {XTRIM with ~ MAXLEN can propagate correctly} { + for {set j 0} {$j < 100} {incr j} { + r XADD mystream * xitem v + } + r XTRIM mystream MAXLEN ~ 85 + assert {[r xlen mystream] == 90} + r config set stream-node-max-entries 1 + r debug loadaof + r XADD mystream * xitem v + incr j + assert {[r xlen mystream] == 91} + } +} + +start_server {tags {"stream"}} { + test {XADD can CREATE an empty stream} { + r XADD mystream MAXLEN 0 * a b + assert {[dict get [r xinfo stream mystream] length] == 0} + } + + test {XSETID can set a specific ID} { + r XSETID mystream "200-0" + set reply [r XINFO stream mystream] + assert_equal [dict get $reply last-generated-id] "200-0" + assert_equal [dict get $reply entries-added] 1 + } + + test {XSETID cannot SETID with smaller ID} { + r XADD mystream * a b + catch {r XSETID mystream "1-1"} err + r XADD mystream MAXLEN 0 * a b + set err + } {ERR *smaller*} + + test {XSETID cannot SETID on non-existent key} { + catch {r XSETID stream 1-1} err + set _ $err + } {ERR no such key} + + test {XSETID cannot run with an offset but without a maximal tombstone} { + catch {r XSETID stream 1-1 0} err + set _ $err + } {ERR syntax error} + + test {XSETID cannot run with a maximal tombstone but without an offset} { + catch {r XSETID stream 1-1 0-0} err + set _ $err + } {ERR syntax error} + + test {XSETID errors on negstive offset} { + catch {r XSETID stream 1-1 ENTRIESADDED -1 MAXDELETEDID 0-0} err + set _ $err + } {ERR *must be positive} + + test {XSETID cannot set the maximal tombstone with larger ID} { + r DEL x + r XADD x 1-0 a b + + catch {r XSETID x "1-0" ENTRIESADDED 1 MAXDELETEDID "2-0" } err + r XADD mystream MAXLEN 0 * a b + set err + } {ERR *smaller*} + + test {XSETID cannot set the offset to less than the length} { + r DEL x + r XADD x 1-0 a b + + catch {r XSETID x "1-0" ENTRIESADDED 0 MAXDELETEDID "0-0" } err + r XADD mystream MAXLEN 0 * a b + set err + } {ERR *smaller*} + + test {XSETID cannot set smaller ID than current MAXDELETEDID} { + r DEL x + r XADD x 1-1 a 1 + r XADD x 1-2 b 2 + r XADD x 1-3 c 3 + r XDEL x 1-2 + r XDEL x 1-3 + set reply [r XINFO stream x] + assert_equal [dict get $reply max-deleted-entry-id] "1-3" + catch {r XSETID x "1-2" } err + set err + } {ERR *smaller*} +} + +start_server {tags {"stream"}} { + test {XADD advances the entries-added counter and sets the recorded-first-entry-id} { + r DEL x + r XADD x 1-0 data a + + set reply [r XINFO STREAM x FULL] + assert_equal [dict get $reply entries-added] 1 + assert_equal [dict get $reply recorded-first-entry-id] "1-0" + + r XADD x 2-0 data a + set reply [r XINFO STREAM x FULL] + assert_equal [dict get $reply entries-added] 2 + assert_equal [dict get $reply recorded-first-entry-id] "1-0" + } + + test {XDEL/TRIM are reflected by recorded first entry} { + r DEL x + r XADD x 1-0 data a + r XADD x 2-0 data a + r XADD x 3-0 data a + r XADD x 4-0 data a + r XADD x 5-0 data a + + set reply [r XINFO STREAM x FULL] + assert_equal [dict get $reply entries-added] 5 + assert_equal [dict get $reply recorded-first-entry-id] "1-0" + + r XDEL x 2-0 + set reply [r XINFO STREAM x FULL] + assert_equal [dict get $reply recorded-first-entry-id] "1-0" + + r XDEL x 1-0 + set reply [r XINFO STREAM x FULL] + assert_equal [dict get $reply recorded-first-entry-id] "3-0" + + r XTRIM x MAXLEN = 2 + set reply [r XINFO STREAM x FULL] + assert_equal [dict get $reply recorded-first-entry-id] "4-0" + } + + test {Maximum XDEL ID behaves correctly} { + r DEL x + r XADD x 1-0 data a + r XADD x 2-0 data b + r XADD x 3-0 data c + + set reply [r XINFO STREAM x FULL] + assert_equal [dict get $reply max-deleted-entry-id] "0-0" + + r XDEL x 2-0 + set reply [r XINFO STREAM x FULL] + assert_equal [dict get $reply max-deleted-entry-id] "2-0" + + r XDEL x 1-0 + set reply [r XINFO STREAM x FULL] + assert_equal [dict get $reply max-deleted-entry-id] "2-0" + } + + test {XADD with artial ID with maximal seq} { + r DEL x + r XADD x 1-18446744073709551615 f1 v1 + assert_error {*The ID specified in XADD is equal or smaller*} {r XADD x 1-* f2 v2} + } +} + +start_server {tags {"stream needs:debug"} overrides {appendonly yes aof-use-rdb-preamble no}} { + test {Empty stream can be rewrite into AOF correctly} { + r XADD mystream MAXLEN 0 * a b + assert {[dict get [r xinfo stream mystream] length] == 0} + r bgrewriteaof + waitForBgrewriteaof r + r debug loadaof + assert {[dict get [r xinfo stream mystream] length] == 0} + } + + test {Stream can be rewrite into AOF correctly after XDEL lastid} { + r XSETID mystream 0-0 + r XADD mystream 1-1 a b + r XADD mystream 2-2 a b + assert {[dict get [r xinfo stream mystream] length] == 2} + r XDEL mystream 2-2 + r bgrewriteaof + waitForBgrewriteaof r + r debug loadaof + assert {[dict get [r xinfo stream mystream] length] == 1} + assert_equal [dict get [r xinfo stream mystream] last-generated-id] "2-2" + } +} + +start_server {tags {"stream"}} { + test {XGROUP HELP should not have unexpected options} { + catch {r XGROUP help xxx} e + assert_match "*wrong number of arguments for 'xgroup|help' command" $e + } + + test {XINFO HELP should not have unexpected options} { + catch {r XINFO help xxx} e + assert_match "*wrong number of arguments for 'xinfo|help' command" $e + } +} diff --git a/tests/unit/type/string.tcl b/tests/unit/type/string.tcl new file mode 100644 index 0000000..94702ec --- /dev/null +++ b/tests/unit/type/string.tcl @@ -0,0 +1,674 @@ +start_server {tags {"string"}} { + test {SET and GET an item} { + r set x foobar + r get x + } {foobar} + + test {SET and GET an empty item} { + r set x {} + r get x + } {} + + test {Very big payload in GET/SET} { + set buf [string repeat "abcd" 1000000] + r set foo $buf + r get foo + } [string repeat "abcd" 1000000] + + tags {"slow"} { + test {Very big payload random access} { + set err {} + array set payload {} + for {set j 0} {$j < 100} {incr j} { + set size [expr 1+[randomInt 100000]] + set buf [string repeat "pl-$j" $size] + set payload($j) $buf + r set bigpayload_$j $buf + } + for {set j 0} {$j < 1000} {incr j} { + set index [randomInt 100] + set buf [r get bigpayload_$index] + if {$buf != $payload($index)} { + set err "Values differ: I set '$payload($index)' but I read back '$buf'" + break + } + } + unset payload + set _ $err + } {} + + test {SET 10000 numeric keys and access all them in reverse order} { + r flushdb + set err {} + for {set x 0} {$x < 10000} {incr x} { + r set $x $x + } + set sum 0 + for {set x 9999} {$x >= 0} {incr x -1} { + set val [r get $x] + if {$val ne $x} { + set err "Element at position $x is $val instead of $x" + break + } + } + set _ $err + } {} + + test {DBSIZE should be 10000 now} { + r dbsize + } {10000} + } + + test "SETNX target key missing" { + r del novar + assert_equal 1 [r setnx novar foobared] + assert_equal "foobared" [r get novar] + } + + test "SETNX target key exists" { + r set novar foobared + assert_equal 0 [r setnx novar blabla] + assert_equal "foobared" [r get novar] + } + + test "SETNX against not-expired volatile key" { + r set x 10 + r expire x 10000 + assert_equal 0 [r setnx x 20] + assert_equal 10 [r get x] + } + + test "SETNX against expired volatile key" { + # Make it very unlikely for the key this test uses to be expired by the + # active expiry cycle. This is tightly coupled to the implementation of + # active expiry and dbAdd() but currently the only way to test that + # SETNX expires a key when it should have been. + for {set x 0} {$x < 9999} {incr x} { + r setex key-$x 3600 value + } + + # This will be one of 10000 expiring keys. A cycle is executed every + # 100ms, sampling 10 keys for being expired or not. This key will be + # expired for at most 1s when we wait 2s, resulting in a total sample + # of 100 keys. The probability of the success of this test being a + # false positive is therefore approx. 1%. + r set x 10 + r expire x 1 + + # Wait for the key to expire + after 2000 + + assert_equal 1 [r setnx x 20] + assert_equal 20 [r get x] + } + + test "GETEX EX option" { + r del foo + r set foo bar + r getex foo ex 10 + assert_range [r ttl foo] 5 10 + } + + test "GETEX PX option" { + r del foo + r set foo bar + r getex foo px 10000 + assert_range [r pttl foo] 5000 10000 + } + + test "GETEX EXAT option" { + r del foo + r set foo bar + r getex foo exat [expr [clock seconds] + 10] + assert_range [r ttl foo] 5 10 + } + + test "GETEX PXAT option" { + r del foo + r set foo bar + r getex foo pxat [expr [clock milliseconds] + 10000] + assert_range [r pttl foo] 5000 10000 + } + + test "GETEX PERSIST option" { + r del foo + r set foo bar ex 10 + assert_range [r ttl foo] 5 10 + r getex foo persist + assert_equal -1 [r ttl foo] + } + + test "GETEX no option" { + r del foo + r set foo bar + r getex foo + assert_equal bar [r getex foo] + } + + test "GETEX syntax errors" { + set ex {} + catch {r getex foo non-existent-option} ex + set ex + } {*syntax*} + + test "GETEX and GET expired key or not exist" { + r del foo + r set foo bar px 1 + after 2 + assert_equal {} [r getex foo] + assert_equal {} [r get foo] + } + + test "GETEX no arguments" { + set ex {} + catch {r getex} ex + set ex + } {*wrong number of arguments for 'getex' command} + + test "GETDEL command" { + r del foo + r set foo bar + assert_equal bar [r getdel foo ] + assert_equal {} [r getdel foo ] + } + + test {GETDEL propagate as DEL command to replica} { + set repl [attach_to_replication_stream] + r set foo bar + r getdel foo + assert_replication_stream $repl { + {select *} + {set foo bar} + {del foo} + } + close_replication_stream $repl + } {} {needs:repl} + + test {GETEX without argument does not propagate to replica} { + set repl [attach_to_replication_stream] + r set foo bar + r getex foo + r del foo + assert_replication_stream $repl { + {select *} + {set foo bar} + {del foo} + } + close_replication_stream $repl + } {} {needs:repl} + + test {MGET} { + r flushdb + r set foo{t} BAR + r set bar{t} FOO + r mget foo{t} bar{t} + } {BAR FOO} + + test {MGET against non existing key} { + r mget foo{t} baazz{t} bar{t} + } {BAR {} FOO} + + test {MGET against non-string key} { + r sadd myset{t} ciao + r sadd myset{t} bau + r mget foo{t} baazz{t} bar{t} myset{t} + } {BAR {} FOO {}} + + test {GETSET (set new value)} { + r del foo + list [r getset foo xyz] [r get foo] + } {{} xyz} + + test {GETSET (replace old value)} { + r set foo bar + list [r getset foo xyz] [r get foo] + } {bar xyz} + + test {MSET base case} { + r mset x{t} 10 y{t} "foo bar" z{t} "x x x x x x x\n\n\r\n" + r mget x{t} y{t} z{t} + } [list 10 {foo bar} "x x x x x x x\n\n\r\n"] + + test {MSET/MSETNX wrong number of args} { + assert_error {*wrong number of arguments for 'mset' command} {r mset x{t} 10 y{t} "foo bar" z{t}} + assert_error {*wrong number of arguments for 'msetnx' command} {r msetnx x{t} 20 y{t} "foo bar" z{t}} + } + + test {MSET with already existing - same key twice} { + r set x{t} x + list [r mset x{t} xxx x{t} yyy] [r get x{t}] + } {OK yyy} + + test {MSETNX with already existent key} { + list [r msetnx x1{t} xxx y2{t} yyy x{t} 20] [r exists x1{t}] [r exists y2{t}] + } {0 0 0} + + test {MSETNX with not existing keys} { + list [r msetnx x1{t} xxx y2{t} yyy] [r get x1{t}] [r get y2{t}] + } {1 xxx yyy} + + test {MSETNX with not existing keys - same key twice} { + r del x1{t} + list [r msetnx x1{t} xxx x1{t} yyy] [r get x1{t}] + } {1 yyy} + + test {MSETNX with already existing keys - same key twice} { + list [r msetnx x1{t} xxx x1{t} zzz] [r get x1{t}] + } {0 yyy} + + test "STRLEN against non-existing key" { + assert_equal 0 [r strlen notakey] + } + + test "STRLEN against integer-encoded value" { + r set myinteger -555 + assert_equal 4 [r strlen myinteger] + } + + test "STRLEN against plain string" { + r set mystring "foozzz0123456789 baz" + assert_equal 20 [r strlen mystring] + } + + test "SETBIT against non-existing key" { + r del mykey + assert_equal 0 [r setbit mykey 1 1] + assert_equal [binary format B* 01000000] [r get mykey] + } + + test "SETBIT against string-encoded key" { + # Ascii "@" is integer 64 = 01 00 00 00 + r set mykey "@" + + assert_equal 0 [r setbit mykey 2 1] + assert_equal [binary format B* 01100000] [r get mykey] + assert_equal 1 [r setbit mykey 1 0] + assert_equal [binary format B* 00100000] [r get mykey] + } + + test "SETBIT against integer-encoded key" { + # Ascii "1" is integer 49 = 00 11 00 01 + r set mykey 1 + assert_encoding int mykey + + assert_equal 0 [r setbit mykey 6 1] + assert_equal [binary format B* 00110011] [r get mykey] + assert_equal 1 [r setbit mykey 2 0] + assert_equal [binary format B* 00010011] [r get mykey] + } + + test "SETBIT against key with wrong type" { + r del mykey + r lpush mykey "foo" + assert_error "WRONGTYPE*" {r setbit mykey 0 1} + } + + test "SETBIT with out of range bit offset" { + r del mykey + assert_error "*out of range*" {r setbit mykey [expr 4*1024*1024*1024] 1} + assert_error "*out of range*" {r setbit mykey -1 1} + } + + test "SETBIT with non-bit argument" { + r del mykey + assert_error "*out of range*" {r setbit mykey 0 -1} + assert_error "*out of range*" {r setbit mykey 0 2} + assert_error "*out of range*" {r setbit mykey 0 10} + assert_error "*out of range*" {r setbit mykey 0 20} + } + + test "SETBIT fuzzing" { + set str "" + set len [expr 256*8] + r del mykey + + for {set i 0} {$i < 2000} {incr i} { + set bitnum [randomInt $len] + set bitval [randomInt 2] + set fmt [format "%%-%ds%%d%%-s" $bitnum] + set head [string range $str 0 $bitnum-1] + set tail [string range $str $bitnum+1 end] + set str [string map {" " 0} [format $fmt $head $bitval $tail]] + + r setbit mykey $bitnum $bitval + assert_equal [binary format B* $str] [r get mykey] + } + } + + test "GETBIT against non-existing key" { + r del mykey + assert_equal 0 [r getbit mykey 0] + } + + test "GETBIT against string-encoded key" { + # Single byte with 2nd and 3rd bit set + r set mykey "`" + + # In-range + assert_equal 0 [r getbit mykey 0] + assert_equal 1 [r getbit mykey 1] + assert_equal 1 [r getbit mykey 2] + assert_equal 0 [r getbit mykey 3] + + # Out-range + assert_equal 0 [r getbit mykey 8] + assert_equal 0 [r getbit mykey 100] + assert_equal 0 [r getbit mykey 10000] + } + + test "GETBIT against integer-encoded key" { + r set mykey 1 + assert_encoding int mykey + + # Ascii "1" is integer 49 = 00 11 00 01 + assert_equal 0 [r getbit mykey 0] + assert_equal 0 [r getbit mykey 1] + assert_equal 1 [r getbit mykey 2] + assert_equal 1 [r getbit mykey 3] + + # Out-range + assert_equal 0 [r getbit mykey 8] + assert_equal 0 [r getbit mykey 100] + assert_equal 0 [r getbit mykey 10000] + } + + test "SETRANGE against non-existing key" { + r del mykey + assert_equal 3 [r setrange mykey 0 foo] + assert_equal "foo" [r get mykey] + + r del mykey + assert_equal 0 [r setrange mykey 0 ""] + assert_equal 0 [r exists mykey] + + r del mykey + assert_equal 4 [r setrange mykey 1 foo] + assert_equal "\000foo" [r get mykey] + } + + test "SETRANGE against string-encoded key" { + r set mykey "foo" + assert_equal 3 [r setrange mykey 0 b] + assert_equal "boo" [r get mykey] + + r set mykey "foo" + assert_equal 3 [r setrange mykey 0 ""] + assert_equal "foo" [r get mykey] + + r set mykey "foo" + assert_equal 3 [r setrange mykey 1 b] + assert_equal "fbo" [r get mykey] + + r set mykey "foo" + assert_equal 7 [r setrange mykey 4 bar] + assert_equal "foo\000bar" [r get mykey] + } + + test "SETRANGE against integer-encoded key" { + r set mykey 1234 + assert_encoding int mykey + assert_equal 4 [r setrange mykey 0 2] + assert_encoding raw mykey + assert_equal 2234 [r get mykey] + + # Shouldn't change encoding when nothing is set + r set mykey 1234 + assert_encoding int mykey + assert_equal 4 [r setrange mykey 0 ""] + assert_encoding int mykey + assert_equal 1234 [r get mykey] + + r set mykey 1234 + assert_encoding int mykey + assert_equal 4 [r setrange mykey 1 3] + assert_encoding raw mykey + assert_equal 1334 [r get mykey] + + r set mykey 1234 + assert_encoding int mykey + assert_equal 6 [r setrange mykey 5 2] + assert_encoding raw mykey + assert_equal "1234\0002" [r get mykey] + } + + test "SETRANGE against key with wrong type" { + r del mykey + r lpush mykey "foo" + assert_error "WRONGTYPE*" {r setrange mykey 0 bar} + } + + test "SETRANGE with out of range offset" { + r del mykey + assert_error "*maximum allowed size*" {r setrange mykey [expr 512*1024*1024-4] world} + + r set mykey "hello" + assert_error "*out of range*" {r setrange mykey -1 world} + assert_error "*maximum allowed size*" {r setrange mykey [expr 512*1024*1024-4] world} + } + + test "GETRANGE against non-existing key" { + r del mykey + assert_equal "" [r getrange mykey 0 -1] + } + + test "GETRANGE against wrong key type" { + r lpush lkey1 "list" + assert_error {WRONGTYPE Operation against a key holding the wrong kind of value*} {r getrange lkey1 0 -1} + } + + test "GETRANGE against string value" { + r set mykey "Hello World" + assert_equal "Hell" [r getrange mykey 0 3] + assert_equal "Hello World" [r getrange mykey 0 -1] + assert_equal "orld" [r getrange mykey -4 -1] + assert_equal "" [r getrange mykey 5 3] + assert_equal " World" [r getrange mykey 5 5000] + assert_equal "Hello World" [r getrange mykey -5000 10000] + } + + test "GETRANGE against integer-encoded value" { + r set mykey 1234 + assert_equal "123" [r getrange mykey 0 2] + assert_equal "1234" [r getrange mykey 0 -1] + assert_equal "234" [r getrange mykey -3 -1] + assert_equal "" [r getrange mykey 5 3] + assert_equal "4" [r getrange mykey 3 5000] + assert_equal "1234" [r getrange mykey -5000 10000] + } + + test "GETRANGE fuzzing" { + for {set i 0} {$i < 1000} {incr i} { + r set bin [set bin [randstring 0 1024 binary]] + set _start [set start [randomInt 1500]] + set _end [set end [randomInt 1500]] + if {$_start < 0} {set _start "end-[abs($_start)-1]"} + if {$_end < 0} {set _end "end-[abs($_end)-1]"} + assert_equal [string range $bin $_start $_end] [r getrange bin $start $end] + } + } + + test "Coverage: SUBSTR" { + r set key abcde + assert_equal "a" [r substr key 0 0] + assert_equal "abcd" [r substr key 0 3] + assert_equal "bcde" [r substr key -4 -1] + assert_equal "" [r substr key -1 -3] + assert_equal "" [r substr key 7 8] + assert_equal "" [r substr nokey 0 1] + } + +if {[string match {*jemalloc*} [s mem_allocator]]} { + test {trim on SET with big value} { + # set a big value to trigger increasing the query buf + r set key [string repeat A 100000] + # set a smaller value but > PROTO_MBULK_BIG_ARG (32*1024) Redis will try to save the query buf itself on the DB. + r set key [string repeat A 33000] + # asset the value was trimmed + assert {[r memory usage key] < 42000}; # 42K to count for Jemalloc's additional memory overhead. + } +} ;# if jemalloc + + test {Extended SET can detect syntax errors} { + set e {} + catch {r set foo bar non-existing-option} e + set e + } {*syntax*} + + test {Extended SET NX option} { + r del foo + set v1 [r set foo 1 nx] + set v2 [r set foo 2 nx] + list $v1 $v2 [r get foo] + } {OK {} 1} + + test {Extended SET XX option} { + r del foo + set v1 [r set foo 1 xx] + r set foo bar + set v2 [r set foo 2 xx] + list $v1 $v2 [r get foo] + } {{} OK 2} + + test {Extended SET GET option} { + r del foo + r set foo bar + set old_value [r set foo bar2 GET] + set new_value [r get foo] + list $old_value $new_value + } {bar bar2} + + test {Extended SET GET option with no previous value} { + r del foo + set old_value [r set foo bar GET] + set new_value [r get foo] + list $old_value $new_value + } {{} bar} + + test {Extended SET GET option with XX} { + r del foo + r set foo bar + set old_value [r set foo baz GET XX] + set new_value [r get foo] + list $old_value $new_value + } {bar baz} + + test {Extended SET GET option with XX and no previous value} { + r del foo + set old_value [r set foo bar GET XX] + set new_value [r get foo] + list $old_value $new_value + } {{} {}} + + test {Extended SET GET option with NX} { + r del foo + set old_value [r set foo bar GET NX] + set new_value [r get foo] + list $old_value $new_value + } {{} bar} + + test {Extended SET GET option with NX and previous value} { + r del foo + r set foo bar + set old_value [r set foo baz GET NX] + set new_value [r get foo] + list $old_value $new_value + } {bar bar} + + test {Extended SET GET with incorrect type should result in wrong type error} { + r del foo + r rpush foo waffle + catch {r set foo bar GET} err1 + assert_equal "waffle" [r rpop foo] + set err1 + } {*WRONGTYPE*} + + test {Extended SET EX option} { + r del foo + r set foo bar ex 10 + set ttl [r ttl foo] + assert {$ttl <= 10 && $ttl > 5} + } + + test {Extended SET PX option} { + r del foo + r set foo bar px 10000 + set ttl [r ttl foo] + assert {$ttl <= 10 && $ttl > 5} + } + + test "Extended SET EXAT option" { + r del foo + r set foo bar exat [expr [clock seconds] + 10] + assert_range [r ttl foo] 5 10 + } + + test "Extended SET PXAT option" { + r del foo + r set foo bar pxat [expr [clock milliseconds] + 10000] + assert_range [r ttl foo] 5 10 + } + test {Extended SET using multiple options at once} { + r set foo val + assert {[r set foo bar xx px 10000] eq {OK}} + set ttl [r ttl foo] + assert {$ttl <= 10 && $ttl > 5} + } + + test {GETRANGE with huge ranges, Github issue #1844} { + r set foo bar + r getrange foo 0 4294967297 + } {bar} + + set rna1 {CACCTTCCCAGGTAACAAACCAACCAACTTTCGATCTCTTGTAGATCTGTTCTCTAAACGAACTTTAAAATCTGTGTGGCTGTCACTCGGCTGCATGCTTAGTGCACTCACGCAGTATAATTAATAACTAATTACTGTCGTTGACAGGACACGAGTAACTCGTCTATCTTCTGCAGGCTGCTTACGGTTTCGTCCGTGTTGCAGCCGATCATCAGCACATCTAGGTTTCGTCCGGGTGTG} + set rna2 {ATTAAAGGTTTATACCTTCCCAGGTAACAAACCAACCAACTTTCGATCTCTTGTAGATCTGTTCTCTAAACGAACTTTAAAATCTGTGTGGCTGTCACTCGGCTGCATGCTTAGTGCACTCACGCAGTATAATTAATAACTAATTACTGTCGTTGACAGGACACGAGTAACTCGTCTATCTTCTGCAGGCTGCTTACGGTTTCGTCCGTGTTGCAGCCGATCATCAGCACATCTAGGTTT} + set rnalcs {ACCTTCCCAGGTAACAAACCAACCAACTTTCGATCTCTTGTAGATCTGTTCTCTAAACGAACTTTAAAATCTGTGTGGCTGTCACTCGGCTGCATGCTTAGTGCACTCACGCAGTATAATTAATAACTAATTACTGTCGTTGACAGGACACGAGTAACTCGTCTATCTTCTGCAGGCTGCTTACGGTTTCGTCCGTGTTGCAGCCGATCATCAGCACATCTAGGTTT} + + test {LCS basic} { + r set virus1{t} $rna1 + r set virus2{t} $rna2 + r LCS virus1{t} virus2{t} + } $rnalcs + + test {LCS len} { + r set virus1{t} $rna1 + r set virus2{t} $rna2 + r LCS virus1{t} virus2{t} LEN + } [string length $rnalcs] + + test {LCS indexes} { + dict get [r LCS virus1{t} virus2{t} IDX] matches + } {{{238 238} {239 239}} {{236 236} {238 238}} {{229 230} {236 237}} {{224 224} {235 235}} {{1 222} {13 234}}} + + test {LCS indexes with match len} { + dict get [r LCS virus1{t} virus2{t} IDX WITHMATCHLEN] matches + } {{{238 238} {239 239} 1} {{236 236} {238 238} 1} {{229 230} {236 237} 2} {{224 224} {235 235} 1} {{1 222} {13 234} 222}} + + test {LCS indexes with match len and minimum match len} { + dict get [r LCS virus1{t} virus2{t} IDX WITHMATCHLEN MINMATCHLEN 5] matches + } {{{1 222} {13 234} 222}} + + test {SETRANGE with huge offset} { + foreach value {9223372036854775807 2147483647} { + catch {[r setrange K $value A]} res + # expecting a different error on 32 and 64 bit systems + if {![string match "*string exceeds maximum allowed size*" $res] && ![string match "*out of range*" $res]} { + assert_equal $res "expecting an error" + } + } + } + + test {APPEND modifies the encoding from int to raw} { + r del foo + r set foo 1 + assert_encoding "int" foo + r append foo 2 + + set res {} + lappend res [r get foo] + assert_encoding "raw" foo + + r set bar 12 + assert_encoding "int" bar + lappend res [r get bar] + } {12 12} +} diff --git a/tests/unit/type/zset.tcl b/tests/unit/type/zset.tcl new file mode 100644 index 0000000..33427d8 --- /dev/null +++ b/tests/unit/type/zset.tcl @@ -0,0 +1,2654 @@ +start_server {tags {"zset"}} { + proc create_zset {key items} { + r del $key + foreach {score entry} $items { + r zadd $key $score $entry + } + } + + # A helper function to verify either ZPOP* or ZMPOP* response. + proc verify_pop_response {pop res zpop_expected_response zmpop_expected_response} { + if {[string match "*ZM*" $pop]} { + assert_equal $res $zmpop_expected_response + } else { + assert_equal $res $zpop_expected_response + } + } + + # A helper function to verify either ZPOP* or ZMPOP* response when given one input key. + proc verify_zpop_response {rd pop key count zpop_expected_response zmpop_expected_response} { + if {[string match "ZM*" $pop]} { + lassign [split $pop "_"] pop where + + if {$count == 0} { + set res [$rd $pop 1 $key $where] + } else { + set res [$rd $pop 1 $key $where COUNT $count] + } + } else { + if {$count == 0} { + set res [$rd $pop $key] + } else { + set res [$rd $pop $key $count] + } + } + verify_pop_response $pop $res $zpop_expected_response $zmpop_expected_response + } + + # A helper function to verify either BZPOP* or BZMPOP* response when given one input key. + proc verify_bzpop_response {rd pop key timeout count bzpop_expected_response bzmpop_expected_response} { + if {[string match "BZM*" $pop]} { + lassign [split $pop "_"] pop where + + if {$count == 0} { + $rd $pop $timeout 1 $key $where + } else { + $rd $pop $timeout 1 $key $where COUNT $count + } + } else { + $rd $pop $key $timeout + } + verify_pop_response $pop [$rd read] $bzpop_expected_response $bzmpop_expected_response + } + + # A helper function to verify either ZPOP* or ZMPOP* response when given two input keys. + proc verify_bzpop_two_key_response {rd pop key key2 timeout count bzpop_expected_response bzmpop_expected_response} { + if {[string match "BZM*" $pop]} { + lassign [split $pop "_"] pop where + + if {$count == 0} { + $rd $pop $timeout 2 $key $key2 $where + } else { + $rd $pop $timeout 2 $key $key2 $where COUNT $count + } + } else { + $rd $pop $key $key2 $timeout + } + verify_pop_response $pop [$rd read] $bzpop_expected_response $bzmpop_expected_response + } + + # A helper function to execute either BZPOP* or BZMPOP* with one input key. + proc bzpop_command {rd pop key timeout} { + if {[string match "BZM*" $pop]} { + lassign [split $pop "_"] pop where + $rd $pop $timeout 1 $key $where COUNT 1 + } else { + $rd $pop $key $timeout + } + } + + # A helper function to verify nil response in readraw base on RESP version. + proc verify_nil_response {resp nil_response} { + if {$resp == 2} { + assert_equal $nil_response {*-1} + } elseif {$resp == 3} { + assert_equal $nil_response {_} + } + } + + # A helper function to verify zset score response in readraw base on RESP version. + proc verify_score_response {rd resp score} { + if {$resp == 2} { + assert_equal [$rd read] {$1} + assert_equal [$rd read] $score + } elseif {$resp == 3} { + assert_equal [$rd read] ",$score" + } + } + + proc basics {encoding} { + set original_max_entries [lindex [r config get zset-max-ziplist-entries] 1] + set original_max_value [lindex [r config get zset-max-ziplist-value] 1] + if {$encoding == "listpack"} { + r config set zset-max-ziplist-entries 128 + r config set zset-max-ziplist-value 64 + } elseif {$encoding == "skiplist"} { + r config set zset-max-ziplist-entries 0 + r config set zset-max-ziplist-value 0 + } else { + puts "Unknown sorted set encoding" + exit + } + + test "Check encoding - $encoding" { + r del ztmp + r zadd ztmp 10 x + assert_encoding $encoding ztmp + } + + test "ZSET basic ZADD and score update - $encoding" { + r del ztmp + r zadd ztmp 10 x + r zadd ztmp 20 y + r zadd ztmp 30 z + assert_equal {x y z} [r zrange ztmp 0 -1] + + r zadd ztmp 1 y + assert_equal {y x z} [r zrange ztmp 0 -1] + } + + test "ZSET element can't be set to NaN with ZADD - $encoding" { + assert_error "*not*float*" {r zadd myzset nan abc} + } + + test "ZSET element can't be set to NaN with ZINCRBY - $encoding" { + assert_error "*not*float*" {r zincrby myzset nan abc} + } + + test "ZADD with options syntax error with incomplete pair - $encoding" { + r del ztmp + catch {r zadd ztmp xx 10 x 20} err + set err + } {ERR*} + + test "ZADD XX option without key - $encoding" { + r del ztmp + assert {[r zadd ztmp xx 10 x] == 0} + assert {[r type ztmp] eq {none}} + } + + test "ZADD XX existing key - $encoding" { + r del ztmp + r zadd ztmp 10 x + assert {[r zadd ztmp xx 20 y] == 0} + assert {[r zcard ztmp] == 1} + } + + test "ZADD XX returns the number of elements actually added - $encoding" { + r del ztmp + r zadd ztmp 10 x + set retval [r zadd ztmp 10 x 20 y 30 z] + assert {$retval == 2} + } + + test "ZADD XX updates existing elements score - $encoding" { + r del ztmp + r zadd ztmp 10 x 20 y 30 z + r zadd ztmp xx 5 foo 11 x 21 y 40 zap + assert {[r zcard ztmp] == 3} + assert {[r zscore ztmp x] == 11} + assert {[r zscore ztmp y] == 21} + } + + test "ZADD GT updates existing elements when new scores are greater - $encoding" { + r del ztmp + r zadd ztmp 10 x 20 y 30 z + assert {[r zadd ztmp gt ch 5 foo 11 x 21 y 29 z] == 3} + assert {[r zcard ztmp] == 4} + assert {[r zscore ztmp x] == 11} + assert {[r zscore ztmp y] == 21} + assert {[r zscore ztmp z] == 30} + } + + test "ZADD LT updates existing elements when new scores are lower - $encoding" { + r del ztmp + r zadd ztmp 10 x 20 y 30 z + assert {[r zadd ztmp lt ch 5 foo 11 x 21 y 29 z] == 2} + assert {[r zcard ztmp] == 4} + assert {[r zscore ztmp x] == 10} + assert {[r zscore ztmp y] == 20} + assert {[r zscore ztmp z] == 29} + } + + test "ZADD GT XX updates existing elements when new scores are greater and skips new elements - $encoding" { + r del ztmp + r zadd ztmp 10 x 20 y 30 z + assert {[r zadd ztmp gt xx ch 5 foo 11 x 21 y 29 z] == 2} + assert {[r zcard ztmp] == 3} + assert {[r zscore ztmp x] == 11} + assert {[r zscore ztmp y] == 21} + assert {[r zscore ztmp z] == 30} + } + + test "ZADD LT XX updates existing elements when new scores are lower and skips new elements - $encoding" { + r del ztmp + r zadd ztmp 10 x 20 y 30 z + assert {[r zadd ztmp lt xx ch 5 foo 11 x 21 y 29 z] == 1} + assert {[r zcard ztmp] == 3} + assert {[r zscore ztmp x] == 10} + assert {[r zscore ztmp y] == 20} + assert {[r zscore ztmp z] == 29} + } + + test "ZADD XX and NX are not compatible - $encoding" { + r del ztmp + catch {r zadd ztmp xx nx 10 x} err + set err + } {ERR*} + + test "ZADD NX with non existing key - $encoding" { + r del ztmp + r zadd ztmp nx 10 x 20 y 30 z + assert {[r zcard ztmp] == 3} + } + + test "ZADD NX only add new elements without updating old ones - $encoding" { + r del ztmp + r zadd ztmp 10 x 20 y 30 z + assert {[r zadd ztmp nx 11 x 21 y 100 a 200 b] == 2} + assert {[r zscore ztmp x] == 10} + assert {[r zscore ztmp y] == 20} + assert {[r zscore ztmp a] == 100} + assert {[r zscore ztmp b] == 200} + } + + test "ZADD GT and NX are not compatible - $encoding" { + r del ztmp + catch {r zadd ztmp gt nx 10 x} err + set err + } {ERR*} + + test "ZADD LT and NX are not compatible - $encoding" { + r del ztmp + catch {r zadd ztmp lt nx 10 x} err + set err + } {ERR*} + + test "ZADD LT and GT are not compatible - $encoding" { + r del ztmp + catch {r zadd ztmp lt gt 10 x} err + set err + } {ERR*} + + test "ZADD INCR LT/GT replies with nill if score not updated - $encoding" { + r del ztmp + r zadd ztmp 28 x + assert {[r zadd ztmp lt incr 1 x] eq {}} + assert {[r zscore ztmp x] == 28} + assert {[r zadd ztmp gt incr -1 x] eq {}} + assert {[r zscore ztmp x] == 28} + } + + test "ZADD INCR LT/GT with inf - $encoding" { + r del ztmp + r zadd ztmp +inf x -inf y + + assert {[r zadd ztmp lt incr 1 x] eq {}} + assert {[r zscore ztmp x] == inf} + assert {[r zadd ztmp gt incr -1 x] eq {}} + assert {[r zscore ztmp x] == inf} + assert {[r zadd ztmp lt incr -1 x] eq {}} + assert {[r zscore ztmp x] == inf} + assert {[r zadd ztmp gt incr 1 x] eq {}} + assert {[r zscore ztmp x] == inf} + + assert {[r zadd ztmp lt incr 1 y] eq {}} + assert {[r zscore ztmp y] == -inf} + assert {[r zadd ztmp gt incr -1 y] eq {}} + assert {[r zscore ztmp y] == -inf} + assert {[r zadd ztmp lt incr -1 y] eq {}} + assert {[r zscore ztmp y] == -inf} + assert {[r zadd ztmp gt incr 1 y] eq {}} + assert {[r zscore ztmp y] == -inf} + } + + test "ZADD INCR works like ZINCRBY - $encoding" { + r del ztmp + r zadd ztmp 10 x 20 y 30 z + r zadd ztmp INCR 15 x + assert {[r zscore ztmp x] == 25} + } + + test "ZADD INCR works with a single score-elemenet pair - $encoding" { + r del ztmp + r zadd ztmp 10 x 20 y 30 z + catch {r zadd ztmp INCR 15 x 10 y} err + set err + } {ERR*} + + test "ZADD CH option changes return value to all changed elements - $encoding" { + r del ztmp + r zadd ztmp 10 x 20 y 30 z + assert {[r zadd ztmp 11 x 21 y 30 z] == 0} + assert {[r zadd ztmp ch 12 x 22 y 30 z] == 2} + } + + test "ZINCRBY calls leading to NaN result in error - $encoding" { + r zincrby myzset +inf abc + assert_error "*NaN*" {r zincrby myzset -inf abc} + } + + test "ZADD - Variadic version base case - $encoding" { + r del myzset + list [r zadd myzset 10 a 20 b 30 c] [r zrange myzset 0 -1 withscores] + } {3 {a 10 b 20 c 30}} + + test "ZADD - Return value is the number of actually added items - $encoding" { + list [r zadd myzset 5 x 20 b 30 c] [r zrange myzset 0 -1 withscores] + } {1 {x 5 a 10 b 20 c 30}} + + test "ZADD - Variadic version does not add nothing on single parsing err - $encoding" { + r del myzset + catch {r zadd myzset 10 a 20 b 30.badscore c} e + assert_match {*ERR*not*float*} $e + r exists myzset + } {0} + + test "ZADD - Variadic version will raise error on missing arg - $encoding" { + r del myzset + catch {r zadd myzset 10 a 20 b 30 c 40} e + assert_match {*ERR*syntax*} $e + } + + test "ZINCRBY does not work variadic even if shares ZADD implementation - $encoding" { + r del myzset + catch {r zincrby myzset 10 a 20 b 30 c} e + assert_match {*ERR*wrong*number*arg*} $e + } + + test "ZCARD basics - $encoding" { + r del ztmp + r zadd ztmp 10 a 20 b 30 c + assert_equal 3 [r zcard ztmp] + assert_equal 0 [r zcard zdoesntexist] + } + + test "ZREM removes key after last element is removed - $encoding" { + r del ztmp + r zadd ztmp 10 x + r zadd ztmp 20 y + + assert_equal 1 [r exists ztmp] + assert_equal 0 [r zrem ztmp z] + assert_equal 1 [r zrem ztmp y] + assert_equal 1 [r zrem ztmp x] + assert_equal 0 [r exists ztmp] + } + + test "ZREM variadic version - $encoding" { + r del ztmp + r zadd ztmp 10 a 20 b 30 c + assert_equal 2 [r zrem ztmp x y a b k] + assert_equal 0 [r zrem ztmp foo bar] + assert_equal 1 [r zrem ztmp c] + r exists ztmp + } {0} + + test "ZREM variadic version -- remove elements after key deletion - $encoding" { + r del ztmp + r zadd ztmp 10 a 20 b 30 c + r zrem ztmp a b c d e f g + } {3} + + test "ZRANGE basics - $encoding" { + r del ztmp + r zadd ztmp 1 a + r zadd ztmp 2 b + r zadd ztmp 3 c + r zadd ztmp 4 d + + assert_equal {a b c d} [r zrange ztmp 0 -1] + assert_equal {a b c} [r zrange ztmp 0 -2] + assert_equal {b c d} [r zrange ztmp 1 -1] + assert_equal {b c} [r zrange ztmp 1 -2] + assert_equal {c d} [r zrange ztmp -2 -1] + assert_equal {c} [r zrange ztmp -2 -2] + + # out of range start index + assert_equal {a b c} [r zrange ztmp -5 2] + assert_equal {a b} [r zrange ztmp -5 1] + assert_equal {} [r zrange ztmp 5 -1] + assert_equal {} [r zrange ztmp 5 -2] + + # out of range end index + assert_equal {a b c d} [r zrange ztmp 0 5] + assert_equal {b c d} [r zrange ztmp 1 5] + assert_equal {} [r zrange ztmp 0 -5] + assert_equal {} [r zrange ztmp 1 -5] + + # withscores + assert_equal {a 1 b 2 c 3 d 4} [r zrange ztmp 0 -1 withscores] + } + + test "ZREVRANGE basics - $encoding" { + r del ztmp + r zadd ztmp 1 a + r zadd ztmp 2 b + r zadd ztmp 3 c + r zadd ztmp 4 d + + assert_equal {d c b a} [r zrevrange ztmp 0 -1] + assert_equal {d c b} [r zrevrange ztmp 0 -2] + assert_equal {c b a} [r zrevrange ztmp 1 -1] + assert_equal {c b} [r zrevrange ztmp 1 -2] + assert_equal {b a} [r zrevrange ztmp -2 -1] + assert_equal {b} [r zrevrange ztmp -2 -2] + + # out of range start index + assert_equal {d c b} [r zrevrange ztmp -5 2] + assert_equal {d c} [r zrevrange ztmp -5 1] + assert_equal {} [r zrevrange ztmp 5 -1] + assert_equal {} [r zrevrange ztmp 5 -2] + + # out of range end index + assert_equal {d c b a} [r zrevrange ztmp 0 5] + assert_equal {c b a} [r zrevrange ztmp 1 5] + assert_equal {} [r zrevrange ztmp 0 -5] + assert_equal {} [r zrevrange ztmp 1 -5] + + # withscores + assert_equal {d 4 c 3 b 2 a 1} [r zrevrange ztmp 0 -1 withscores] + } + + test "ZRANK/ZREVRANK basics - $encoding" { + set nullres {$-1} + if {$::force_resp3} { + set nullres {_} + } + r del zranktmp + r zadd zranktmp 10 x + r zadd zranktmp 20 y + r zadd zranktmp 30 z + assert_equal 0 [r zrank zranktmp x] + assert_equal 1 [r zrank zranktmp y] + assert_equal 2 [r zrank zranktmp z] + assert_equal 2 [r zrevrank zranktmp x] + assert_equal 1 [r zrevrank zranktmp y] + assert_equal 0 [r zrevrank zranktmp z] + r readraw 1 + assert_equal $nullres [r zrank zranktmp foo] + assert_equal $nullres [r zrevrank zranktmp foo] + r readraw 0 + + # withscore + set nullres {*-1} + if {$::force_resp3} { + set nullres {_} + } + assert_equal {0 10} [r zrank zranktmp x withscore] + assert_equal {1 20} [r zrank zranktmp y withscore] + assert_equal {2 30} [r zrank zranktmp z withscore] + assert_equal {2 10} [r zrevrank zranktmp x withscore] + assert_equal {1 20} [r zrevrank zranktmp y withscore] + assert_equal {0 30} [r zrevrank zranktmp z withscore] + r readraw 1 + assert_equal $nullres [r zrank zranktmp foo withscore] + assert_equal $nullres [r zrevrank zranktmp foo withscore] + r readraw 0 + } + + test "ZRANK - after deletion - $encoding" { + r zrem zranktmp y + assert_equal 0 [r zrank zranktmp x] + assert_equal 1 [r zrank zranktmp z] + assert_equal {0 10} [r zrank zranktmp x withscore] + assert_equal {1 30} [r zrank zranktmp z withscore] + } + + test "ZINCRBY - can create a new sorted set - $encoding" { + r del zset + r zincrby zset 1 foo + assert_equal {foo} [r zrange zset 0 -1] + assert_equal 1 [r zscore zset foo] + } + + test "ZINCRBY - increment and decrement - $encoding" { + r zincrby zset 2 foo + r zincrby zset 1 bar + assert_equal {bar foo} [r zrange zset 0 -1] + + r zincrby zset 10 bar + r zincrby zset -5 foo + r zincrby zset -5 bar + assert_equal {foo bar} [r zrange zset 0 -1] + + assert_equal -2 [r zscore zset foo] + assert_equal 6 [r zscore zset bar] + } + + test "ZINCRBY return value - $encoding" { + r del ztmp + set retval [r zincrby ztmp 1.0 x] + assert {$retval == 1.0} + } + + proc create_default_zset {} { + create_zset zset {-inf a 1 b 2 c 3 d 4 e 5 f +inf g} + } + + test "ZRANGEBYSCORE/ZREVRANGEBYSCORE/ZCOUNT basics - $encoding" { + create_default_zset + + # inclusive range + assert_equal {a b c} [r zrangebyscore zset -inf 2] + assert_equal {b c d} [r zrangebyscore zset 0 3] + assert_equal {d e f} [r zrangebyscore zset 3 6] + assert_equal {e f g} [r zrangebyscore zset 4 +inf] + assert_equal {c b a} [r zrevrangebyscore zset 2 -inf] + assert_equal {d c b} [r zrevrangebyscore zset 3 0] + assert_equal {f e d} [r zrevrangebyscore zset 6 3] + assert_equal {g f e} [r zrevrangebyscore zset +inf 4] + assert_equal 3 [r zcount zset 0 3] + + # exclusive range + assert_equal {b} [r zrangebyscore zset (-inf (2] + assert_equal {b c} [r zrangebyscore zset (0 (3] + assert_equal {e f} [r zrangebyscore zset (3 (6] + assert_equal {f} [r zrangebyscore zset (4 (+inf] + assert_equal {b} [r zrevrangebyscore zset (2 (-inf] + assert_equal {c b} [r zrevrangebyscore zset (3 (0] + assert_equal {f e} [r zrevrangebyscore zset (6 (3] + assert_equal {f} [r zrevrangebyscore zset (+inf (4] + assert_equal 2 [r zcount zset (0 (3] + + # test empty ranges + r zrem zset a + r zrem zset g + + # inclusive + assert_equal {} [r zrangebyscore zset 4 2] + assert_equal {} [r zrangebyscore zset 6 +inf] + assert_equal {} [r zrangebyscore zset -inf -6] + assert_equal {} [r zrevrangebyscore zset +inf 6] + assert_equal {} [r zrevrangebyscore zset -6 -inf] + + # exclusive + assert_equal {} [r zrangebyscore zset (4 (2] + assert_equal {} [r zrangebyscore zset 2 (2] + assert_equal {} [r zrangebyscore zset (2 2] + assert_equal {} [r zrangebyscore zset (6 (+inf] + assert_equal {} [r zrangebyscore zset (-inf (-6] + assert_equal {} [r zrevrangebyscore zset (+inf (6] + assert_equal {} [r zrevrangebyscore zset (-6 (-inf] + + # empty inner range + assert_equal {} [r zrangebyscore zset 2.4 2.6] + assert_equal {} [r zrangebyscore zset (2.4 2.6] + assert_equal {} [r zrangebyscore zset 2.4 (2.6] + assert_equal {} [r zrangebyscore zset (2.4 (2.6] + } + + test "ZRANGEBYSCORE with WITHSCORES - $encoding" { + create_default_zset + assert_equal {b 1 c 2 d 3} [r zrangebyscore zset 0 3 withscores] + assert_equal {d 3 c 2 b 1} [r zrevrangebyscore zset 3 0 withscores] + } + + test "ZRANGEBYSCORE with LIMIT - $encoding" { + create_default_zset + assert_equal {b c} [r zrangebyscore zset 0 10 LIMIT 0 2] + assert_equal {d e f} [r zrangebyscore zset 0 10 LIMIT 2 3] + assert_equal {d e f} [r zrangebyscore zset 0 10 LIMIT 2 10] + assert_equal {} [r zrangebyscore zset 0 10 LIMIT 20 10] + assert_equal {f e} [r zrevrangebyscore zset 10 0 LIMIT 0 2] + assert_equal {d c b} [r zrevrangebyscore zset 10 0 LIMIT 2 3] + assert_equal {d c b} [r zrevrangebyscore zset 10 0 LIMIT 2 10] + assert_equal {} [r zrevrangebyscore zset 10 0 LIMIT 20 10] + } + + test "ZRANGEBYSCORE with LIMIT and WITHSCORES - $encoding" { + create_default_zset + assert_equal {e 4 f 5} [r zrangebyscore zset 2 5 LIMIT 2 3 WITHSCORES] + assert_equal {d 3 c 2} [r zrevrangebyscore zset 5 2 LIMIT 2 3 WITHSCORES] + assert_equal {} [r zrangebyscore zset 2 5 LIMIT 12 13 WITHSCORES] + } + + test "ZRANGEBYSCORE with non-value min or max - $encoding" { + assert_error "*not*float*" {r zrangebyscore fooz str 1} + assert_error "*not*float*" {r zrangebyscore fooz 1 str} + assert_error "*not*float*" {r zrangebyscore fooz 1 NaN} + } + + proc create_default_lex_zset {} { + create_zset zset {0 alpha 0 bar 0 cool 0 down + 0 elephant 0 foo 0 great 0 hill + 0 omega} + } + + test "ZRANGEBYLEX/ZREVRANGEBYLEX/ZLEXCOUNT basics - $encoding" { + create_default_lex_zset + + # inclusive range + assert_equal {alpha bar cool} [r zrangebylex zset - \[cool] + assert_equal {bar cool down} [r zrangebylex zset \[bar \[down] + assert_equal {great hill omega} [r zrangebylex zset \[g +] + assert_equal {cool bar alpha} [r zrevrangebylex zset \[cool -] + assert_equal {down cool bar} [r zrevrangebylex zset \[down \[bar] + assert_equal {omega hill great foo elephant down} [r zrevrangebylex zset + \[d] + assert_equal 3 [r zlexcount zset \[ele \[h] + + # exclusive range + assert_equal {alpha bar} [r zrangebylex zset - (cool] + assert_equal {cool} [r zrangebylex zset (bar (down] + assert_equal {hill omega} [r zrangebylex zset (great +] + assert_equal {bar alpha} [r zrevrangebylex zset (cool -] + assert_equal {cool} [r zrevrangebylex zset (down (bar] + assert_equal {omega hill} [r zrevrangebylex zset + (great] + assert_equal 2 [r zlexcount zset (ele (great] + + # inclusive and exclusive + assert_equal {} [r zrangebylex zset (az (b] + assert_equal {} [r zrangebylex zset (z +] + assert_equal {} [r zrangebylex zset - \[aaaa] + assert_equal {} [r zrevrangebylex zset \[elez \[elex] + assert_equal {} [r zrevrangebylex zset (hill (omega] + } + + test "ZLEXCOUNT advanced - $encoding" { + create_default_lex_zset + + assert_equal 9 [r zlexcount zset - +] + assert_equal 0 [r zlexcount zset + -] + assert_equal 0 [r zlexcount zset + \[c] + assert_equal 0 [r zlexcount zset \[c -] + assert_equal 8 [r zlexcount zset \[bar +] + assert_equal 5 [r zlexcount zset \[bar \[foo] + assert_equal 4 [r zlexcount zset \[bar (foo] + assert_equal 4 [r zlexcount zset (bar \[foo] + assert_equal 3 [r zlexcount zset (bar (foo] + assert_equal 5 [r zlexcount zset - (foo] + assert_equal 1 [r zlexcount zset (maxstring +] + } + + test "ZRANGEBYSLEX with LIMIT - $encoding" { + create_default_lex_zset + assert_equal {alpha bar} [r zrangebylex zset - \[cool LIMIT 0 2] + assert_equal {bar cool} [r zrangebylex zset - \[cool LIMIT 1 2] + assert_equal {} [r zrangebylex zset \[bar \[down LIMIT 0 0] + assert_equal {} [r zrangebylex zset \[bar \[down LIMIT 2 0] + assert_equal {bar} [r zrangebylex zset \[bar \[down LIMIT 0 1] + assert_equal {cool} [r zrangebylex zset \[bar \[down LIMIT 1 1] + assert_equal {bar cool down} [r zrangebylex zset \[bar \[down LIMIT 0 100] + assert_equal {omega hill great foo elephant} [r zrevrangebylex zset + \[d LIMIT 0 5] + assert_equal {omega hill great foo} [r zrevrangebylex zset + \[d LIMIT 0 4] + } + + test "ZRANGEBYLEX with invalid lex range specifiers - $encoding" { + assert_error "*not*string*" {r zrangebylex fooz foo bar} + assert_error "*not*string*" {r zrangebylex fooz \[foo bar} + assert_error "*not*string*" {r zrangebylex fooz foo \[bar} + assert_error "*not*string*" {r zrangebylex fooz +x \[bar} + assert_error "*not*string*" {r zrangebylex fooz -x \[bar} + } + + test "ZREMRANGEBYSCORE basics - $encoding" { + proc remrangebyscore {min max} { + create_zset zset {1 a 2 b 3 c 4 d 5 e} + assert_equal 1 [r exists zset] + r zremrangebyscore zset $min $max + } + + # inner range + assert_equal 3 [remrangebyscore 2 4] + assert_equal {a e} [r zrange zset 0 -1] + + # start underflow + assert_equal 1 [remrangebyscore -10 1] + assert_equal {b c d e} [r zrange zset 0 -1] + + # end overflow + assert_equal 1 [remrangebyscore 5 10] + assert_equal {a b c d} [r zrange zset 0 -1] + + # switch min and max + assert_equal 0 [remrangebyscore 4 2] + assert_equal {a b c d e} [r zrange zset 0 -1] + + # -inf to mid + assert_equal 3 [remrangebyscore -inf 3] + assert_equal {d e} [r zrange zset 0 -1] + + # mid to +inf + assert_equal 3 [remrangebyscore 3 +inf] + assert_equal {a b} [r zrange zset 0 -1] + + # -inf to +inf + assert_equal 5 [remrangebyscore -inf +inf] + assert_equal {} [r zrange zset 0 -1] + + # exclusive min + assert_equal 4 [remrangebyscore (1 5] + assert_equal {a} [r zrange zset 0 -1] + assert_equal 3 [remrangebyscore (2 5] + assert_equal {a b} [r zrange zset 0 -1] + + # exclusive max + assert_equal 4 [remrangebyscore 1 (5] + assert_equal {e} [r zrange zset 0 -1] + assert_equal 3 [remrangebyscore 1 (4] + assert_equal {d e} [r zrange zset 0 -1] + + # exclusive min and max + assert_equal 3 [remrangebyscore (1 (5] + assert_equal {a e} [r zrange zset 0 -1] + + # destroy when empty + assert_equal 5 [remrangebyscore 1 5] + assert_equal 0 [r exists zset] + } + + test "ZREMRANGEBYSCORE with non-value min or max - $encoding" { + assert_error "*not*float*" {r zremrangebyscore fooz str 1} + assert_error "*not*float*" {r zremrangebyscore fooz 1 str} + assert_error "*not*float*" {r zremrangebyscore fooz 1 NaN} + } + + test "ZREMRANGEBYRANK basics - $encoding" { + proc remrangebyrank {min max} { + create_zset zset {1 a 2 b 3 c 4 d 5 e} + assert_equal 1 [r exists zset] + r zremrangebyrank zset $min $max + } + + # inner range + assert_equal 3 [remrangebyrank 1 3] + assert_equal {a e} [r zrange zset 0 -1] + + # start underflow + assert_equal 1 [remrangebyrank -10 0] + assert_equal {b c d e} [r zrange zset 0 -1] + + # start overflow + assert_equal 0 [remrangebyrank 10 -1] + assert_equal {a b c d e} [r zrange zset 0 -1] + + # end underflow + assert_equal 0 [remrangebyrank 0 -10] + assert_equal {a b c d e} [r zrange zset 0 -1] + + # end overflow + assert_equal 5 [remrangebyrank 0 10] + assert_equal {} [r zrange zset 0 -1] + + # destroy when empty + assert_equal 5 [remrangebyrank 0 4] + assert_equal 0 [r exists zset] + } + + test "ZREMRANGEBYLEX basics - $encoding" { + proc remrangebylex {min max} { + create_default_lex_zset + assert_equal 1 [r exists zset] + r zremrangebylex zset $min $max + } + + # inclusive range + assert_equal 3 [remrangebylex - \[cool] + assert_equal {down elephant foo great hill omega} [r zrange zset 0 -1] + assert_equal 3 [remrangebylex \[bar \[down] + assert_equal {alpha elephant foo great hill omega} [r zrange zset 0 -1] + assert_equal 3 [remrangebylex \[g +] + assert_equal {alpha bar cool down elephant foo} [r zrange zset 0 -1] + assert_equal 6 [r zcard zset] + + # exclusive range + assert_equal 2 [remrangebylex - (cool] + assert_equal {cool down elephant foo great hill omega} [r zrange zset 0 -1] + assert_equal 1 [remrangebylex (bar (down] + assert_equal {alpha bar down elephant foo great hill omega} [r zrange zset 0 -1] + assert_equal 2 [remrangebylex (great +] + assert_equal {alpha bar cool down elephant foo great} [r zrange zset 0 -1] + assert_equal 7 [r zcard zset] + + # inclusive and exclusive + assert_equal 0 [remrangebylex (az (b] + assert_equal {alpha bar cool down elephant foo great hill omega} [r zrange zset 0 -1] + assert_equal 0 [remrangebylex (z +] + assert_equal {alpha bar cool down elephant foo great hill omega} [r zrange zset 0 -1] + assert_equal 0 [remrangebylex - \[aaaa] + assert_equal {alpha bar cool down elephant foo great hill omega} [r zrange zset 0 -1] + assert_equal 9 [r zcard zset] + + # destroy when empty + assert_equal 9 [remrangebylex - +] + assert_equal 0 [r zcard zset] + assert_equal 0 [r exists zset] + } + + test "ZUNIONSTORE against non-existing key doesn't set destination - $encoding" { + r del zseta{t} + assert_equal 0 [r zunionstore dst_key{t} 1 zseta{t}] + assert_equal 0 [r exists dst_key{t}] + } + + test "ZUNION/ZINTER/ZINTERCARD/ZDIFF against non-existing key - $encoding" { + r del zseta + assert_equal {} [r zunion 1 zseta] + assert_equal {} [r zinter 1 zseta] + assert_equal 0 [r zintercard 1 zseta] + assert_equal 0 [r zintercard 1 zseta limit 0] + assert_equal {} [r zdiff 1 zseta] + } + + test "ZUNIONSTORE with empty set - $encoding" { + r del zseta{t} zsetb{t} + r zadd zseta{t} 1 a + r zadd zseta{t} 2 b + r zunionstore zsetc{t} 2 zseta{t} zsetb{t} + r zrange zsetc{t} 0 -1 withscores + } {a 1 b 2} + + test "ZUNION/ZINTER/ZINTERCARD/ZDIFF with empty set - $encoding" { + r del zseta{t} zsetb{t} + r zadd zseta{t} 1 a + r zadd zseta{t} 2 b + assert_equal {a 1 b 2} [r zunion 2 zseta{t} zsetb{t} withscores] + assert_equal {} [r zinter 2 zseta{t} zsetb{t} withscores] + assert_equal 0 [r zintercard 2 zseta{t} zsetb{t}] + assert_equal 0 [r zintercard 2 zseta{t} zsetb{t} limit 0] + assert_equal {a 1 b 2} [r zdiff 2 zseta{t} zsetb{t} withscores] + } + + test "ZUNIONSTORE basics - $encoding" { + r del zseta{t} zsetb{t} zsetc{t} + r zadd zseta{t} 1 a + r zadd zseta{t} 2 b + r zadd zseta{t} 3 c + r zadd zsetb{t} 1 b + r zadd zsetb{t} 2 c + r zadd zsetb{t} 3 d + + assert_equal 4 [r zunionstore zsetc{t} 2 zseta{t} zsetb{t}] + assert_equal {a 1 b 3 d 3 c 5} [r zrange zsetc{t} 0 -1 withscores] + } + + test "ZUNION/ZINTER/ZINTERCARD/ZDIFF with integer members - $encoding" { + r del zsetd{t} zsetf{t} + r zadd zsetd{t} 1 1 + r zadd zsetd{t} 2 2 + r zadd zsetd{t} 3 3 + r zadd zsetf{t} 1 1 + r zadd zsetf{t} 3 3 + r zadd zsetf{t} 4 4 + + assert_equal {1 2 2 2 4 4 3 6} [r zunion 2 zsetd{t} zsetf{t} withscores] + assert_equal {1 2 3 6} [r zinter 2 zsetd{t} zsetf{t} withscores] + assert_equal 2 [r zintercard 2 zsetd{t} zsetf{t}] + assert_equal 2 [r zintercard 2 zsetd{t} zsetf{t} limit 0] + assert_equal {2 2} [r zdiff 2 zsetd{t} zsetf{t} withscores] + } + + test "ZUNIONSTORE with weights - $encoding" { + assert_equal 4 [r zunionstore zsetc{t} 2 zseta{t} zsetb{t} weights 2 3] + assert_equal {a 2 b 7 d 9 c 12} [r zrange zsetc{t} 0 -1 withscores] + } + + test "ZUNION with weights - $encoding" { + assert_equal {a 2 b 7 d 9 c 12} [r zunion 2 zseta{t} zsetb{t} weights 2 3 withscores] + assert_equal {b 7 c 12} [r zinter 2 zseta{t} zsetb{t} weights 2 3 withscores] + } + + test "ZUNIONSTORE with a regular set and weights - $encoding" { + r del seta{t} + r sadd seta{t} a + r sadd seta{t} b + r sadd seta{t} c + + assert_equal 4 [r zunionstore zsetc{t} 2 seta{t} zsetb{t} weights 2 3] + assert_equal {a 2 b 5 c 8 d 9} [r zrange zsetc{t} 0 -1 withscores] + } + + test "ZUNIONSTORE with AGGREGATE MIN - $encoding" { + assert_equal 4 [r zunionstore zsetc{t} 2 zseta{t} zsetb{t} aggregate min] + assert_equal {a 1 b 1 c 2 d 3} [r zrange zsetc{t} 0 -1 withscores] + } + + test "ZUNION/ZINTER with AGGREGATE MIN - $encoding" { + assert_equal {a 1 b 1 c 2 d 3} [r zunion 2 zseta{t} zsetb{t} aggregate min withscores] + assert_equal {b 1 c 2} [r zinter 2 zseta{t} zsetb{t} aggregate min withscores] + } + + test "ZUNIONSTORE with AGGREGATE MAX - $encoding" { + assert_equal 4 [r zunionstore zsetc{t} 2 zseta{t} zsetb{t} aggregate max] + assert_equal {a 1 b 2 c 3 d 3} [r zrange zsetc{t} 0 -1 withscores] + } + + test "ZUNION/ZINTER with AGGREGATE MAX - $encoding" { + assert_equal {a 1 b 2 c 3 d 3} [r zunion 2 zseta{t} zsetb{t} aggregate max withscores] + assert_equal {b 2 c 3} [r zinter 2 zseta{t} zsetb{t} aggregate max withscores] + } + + test "ZINTERSTORE basics - $encoding" { + assert_equal 2 [r zinterstore zsetc{t} 2 zseta{t} zsetb{t}] + assert_equal {b 3 c 5} [r zrange zsetc{t} 0 -1 withscores] + } + + test "ZINTER basics - $encoding" { + assert_equal {b 3 c 5} [r zinter 2 zseta{t} zsetb{t} withscores] + } + + test "ZINTERCARD with illegal arguments" { + assert_error "ERR syntax error*" {r zintercard 1 zseta{t} zseta{t}} + assert_error "ERR syntax error*" {r zintercard 1 zseta{t} bar_arg} + assert_error "ERR syntax error*" {r zintercard 1 zseta{t} LIMIT} + + assert_error "ERR LIMIT*" {r zintercard 1 myset{t} LIMIT -1} + assert_error "ERR LIMIT*" {r zintercard 1 myset{t} LIMIT a} + } + + test "ZINTERCARD basics - $encoding" { + assert_equal 2 [r zintercard 2 zseta{t} zsetb{t}] + assert_equal 2 [r zintercard 2 zseta{t} zsetb{t} limit 0] + assert_equal 1 [r zintercard 2 zseta{t} zsetb{t} limit 1] + assert_equal 2 [r zintercard 2 zseta{t} zsetb{t} limit 10] + } + + test "ZINTER RESP3 - $encoding" { + r hello 3 + assert_equal {{b 3.0} {c 5.0}} [r zinter 2 zseta{t} zsetb{t} withscores] + r hello 2 + } + + test "ZINTERSTORE with weights - $encoding" { + assert_equal 2 [r zinterstore zsetc{t} 2 zseta{t} zsetb{t} weights 2 3] + assert_equal {b 7 c 12} [r zrange zsetc{t} 0 -1 withscores] + } + + test "ZINTER with weights - $encoding" { + assert_equal {b 7 c 12} [r zinter 2 zseta{t} zsetb{t} weights 2 3 withscores] + } + + test "ZINTERSTORE with a regular set and weights - $encoding" { + r del seta{t} + r sadd seta{t} a + r sadd seta{t} b + r sadd seta{t} c + assert_equal 2 [r zinterstore zsetc{t} 2 seta{t} zsetb{t} weights 2 3] + assert_equal {b 5 c 8} [r zrange zsetc{t} 0 -1 withscores] + } + + test "ZINTERSTORE with AGGREGATE MIN - $encoding" { + assert_equal 2 [r zinterstore zsetc{t} 2 zseta{t} zsetb{t} aggregate min] + assert_equal {b 1 c 2} [r zrange zsetc{t} 0 -1 withscores] + } + + test "ZINTERSTORE with AGGREGATE MAX - $encoding" { + assert_equal 2 [r zinterstore zsetc{t} 2 zseta{t} zsetb{t} aggregate max] + assert_equal {b 2 c 3} [r zrange zsetc{t} 0 -1 withscores] + } + + foreach cmd {ZUNIONSTORE ZINTERSTORE} { + test "$cmd with +inf/-inf scores - $encoding" { + r del zsetinf1{t} zsetinf2{t} + + r zadd zsetinf1{t} +inf key + r zadd zsetinf2{t} +inf key + r $cmd zsetinf3{t} 2 zsetinf1{t} zsetinf2{t} + assert_equal inf [r zscore zsetinf3{t} key] + + r zadd zsetinf1{t} -inf key + r zadd zsetinf2{t} +inf key + r $cmd zsetinf3{t} 2 zsetinf1{t} zsetinf2{t} + assert_equal 0 [r zscore zsetinf3{t} key] + + r zadd zsetinf1{t} +inf key + r zadd zsetinf2{t} -inf key + r $cmd zsetinf3{t} 2 zsetinf1{t} zsetinf2{t} + assert_equal 0 [r zscore zsetinf3{t} key] + + r zadd zsetinf1{t} -inf key + r zadd zsetinf2{t} -inf key + r $cmd zsetinf3{t} 2 zsetinf1{t} zsetinf2{t} + assert_equal -inf [r zscore zsetinf3{t} key] + } + + test "$cmd with NaN weights - $encoding" { + r del zsetinf1{t} zsetinf2{t} + + r zadd zsetinf1{t} 1.0 key + r zadd zsetinf2{t} 1.0 key + assert_error "*weight*not*float*" { + r $cmd zsetinf3{t} 2 zsetinf1{t} zsetinf2{t} weights nan nan + } + } + } + + test "ZDIFFSTORE basics - $encoding" { + assert_equal 1 [r zdiffstore zsetc{t} 2 zseta{t} zsetb{t}] + assert_equal {a 1} [r zrange zsetc{t} 0 -1 withscores] + } + + test "ZDIFF basics - $encoding" { + assert_equal {a 1} [r zdiff 2 zseta{t} zsetb{t} withscores] + } + + test "ZDIFFSTORE with a regular set - $encoding" { + r del seta{t} + r sadd seta{t} a + r sadd seta{t} b + r sadd seta{t} c + assert_equal 1 [r zdiffstore zsetc{t} 2 seta{t} zsetb{t}] + assert_equal {a 1} [r zrange zsetc{t} 0 -1 withscores] + } + + test "ZDIFF subtracting set from itself - $encoding" { + assert_equal 0 [r zdiffstore zsetc{t} 2 zseta{t} zseta{t}] + assert_equal {} [r zrange zsetc{t} 0 -1 withscores] + } + + test "ZDIFF algorithm 1 - $encoding" { + r del zseta{t} zsetb{t} zsetc{t} + r zadd zseta{t} 1 a + r zadd zseta{t} 2 b + r zadd zseta{t} 3 c + r zadd zsetb{t} 1 b + r zadd zsetb{t} 2 c + r zadd zsetb{t} 3 d + assert_equal 1 [r zdiffstore zsetc{t} 2 zseta{t} zsetb{t}] + assert_equal {a 1} [r zrange zsetc{t} 0 -1 withscores] + } + + test "ZDIFF algorithm 2 - $encoding" { + r del zseta{t} zsetb{t} zsetc{t} zsetd{t} zsete{t} + r zadd zseta{t} 1 a + r zadd zseta{t} 2 b + r zadd zseta{t} 3 c + r zadd zseta{t} 5 e + r zadd zsetb{t} 1 b + r zadd zsetc{t} 1 c + r zadd zsetd{t} 1 d + assert_equal 2 [r zdiffstore zsete{t} 4 zseta{t} zsetb{t} zsetc{t} zsetd{t}] + assert_equal {a 1 e 5} [r zrange zsete{t} 0 -1 withscores] + } + + test "ZDIFF fuzzing - $encoding" { + for {set j 0} {$j < 100} {incr j} { + unset -nocomplain s + array set s {} + set args {} + set num_sets [expr {[randomInt 10]+1}] + for {set i 0} {$i < $num_sets} {incr i} { + set num_elements [randomInt 100] + r del zset_$i{t} + lappend args zset_$i{t} + while {$num_elements} { + set ele [randomValue] + r zadd zset_$i{t} [randomInt 100] $ele + if {$i == 0} { + set s($ele) x + } else { + unset -nocomplain s($ele) + } + incr num_elements -1 + } + } + set result [lsort [r zdiff [llength $args] {*}$args]] + assert_equal $result [lsort [array names s]] + } + } + + foreach {pop} {ZPOPMIN ZPOPMAX} { + test "$pop with the count 0 returns an empty array" { + r del zset + r zadd zset 1 a 2 b 3 c + assert_equal {} [r $pop zset 0] + + # Make sure we can distinguish between an empty array and a null response + r readraw 1 + assert_equal {*0} [r $pop zset 0] + r readraw 0 + + assert_equal 3 [r zcard zset] + } + + test "$pop with negative count" { + r set zset foo + assert_error "ERR *must be positive" {r $pop zset -1} + + r del zset + assert_error "ERR *must be positive" {r $pop zset -2} + + r zadd zset 1 a 2 b 3 c + assert_error "ERR *must be positive" {r $pop zset -3} + } + } + + foreach {popmin popmax} {ZPOPMIN ZPOPMAX ZMPOP_MIN ZMPOP_MAX} { + test "Basic $popmin/$popmax with a single key - $encoding" { + r del zset + verify_zpop_response r $popmin zset 0 {} {} + + create_zset zset {-1 a 1 b 2 c 3 d 4 e} + verify_zpop_response r $popmin zset 0 {a -1} {zset {{a -1}}} + verify_zpop_response r $popmin zset 0 {b 1} {zset {{b 1}}} + verify_zpop_response r $popmax zset 0 {e 4} {zset {{e 4}}} + verify_zpop_response r $popmax zset 0 {d 3} {zset {{d 3}}} + verify_zpop_response r $popmin zset 0 {c 2} {zset {{c 2}}} + assert_equal 0 [r exists zset] + } + + test "$popmin/$popmax with count - $encoding" { + r del z1 + verify_zpop_response r $popmin z1 2 {} {} + + create_zset z1 {0 a 1 b 2 c 3 d} + verify_zpop_response r $popmin z1 2 {a 0 b 1} {z1 {{a 0} {b 1}}} + verify_zpop_response r $popmax z1 2 {d 3 c 2} {z1 {{d 3} {c 2}}} + } + } + + foreach {popmin popmax} {BZPOPMIN BZPOPMAX BZMPOP_MIN BZMPOP_MAX} { + test "$popmin/$popmax with a single existing sorted set - $encoding" { + set rd [redis_deferring_client] + create_zset zset {0 a 1 b 2 c 3 d} + + verify_bzpop_response $rd $popmin zset 5 0 {zset a 0} {zset {{a 0}}} + verify_bzpop_response $rd $popmax zset 5 0 {zset d 3} {zset {{d 3}}} + verify_bzpop_response $rd $popmin zset 5 0 {zset b 1} {zset {{b 1}}} + verify_bzpop_response $rd $popmax zset 5 0 {zset c 2} {zset {{c 2}}} + assert_equal 0 [r exists zset] + $rd close + } + + test "$popmin/$popmax with multiple existing sorted sets - $encoding" { + set rd [redis_deferring_client] + create_zset z1{t} {0 a 1 b 2 c} + create_zset z2{t} {3 d 4 e 5 f} + + verify_bzpop_two_key_response $rd $popmin z1{t} z2{t} 5 0 {z1{t} a 0} {z1{t} {{a 0}}} + verify_bzpop_two_key_response $rd $popmax z1{t} z2{t} 5 0 {z1{t} c 2} {z1{t} {{c 2}}} + assert_equal 1 [r zcard z1{t}] + assert_equal 3 [r zcard z2{t}] + + verify_bzpop_two_key_response $rd $popmax z2{t} z1{t} 5 0 {z2{t} f 5} {z2{t} {{f 5}}} + verify_bzpop_two_key_response $rd $popmin z2{t} z1{t} 5 0 {z2{t} d 3} {z2{t} {{d 3}}} + assert_equal 1 [r zcard z1{t}] + assert_equal 1 [r zcard z2{t}] + $rd close + } + + test "$popmin/$popmax second sorted set has members - $encoding" { + set rd [redis_deferring_client] + r del z1{t} + create_zset z2{t} {3 d 4 e 5 f} + + verify_bzpop_two_key_response $rd $popmax z1{t} z2{t} 5 0 {z2{t} f 5} {z2{t} {{f 5}}} + verify_bzpop_two_key_response $rd $popmin z1{t} z2{t} 5 0 {z2{t} d 3} {z2{t} {{d 3}}} + assert_equal 0 [r zcard z1{t}] + assert_equal 1 [r zcard z2{t}] + $rd close + } + } + + foreach {popmin popmax} {ZPOPMIN ZPOPMAX ZMPOP_MIN ZMPOP_MAX} { + test "Basic $popmin/$popmax - $encoding RESP3" { + r hello 3 + create_zset z1 {0 a 1 b 2 c 3 d} + verify_zpop_response r $popmin z1 0 {a 0.0} {z1 {{a 0.0}}} + verify_zpop_response r $popmax z1 0 {d 3.0} {z1 {{d 3.0}}} + r hello 2 + } + + test "$popmin/$popmax with count - $encoding RESP3" { + r hello 3 + create_zset z1 {0 a 1 b 2 c 3 d} + verify_zpop_response r $popmin z1 2 {{a 0.0} {b 1.0}} {z1 {{a 0.0} {b 1.0}}} + verify_zpop_response r $popmax z1 2 {{d 3.0} {c 2.0}} {z1 {{d 3.0} {c 2.0}}} + r hello 2 + } + } + + foreach {popmin popmax} {BZPOPMIN BZPOPMAX BZMPOP_MIN BZMPOP_MAX} { + test "$popmin/$popmax - $encoding RESP3" { + r hello 3 + set rd [redis_deferring_client] + create_zset zset {0 a 1 b 2 c 3 d} + + verify_bzpop_response $rd $popmin zset 5 0 {zset a 0} {zset {{a 0}}} + verify_bzpop_response $rd $popmax zset 5 0 {zset d 3} {zset {{d 3}}} + verify_bzpop_response $rd $popmin zset 5 0 {zset b 1} {zset {{b 1}}} + verify_bzpop_response $rd $popmax zset 5 0 {zset c 2} {zset {{c 2}}} + + assert_equal 0 [r exists zset] + r hello 2 + $rd close + } + } + + r config set zset-max-ziplist-entries $original_max_entries + r config set zset-max-ziplist-value $original_max_value + } + + basics listpack + basics skiplist + + test "ZPOP/ZMPOP against wrong type" { + r set foo{t} bar + assert_error "*WRONGTYPE*" {r zpopmin foo{t}} + assert_error "*WRONGTYPE*" {r zpopmin foo{t} 0} + assert_error "*WRONGTYPE*" {r zpopmax foo{t}} + assert_error "*WRONGTYPE*" {r zpopmax foo{t} 0} + assert_error "*WRONGTYPE*" {r zpopmin foo{t} 2} + + assert_error "*WRONGTYPE*" {r zmpop 1 foo{t} min} + assert_error "*WRONGTYPE*" {r zmpop 1 foo{t} max} + assert_error "*WRONGTYPE*" {r zmpop 1 foo{t} max count 200} + + r del foo{t} + r set foo2{t} bar + assert_error "*WRONGTYPE*" {r zmpop 2 foo{t} foo2{t} min} + assert_error "*WRONGTYPE*" {r zmpop 2 foo2{t} foo1{t} max count 1} + } + + test "ZMPOP with illegal argument" { + assert_error "ERR wrong number of arguments for 'zmpop' command" {r zmpop} + assert_error "ERR wrong number of arguments for 'zmpop' command" {r zmpop 1} + assert_error "ERR wrong number of arguments for 'zmpop' command" {r zmpop 1 myzset{t}} + + assert_error "ERR numkeys*" {r zmpop 0 myzset{t} MIN} + assert_error "ERR numkeys*" {r zmpop a myzset{t} MIN} + assert_error "ERR numkeys*" {r zmpop -1 myzset{t} MAX} + + assert_error "ERR syntax error*" {r zmpop 1 myzset{t} bad_where} + assert_error "ERR syntax error*" {r zmpop 1 myzset{t} MIN bar_arg} + assert_error "ERR syntax error*" {r zmpop 1 myzset{t} MAX MIN} + assert_error "ERR syntax error*" {r zmpop 1 myzset{t} COUNT} + assert_error "ERR syntax error*" {r zmpop 1 myzset{t} MAX COUNT 1 COUNT 2} + assert_error "ERR syntax error*" {r zmpop 2 myzset{t} myzset2{t} bad_arg} + + assert_error "ERR count*" {r zmpop 1 myzset{t} MIN COUNT 0} + assert_error "ERR count*" {r zmpop 1 myzset{t} MAX COUNT a} + assert_error "ERR count*" {r zmpop 1 myzset{t} MIN COUNT -1} + assert_error "ERR count*" {r zmpop 2 myzset{t} myzset2{t} MAX COUNT -1} + } + + test "ZMPOP propagate as pop with count command to replica" { + set repl [attach_to_replication_stream] + + # ZMPOP min/max propagate as ZPOPMIN/ZPOPMAX with count + r zadd myzset{t} 1 one 2 two 3 three + + # Pop elements from one zset. + r zmpop 1 myzset{t} min + r zmpop 1 myzset{t} max count 1 + + # Now the zset have only one element + r zmpop 2 myzset{t} myzset2{t} min count 10 + + # No elements so we don't propagate. + r zmpop 2 myzset{t} myzset2{t} max count 10 + + # Pop elements from the second zset. + r zadd myzset2{t} 1 one 2 two 3 three + r zmpop 2 myzset{t} myzset2{t} min count 2 + r zmpop 2 myzset{t} myzset2{t} max count 1 + + # Pop all elements. + r zadd myzset{t} 1 one 2 two 3 three + r zadd myzset2{t} 4 four 5 five 6 six + r zmpop 2 myzset{t} myzset2{t} min count 10 + r zmpop 2 myzset{t} myzset2{t} max count 10 + + assert_replication_stream $repl { + {select *} + {zadd myzset{t} 1 one 2 two 3 three} + {zpopmin myzset{t} 1} + {zpopmax myzset{t} 1} + {zpopmin myzset{t} 1} + {zadd myzset2{t} 1 one 2 two 3 three} + {zpopmin myzset2{t} 2} + {zpopmax myzset2{t} 1} + {zadd myzset{t} 1 one 2 two 3 three} + {zadd myzset2{t} 4 four 5 five 6 six} + {zpopmin myzset{t} 3} + {zpopmax myzset2{t} 3} + } + close_replication_stream $repl + } {} {needs:repl} + + foreach resp {3 2} { + set rd [redis_deferring_client] + + if {[lsearch $::denytags "resp3"] >= 0} { + if {$resp == 3} {continue} + } elseif {$::force_resp3} { + if {$resp == 2} {continue} + } + r hello $resp + $rd hello $resp + $rd read + + test "ZPOPMIN/ZPOPMAX readraw in RESP$resp" { + r del zset{t} + create_zset zset2{t} {1 a 2 b 3 c 4 d 5 e} + + r readraw 1 + + # ZPOP against non existing key. + assert_equal {*0} [r zpopmin zset{t}] + assert_equal {*0} [r zpopmin zset{t} 1] + + # ZPOP without COUNT option. + assert_equal {*2} [r zpopmin zset2{t}] + assert_equal [r read] {$1} + assert_equal [r read] {a} + verify_score_response r $resp 1 + + # ZPOP with COUNT option. + if {$resp == 2} { + assert_equal {*2} [r zpopmax zset2{t} 1] + assert_equal [r read] {$1} + assert_equal [r read] {e} + } elseif {$resp == 3} { + assert_equal {*1} [r zpopmax zset2{t} 1] + assert_equal [r read] {*2} + assert_equal [r read] {$1} + assert_equal [r read] {e} + } + verify_score_response r $resp 5 + + r readraw 0 + } + + test "BZPOPMIN/BZPOPMAX readraw in RESP$resp" { + r del zset{t} + create_zset zset2{t} {1 a 2 b 3 c 4 d 5 e} + + $rd readraw 1 + + # BZPOP released on timeout. + $rd bzpopmin zset{t} 0.01 + verify_nil_response $resp [$rd read] + $rd bzpopmax zset{t} 0.01 + verify_nil_response $resp [$rd read] + + # BZPOP non-blocking path. + $rd bzpopmin zset1{t} zset2{t} 0.1 + assert_equal [$rd read] {*3} + assert_equal [$rd read] {$8} + assert_equal [$rd read] {zset2{t}} + assert_equal [$rd read] {$1} + assert_equal [$rd read] {a} + verify_score_response $rd $resp 1 + + # BZPOP blocking path. + $rd bzpopmin zset{t} 5 + wait_for_blocked_client + r zadd zset{t} 1 a + assert_equal [$rd read] {*3} + assert_equal [$rd read] {$7} + assert_equal [$rd read] {zset{t}} + assert_equal [$rd read] {$1} + assert_equal [$rd read] {a} + verify_score_response $rd $resp 1 + + $rd readraw 0 + } + + test "ZMPOP readraw in RESP$resp" { + r del zset{t} zset2{t} + create_zset zset3{t} {1 a} + create_zset zset4{t} {1 a 2 b 3 c 4 d 5 e} + + r readraw 1 + + # ZMPOP against non existing key. + verify_nil_response $resp [r zmpop 1 zset{t} min] + verify_nil_response $resp [r zmpop 1 zset{t} max count 1] + verify_nil_response $resp [r zmpop 2 zset{t} zset2{t} min] + verify_nil_response $resp [r zmpop 2 zset{t} zset2{t} max count 1] + + # ZMPOP with one input key. + assert_equal {*2} [r zmpop 1 zset3{t} max] + assert_equal [r read] {$8} + assert_equal [r read] {zset3{t}} + assert_equal [r read] {*1} + assert_equal [r read] {*2} + assert_equal [r read] {$1} + assert_equal [r read] {a} + verify_score_response r $resp 1 + + # ZMPOP with COUNT option. + assert_equal {*2} [r zmpop 2 zset3{t} zset4{t} min count 2] + assert_equal [r read] {$8} + assert_equal [r read] {zset4{t}} + assert_equal [r read] {*2} + assert_equal [r read] {*2} + assert_equal [r read] {$1} + assert_equal [r read] {a} + verify_score_response r $resp 1 + assert_equal [r read] {*2} + assert_equal [r read] {$1} + assert_equal [r read] {b} + verify_score_response r $resp 2 + + r readraw 0 + } + + test "BZMPOP readraw in RESP$resp" { + r del zset{t} zset2{t} + create_zset zset3{t} {1 a 2 b 3 c 4 d 5 e} + + $rd readraw 1 + + # BZMPOP released on timeout. + $rd bzmpop 0.01 1 zset{t} min + verify_nil_response $resp [$rd read] + $rd bzmpop 0.01 2 zset{t} zset2{t} max + verify_nil_response $resp [$rd read] + + # BZMPOP non-blocking path. + $rd bzmpop 0.1 2 zset3{t} zset4{t} min + + assert_equal [$rd read] {*2} + assert_equal [$rd read] {$8} + assert_equal [$rd read] {zset3{t}} + assert_equal [$rd read] {*1} + assert_equal [$rd read] {*2} + assert_equal [$rd read] {$1} + assert_equal [$rd read] {a} + verify_score_response $rd $resp 1 + + # BZMPOP blocking path with COUNT option. + $rd bzmpop 5 2 zset{t} zset2{t} max count 2 + wait_for_blocked_client + r zadd zset2{t} 1 a 2 b 3 c + + assert_equal [$rd read] {*2} + assert_equal [$rd read] {$8} + assert_equal [$rd read] {zset2{t}} + assert_equal [$rd read] {*2} + assert_equal [$rd read] {*2} + assert_equal [$rd read] {$1} + assert_equal [$rd read] {c} + verify_score_response $rd $resp 3 + assert_equal [$rd read] {*2} + assert_equal [$rd read] {$1} + assert_equal [$rd read] {b} + verify_score_response $rd $resp 2 + + } + + $rd close + r hello 2 + } + + test {ZINTERSTORE regression with two sets, intset+hashtable} { + r del seta{t} setb{t} setc{t} + r sadd set1{t} a + r sadd set2{t} 10 + r zinterstore set3{t} 2 set1{t} set2{t} + } {0} + + test {ZUNIONSTORE regression, should not create NaN in scores} { + r zadd z{t} -inf neginf + r zunionstore out{t} 1 z{t} weights 0 + r zrange out{t} 0 -1 withscores + } {neginf 0} + + test {ZINTERSTORE #516 regression, mixed sets and ziplist zsets} { + r sadd one{t} 100 101 102 103 + r sadd two{t} 100 200 201 202 + r zadd three{t} 1 500 1 501 1 502 1 503 1 100 + r zinterstore to_here{t} 3 one{t} two{t} three{t} WEIGHTS 0 0 1 + r zrange to_here{t} 0 -1 + } {100} + + test {ZUNIONSTORE result is sorted} { + # Create two sets with common and not common elements, perform + # the UNION, check that elements are still sorted. + r del one{t} two{t} dest{t} + set cmd1 [list r zadd one{t}] + set cmd2 [list r zadd two{t}] + for {set j 0} {$j < 1000} {incr j} { + lappend cmd1 [expr rand()] [randomInt 1000] + lappend cmd2 [expr rand()] [randomInt 1000] + } + {*}$cmd1 + {*}$cmd2 + assert {[r zcard one{t}] > 100} + assert {[r zcard two{t}] > 100} + r zunionstore dest{t} 2 one{t} two{t} + set oldscore 0 + foreach {ele score} [r zrange dest{t} 0 -1 withscores] { + assert {$score >= $oldscore} + set oldscore $score + } + } + + test "ZUNIONSTORE/ZINTERSTORE/ZDIFFSTORE error if using WITHSCORES " { + assert_error "*ERR*syntax*" {r zunionstore foo{t} 2 zsetd{t} zsetf{t} withscores} + assert_error "*ERR*syntax*" {r zinterstore foo{t} 2 zsetd{t} zsetf{t} withscores} + assert_error "*ERR*syntax*" {r zdiffstore foo{t} 2 zsetd{t} zsetf{t} withscores} + } + + test {ZMSCORE retrieve} { + r del zmscoretest + r zadd zmscoretest 10 x + r zadd zmscoretest 20 y + + r zmscore zmscoretest x y + } {10 20} + + test {ZMSCORE retrieve from empty set} { + r del zmscoretest + + r zmscore zmscoretest x y + } {{} {}} + + test {ZMSCORE retrieve with missing member} { + r del zmscoretest + r zadd zmscoretest 10 x + + r zmscore zmscoretest x y + } {10 {}} + + test {ZMSCORE retrieve single member} { + r del zmscoretest + r zadd zmscoretest 10 x + r zadd zmscoretest 20 y + + r zmscore zmscoretest x + } {10} + + test {ZMSCORE retrieve requires one or more members} { + r del zmscoretest + r zadd zmscoretest 10 x + r zadd zmscoretest 20 y + + catch {r zmscore zmscoretest} e + assert_match {*ERR*wrong*number*arg*} $e + } + + test "ZSET commands don't accept the empty strings as valid score" { + assert_error "*not*float*" {r zadd myzset "" abc} + } + + test "zunionInterDiffGenericCommand at least 1 input key" { + assert_error {*at least 1 input key * 'zunion' command} {r zunion 0 key{t}} + assert_error {*at least 1 input key * 'zunionstore' command} {r zunionstore dst_key{t} 0 key{t}} + assert_error {*at least 1 input key * 'zinter' command} {r zinter 0 key{t}} + assert_error {*at least 1 input key * 'zinterstore' command} {r zinterstore dst_key{t} 0 key{t}} + assert_error {*at least 1 input key * 'zdiff' command} {r zdiff 0 key{t}} + assert_error {*at least 1 input key * 'zdiffstore' command} {r zdiffstore dst_key{t} 0 key{t}} + assert_error {*at least 1 input key * 'zintercard' command} {r zintercard 0 key{t}} + } + + proc stressers {encoding} { + set original_max_entries [lindex [r config get zset-max-ziplist-entries] 1] + set original_max_value [lindex [r config get zset-max-ziplist-value] 1] + if {$encoding == "listpack"} { + # Little extra to allow proper fuzzing in the sorting stresser + r config set zset-max-ziplist-entries 256 + r config set zset-max-ziplist-value 64 + set elements 128 + } elseif {$encoding == "skiplist"} { + r config set zset-max-ziplist-entries 0 + r config set zset-max-ziplist-value 0 + if {$::accurate} {set elements 1000} else {set elements 100} + } else { + puts "Unknown sorted set encoding" + exit + } + + test "ZSCORE - $encoding" { + r del zscoretest + set aux {} + for {set i 0} {$i < $elements} {incr i} { + set score [expr rand()] + lappend aux $score + r zadd zscoretest $score $i + } + + assert_encoding $encoding zscoretest + for {set i 0} {$i < $elements} {incr i} { + # If an IEEE 754 double-precision number is converted to a decimal string with at + # least 17 significant digits (reply of zscore), and then converted back to double-precision representation, + # the final result replied via zscore command must match the original number present on the $aux list. + # Given Tcl is mostly very relaxed about types (everything is a string) we need to use expr to convert a string to float. + assert_equal [expr [lindex $aux $i]] [expr [r zscore zscoretest $i]] + } + } + + test "ZMSCORE - $encoding" { + r del zscoretest + set aux {} + for {set i 0} {$i < $elements} {incr i} { + set score [expr rand()] + lappend aux $score + r zadd zscoretest $score $i + } + + assert_encoding $encoding zscoretest + for {set i 0} {$i < $elements} {incr i} { + # Check above notes on IEEE 754 double-precision comparison + assert_equal [expr [lindex $aux $i]] [expr [r zscore zscoretest $i]] + } + } + + test "ZSCORE after a DEBUG RELOAD - $encoding" { + r del zscoretest + set aux {} + for {set i 0} {$i < $elements} {incr i} { + set score [expr rand()] + lappend aux $score + r zadd zscoretest $score $i + } + + r debug reload + assert_encoding $encoding zscoretest + for {set i 0} {$i < $elements} {incr i} { + # Check above notes on IEEE 754 double-precision comparison + assert_equal [expr [lindex $aux $i]] [expr [r zscore zscoretest $i]] + } + } {} {needs:debug} + + test "ZSET sorting stresser - $encoding" { + set delta 0 + for {set test 0} {$test < 2} {incr test} { + unset -nocomplain auxarray + array set auxarray {} + set auxlist {} + r del myzset + for {set i 0} {$i < $elements} {incr i} { + if {$test == 0} { + set score [expr rand()] + } else { + set score [expr int(rand()*10)] + } + set auxarray($i) $score + r zadd myzset $score $i + # Random update + if {[expr rand()] < .2} { + set j [expr int(rand()*1000)] + if {$test == 0} { + set score [expr rand()] + } else { + set score [expr int(rand()*10)] + } + set auxarray($j) $score + r zadd myzset $score $j + } + } + foreach {item score} [array get auxarray] { + lappend auxlist [list $score $item] + } + set sorted [lsort -command zlistAlikeSort $auxlist] + set auxlist {} + foreach x $sorted { + lappend auxlist [lindex $x 1] + } + + assert_encoding $encoding myzset + set fromredis [r zrange myzset 0 -1] + set delta 0 + for {set i 0} {$i < [llength $fromredis]} {incr i} { + if {[lindex $fromredis $i] != [lindex $auxlist $i]} { + incr delta + } + } + } + assert_equal 0 $delta + } + + test "ZRANGEBYSCORE fuzzy test, 100 ranges in $elements element sorted set - $encoding" { + set err {} + r del zset + for {set i 0} {$i < $elements} {incr i} { + r zadd zset [expr rand()] $i + } + + assert_encoding $encoding zset + for {set i 0} {$i < 100} {incr i} { + set min [expr rand()] + set max [expr rand()] + if {$min > $max} { + set aux $min + set min $max + set max $aux + } + set low [r zrangebyscore zset -inf $min] + set ok [r zrangebyscore zset $min $max] + set high [r zrangebyscore zset $max +inf] + set lowx [r zrangebyscore zset -inf ($min] + set okx [r zrangebyscore zset ($min ($max] + set highx [r zrangebyscore zset ($max +inf] + + if {[r zcount zset -inf $min] != [llength $low]} { + append err "Error, len does not match zcount\n" + } + if {[r zcount zset $min $max] != [llength $ok]} { + append err "Error, len does not match zcount\n" + } + if {[r zcount zset $max +inf] != [llength $high]} { + append err "Error, len does not match zcount\n" + } + if {[r zcount zset -inf ($min] != [llength $lowx]} { + append err "Error, len does not match zcount\n" + } + if {[r zcount zset ($min ($max] != [llength $okx]} { + append err "Error, len does not match zcount\n" + } + if {[r zcount zset ($max +inf] != [llength $highx]} { + append err "Error, len does not match zcount\n" + } + + foreach x $low { + set score [r zscore zset $x] + if {$score > $min} { + append err "Error, score for $x is $score > $min\n" + } + } + foreach x $lowx { + set score [r zscore zset $x] + if {$score >= $min} { + append err "Error, score for $x is $score >= $min\n" + } + } + foreach x $ok { + set score [r zscore zset $x] + if {$score < $min || $score > $max} { + append err "Error, score for $x is $score outside $min-$max range\n" + } + } + foreach x $okx { + set score [r zscore zset $x] + if {$score <= $min || $score >= $max} { + append err "Error, score for $x is $score outside $min-$max open range\n" + } + } + foreach x $high { + set score [r zscore zset $x] + if {$score < $max} { + append err "Error, score for $x is $score < $max\n" + } + } + foreach x $highx { + set score [r zscore zset $x] + if {$score <= $max} { + append err "Error, score for $x is $score <= $max\n" + } + } + } + assert_equal {} $err + } + + test "ZRANGEBYLEX fuzzy test, 100 ranges in $elements element sorted set - $encoding" { + set lexset {} + r del zset + for {set j 0} {$j < $elements} {incr j} { + set e [randstring 0 30 alpha] + lappend lexset $e + r zadd zset 0 $e + } + set lexset [lsort -unique $lexset] + for {set j 0} {$j < 100} {incr j} { + set min [randstring 0 30 alpha] + set max [randstring 0 30 alpha] + set mininc [randomInt 2] + set maxinc [randomInt 2] + if {$mininc} {set cmin "\[$min"} else {set cmin "($min"} + if {$maxinc} {set cmax "\[$max"} else {set cmax "($max"} + set rev [randomInt 2] + if {$rev} { + set cmd zrevrangebylex + } else { + set cmd zrangebylex + } + + # Make sure data is the same in both sides + assert {[r zrange zset 0 -1] eq $lexset} + + # Get the Redis output + set output [r $cmd zset $cmin $cmax] + if {$rev} { + set outlen [r zlexcount zset $cmax $cmin] + } else { + set outlen [r zlexcount zset $cmin $cmax] + } + + # Compute the same output via Tcl + set o {} + set copy $lexset + if {(!$rev && [string compare $min $max] > 0) || + ($rev && [string compare $max $min] > 0)} { + # Empty output when ranges are inverted. + } else { + if {$rev} { + # Invert the Tcl array using Redis itself. + set copy [r zrevrange zset 0 -1] + # Invert min / max as well + lassign [list $min $max $mininc $maxinc] \ + max min maxinc mininc + } + foreach e $copy { + set mincmp [string compare $e $min] + set maxcmp [string compare $e $max] + if { + ($mininc && $mincmp >= 0 || !$mininc && $mincmp > 0) + && + ($maxinc && $maxcmp <= 0 || !$maxinc && $maxcmp < 0) + } { + lappend o $e + } + } + } + assert {$o eq $output} + assert {$outlen eq [llength $output]} + } + } + + test "ZREMRANGEBYLEX fuzzy test, 100 ranges in $elements element sorted set - $encoding" { + set lexset {} + r del zset{t} zsetcopy{t} + for {set j 0} {$j < $elements} {incr j} { + set e [randstring 0 30 alpha] + lappend lexset $e + r zadd zset{t} 0 $e + } + set lexset [lsort -unique $lexset] + for {set j 0} {$j < 100} {incr j} { + # Copy... + r zunionstore zsetcopy{t} 1 zset{t} + set lexsetcopy $lexset + + set min [randstring 0 30 alpha] + set max [randstring 0 30 alpha] + set mininc [randomInt 2] + set maxinc [randomInt 2] + if {$mininc} {set cmin "\[$min"} else {set cmin "($min"} + if {$maxinc} {set cmax "\[$max"} else {set cmax "($max"} + + # Make sure data is the same in both sides + assert {[r zrange zset{t} 0 -1] eq $lexset} + + # Get the range we are going to remove + set torem [r zrangebylex zset{t} $cmin $cmax] + set toremlen [r zlexcount zset{t} $cmin $cmax] + r zremrangebylex zsetcopy{t} $cmin $cmax + set output [r zrange zsetcopy{t} 0 -1] + + # Remove the range with Tcl from the original list + if {$toremlen} { + set first [lsearch -exact $lexsetcopy [lindex $torem 0]] + set last [expr {$first+$toremlen-1}] + set lexsetcopy [lreplace $lexsetcopy $first $last] + } + assert {$lexsetcopy eq $output} + } + } + + test "ZSETs skiplist implementation backlink consistency test - $encoding" { + set diff 0 + for {set j 0} {$j < $elements} {incr j} { + r zadd myzset [expr rand()] "Element-$j" + r zrem myzset "Element-[expr int(rand()*$elements)]" + } + + assert_encoding $encoding myzset + set l1 [r zrange myzset 0 -1] + set l2 [r zrevrange myzset 0 -1] + for {set j 0} {$j < [llength $l1]} {incr j} { + if {[lindex $l1 $j] ne [lindex $l2 end-$j]} { + incr diff + } + } + assert_equal 0 $diff + } + + test "ZSETs ZRANK augmented skip list stress testing - $encoding" { + set err {} + r del myzset + for {set k 0} {$k < 2000} {incr k} { + set i [expr {$k % $elements}] + if {[expr rand()] < .2} { + r zrem myzset $i + } else { + set score [expr rand()] + r zadd myzset $score $i + assert_encoding $encoding myzset + } + + set card [r zcard myzset] + if {$card > 0} { + set index [randomInt $card] + set ele [lindex [r zrange myzset $index $index] 0] + set rank [r zrank myzset $ele] + if {$rank != $index} { + set err "$ele RANK is wrong! ($rank != $index)" + break + } + } + } + assert_equal {} $err + } + + foreach {pop} {BZPOPMIN BZMPOP_MIN} { + test "$pop, ZADD + DEL should not awake blocked client" { + set rd [redis_deferring_client] + r del zset + + bzpop_command $rd $pop zset 0 + wait_for_blocked_client + + r multi + r zadd zset 0 foo + r del zset + r exec + r del zset + r zadd zset 1 bar + + verify_pop_response $pop [$rd read] {zset bar 1} {zset {{bar 1}}} + $rd close + } + + test "$pop, ZADD + DEL + SET should not awake blocked client" { + set rd [redis_deferring_client] + r del zset + + bzpop_command $rd $pop zset 0 + wait_for_blocked_client + + r multi + r zadd zset 0 foo + r del zset + r set zset foo + r exec + r del zset + r zadd zset 1 bar + + verify_pop_response $pop [$rd read] {zset bar 1} {zset {{bar 1}}} + $rd close + } + } + + test "BZPOPMIN with same key multiple times should work" { + set rd [redis_deferring_client] + r del z1{t} z2{t} + + # Data arriving after the BZPOPMIN. + $rd bzpopmin z1{t} z2{t} z2{t} z1{t} 0 + wait_for_blocked_client + r zadd z1{t} 0 a + assert_equal [$rd read] {z1{t} a 0} + $rd bzpopmin z1{t} z2{t} z2{t} z1{t} 0 + wait_for_blocked_client + r zadd z2{t} 1 b + assert_equal [$rd read] {z2{t} b 1} + + # Data already there. + r zadd z1{t} 0 a + r zadd z2{t} 1 b + $rd bzpopmin z1{t} z2{t} z2{t} z1{t} 0 + assert_equal [$rd read] {z1{t} a 0} + $rd bzpopmin z1{t} z2{t} z2{t} z1{t} 0 + assert_equal [$rd read] {z2{t} b 1} + $rd close + } + + foreach {pop} {BZPOPMIN BZMPOP_MIN} { + test "MULTI/EXEC is isolated from the point of view of $pop" { + set rd [redis_deferring_client] + r del zset + + bzpop_command $rd $pop zset 0 + wait_for_blocked_client + + r multi + r zadd zset 0 a + r zadd zset 1 b + r zadd zset 2 c + r exec + + verify_pop_response $pop [$rd read] {zset a 0} {zset {{a 0}}} + $rd close + } + + test "$pop with variadic ZADD" { + set rd [redis_deferring_client] + r del zset + if {$::valgrind} {after 100} + bzpop_command $rd $pop zset 0 + wait_for_blocked_client + if {$::valgrind} {after 100} + assert_equal 2 [r zadd zset -1 foo 1 bar] + if {$::valgrind} {after 100} + verify_pop_response $pop [$rd read] {zset foo -1} {zset {{foo -1}}} + assert_equal {bar} [r zrange zset 0 -1] + $rd close + } + + test "$pop with zero timeout should block indefinitely" { + set rd [redis_deferring_client] + r del zset + bzpop_command $rd $pop zset 0 + wait_for_blocked_client + after 1000 + r zadd zset 0 foo + verify_pop_response $pop [$rd read] {zset foo 0} {zset {{foo 0}}} + $rd close + } + } + + r config set zset-max-ziplist-entries $original_max_entries + r config set zset-max-ziplist-value $original_max_value + } + + tags {"slow"} { + stressers listpack + stressers skiplist + } + + test "BZPOP/BZMPOP against wrong type" { + r set foo{t} bar + assert_error "*WRONGTYPE*" {r bzpopmin foo{t} 1} + assert_error "*WRONGTYPE*" {r bzpopmax foo{t} 1} + + assert_error "*WRONGTYPE*" {r bzmpop 1 1 foo{t} min} + assert_error "*WRONGTYPE*" {r bzmpop 1 1 foo{t} max} + assert_error "*WRONGTYPE*" {r bzmpop 1 1 foo{t} min count 10} + + r del foo{t} + r set foo2{t} bar + assert_error "*WRONGTYPE*" {r bzmpop 1 2 foo{t} foo2{t} min} + assert_error "*WRONGTYPE*" {r bzmpop 1 2 foo2{t} foo{t} max count 1} + } + + test "BZMPOP with illegal argument" { + assert_error "ERR wrong number of arguments for 'bzmpop' command" {r bzmpop} + assert_error "ERR wrong number of arguments for 'bzmpop' command" {r bzmpop 0 1} + assert_error "ERR wrong number of arguments for 'bzmpop' command" {r bzmpop 0 1 myzset{t}} + + assert_error "ERR numkeys*" {r bzmpop 1 0 myzset{t} MIN} + assert_error "ERR numkeys*" {r bzmpop 1 a myzset{t} MIN} + assert_error "ERR numkeys*" {r bzmpop 1 -1 myzset{t} MAX} + + assert_error "ERR syntax error*" {r bzmpop 1 1 myzset{t} bad_where} + assert_error "ERR syntax error*" {r bzmpop 1 1 myzset{t} MIN bar_arg} + assert_error "ERR syntax error*" {r bzmpop 1 1 myzset{t} MAX MIN} + assert_error "ERR syntax error*" {r bzmpop 1 1 myzset{t} COUNT} + assert_error "ERR syntax error*" {r bzmpop 1 1 myzset{t} MIN COUNT 1 COUNT 2} + assert_error "ERR syntax error*" {r bzmpop 1 2 myzset{t} myzset2{t} bad_arg} + + assert_error "ERR count*" {r bzmpop 1 1 myzset{t} MIN COUNT 0} + assert_error "ERR count*" {r bzmpop 1 1 myzset{t} MAX COUNT a} + assert_error "ERR count*" {r bzmpop 1 1 myzset{t} MIN COUNT -1} + assert_error "ERR count*" {r bzmpop 1 2 myzset{t} myzset2{t} MAX COUNT -1} + } + + test "BZMPOP with multiple blocked clients" { + set rd1 [redis_deferring_client] + set rd2 [redis_deferring_client] + set rd3 [redis_deferring_client] + set rd4 [redis_deferring_client] + r del myzset{t} myzset2{t} + + $rd1 bzmpop 0 2 myzset{t} myzset2{t} min count 1 + wait_for_blocked_clients_count 1 + $rd2 bzmpop 0 2 myzset{t} myzset2{t} max count 10 + wait_for_blocked_clients_count 2 + $rd3 bzmpop 0 2 myzset{t} myzset2{t} min count 10 + wait_for_blocked_clients_count 3 + $rd4 bzmpop 0 2 myzset{t} myzset2{t} max count 1 + wait_for_blocked_clients_count 4 + + r multi + r zadd myzset{t} 1 a 2 b 3 c 4 d 5 e + r zadd myzset2{t} 1 a 2 b 3 c 4 d 5 e + r exec + + assert_equal {myzset{t} {{a 1}}} [$rd1 read] + assert_equal {myzset{t} {{e 5} {d 4} {c 3} {b 2}}} [$rd2 read] + assert_equal {myzset2{t} {{a 1} {b 2} {c 3} {d 4} {e 5}}} [$rd3 read] + + r zadd myzset2{t} 1 a 2 b 3 c + assert_equal {myzset2{t} {{c 3}}} [$rd4 read] + + r del myzset{t} myzset2{t} + $rd1 close + $rd2 close + $rd3 close + $rd4 close + } + + test "BZMPOP propagate as pop with count command to replica" { + set rd [redis_deferring_client] + set repl [attach_to_replication_stream] + + # BZMPOP without being blocked. + r zadd myzset{t} 1 one 2 two 3 three + r zadd myzset2{t} 4 four 5 five 6 six + r bzmpop 0 1 myzset{t} min + r bzmpop 0 2 myzset{t} myzset2{t} max count 10 + r bzmpop 0 2 myzset{t} myzset2{t} max count 10 + + # BZMPOP that gets blocked. + $rd bzmpop 0 1 myzset{t} min count 1 + wait_for_blocked_client + r zadd myzset{t} 1 one + $rd bzmpop 0 2 myzset{t} myzset2{t} min count 5 + wait_for_blocked_client + r zadd myzset{t} 1 one 2 two 3 three + $rd bzmpop 0 2 myzset{t} myzset2{t} max count 10 + wait_for_blocked_client + r zadd myzset2{t} 4 four 5 five 6 six + + # Released on timeout. + assert_equal {} [r bzmpop 0.01 1 myzset{t} max count 10] + r set foo{t} bar ;# something else to propagate after, so we can make sure the above pop didn't. + + $rd close + + assert_replication_stream $repl { + {select *} + {zadd myzset{t} 1 one 2 two 3 three} + {zadd myzset2{t} 4 four 5 five 6 six} + {zpopmin myzset{t} 1} + {zpopmax myzset{t} 2} + {zpopmax myzset2{t} 3} + {zadd myzset{t} 1 one} + {zpopmin myzset{t} 1} + {zadd myzset{t} 1 one 2 two 3 three} + {zpopmin myzset{t} 3} + {zadd myzset2{t} 4 four 5 five 6 six} + {zpopmax myzset2{t} 3} + {set foo{t} bar} + } + close_replication_stream $repl + } {} {needs:repl} + + test "BZMPOP should not blocks on non key arguments - #10762" { + set rd1 [redis_deferring_client] + set rd2 [redis_deferring_client] + r del myzset myzset2 myzset3 + + $rd1 bzmpop 0 1 myzset min count 10 + wait_for_blocked_clients_count 1 + $rd2 bzmpop 0 2 myzset2 myzset3 max count 10 + wait_for_blocked_clients_count 2 + + # These non-key keys will not unblock the clients. + r zadd 0 100 timeout_value + r zadd 1 200 numkeys_value + r zadd min 300 min_token + r zadd max 400 max_token + r zadd count 500 count_token + r zadd 10 600 count_value + + r zadd myzset 1 zset + r zadd myzset3 1 zset3 + assert_equal {myzset {{zset 1}}} [$rd1 read] + assert_equal {myzset3 {{zset3 1}}} [$rd2 read] + + $rd1 close + $rd2 close + } {0} {cluster:skip} + + test {ZSET skiplist order consistency when elements are moved} { + set original_max [lindex [r config get zset-max-ziplist-entries] 1] + r config set zset-max-ziplist-entries 0 + for {set times 0} {$times < 10} {incr times} { + r del zset + for {set j 0} {$j < 1000} {incr j} { + r zadd zset [randomInt 50] ele-[randomInt 10] + } + + # Make sure that element ordering is correct + set prev_element {} + set prev_score -1 + foreach {element score} [r zrange zset 0 -1 WITHSCORES] { + # Assert that elements are in increasing ordering + assert { + $prev_score < $score || + ($prev_score == $score && + [string compare $prev_element $element] == -1) + } + set prev_element $element + set prev_score $score + } + } + r config set zset-max-ziplist-entries $original_max + } + + test {ZRANGESTORE basic} { + r flushall + r zadd z1{t} 1 a 2 b 3 c 4 d + set res [r zrangestore z2{t} z1{t} 0 -1] + assert_equal $res 4 + r zrange z2{t} 0 -1 withscores + } {a 1 b 2 c 3 d 4} + + test {ZRANGESTORE RESP3} { + r hello 3 + assert_equal [r zrange z2{t} 0 -1 withscores] {{a 1.0} {b 2.0} {c 3.0} {d 4.0}} + r hello 2 + } + + test {ZRANGESTORE range} { + set res [r zrangestore z2{t} z1{t} 1 2] + assert_equal $res 2 + r zrange z2{t} 0 -1 withscores + } {b 2 c 3} + + test {ZRANGESTORE BYLEX} { + set res [r zrangestore z2{t} z1{t} \[b \[c BYLEX] + assert_equal $res 2 + r zrange z2{t} 0 -1 withscores + } {b 2 c 3} + + test {ZRANGESTORE BYSCORE} { + set res [r zrangestore z2{t} z1{t} 1 2 BYSCORE] + assert_equal $res 2 + r zrange z2{t} 0 -1 withscores + } {a 1 b 2} + + test {ZRANGESTORE BYSCORE LIMIT} { + set res [r zrangestore z2{t} z1{t} 0 5 BYSCORE LIMIT 0 2] + assert_equal $res 2 + r zrange z2{t} 0 -1 withscores + } {a 1 b 2} + + test {ZRANGESTORE BYSCORE REV LIMIT} { + set res [r zrangestore z2{t} z1{t} 5 0 BYSCORE REV LIMIT 0 2] + assert_equal $res 2 + r zrange z2{t} 0 -1 withscores + } {c 3 d 4} + + test {ZRANGE BYSCORE REV LIMIT} { + r zrange z1{t} 5 0 BYSCORE REV LIMIT 0 2 WITHSCORES + } {d 4 c 3} + + test {ZRANGESTORE - src key missing} { + set res [r zrangestore z2{t} missing{t} 0 -1] + assert_equal $res 0 + r exists z2{t} + } {0} + + test {ZRANGESTORE - src key wrong type} { + r zadd z2{t} 1 a + r set foo{t} bar + assert_error "*WRONGTYPE*" {r zrangestore z2{t} foo{t} 0 -1} + r zrange z2{t} 0 -1 + } {a} + + test {ZRANGESTORE - empty range} { + set res [r zrangestore z2{t} z1{t} 5 6] + assert_equal $res 0 + r exists z2{t} + } {0} + + test {ZRANGESTORE BYLEX - empty range} { + set res [r zrangestore z2{t} z1{t} \[f \[g BYLEX] + assert_equal $res 0 + r exists z2{t} + } {0} + + test {ZRANGESTORE BYSCORE - empty range} { + set res [r zrangestore z2{t} z1{t} 5 6 BYSCORE] + assert_equal $res 0 + r exists z2{t} + } {0} + + test {ZRANGE BYLEX} { + r zrange z1{t} \[b \[c BYLEX + } {b c} + + test {ZRANGESTORE invalid syntax} { + catch {r zrangestore z2{t} z1{t} 0 -1 limit 1 2} err + assert_match "*syntax*" $err + catch {r zrangestore z2{t} z1{t} 0 -1 WITHSCORES} err + assert_match "*syntax*" $err + } + + test {ZRANGESTORE with zset-max-listpack-entries 0 #10767 case} { + set original_max [lindex [r config get zset-max-listpack-entries] 1] + r config set zset-max-listpack-entries 0 + r del z1{t} z2{t} + r zadd z1{t} 1 a + assert_encoding skiplist z1{t} + assert_equal 1 [r zrangestore z2{t} z1{t} 0 -1] + assert_encoding skiplist z2{t} + r config set zset-max-listpack-entries $original_max + } + + test {ZRANGESTORE with zset-max-listpack-entries 1 dst key should use skiplist encoding} { + set original_max [lindex [r config get zset-max-listpack-entries] 1] + r config set zset-max-listpack-entries 1 + r del z1{t} z2{t} z3{t} + r zadd z1{t} 1 a 2 b + assert_equal 1 [r zrangestore z2{t} z1{t} 0 0] + assert_encoding listpack z2{t} + assert_equal 2 [r zrangestore z3{t} z1{t} 0 1] + assert_encoding skiplist z3{t} + r config set zset-max-listpack-entries $original_max + } + + test {ZRANGE invalid syntax} { + catch {r zrange z1{t} 0 -1 limit 1 2} err + assert_match "*syntax*" $err + catch {r zrange z1{t} 0 -1 BYLEX WITHSCORES} err + assert_match "*syntax*" $err + catch {r zrevrange z1{t} 0 -1 BYSCORE} err + assert_match "*syntax*" $err + catch {r zrangebyscore z1{t} 0 -1 REV} err + assert_match "*syntax*" $err + } + + proc get_keys {l} { + set res {} + foreach {score key} $l { + lappend res $key + } + return $res + } + + # Check whether the zset members belong to the zset + proc check_member {mydict res} { + foreach ele $res { + assert {[dict exists $mydict $ele]} + } + } + + # Check whether the zset members and score belong to the zset + proc check_member_and_score {mydict res} { + foreach {key val} $res { + assert_equal $val [dict get $mydict $key] + } + } + + foreach {type contents} "listpack {1 a 2 b 3 c} skiplist {1 a 2 b 3 [randstring 70 90 alpha]}" { + set original_max_value [lindex [r config get zset-max-ziplist-value] 1] + r config set zset-max-ziplist-value 10 + create_zset myzset $contents + assert_encoding $type myzset + + test "ZRANDMEMBER - $type" { + unset -nocomplain myzset + array set myzset {} + for {set i 0} {$i < 100} {incr i} { + set key [r zrandmember myzset] + set myzset($key) 1 + } + assert_equal [lsort [get_keys $contents]] [lsort [array names myzset]] + } + r config set zset-max-ziplist-value $original_max_value + } + + test "ZRANDMEMBER with RESP3" { + r hello 3 + set res [r zrandmember myzset 3 withscores] + assert_equal [llength $res] 3 + assert_equal [llength [lindex $res 1]] 2 + + set res [r zrandmember myzset 3] + assert_equal [llength $res] 3 + assert_equal [llength [lindex $res 1]] 1 + r hello 2 + } + + test "ZRANDMEMBER count of 0 is handled correctly" { + r zrandmember myzset 0 + } {} + + test "ZRANDMEMBER with <count> against non existing key" { + r zrandmember nonexisting_key 100 + } {} + + test "ZRANDMEMBER count overflow" { + r zadd myzset 0 a + assert_error {*value is out of range*} {r zrandmember myzset -9223372036854770000 withscores} + assert_error {*value is out of range*} {r zrandmember myzset -9223372036854775808 withscores} + assert_error {*value is out of range*} {r zrandmember myzset -9223372036854775808} + } {} + + # Make sure we can distinguish between an empty array and a null response + r readraw 1 + + test "ZRANDMEMBER count of 0 is handled correctly - emptyarray" { + r zrandmember myzset 0 + } {*0} + + test "ZRANDMEMBER with <count> against non existing key - emptyarray" { + r zrandmember nonexisting_key 100 + } {*0} + + r readraw 0 + + foreach {type contents} " + skiplist {1 a 2 b 3 c 4 d 5 e 6 f 7 g 7 h 9 i 10 [randstring 70 90 alpha]} + listpack {1 a 2 b 3 c 4 d 5 e 6 f 7 g 7 h 9 i 10 j} " { + test "ZRANDMEMBER with <count> - $type" { + set original_max_value [lindex [r config get zset-max-ziplist-value] 1] + r config set zset-max-ziplist-value 10 + create_zset myzset $contents + assert_encoding $type myzset + + # create a dict for easy lookup + set mydict [dict create {*}[r zrange myzset 0 -1 withscores]] + + # We'll stress different parts of the code, see the implementation + # of ZRANDMEMBER for more information, but basically there are + # four different code paths. + + # PATH 1: Use negative count. + + # 1) Check that it returns repeated elements with and without values. + # 2) Check that all the elements actually belong to the original zset. + set res [r zrandmember myzset -20] + assert_equal [llength $res] 20 + check_member $mydict $res + + set res [r zrandmember myzset -1001] + assert_equal [llength $res] 1001 + check_member $mydict $res + + # again with WITHSCORES + set res [r zrandmember myzset -20 withscores] + assert_equal [llength $res] 40 + check_member_and_score $mydict $res + + set res [r zrandmember myzset -1001 withscores] + assert_equal [llength $res] 2002 + check_member_and_score $mydict $res + + # Test random uniform distribution + # df = 9, 40 means 0.00001 probability + set res [r zrandmember myzset -1000] + assert_lessthan [chi_square_value $res] 40 + check_member $mydict $res + + # 3) Check that eventually all the elements are returned. + # Use both WITHSCORES and without + unset -nocomplain auxset + set iterations 1000 + while {$iterations != 0} { + incr iterations -1 + if {[expr {$iterations % 2}] == 0} { + set res [r zrandmember myzset -3 withscores] + foreach {key val} $res { + dict append auxset $key $val + } + } else { + set res [r zrandmember myzset -3] + foreach key $res { + dict append auxset $key + } + } + if {[lsort [dict keys $mydict]] eq + [lsort [dict keys $auxset]]} { + break; + } + } + assert {$iterations != 0} + + # PATH 2: positive count (unique behavior) with requested size + # equal or greater than set size. + foreach size {10 20} { + set res [r zrandmember myzset $size] + assert_equal [llength $res] 10 + assert_equal [lsort $res] [lsort [dict keys $mydict]] + check_member $mydict $res + + # again with WITHSCORES + set res [r zrandmember myzset $size withscores] + assert_equal [llength $res] 20 + assert_equal [lsort $res] [lsort $mydict] + check_member_and_score $mydict $res + } + + # PATH 3: Ask almost as elements as there are in the set. + # In this case the implementation will duplicate the original + # set and will remove random elements up to the requested size. + # + # PATH 4: Ask a number of elements definitely smaller than + # the set size. + # + # We can test both the code paths just changing the size but + # using the same code. + foreach size {1 2 8} { + # 1) Check that all the elements actually belong to the + # original set. + set res [r zrandmember myzset $size] + assert_equal [llength $res] $size + check_member $mydict $res + + # again with WITHSCORES + set res [r zrandmember myzset $size withscores] + assert_equal [llength $res] [expr {$size * 2}] + check_member_and_score $mydict $res + + # 2) Check that eventually all the elements are returned. + # Use both WITHSCORES and without + unset -nocomplain auxset + unset -nocomplain allkey + set iterations [expr {1000 / $size}] + set all_ele_return false + while {$iterations != 0} { + incr iterations -1 + if {[expr {$iterations % 2}] == 0} { + set res [r zrandmember myzset $size withscores] + foreach {key value} $res { + dict append auxset $key $value + lappend allkey $key + } + } else { + set res [r zrandmember myzset $size] + foreach key $res { + dict append auxset $key + lappend allkey $key + } + } + if {[lsort [dict keys $mydict]] eq + [lsort [dict keys $auxset]]} { + set all_ele_return true + } + } + assert_equal $all_ele_return true + # df = 9, 40 means 0.00001 probability + assert_lessthan [chi_square_value $allkey] 40 + } + } + r config set zset-max-ziplist-value $original_max_value + } + + test {zset score double range} { + set dblmax 179769313486231570814527423731704356798070567525844996598917476803157260780028538760589558632766878171540458953514382464234321326889464182768467546703537516986049910576551282076245490090389328944075868508455133942304583236903222948165808559332123348274797826204144723168738177180919299881250404026184124858368.00000000000000000 + r del zz + r zadd zz $dblmax dblmax + assert_encoding listpack zz + r zscore zz dblmax + } {1.7976931348623157e+308} + + test {zunionInterDiffGenericCommand acts on SET and ZSET} { + r del set_small{t} set_big{t} zset_small{t} zset_big{t} zset_dest{t} + + foreach set_type {intset listpack hashtable} { + # Restore all default configurations before each round of testing. + r config set set-max-intset-entries 512 + r config set set-max-listpack-entries 128 + r config set zset-max-listpack-entries 128 + + r del set_small{t} set_big{t} + + if {$set_type == "intset"} { + r sadd set_small{t} 1 2 3 + r sadd set_big{t} 1 2 3 4 5 + assert_encoding intset set_small{t} + assert_encoding intset set_big{t} + } elseif {$set_type == "listpack"} { + # Add an "a" and then remove it, make sure the set is listpack encoding. + r sadd set_small{t} a 1 2 3 + r sadd set_big{t} a 1 2 3 4 5 + r srem set_small{t} a + r srem set_big{t} a + assert_encoding listpack set_small{t} + assert_encoding listpack set_big{t} + } elseif {$set_type == "hashtable"} { + r config set set-max-intset-entries 0 + r config set set-max-listpack-entries 0 + r sadd set_small{t} 1 2 3 + r sadd set_big{t} 1 2 3 4 5 + assert_encoding hashtable set_small{t} + assert_encoding hashtable set_big{t} + } + + foreach zset_type {listpack skiplist} { + r del zset_small{t} zset_big{t} + + if {$zset_type == "listpack"} { + r zadd zset_small{t} 1 1 2 2 3 3 + r zadd zset_big{t} 1 1 2 2 3 3 4 4 5 5 + assert_encoding listpack zset_small{t} + assert_encoding listpack zset_big{t} + } elseif {$zset_type == "skiplist"} { + r config set zset-max-listpack-entries 0 + r zadd zset_small{t} 1 1 2 2 3 3 + r zadd zset_big{t} 1 1 2 2 3 3 4 4 5 5 + assert_encoding skiplist zset_small{t} + assert_encoding skiplist zset_big{t} + } + + # Test one key is big and one key is small separately. + # The reason for this is because we will sort the sets from smallest to largest. + # So set one big key and one small key, then the test can cover more code paths. + foreach {small_or_big set_key zset_key} { + small set_small{t} zset_big{t} + big set_big{t} zset_small{t} + } { + # The result of these commands are not related to the order of the keys. + assert_equal {1 2 3 4 5} [lsort [r zunion 2 $set_key $zset_key]] + assert_equal {5} [r zunionstore zset_dest{t} 2 $set_key $zset_key] + assert_equal {1 2 3} [lsort [r zinter 2 $set_key $zset_key]] + assert_equal {3} [r zinterstore zset_dest{t} 2 $set_key $zset_key] + assert_equal {3} [r zintercard 2 $set_key $zset_key] + + # The result of sdiff is related to the order of the keys. + if {$small_or_big == "small"} { + assert_equal {} [r zdiff 2 $set_key $zset_key] + assert_equal {0} [r zdiffstore zset_dest{t} 2 $set_key $zset_key] + } else { + assert_equal {4 5} [lsort [r zdiff 2 $set_key $zset_key]] + assert_equal {2} [r zdiffstore zset_dest{t} 2 $set_key $zset_key] + } + } + } + } + + r config set set-max-intset-entries 512 + r config set set-max-listpack-entries 128 + r config set zset-max-listpack-entries 128 + } + + foreach type {single multiple single_multiple} { + test "ZADD overflows the maximum allowed elements in a listpack - $type" { + r del myzset + + set max_entries 64 + set original_max [lindex [r config get zset-max-listpack-entries] 1] + r config set zset-max-listpack-entries $max_entries + + if {$type == "single"} { + # All are single zadd commands. + for {set i 0} {$i < $max_entries} {incr i} { r zadd myzset $i $i } + } elseif {$type == "multiple"} { + # One zadd command to add all elements. + set args {} + for {set i 0} {$i < $max_entries * 2} {incr i} { lappend args $i } + r zadd myzset {*}$args + } elseif {$type == "single_multiple"} { + # First one zadd adds an element (creates a key) and then one zadd adds all elements. + r zadd myzset 1 1 + set args {} + for {set i 0} {$i < $max_entries * 2} {incr i} { lappend args $i } + r zadd myzset {*}$args + } + + assert_encoding listpack myzset + assert_equal $max_entries [r zcard myzset] + assert_equal 1 [r zadd myzset 1 b] + assert_encoding skiplist myzset + + r config set zset-max-listpack-entries $original_max + } + } +} |